Structure and function relationship of toxin from Chinese scorpion Buthus martensii Karsch (BmKAGAP): Gaining insight into related sites of analgesic activity

Peptides 31 (2010) 995–1000

Contents lists available at ScienceDirect

Peptides journal homepage: www.elsevier.com/locate/peptides

Structure and function relationship of toxin from Chinese scorpion Buthus martensii Karsch (BmKAGAP): Gaining insight into related sites of analgesic activity Yong Cui, Gui-Li Guo, Lin Ma, Nan Hu, Yong-Bo Song, Yan-Feng Liu, Chun-Fu Wu, Jing-Hai Zhang ∗ School of Life Science and Bio-pharmaceutics, Shenyang Pharmaceutical University, Shenyang, Liaoning Province 110016, PR China

a r t i c l e

i n f o

Article history: Received 11 February 2010 Received in revised form 9 March 2010 Accepted 9 March 2010 Available online 20 March 2010 Keywords: Analgesic activity BmKAGAP Circular dichroism Homology modeling Structure–function relationship Site-directed mutagenesis

a b s t r a c t In this study, an effective Escherichia coli expression system was used to study the role of residues in the antitumor-analgesic peptide from Chinese scorpion Buthus martensii Karsch (BmKAGAP). To evaluate the extent to which residues of the toxin core contribute to its analgesic activity, nine mutants of BmKAGAP were obtained by PCR. Using site-directed mutagenesis, all of these residues were individually substituted by one amino acid. These were then subjected to a circular dichroism analysis, and an analgesic activity assay in mice. This study represents a thorough mapping and elucidation of the epitopes that underlie the molecular basis of the analgesic activity. The three-dimensional structure of BmKAGAP was established by homology modeling. Our results revealed large mutant-dependent differences that indicated important roles for the studied residues. With our ongoing efforts for establishing the structure and analgesic activity relationship of BmKAGAP, we have succeeded in pinpointing which residues are important for the analgesic activity. © 2010 Elsevier Inc. All rights reserved.

1. Introduction The chemical modification, site-directed mutagenesis, and/or 3D structure elucidation of several scorpion ␣-toxins have been reported recently, including ␣-mammal toxins AaHII, BotIII, and BmKM8 [2,11,13], ␣-insect toxin Lqh␣IT [9], and ␣-like toxin BmKM1 [21]. These studies shed some light on the structural and functional anatomy of scorpion ␣-toxins: ␣-toxins consist of three major functional domains: (1) the first three N-terminal residues; (2) the five-residue turn (residues 8–12) in combination with the C-tail (residues 57–61); and (3) the loop between the ␤2 and ␤3 sheets (residues 38–40). On the other hand, the conserved hydrophobic surface, consisting of some aromatic amino acid residues (Tyr5, 14, 21, 35, 42 and Trp38, 47 ) has both structural and functional roles. The aromatic residues Tyr5 , Tyr35 , and Trp47 are essential for structural stability as well as function, while Trp38

Abbreviations: BmKAGAP, antitumor-analgesic peptide from Buthus martensii Karsch; rBmKAGAP, recombinant antitumor-analgesic peptide from Buthus martensii Karsch; Lqh␣IT, ␣-insect toxin from Leiurus Quinquestriatus Hebraeus; AaH, Androctonus australis hector; Bot, Buthus occitanus tunetanus; Lqq, Leiurus quinquestriatus quinquestriatus; Nav s, voltage-gated sodium channels; CD, circular dichroism. ∗ Corresponding author at: Shenyang Pharmaceutical University, P.O. Box 17, 103 Wenhua Road, Shenhe District, Shenyang, Liaoning Province 110016, PR China. Tel.: +86 24 23986431; fax: +86 24 23986431. E-mail address: [email protected] (J.-H. Zhang). 0196-9781/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2010.03.017

and Tyr42 are involved in the pharmacological activity of ␣-toxins [21]. A better understanding of the structure–function relationships of these toxins could be obtained by using mutagenesis to generate different mutants to study the interaction of variants with the target channels [15,18]. It has been predicted that the N-terminus and the C-terminus are important in the interaction of these toxins with their target channels [17]. BmKAGAP was firstly purified, cloned and found to exhibited soluble expression efficiently in Escherichia coli and its bioactivity has been explored in animal experiment [16]. However the mechanisms of analgesic effects relating to the voltage-gated sodium channels (Nav s) of BmKAGAP as well as its structure–function relationship are not very clear. With the objective of analyzing the analgesic related functional site, we designed and expressed a series of mutations as described in this report. Then, their expression, purification, circular dichroism (CD) analysis, analgesic activity and three-dimensional modeling were studied. In the light of the results obtained, the important residues which can influence the analgesic activity are discussed. Six sites from the toxin BmKAGAP were analyzed. Correlating data from high impact substitutions such as Gly, conservative substitutions such as Phe, and differently charged residues (positive to negative and vice versa), were partially based on sequence similarity with other scorpion toxins. Our efforts establishing the structure and analgesic activity relationship of BmKAGAP has allowed us to pinpoint which residues are important for the analgesic activity. Remarkably, a

996

Y. Cui et al. / Peptides 31 (2010) 995–1000 Table 1 Primers used to construct different mutations of BmKAGAP. Name

Nucleotide sequence (5 –3 )

Orientation

Y5F

CGCGATGGTTTCATTGCCGAC GTCGGCAATGAAACCATCGCG

Sense Antiense

D8K

GGTTATATTGCCAAAGATAAGAATTGC GCAATTCTTATCTTTGGCAATATAACC

Sense Antiense

Y35G

GAGAGTGGCGGATGCCAATGG CCATTGGCATCCGCCACTCTC

Sense Antiense

W38G

TATTGCCAAGGTGCAGGTGTA TACACCTGCACCTTGGCAATA

Sense Antiense

W38F

TATTGCCAATTCGCAGGTGTA TACACCTGCGAATTGGCAATA

Sense Antiense

Y42G

GCAGGTGTAGGTGGAAACGCC GGCGTTTCCACCTACACCTGC

Sense Antiense

Y42F

GCAGGTGTATTCGGAAACGCC GGCGTTTCCGAATACACCTGC

Sense Antiense

R58D

CGCGGATCCTTAACCGCCATTGCATTTTCCTGGTACATCAATA

Antiense

R58K

CGCGGATCCTTAACCGCCATTGCATTTTCCTGGTACTTTAATA

Antiense

T7

TAATACGACTCACTATAGGGG

Sense

BmKAGAP R

CGCGGATCCTTAACCGCCATTGCATTTTCCT

Antiense

The underlined GGATCC represents the BamHI restriction enzyme site at the 3 terminal of BmKAGAP mature peptide; to terminate the translation, the boxed codon TTA was inserted between the encoding sequence and the BamHI restriction enzyme site. The nucleotides in bold font represent the mutational site.

mutation of one residue can alter the analgesic activity of BmKAGAP.

tors pSYPU/BmKAGAP(mutants) were grown in the Luria-Bertani medium. The purification procedure was performed as described elsewhere [16].

2. Materials and methods 2.1. Strains, plasmids, materials, and animals Plasmids pET28a-Tag(His) -AGAP and pSYPU, E. coli strains DH5␣ and BL21 (␭DE3), were kept in our laboratory. Restriction endonucleases, T4 DNA ligase and Taq DNA polymerase were obtained from TaKaRa (Japan). The mice used for the analgesic activity bioassay were Kunming mice from the Institute of Military Medical Science Center for Experimental Animals (NO: SCXK-[Army] 2007-004, Beijing, China). 2.2. Site-directed mutagenesis of BmKAGAP The cDNA of BmKAGAP was previously cloned [16]. According to the sequence of BmKAGAP, the mutagenic primers used to generate the desired mutations were designed (Table 1). Using pET28aTag(His) -AGAP as a template along with T7 promoter primer and mutagenic primer, mutants R58D and R58K were created by onestep PCR. Other mutants (Y5F, D8K, Y35G, W38G, W38F, Y42G, and Y42F) were obtained by three-step PCR. A pair of mutagenic primers was applied in the first or second PCR with T7 primer or BmKAGAP R primer, respectively, to create two intermediate products, which shared an identical sequence. The PCR products were purified by gel excision, taking it as a template, using T7 primer or BmKAGAP R primer, and the third PCR was performed using an overlapping extension method.

2.4. Characterization of partial BmKAGAP mutants by CD spectroscopy Samples used for analyses were dissolved in 50 mM sodium phosphate buffer (pH 7.6) at a concentration of 0.2 mg/ml. CD spectra were recorded from 250 to 190 nm using a quartz cell 0.2 mm in length at 25 ◦ C with a Jasco J-810 spectropolarimeter (Japan). Data were collected at 0.1-nm intervals at a scan rate of 100 nm/min. All CD spectra were obtained from the average of three scans. The spectra were corrected by subtracting the corresponding base-line spectra obtained under identical conditions. The data were processed using IGOR software (WaveMetrics, Lake Oswego, OR, USA). 2.5. Analgesic activity The mouse-twisting test was carried out as described by Fennessy and Lee [5]. To perform the bioassay, solutions of 0.2 ml toxin were injected intraperitoneally into Kunming mice (male and female, specified pathogen-free level, 18–20 g of body weight), using unmodified recombinant antitumor-analgesic peptide from Buthus martensii Karsch (rBmKAGAP) and 0.9% (w/v) NaCl as a positive and negative control, respectively. Each group contained ten mice. Twenty minutes later, 0.2 ml 0.6% (v/v) acetic acid solution was injected intraperitoneally. Five minutes later, the number of twisting actions was counted within a 10-min period. All animal protocols were approved by the Institutional Animal Care and Use Committee (IACUC).

2.3. Construction, expression and purification of mutants 2.6. Sequence analysis and homology modeling All genes were cloned into T7 promoter-based E. coli expression vectors, pSYPU. The ligated products were used to transform competent E. coli DH5␣ cells. Positive clones were identified by colony PCR screening and confirmed by DNA sequencing with T7 primers. E. coli BL21 (␭DE3) cells harboring expression vec-

The Homology Model of BmKAGAP was generated using MODELLER [19] with ClustalX2 (ftp://ftp.ebi.ac.uk/ pub/software/clustalw2) alignment of Lqh␣IT and its crystal structure (PDB ID: 2ATB) as a template chosen from the PDB

Y. Cui et al. / Peptides 31 (2010) 995–1000

997

Fig. 2. CD spectra of rBmKAGAP and its mutants.

3.2. Production and purification of mutants For simplicity, the purification and detection of Y5F was used as an example. After expression in E. coli BL21 (␭DE3), the fusion proteins were mostly expressed in soluble form. The recombinant proteins were isolated from soluble fractions and purified to homogeneity on a Nickel metal chelating affinity column. The fraction purity was confirmed by 15% SDS-PAGE (Fig. 1).

Fig. 1. 15% SDS-PAGE analysis of rBmKAGAP and Y5F, stained with Coomassie Bright Blue R-250. Lane 1, purified rBmKAGAP; Lane 2, purified Y5F; Lane 3, low molecular weight marker.

3.3. CD spectra of partial BmKAGAP mutants Mutants W38G and W38F, prepared following the protocol for the unmodified toxin rBmKAGAP, were examined for analgesic activity and CD spectroscopy was used to differentiate between effects resulting from structural perturbation and those reflecting changes in the putative interaction with the channel receptor. Residues for which substitution substantially reduced the analgesic activity with no alteration of the CD spectrum were considered significant for activity and assigned to the putative functional site; residues for which substitution substantially altered the CD spectrum with little change in analgesic activity were considered possibly significant for structural stability. CD spectra in the far-UV region (250–190 nm) probe the secondary structure of proteins. The wavelength of ␣-helix negative adsorption band is 208 nm. Different values at the minimum around 208 nm mainly represent various mutants having different ␣-helix content. The CD spectra in the far-UV range of 250–190 nm are shown in Fig. 2. Compared with rBmKAGAP, the CD spectra of W38G and

BLAST hit. The obtained Model was validated using PROCHECK [12] and the final Energy minimized and dynamics examined using GROMACS-3.0 [14] to obtain a stable structure for further studies. The figures were prepared using Accelrys DS Visualizer V2.5 (http://accelrys.com/products/discovery-studio/).

3. Results 3.1. Construction of recombinant plasmids In order to produce mutants by recombinant technology, we cloned the DNA sequence encoding different BmKAGAP mutants in a T7 promoter-based E. coli expression vector. The DNA sequence determination confirmed that the recombinant mutational genes were obtained correctly.

Table 2 Overview of expression levels and analgesic activity on mice of rBmKAGAP and its mutants. Toxin

Expression (mg/l)

Dosage (␮mol/kg)

Twisting times (mean ± SEM)

Normal saline rBmKAGAP Y5F D8K Y35G W38G W38F Y42G Y42F R58D R58K

– 2–3 1–2 1–2 1–2 1–2 1–2 2–3 1–2 2–3 2–3

– 0.14 0.14 0.14 0.14 0.14 0.14 0.14 0.14 0.14 0.14

43.70 19.75 21.67 14.44 23.25 20.67 34.30 25.67 24.50 28.90 28.78

± ± ± ± ± ± ± ± ± ± ±

2.99 2.29** 5.38** 1.87** 4.59** 2.36** 2.37** ,b 1.32** 2.06** 1.85** 2.85**

Inhibition efficiency (%)a

Relative activity (%)

– 54.81 50.41 66.96 46.80 52.70 21.51 41.26 43.94 33.87 34.14

– 100 92 122 85 96 39 75 80 62 62

a The inhibition efficiency is the ratio (T0 − T)/T0 , where T0 is the mean twisting time of the negative control group and T is the mean twisting time of the experiment groups with rBmKAGAP and mutants (n = 10). b p < 0.05 vs. rBmKAGAP. ** p < 0.05 vs. normal saline.

998

Y. Cui et al. / Peptides 31 (2010) 995–1000

Fig. 3. Multiple sequence alignment of BmKAGAP with other scorpion ␣-mammal, ␣-insect, and ␣-like toxins. Sequences are aligned according to the conserved cysteine residues, and the disulfide bonds formed between cysteine pairs are marked by solid lines. Gaps (donated by “-”) are inserted in the sequences to attain maximum identity. Secondary structural features are indicated on top and motifs in BmKAGAP follow the published structure of Lqh␣IT. The conservative aromatic residues which have been chosen for mutagenesis are indicated by an asterisk, and arrows at the bottom identify another two mutational sites, namely Asp8 and Arg58 .

W38F dramatically changed, indicating that there are apparent changes in the secondary structures of the mutants. 3.4. Analgesic activity of BmKAGAP mutants The mouse-twisting model was used to determine the analgesic effect of mutants in vivo. As shown in Table 2, they were significantly different from the negative control group (p < 0.05), but most of them exhibited no significant differences compared with the rBmKAGAP group (p > 0.05), except mutant W38F. Within these mutants, only D8K increased the analgesic activity. 3.5. Homology modeling and 3D structure analysis The alignment of the primary sequence of BmKAGAP shows 73.13% identity with the toxin based on which the threedimensional structure of Lqh␣IT was taken as the template to build the model structure. Alignment of the amino acid sequences of several ␣-toxins shows that some aromatic residues are very conserved (Fig. 3). The schematic representation of a homology model structure of BmKAGAP is shown (Fig. 4A). After the refinement process, validation of the Model was carried out using Ramachandran plot calculations computed with the PROCHECK program (Fig. 4B). 4. Discussion The limited availability of naturally occurring toxins in crude venom is an obstacle to the structural characterization of these proteins. In recent years, overproduction of heterologous polypeptides in bacteria such as E. coli has emerged as a routine technique. The amount of active protein was further enhanced up to 15-fold by co-expression of TrxA (thioredoxin1) mutant with different redox potentials [3]. To achieve a high level of expression, we used the vector of pSYPU which can increase the solubility of products by thioredoxin. Because the expression system is used to produce numerous BmKAGAP mutants, it had to fulfil several requirements: (i) allow easy detection of recombinant BmK in crude extracts; (ii) allow the production of a functional peptide without any refolding steps, and (iii) provide an easy way to purify the recombinant peptide. There is ample evidence that several Nav s play major roles in pain sensation [1,8]. Recently, Schnur et al. [20] has shown that peptides corresponding in sequence to the extracellular S3–S4 loop in domain 4 of the ␣-subunit of Nav s (D4/S3–S4) exhibit millimolar affinity for Lqh␣IT. Analysis of the perturbations in Lqh␣IT was used

to map the binding site for the S3–S4 loop on the scorpion toxin and provided new insights into receptor site 3 and the toxin binding mechanism. In the light of the high similarity between BmKAGAP and Lqh␣IT, we should take this binding mechanism as a reference, to investigate our target protein. Inspecting the sequences of most ␣-toxins known to date, almost all aromatic residues, including Tyr5, 14, 21, 35 , Trp38 , Tyr42 , are conserved (Fig. 3). In ␣-toxins, they constituted two surfaces opposite each other, namely Face A and Face B. Face A is mainly composed of Tyr5, 35 , Arg2 , Asp3 , and the N-terminal amino group. Biochemical experiments [4,11] and structural comparisons of the toxins with different activities [7] suggested that several residues on these two faces are involved in the toxin-receptor interactions. Since Trp38 is located between these two faces, it seems to be a link from Face A to Face B in a toxin-receptor interaction. In our study, the most detrimental effect was obtained upon substitution of Trp38 by Phe, the relative activity of which was 39%. In contrast, W38G, has similar activity to rBmKAGAP (Table 2). From the CD results, both of W38G and W38F changed their CD spectra compared with the unmodified toxin, so Trp38 was important for structural stability from the CD result. As far as we know, due to the lack of side-chain, Gly can adjust the steric hindrance from other residues very well. The secondary structural change of W38G was observed, but this may not affect the site for scorpion toxin and its receptor recognition, so it has no effect on antinociceptive potency. Obviously, the CD spectrum of W38F reveals a severe conformational change compared with W38G, thus influence the overall three-dimensional structure and may affect the functional site for analgesic activity. The results emphasized the importance of residue 38 which was in agreement with previously described findings [21]. The loop between the ␤2 and ␤3 sheets, belongs to the ‘Core-domain’ which is believed to play a role in the affinity to the receptor Site-3 of Nav s [21]. Besides the two faces, residues Tyr42 , Lys58 and Lys62 from the C-terminus and loop 38–44, forming a special area containing many of the positively charged residues and designated as site C, are conserved in ␣-toxins. Fontecilla-Camps et al. [6] have proposed that the site C region is closely related to the specificity of the receptor binding sites for ␣- and ␤-toxin. Some approaches highlighted positively charge parts, such as Lys8 , Arg18 , Lys62 , and Arg64 residues that may interact directly with putative recognition points at the receptor site. They are important for the spatial arrangement of the toxin polypeptide and contribute to the formation of an electrostatic potential that may be involved in recognition with corresponding receptor site. The increasing activity in D8K could result from the positively charged amino group.

Y. Cui et al. / Peptides 31 (2010) 995–1000

999

Fig. 4. (A) The final model of stable structure of BmKAGAP. The molecule demonstrates a conserved structural scaffold common to scorpion ␣-toxins, i.e., an ␣-helix (red), three-stranded antiparallel ␤-sheets (cyan) connected by reverse turn (green). (B) Validation of the model using Ramachandran plot with 92.3% of the residues in favored regions. (C) Root mean squared deviations (RMSD) in molecular dynamics simulations of BmKAGAP. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

We propose that the positively charged amino group in D8K may be favorable for analgesic activity to some extent (22% increase) but likely plays no major role in the binding site interaction. In the mutants, the accessible areas of the functional group of residue 58 side-chain 8 are reduced due to the alteration of a guanidino group in the native toxin (Arg58 ) to an NH2 group in the mutants (Lys58 ). Mutants R58D and R58K exhibited a relative activity of 62% compared with rBmKAGAP (Table 2). Recently, Zhu et al. [23] suggested that residue 58 and corresponding position in all ␣-toxins function as structure switch of the NC-domain. The residue 58 is assigned as one of structural determinants for the C-tail orientation and also acts as a support to stabilize the local conformation through the side-chain hydrophobic interactions with residues 5, 13 and 42. For R58D mutant in BmKAGAP, the negatively charged residue may be detrimental for toxin-receptor recognition; for R58K, the volume of residue 58 reduced and could not sustain the original hydrophobic cluster. Therefore, the loss of analgesic activity was found. This leads to the deduction that residue 58 may be not direct correlation for analgesic activity, although it has been concluded that this residue is important for toxicity [10,22]. In conclusion, an overview of all the studied mutants on the ribbon structure of BmKAGAP given in Fig. 5. Further structural and mutagenesis studies are being carried out to identify its molecular mechanism as well as to exploit its analgesic activity. To our knowledge, this is the first report which describes the structure and analgesic activity relationships of long-chain scorpion toxins. The structural mutagenesis data of BmKAGAP reported here provide

Fig. 5. Overview of all studied mutants indicated on the ribbon structure of BmKAGAP. Changes in analgesic activity toward mice are indicated in gray.

1000

Y. Cui et al. / Peptides 31 (2010) 995–1000

further information not only about the structure-analgesic activity relationship, but also with regard to the design of genetic or synthetic mutants for future functional studies. Acknowledgements This work was supported by the grants from the National Natural Science Foundation of China (No. 30772738), Major Drug Innovation of National Eleventh Five-Year Major Project of China (No. 2009ZX09103-662), Liaoning Educational Burial (No. 05L427), Liaoning Provincial Department of Education Research Fund (No. 2009A689), Natural Science Foundation of Liaoning Province (No. 20082060), Science and Technology Bureau of Shenyang City for Key Laboratory Construction of Pharmaceutical Biotechnology (No. 1081102-1-00). Special thanks are for the help from Dr. Xiao-Gang Qu, Chinese Academy of Sciences, in CD determination. References [1] Baker MD, Wood JN. Involvement of Na+ channels in pain pathways. Trends Pharmacol Sci 2001;22:27–31. [2] Benkhadir K, Kharrat R, Cestele S, Mosbah A, Rochat H, El Ayeb M, et al. Molecular cloning and functional expression of the alpha-scorpion toxin BotIII: pivotal role of the C-terminal region for its interaction with voltage-dependent sodium channels. Peptides 2004;25:151–61. [3] Bessette PH, Aslund F, Beckwith J, Georgiou G. Efficient folding of proteins with multiple disulfide bonds in the Escherichia coli cytoplasm. Proc Natl Acad Sci USA 1999;96:13703–8. [4] El Ayeb M, Darbon H, Bahraoui EM, Vargas O, Rochat H. Differential effects of defined chemical modifications on antigenic and pharmacological activities of scorpion alpha and beta toxins. Eur J Biochem 1986;155:289–94. [5] Fennessy MR, Lee JR. In: Ehrenpreis S, Neidle A, editors. Methods in narcotics research. New York: Marcel Dekker; 1975. p. 76–9. [6] Fontecilla-Camps JC, Habersetzer-Rochat C, Rochat H. Orthorhombic crystals and three-dimensional structure of the potent toxin II from the scorpion Androctonus australis Hector. Proc Natl Acad Sci USA 1988;85: 7443–7. [7] Housset D, Habersetzer-Rochat C, Astier JP, Fontecilla-Camps JC. Crystal structure of toxin II from the scorpion Androctonus australis Hector refined at 1.3 Å resolution. J Mol Biol 1994;238:88–103.

[8] Julius D, Basbaum AI. Molecular mechanisms of nociception. Nature 2001;413:203–10. [9] Karbat I, Frolow F, Froy O, Gilles N, Cohen L, Turkov M, et al. Molecular basis of the high insecticidal potency of scorpion alpha-toxins. J Biol Chem 2004;279:31679–86. [10] Karbat I, Kahn R, Cohen L, Ilan N, Gilles N, Corzo G, et al. The unique pharmacology of the scorpion alpha-like toxin Lqh3 is associated with its flexible C-tail. FEBS J 2007;274:1918–31. [11] Kharrat R, Darbon H, Rochat H, Granier C. Structure/activity relationships of scorpion alpha-toxins: multiple residues contribute to the interaction with receptors. Eur J Biochem 1989;181:381–90. [12] Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PROCHECK: a program to check the stereochemical quality of protein structures. J Appl Cryst 1993;26:283–91. [13] Legros C, Ceard B, Vacher H, Marchot P, Bougis PE, Martin-Eauclaire MF. Expression of the standard scorpion alpha-toxin AaH II and AaH II mutants leading to the identification of some key bioactive elements. Biochim Biophys Acta 2005;1723:91–9. [14] Lindahl E, Hess B, van der Spoel D. GROMACS 3.0: a package for molecular simulation and trajectory analysis. J Mol Model 2001;7:306–17. [15] Lipkind GM, Fozzard HA. A model of scorpion toxin binding to voltage-gated K+ channels. J Membr Biol 1997;158:187–96. [16] Liu YF, Ma RL, Wang SL, Duan ZY, Zhang JH, Wu LJ, et al. Expression of an antitumor-analgesic peptide from the venom of Chinese scorpion Buthus martensii karsch in Escherichia coli. Protein Expr Purif 2003;27:253–8. [17] Menez A. Functional architectures of animal toxins: a clue to drug design? Toxicon 1998;36:1557–72. [18] Naranjo D, Miller C. A strongly interacting pair of residues on the contact surface of charybdotoxin and a Shaker K+ channel. Neuron 1996;16:123–30. [19] Sali A, Blundell TL. Comparative protein modelling by satisfaction of spatial restraints. J Mol Biol 1993;234:779–815. [20] Schnur E, Turkov M, Kahn R, Gordon D, Gurevitz M, Anglister J. NMR analysis of interaction of LqhalphaIT scorpion toxin with a peptide corresponding to the D4/S3–S4 loop of insect para voltage-gated sodium channel. Biochemistry 2008;47:911–21. [21] Sun YM, Bosmans F, Zhu RH, Goudet C, Xiong YM, Tytgat J, et al. Importance of the conserved aromatic residues in the scorpion alpha-like toxin BmK M1: the hydrophobic surface region revisited. J Biol Chem 2003;278: 24125–31. [22] Wang CG, Gilles N, Hamon A, Le Gall F, Stankiewicz M, Pelhate M, et al. Exploration of the functional site of a scorpion alpha-like toxin by site-directed mutagenesis. Biochemistry 2003;42:4699–708. [23] Zhu J, Tong XT, Cao CY, Wu G, Zhang NX, Wu HM. Solution structure of BmK␣Tx11, a toxin from the venom of the Chinese scorpion Buthus martensii Karsch. Biochem Biophys Res Commun 2010;391:627–33.