Structure and Mode of Action ofkikA,a Genetic Region Lethal toKlebsiella oxytocaand Associated with Conjugative Antibiotic-Resistance Plasmids of the IncN Group

PLASMID

35, 189–203 (1996) 0021

ARTICLE NO.

Structure and Mode of Action of kikA, a Genetic Region Lethal to Klebsiella oxytoca and Associated with Conjugative AntibioticResistance Plasmids of the IncN Group MARTIN HOLCˇI´K1

AND

V. N. IYER

Department of Biology and Institute of Biochemistry, Carleton University, Ottawa, Ontario, Canada K1S 5B6 Received November 2, 1995; revised March 19, 1996 Transmission of conjugative plasmids of the IncN group into Klebsiella oxytoca, but not into Escherichia coli, results in the marked reduction of viability of the recipients. In the plasmid pCU1 a 500-bp locus called kikA has the major role in determining this phenotype. Expression of two open reading frames (orf104 and orf70) is required for the Kik/ phenotype and they can function in cis or in trans. orf104 encodes a 8.9-kDa soluble protein which is translocated into the periplasm. orf70 encodes a 7.6-kDa soluble protein which is found in the cytoplasm. The expression of the kikA region from its natural promoter(s) is positively regulated at the level of transcription by an additional plasmid locus which is located within the tra region. Further experiments show that the action of kikA causes reversible growth inhibition but does not affect cellular respiration and does not induce any morphological changes of the host cell. q 1996 Academic Press, Inc.

Conjugative plasmids of the gram-negative eubacteria display differences in their hostrange. The group of such plasmids called the N group (based on plasmid incompatibility tests in Escherichia coli K-12) has both a distinct replicon and a distinct conjugative (tra) system (Iyer, 1989). The host-range of the replicon is broad and includes Klebsiella (Krishnan and Iyer, 1988) and that of the tra system is broader (Selvaraj and Iyer, 1984). Despite this, all known members of the group confer upon their hosts a curious phenotype. When donor cells carrying one of these plasmids are mated with Klebsiella oxytoca (previously Klebsiella pneumoniae; Yocum, 1989) 90 to 99% of the recipients are killed (RodrıB guez and Iyer, 1981). Under similar conditions of mating, E. coli recipients do not display a reduction in viability, thus identifying the phenotype as host-specific. This phe1 To whom correspondence should be addressed at present address: Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, Department of Human Genetics, Clinical Research Bldg., 422 Curie Boulevard, Philadelphia, PA 19104-6145. Fax: (215) 898 1257; e-mail: [email protected].

notype was called Kik/ (killing of Klebsiella). Further experiments in our laboratory on this phenomenon have been conducted with the well-studied plasmid pCU1 (Konarska-Kozlowska and Iyer, 1981) and the K. oxytoca strain M5a1 also called UN that has been the subject of genetic and physiological studies (MacNeil et al., 1981; McMorrow et al., 1988; Suhr and Kleiner, 1993). Genetic analysis of pCU1 using transposon and deletion mutagenesis identified a region called kikA which is located next to the left end of tra of pCU1 and which plays the major role in the Kik/ phenotype (Fig. 1) (Thatte et al., 1985). Hengen et al. (1992) analyzed the kikA region by molecular cloning, deletion analysis, and nucleotide sequencing. This region was shown to be conserved among other IncN group plasmids (Hengen et al., 1992; Pohlman et al., 1994). When placed under the transcriptional control of the inducible promoter tac, induction with IPTG in Klebsiella, but not in E. coli, led to the reduction of viability. This raised the possibility that in the natural plasmid pCU1, the kikA product(s) alone is sufficient for specifically killing K. oxytoca cells.

189

0147-619X/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.

AID

Plasmid 1240

/

6606$$$$61

06-12-96 13:45:48

plasa

AP: Plasmid

ˇ ´IK AND IYER HOLC

190

FIG. 1. Physical and genetic map of the plasmid pCU1. The 500-bp kikA region is enlarged below the plasmid. The functional complementation groups of the transfer (tra) region are based on those of Thatte et al. (1985). The origin of transfer (oriT) is based on the sequence data of Paterson and Iyer (1992). The kikA region has been characterized previously: the coding sequences in the kikA locus (orf 70 and orf104) are indicated with arrows, the putative promoters (P1 and P2) and a ribosome binding site (RBS) are shown as boxes (Hengen et al., 1992). Plasmid pCU403 is a kikA deletion derivative of pCU1 and does not confer a Kik/ phenotype (Thatte et al., 1985). Plasmid pCU403-1 is a KpnI deletion derivative of pCU403 (RodrıB guez de Gonza´lez, unpublished data). Plasmid pCU109 is a pACYC184 derivative with the tra region of pCU1 cloned into it (Thatte et al., 1985). Plasmid pCU57D14 is a pACYC184 derivative with the oriTtraG region of pCU1 (coordinates 3.9 to 9.55) cloned into it (Paterson and Iyer, 1992). Rep is the replicon region and Ap, Sm, and Sp are regions specifying resistance to the respective antibiotics.

The nucleotide sequence of the kikA region implicated one or two open reading frames (orf 70 and orf104) and two putative promoters (P1 and P2) as being relevant to the phenotype (Fig. 1) (Hengen et al., 1992). In this paper we first describe experiments that lead to the conclusion that the expression of both of the above open reading frames of kikA is necessary for the Kik/ phenotype, that they can function in cis or in trans to one another, and that expression from their natural promoters is positively regulated. The experiments of Hengen et al. (1992) showed that it is possible

AID

Plasmid 1240

/

6606$$$$62

to control the expression of kikA within Klebsiella and thus to obtain insight into its mode of action. Experiments of this nature using constructs in which the kikA region was cloned under the reversibly regulatable PR promoter of bacteriophage l or the IPTG-inducible tac promoter are described and discussed. They lead to the conclusion that the kikA mode of action is different from that of other plasmid kil genes. The identification and characterization of the protein products of kikA allow us to propose a speculative model for the mechanism of kikA action. Evidence

06-12-96 13:45:48

plasa

AP: Plasmid

191

STRUCTURE AND MODE OF ACTION OF kikA TABLE 1 BACTERIAL STRAINS AND PLASMIDS Bacteria E. coli K-12 DH5a BL21 (DE3) Klebsiella oxytoca UN2979a Plasmids pCU403 pCU403-1

Genotype or phenotype

Source/reference

endA1 hsdR17 supE44 thi-1 recA1 gyrA96 relA1 l0 f80 dlacZ M15 D(lacZYA-argF)U169 hsdS gal (lcIts857 ind1 Sam7 nin5 lacUV5-T7 gene1)

Jessee (1986)

hisD4226 lacZ4001 galactose-resistant

McNeil et al. (1981)

kikA deletion derivative of pCU1, Km KpnI deletion derivative of pCU403, Km

Thatte et al. (1985) Rodrı´guez de Gonza´lez (unpublished data) Rotheim et al. (1988) Rodrı´guez de Gonza´lez (unpublished data) Paterson and Iyer (1992) Hengen et al. (1992) Hengen (1991) Fu¨rste et al. (1986) Rosenberg et al. (1987) Chang and Cohen (1978) This study

pCU801 pVT149-1

oriT 0 derivative of pCU1, Ap, Sm, Sp oriT 0 derivative of pVT149, Cm

pCU57D14 pPH4 pPH0/1 pJF118HE pET23d

oriT-traG region of pCU1 (coordinates 3.9 to 9.55) in pACYC184, Cm 500-bp kikA region of pCU1 cloned in pJF118HE, Ap 500-bp kikA region of pCU1 cloned in pACYC184, Cm Expression vector, Ap Expression vector, Ap

pACYC184

Cloning vector, Cm, Tc

pMH104

orf104 of kikA cloned under the control of the tac promoter in pJF118HE, Ap orf 70 of kikA cloned under the control of the tac promoter in pJF118HE, Ap Sm/SpR derivative of pMH70 created by inserting the V fragment into pMH70 orf 70 of kikA cloned under the control of the T7 promoter in pET23d, Ap The same as pMH70V but with a stop codon in orf 70, Sm/Sp The same as pMH70-T7 but with a stop codon in orf 70, Ap Expression vector, Ap Expression vector derived from pPR111 by the insertion of the V fragment into it Sm, Sp kikA region cloned under the control of the l PR promoter in pPR111V; Sm, Sp

pMH70 pMH70V pMH70-T7 pMH70terV pMH70ter-T7 pPR111 pPR111V pMH5

Studier and Moffatt (1986)

This study This study This study This study This study Windle (1986) This study This study

a This Klebsiella strain has been used extensively in genetic and physiological studies (MacNeil et al., 1981; Suhr and Kleiner, 1993). It was initially described as strain M5a1 of K. pneumoniae; see Yocum (1989).

is also presented to suggest that kikA is regulated at the level of initiation of transcription. MATERIALS AND METHODS

Bacteria and Bacterial Plasmids Table 1 lists and describes the bacterial strains and the recombinant plasmids used in this study.

AID

Plasmid 1240

/

6606$$$$62

Extraction and Manipulation of Plasmid DNA The MagicMiniprep purification system (Promega) or the alkaline lysis method of Birnboim and Doly (1979) was used to extract plasmid DNA. Restriction endonuclease digestion of DNA was usually with 1.0 mg of DNA in a total solution volume of 20 ml. Di-

06-12-96 13:45:48

plasa

AP: Plasmid

ˇ ´IK AND IYER HOLC

192

gested DNA was analyzed by horizontal gel electrophoresis in 1.2 to 1.7% agarose gels or by vertical gel electrophoresis in 6% PAGE gels in TBE buffer. After electrophoresis, the gels were stained with 0.5 mg/ml ethidium bromide, destained in distilled water, and photographed. The ladder of 1-kb DNA molecular weight standard of Bethesda Research Laboratories (Bethesda, MD) and the computer program DNAFrag (Schaffer and Sederoff, 1981) were used to calculate fragment sizes. Extraction of DNA fragments from gels and ligation to plasmid vector molecules was by standard methods (Maniatis et al., 1982) and recombinant plasmids were recovered in E. coli strains by the transformation method of Cohen et al. (1972). The same transformation protocol was used for transferring the recombinant plasmids into Klebsiella. PCR cloning and PCR-directed mutagenesis were performed essentially as described by Higuchi (1990) by using Taq DNA polymerase (Promega). The DNA was amplified using a Hybaid Combi Thermal reactor TR2 with a standard thermal cycle. The amplified DNA was cut with appropriate restriction enzyme, gel purified, and the DNA fragment of interest was cloned into the plasmid vector. All recombinant constructs which were constructed by PCR cloning were sequenced using Sequenase version 2.0 provided in a sequencing kit (USB) and a standard sequencing protocol provided by the manufacturer. Plasmid pMH104 was constructed by cloning PCR-amplified SalI– EcoRI fragment containing orf104 into the expression vector pJF118HE using the primers 104 [d(ATCGGTGGACCATGGATTAAAAGGAGATATACATATGAAGAAACTCTTAATA) which also contains translation termination codons and the ribosome binding site which were cloned in front of the ATG start codon of orf104] and 104/1 [d(CGATGAATTCTATAAGCGAACTTTCCCGTATTT)]. Primers ORFI [d(CTGCCAGCCACGCTGAAGATCCCTGCA)] and ORFII [d(TTCAGCGTGGCTGGCAGGAAGATAA)] were used to introduce a base substitution at position 217 (TrC) which destroys the start codon of orf70 (ATGrACG), but is neutral for

AID

Plasmid 1240

/

6606$$$$62

orf104 (CATrCAC; HisrHis). Plasmids pMH70, pMH70V, and pMH70-T7 were constructed with primers ORF70/1 and 104/1 in the following manner: the 5* primer [ORF70/1: d(ACTGACATGTTGAAGATCCCTGCAAAG)] has a base substitution CrT which introduces a new restriction site (AflIII) into the ATG start codon of orf 70. This mutation does not effect the amino acid sequence of the Orf70 polypeptide (CTGrTTG; LeurLeu). The AflIII–EcoRI PCR fragment was cloned into the expression vector pET23d (NcoI– EcoRI), yielding the plasmid pMH70-T7. The XbaI–EcoRI fragment of pMH70-T7, containing orf 70 and the ribosome binding site of pET23d, was recloned into the HindIII (filled) and EcoRI sites of the plasmid pJF118HE, thus placing orf 70 under the control of the tac promoter (plasmid pMH70). The plasmid pMH70 was used in further cloning in which a SmR/SpR V fragment (Prentki and Krisch, 1984) was inserted into an ApR gene, yielding the plasmid pMH70V. Primers MH5 [d(CAAGCTAATGATAGATAGCGGCGGAA)], MH7 [d(CTATCATTAGCTTGCCCGCCAT)], and ORF70/1 and 104/1 were used to construct plasmids pMH70terV and pMH70ter-T7 which are identical to pMH70V and pMH70ter-T7 with the exception that they carry base substitutions CrA and CCGr TGA at positions 264 and 266 – 269, respectively, which introduce two translation termination signals into orf 70. In the expression vector pPR111 (Windle, 1986), transcription from the bacteriophage l PR promoter is controlled by the heat-sensitive repressor protein determined by the cI857 mutation. This plasmid vector contains an ampicillin-resistance (ApR) gene. As this marker is less suited as a selectable marker in Klebsiella, we first constructed pRI111V with markers for streptomycin and spectinomycin-resistance (SmRSpR) (Prentki and Krisch, 1984). The kikA region was then retrieved as a SphI/EcoRI fragment from pPH4 (Hengen et al., 1992) and placed under the control of the l PR promoter. The resulting derivative was called pMH5. Data base searches for DNA and amino acid se-

06-12-96 13:45:48

plasa

AP: Plasmid

193

STRUCTURE AND MODE OF ACTION OF kikA

quences were done by using the NCBI BLAST network (Altschul et al., 1990), FASTA (Pearson and Lipman, 1988), and PROSITE (Bairoch, 1993). Analysis of nucleotide sequences was performed using a MacDNASIS Pro. V3.0 (Hitachi Software Engineering Co., 1993). Isolation of the Proteins, Protein Purification, and the Gel Electrophoresis of Proteins The protein samples were isolated essentially as described by Hames (1981). The technique of Wood (1978) was used to isolate the periplasmic proteins. Protein samples were then analyzed on 17.5% SDS–PAGE (4.5% stacking gel) using the Tris–glycine discontinuous buffer system described by Hames (1981). Protein Sequencing and Mass Spectrometer Analysis of the Orf104 Protein The periplasmic fraction of the Orf104 protein was purified on a 15% SDS–PAGE gel and was electroblotted onto a Problot PVDF membrane (Applied Biosystems). After staining and excision of the protein band the Nterminal part of the protein was sequenced on a 475A protein sequencing system incorporating a 470A Applied Biosystems gas phase sequencer and 120A PTH amino acid analyzer under the control of a Model 900A data analysis module. The periplasmic fraction of the Orf104 protein was further precipitated with 80% (w/v) ammonium sulfate for 2 h at 07C. Precipitated proteins were pelleted in the Eppendorf centrifuge for 10 min at 47C and the supernatant was dialyzed against 5% acetic acid (21 24 h) and was then analyzed (0.1 mg/ml) on the VG Quattro Triplequadropole Mass Spectrometer (Fisons Instruments) with a flow rate of 4 ml/min. Isolation of Total Cellular RNA, Gel Electrophoresis, and Northern Hybridization Total cellular RNA was isolated using the TRIzol reagent (GIBCO BRL) using the pro-

AID

Plasmid 1240

/

6606$$$$62

tocol provided by the manufacturer. The RNA was separated using a 1.4% agarose gel supplemented with Formalin (2.2 M final) which was run in the RNA buffer as described by Maniatis et al. (1982). The RNA was then transferred onto a Hybond N nylon membrane using a standard technique described by Maniatis et al. (1982). A radiolabeled probe was prepared by restriction of purified DNA and recovery of the fragment from the gel. Labeling of the fragment was by nick translation (Rigby et al., 1977) with approximately 0.1 to 0.5 mg of DNA and 25 mCi of radiolabeled [a-32P]dATP (Amersham Canada, Ltd.) using the nick translation kit (BRL). The prehybridization and hybridization conditions used were as described by Maniatis et al. (1982). DNA, RNA, and Protein Synthesis Synthesis of DNA, RNA, and proteins was determined by measuring the incorporation of [32P]sodium phosphate and L-[35S]methionine into TCA-precipitable material essentially as described by Watson (1972). Retention of Proline An overnight culture of K. oxytoca carrying the plasmid pPH4 or the plasmid pJF118HE was diluted in fresh LB broth supplemented with the appropriate antibiotics and grown at 377C to OD550 Å 0.1. At that time 1 mM IPTG was added and the cells were incubated for an additional 3 h at 377C. The cells were washed twice in saline and resuspended in Davis minimal medium to OD550 Å 0.5. L-[14C]proline (2 mM, 0.05 mCi/ml) was added and the cells were incubated for 10 min at 377C. A 1-ml sample was withdrawn and pipetted onto 0.45mm filter and washed with 5 ml of saline immediately. The remaining cell suspension was centrifuged for 5 min in a bench-top centrifuge, washed once with saline, and resuspended in the original volume of Davis minimal medium. The cell suspension was incubated at 377C and samples (1 ml) were taken in 1-min intervals, pipetted onto 0.45-mm filter, and washed immediately with 5 ml of saline. Filters were counted as described above.

06-12-96 13:45:48

plasa

AP: Plasmid

ˇ ´IK AND IYER HOLC

194

Values were corrected for the loss of radioactivity during centrifugation. Determination of Bacterial Respiration An overnight culture of K. oxytoca carrying the plasmid pPH4 or the plasmid pJF118HE was diluted in fresh LB broth supplemented with the appropriate antibiotics and grown at 377C to OD550 Å 0.1. At that time 1 mM IPTG was added and the cells were incubated for an additional 3 h at 377C. The cells were washed twice in saline and resuspended in PBS buffer (pH 7.4) to OD550 Ç 0.9. Oxygen consumption was measured using an Orion Research Model 97-08 oxygen electrode connected to an Orion 601A digital ionoanalyzer. Readings were taken at 5-s intervals. Cellular respiration was induced by adding filter-sterilized glucose (20%) to a final concentration of 0.4%. Inhibition of respiration by KCN, 0.01 M, was used to confirm that the observed consumption of oxygen was due to respiration. RESULTS

FIG. 2. Viability of Klebsiella oxytoca cells carrying various combinations of the kikA open reading frames in cis or in trans cloned under the control of an inducible tac promoter. An overnight culture was diluted 1:100 and grown in the presence of 0.5 mM IPTG at 377C. The samples were withdrawn at 1-h intervals and the OD550 nm was determined. (j) pJF118HE (control), (l) pPH4 (orf104 and orf 70 in cis), (.) pMH70 (orf 70 only), (,) pMH104 (orf104 only), (h) pMH104 and pMH70V (orf104 and orf 70 in trans).

Both orfs of kikA Are Needed for the KikA/ Phenotype PCR-directed cloning and mutagenesis (Higuchi, 1990) were used to construct plasmid derivatives in which orf104 and orf70 of kikA were cloned separately under the control of the artificially introduced tac promoter as described under Materials and Methods. The plasmids pMH104, pMH70, pJF118HE, and pPH4 were transformed into Klebsiella cells. In addition, plasmid pMH70V was transformed into Klebsiella cells already carrying the plasmid pMH104. The viability of the cells upon IPTG induction was measured and the results are summarized in Fig. 2. Expression of both open reading frames in trans or in cis is required for the inhibition of growth. Neither orf104 nor orf 70 alone was able to inhibit cell growth. The combination of orf104 and orf 70 in trans seems to have a more profound effect on the viability of Klebsiella than the same combination in cis. This may be related to the fact that in the PCR constructs pMH104 and

AID

Plasmid 1240

/

6606$$$$62

pMH70 transcription and transcripts of orf104 and of orf 70 are independent of one another, while in the plasmid pPH4 transcription of orf104 and of orf 70 is driven only from one promoter (tac). The major conclusion from these experiments was that the presence of both orf104 and orf 70 is essential for the KikA/ phenotype. Characterization of the Orf104 Protein Klebsiella cells carrying the plasmid pMH104 were used to overproduce, partially purify, and sequence the Orf104 protein. Gel electrophoresis revealed that there is a water-soluble protein located in the periplasm which is seen upon IPTG induction (Fig. 3A) and which is absent from the samples isolated from control cells. The protein band of the same size was also observed in the samples isolated from E. coli DH5a carrying pMH104 (results not shown). The N-terminal part of the Orf104 protein was

06-12-96 13:45:48

plasa

AP: Plasmid

195

STRUCTURE AND MODE OF ACTION OF kikA

FIG. 3. (A) SDS–PAGE (17.5%) analysis of the protein samples isolated from the K. oxytoca cells carrying the plasmid pMH104 or pJF118HE. Cells were grown to OD550 nm Ç 0.5 and induced with 0.5 mM IPTG for 3 h. Isolation of the periplasmic and cytoplasmic proteins was performed as described in Wood (1978). The arrow indicates the Orf104 protein. 1. pJF118HE—periplasmic fraction; 2. pMH104— periplasmic fraction; 3. MW standard (broad range, Bio-Rad). (B) SDS–PAGE (15%) analysis of the [35S]methionine-labeled protein samples isolated from Rif-treated and IPTG-induced E. coli BL21 (DE3) cells carrying the plasmid pMH70-T7 or pET23d. Cells were grown to OD550 nm Ç 0.5 and were induced with 0.5 mM IPTG for 30 min. Samples were incubated with 200 mg/ml rifampicin for 10 min and labeled for 5 min with L-[35S]methionine (60 mCi/ml) and run on the SDS–PAGE gel. The arrow indicates the Orf70 protein. A MW standard is indicated on the right. 1,2-pET23d; 3,4-pMH70-T7.

sequenced. The sequence which was obtained from this analysis completely matched the protein sequence predicted from the DNA template of orf104, starting at amino acid position 23 (Fig. 4). This confirmed the hypothesis that the

FIG. 4. Predicted amino acid sequence of the Orf104 (A) and Orf70 (B) proteins. The amino acid sequence of the Orf104 protein which was confirmed by microsequencing of the N-terminus is indicated by (*). The predicted cleavage site of the leader region (von Heijne, 1986) is indicated with (f).

AID

Plasmid 1240

/

6606$$$$63

first 22–24 amino acids is a leader region which is cleaved off upon transfer into the periplasm (Hengen et al., 1992). This leader region has sequence similarity to other bacterial leader peptides (not shown). The periplasmic fraction of the induced cells was further purified and the Orf104 protein was analyzed on a mass spectrometer. This analysis identified a polypeptide with a molecular mass of 8988.28 { 3.35 Da. There is a difference of /134.07 Da between the calculated mass of the Orf104 protein based on the amino acid sequence (8854.21 Da) and that obtained from the mass spectrometer analysis. This difference may be due to a posttranslational modification of the Orf104 protein which may involve the addition of a modification group(s) onto the mature Orf104 protein. It is not known, however, to what extent this second modification would affect the proper functioning of Orf104 and what this modification is. There is no homology between the Orf104 protein and any of the proteins accessible in data banks. Characterization of the Orf70 Protein The Orf70 protein could not be detected by staining with Coomassie brilliant blue. We

06-12-96 13:45:48

plasa

AP: Plasmid

ˇ ´IK AND IYER HOLC

196

therefore overproduced it after cloning it under the control of the phage T7 promoter and identified it by L-[35S]methionine pulse-labeling (Fig. 3B) in E. coli BL21 (DE3) cells carrying plasmid pMH70-T7. Two plasmids carrying orf 70 with translation termination signals at positions 264 and 267 were constructed as controls (pMH70terV, pMH70ter-T7). When orf 70ter was expressed from the tac promoter in trans with plasmid pMH104, the Kik/ phenotype was not observed (not shown). When the mutated orf 70 was expressed from the T7 promoter, we did not detect any protein product (not shown). Thus, the coding sequence of orf 70 is necessary for the Kik/ phenotype. Interestingly, the Orf70 protein has an apparent molecular weight of Ç9.0 kDa, which is more than the predicted molecular weight of 7627 Da. However, based on the predicted amino acid sequence of the Orf70 protein (Fig. 4) this protein is basic (pI Å 12.14, net charge /9) which could account for the observed anomalous behavior on SDS–PAGE gels. It has been shown for some very basic proteins (e.g., histones) that these proteins migrate anomalously during electrophoresis (Garfin, 1990). There is no sequence similarity to any protein accessible through the computer search programs in the protein data banks. The Orf70 protein is very likely a cytoplasmic protein, since it is detected only in the cytoplasmic fraction (not shown). Expression of kikA Halts the Growth of Klebsiella Reversibly When Klebsiella cells carrying pMH5 were transferred from 307 to 427C, a temperature that inactivates the lcI repressor, growth was arrested after a lag of 30 to 60 min (not shown). When the culture was shifted back to 307C, cell growth resumed after a lag of 3 to 5 h (not shown). The surviving cells still contained the plasmid and their growth could be repeatedly arrested by changing the temperature to 427C (not shown). Similar result was obtained by plating Klebsiella cells carrying pPH4 on LB-Ap plates with and without IPTG. There were no colonies observed on

AID

Plasmid 1240

/

6606$$$$63

FIG. 5. Effect of kikA expression on DNA, RNA, and protein synthesis in K. oxytoca. Cells carrying kikA under the control of the lPR promoter (plasmid pMH5; solid symbols) or a control plasmid (plasmid pPR111V; hollow symbols) were grown to OD550 Å 0.1 at 307C and then the temperature was shifted to 427C. Synthesis of DNA (l, s), RNA (j, h), and proteins (m, n) was followed by measuring the incorporation of [32P]H3PO4 and [35S]methionine, respectively. The inset shows an enlargement of the time interval from 20 to 80 min.

IPTG plates after 24 h of incubation at 377C, while the colonies on the plates without IPTG had a normal appearance. The IPTG plates were then washed with LB and plated on fresh LB-Ap plates without IPTG. After 24 h incubation we observed normal looking, viable colonies (not shown). The number of colonies was two- to threefold higher than that on the control plates (no IPTG), suggesting that the cells went through one to two cell divisions prior to growth arrest (similar to liquid culture experiments, above). These results indicated that the effect of kikA expression on cell viability was reversible. Light microscopy of the population of cells using phase contrast before and after induction showed no obvious morphological differences. Effect of kikA Expression on DNA, RNA, and Protein Biosynthesis Figure 5 shows that upon a shift from the permissive to the nonpermissive temperature,

06-12-96 13:45:48

plasa

AP: Plasmid

STRUCTURE AND MODE OF ACTION OF kikA

an arrest of both DNA and RNA synthesis occurs after a lag similar to the lag observed in the increase in cell mass (above). The cessation of protein synthesis coincided with the cessation of DNA and RNA synthesis, implying that the primary target of kikA expression is not the synthesis of macromolecules. Cellular Respiration in kikA-Induced Cells and Retention of Proline The observation that kikA expression has a bacteriostatic rather than a bactericidal effect and that its expression had no drastic or immediate effect on the morphology of the cells or the synthesis of macromolecules led to experiments in which the effect of kikA expression on the respiration was examined. The cellular respiration was tested by measuring the consumption of dissolved oxygen using a Clark electrode. As shown in Fig. 6A, there is no difference between the induced and noninduced cells. This result is consistent with the observation that the induction of kikA results in the inhibition of cell growth but not in their death. Also, if kikA-induced cells were preloaded with L-[14C]proline, their ability to retain proline was the same as that of the control cells (Fig. 6B) indicating that there is no generalized cell leakiness. Expression of kikA: Positive Regulation of kikA Promoter(s) Some observations with the kikA clones were unexpected. When the 500-bp kikA region, including its putative native promoter sequences, is cloned into the vector pACYC184 (plasmid pPH0/1 (Hengen, 1991)), the plasmid can be efficiently transformed into Klebsiella and be stably maintained (not shown). However, when the same region is cloned under the control of the tac promoter (plasmid pPH4 (Hengen et al., 1992)), induction by IPTG results in the failure of the cells to grow. Additionally, when Klebsiella cells carrying the kikA containing plasmid pPH0/1 (KikA0 phenotype) were used as recipients in matings with donors carrying the kikA deleted

AID

Plasmid 1240

/

6606$$$$63

197

plasmid pCU403 (Fig. 1), killing occurred (this study, not shown). Since both plasmids are phenotypically KikA0, the observed killing can be only a result of complementation between kikA, the only region of pCU1 present in pPH0/1, and a region present in pCU403. A working hypothesis to explain these observations is that the kikA region on the plasmid pPH0/1 can be activated by some augmenting region of the plasmid pCU403. To test this possibility, total cellular RNA isolated from each of the Klebsiella carrying plasmids pPH0/1, pCU403, or pPH0/1 / pCU403 was gel-separated, transferred onto a nylon membrane, and hybridized with the radiolabeled 500-bp kikA region (Fig. 7). It was found that there is no detectable kikA RNA in the pCU403 background (kikA deletion) (lane 3). The amount of kikA RNA in the pPH0/1 carrying cells (lane 1) is very low. However, the presence of the plasmid pCU403 together with pPH0/1 had a considerable effect on the expression of kikA as indicated by the increase in the amount of kikA RNA detected (lane 2). (It needs to be noted that the presence of pCU403 in Klebsiella renders it immune to killing, thus permitting maintenance of both plasmids. The basis of this immunity has been studied and described by Rodrı´guez et al. (1995).) This increase in the level of detected kikA transcript could be due to the increased level of transcription or increased stability of the transcript. In addition, this result indicated that the P1 – 2 region of kikA is a functional promoter. Previous work in our laboratory showed that the genes required for the Kik/ phenotype are located near the tra region of pCU1 (Thatte et al., 1985). In this work a continuous region that includes tra and kikA of pCU1 was cloned into a cloning vector pACYC184 yielding the plasmid pCU109 (Fig. 1), which was found to be Kik/. We showed here that the augmenting region of pCU1 is located within the DNA sequence present in the plasmid pCU403. We also tested a deletion derivative of pCU403, pCU403-1 (RodrıB guez de Gonza´lez, unpublished data) (Fig. 1), for augmentation of kikA. Since pCU403-1 is not self-

06-12-96 13:45:48

plasa

AP: Plasmid

ˇ ´IK AND IYER HOLC

198

FIG. 6. (A) Effect of kikA on respiration of K. oxytoca. Cells carrying kikA under the control of the tac promoter (plasmid pPH4; solid line) or a control plasmid (plasmid pJF118HE; dotted line) were grown to OD550 Å 0.1 at 377C, induced for 3 h with 1 mM IPTG, and resuspended in PBS buffer (pH 7.4) at room temperature. Glucose-driven oxygen consumption was measured using an Orion Research Model 97-08 oxygen electrode and an Orion 601A digital ionoanalyzer. Readings were taken at 5-s intervals. The respiration was induced by adding filter-sterilized glucose (0.4% w/v final). Inhibition of respiration (KCN, 0.01 M final) was used to confirm that the observed consumption of oxygen was due to respiration. (B) Effect of kikA expression on the retention of [14C]proline in K. oxytoca. Cells carrying kikA under the control of the tac promoter (plasmid pPH4 (l)) or a control plasmid (plasmid pJF118HE (,)) were grown to OD550 Å 0.1 at 377C and then induced with 1 mM IPTG for 3 h. Cells were preloaded with L-[14C]proline (2 mM, 0.05 mCi/ml) for 10 min, washed in saline, and then incubated at 377C for 10 minutes. During this time samples (1 ml) were withdrawn at 1-min intervals, pipetted onto 0.45-mm filter, and washed with 5 ml of saline. Values were corrected for the lost of radioactivity during washing and centrifugation. The dotted lines represent the linear regression lines (r Å 00.100 (pPH4); r Å 00.790 (pJF118HE)).

transmissible it was transferred into K. oxytoca cells carrying pPH0/1 by conjugative mobilization with the helper plasmid pVT149-1 (RodrıB guez de Gonza´lez, unpublished data) which lacks its own origin of transfer and is itself not transferred into a recipient. It was found that this plasmid does augment the expression of kikA as well as does pCU403 (result not shown). Next, we tested the plasmid derivative pCU57D14 (Fig. 1) which was constructed by cloning the oriT-traG region of pCU1 (coordinates 3.9 to 9.55) into pACYC184 (Paterson and Iyer, 1992). When this plasmid was mobilized with the help of Traderivative pCU801 (Rotheim et al., 1988) into K. oxytoca cells carrying pPH0/1 it was found that this derivative does not augment the Kik/ phenotype (result not shown). Therefore, the

AID

Plasmid 1240

/

6606$$$$63

augmenting region of pCU1 is very likely located in the left side of the tra region, between the kikA and traB regions. DISCUSSION

Several distinct killing systems have been found associated with bacterial plasmids. It has been shown that the presence of one group of lethal genes improves the competitiveness of the host (e.g., bacteriocins; (Chao and Levin, 1981)) and that another ensures the stable maintenance of the plasmid (e.g., postsegregational killing; (Nordstro¨m and Austin, 1989)). A third group of potentially lethal genes is represented by the kil/kor genes of RK2 (Figurski et al., 1982) and pKM101 (Winans and Walker, 1985). Although the precise

06-12-96 13:45:48

plasa

AP: Plasmid

STRUCTURE AND MODE OF ACTION OF kikA

FIG. 7. Northern blot hybridization of 500-bp kikA region of the plasmid pPH4 to total cellular RNA isolated from Klebsiella cells carrying the plasmids pPH0/1, pCU403, and pPH0/1 / pCU403, respectively. Cells were grown to OD550 nm Ç 0.9 and total cellular RNA was isolated using the TRIzol reagent (GIBCO BRL), Northern blot and hybridization were performed using standard methods (Maniatis et al., 1982). 23S RNA is shown (EtBr stained) for comparison of the amount of RNA loaded in each lane.

role of these genes in plasmid maintenance has not been established the experimental evidence suggests that these genes are involved in the regulation of plasmid replication and/ or conjugation (Balzer et al., 1992; JaguraBurdzy et al., 1992). It was shown previously that the IncN group conjugative plasmids kill Klebsiella recipients upon conjugative transfer into this host (RodrıB guez and Iyer, 1981). The Kik/ phenotype is host-specific and it is due to the continuous presence of the plasmid inside the host cell, not its segregational loss (RodrıB guez et al., 1995). The 500-bp kikA region of the IncN plasmid pCU1 was identified as a major component of Kik/ and was shown to contain two putative open reading frames (Thatte et al., 1985; Hengen et al., 1992). The evidence in this paper shows that the expression of both open reading frames of kikA (orf104 and orf 70) in cis or in trans is necessary for the Kik/ phenotype. This experimental result thus suggests that there is a co-

AID

Plasmid 1240

/

6606$$$$63

199

operativity between the products of orf 70 and orf104. The possibility that the observed growth inhibition is due to the strong expression of these proteins from an inducible promoter needs to be also considered. However, several results contradict this hypothesis. First, overexpression of individual open reading frames of kikA from the strong promoter did not lead to any abnormal growth and it was the combination of these two proteins which lead to the growth inhibition. It is possible, however, that the level of inhibition is different when kikA genes are expressed from their natural promoters in the pCU1 background. Second, plasmid pPH0/1 has a potentially functional kikA gene but has Kik0 phenotype. When this plasmid was used in trans with plasmid pCU403 (kikA deletion) killing was observed. This could be because (i) pCU403 contains an additional kil-like gene(s) which is required for killing or (ii) pCU403 harbors a region(s) which can activate or enhance expression of the kikA genes which in turn will cause the Kik/ phenotype. Northern blot analysis of the kikA transcripts revealed that in the presence of the plasmid pCU403 the level of expression from the putative kikA promoters is increased severalfold. It thus suggests that it is the increased level of expression of kikA which is detrimental to the cell. Identification of the augmenting region may allow construction of a plasmid in which the effect of kikA can be observed under physiological levels of kikA expression. Our experiments show that the expression of kikA is directed from its natural promoters and is positively regulated at the level of transcription or of RNA stability. This result does not agree with the suggestion of Pohlman et al. (1994). Based on the sequence analysis of the closely related plasmid pKM101, the authors propose that kikA is expressed as a part of a polycistronic transcript including korB, orf1, kikA, and orf 2 (Fig. 8). This transcript was believed to be transcribed from the divergent promoter located between korB and traL, approximately 740 bp upstream of kikA (Pohlman et al., 1994). It has been shown previously, however, that a Tn5 insertion in the

06-12-96 13:45:48

plasa

AP: Plasmid

ˇ ´IK AND IYER HOLC

200

FIG. 8. Genetic map and the alignment of the kikA-traA region of two closely related plasmids: pKM101 (top) and pCU1 (bottom). Arrows indicate directions of translation. The kikA-traA region of pCU1 is described in Hengen et al. (1992) and RodrıB guez et al. (1995). The information on pKM101 is from Pohlman et al. (1994).

plasmid pKM101 (pKM101:V1280) which abolishes the function of this divergent promoter and korB does not affect the Kik/ phenotype (Winans and Walker, 1985), indicating that the expression of kikA (located downstream from korB) is independent of this promoter. Our results support this finding and that kikA is expressed from its own promoter. However, further experiments are needed to analyze the detailed structure of the kikA promoter region. The positive regulation of kikA expression is due to the presence of an additional region which is present in the parental plasmid pCU1 and which we call here the augmenting region. Tests with pCU1 deletions and clones suggest that the augmenting region is located between the kikA and traB regions. The kor genes of plasmid RK2 that have been identified and characterized so far were shown to determine DNA-binding proteins and they are believed to down-regulate the expression of the kil genes by binding in the vicinity of their promoters (Balzer et al., 1992; Kornacki et al., 1993; Thomson et al., 1993). The kikA region is, however, up-regulated by the presence of the augmenting region of pCU1. The nucleotide sequence of the region between kikA and traB is available both for plasmid

AID

Plasmid 1240

/

6606$$$$64

pCU1 (GenBank Accesion Number: U26172 (RodrıB guez et al., 1995)) and for pKM101 (Pohlman et al., 1994), which allows for some speculation as to the nature of the augmenting region. Pohlman et al. (1994) identified six putative open reading frames in the respective region of pKM101 (orf1 and korB in one direction; traL Å kilA, korA, traM, traA in the other direction; Fig. 8). traL (previously kilA) and traM are believed to be exported proteins (based on the hydrophobicity profiles and activity of Tn5phoA insertions in them (Pohlman et al., 1994)) and are therefore unlikely to be involved in the regulation of promoter activity. Additionally, Tn5 insertion in traM of pCU1 (pCU171 (Thatte et al., 1985)) had no effect on the Kik/ phenotype as demonstrated by Rotheim et al. (1988). In contrast, korA and korB are required to prevent a lethal effect of the traL (kilA) and are presumed to encode DNA-binding proteins. However, Winans and Walker (1985) demonstrated previously that the inactivation of traL (kilA) and korB had no effect on the Kik/ phenotype. Potential candidates for the augmenting locus are therefore korA, traA, and orf1 or some combination of them. The corresponding region in the plasmid pCU1 (kikA–traM) has nearly identical

06-12-96 13:45:48

plasa

AP: Plasmid

201

STRUCTURE AND MODE OF ACTION OF kikA

nucleotide sequence to that of pKM101 (RodrıB guez et al., 1995). Several potential open reading frames were identified in this region (Fig. 8), some of which are identical to those of pKM101 (orf125 Å orf1, orf101 Å korB, orf93 Å korA), while orf234 is almost identical to traL (kilA) of pKM101. Additional candidates could be orf184 in one direction and orf63 and orf123 in the other direction. Further genetic analysis of this region is required to identify the augmenting gene or genes precisely. We have shown here that the intracellular overproduction of kikA abolishes synthesis of DNA, RNA, and proteins. It, however, does not cause a general leakiness of the cell or prevent respiration, indicating that the target for the kikA is some general cellular function. In addition, we did not observe any morphological changes associated with the expression of kikA. These findings are in contrast to the described mechanisms of action of other kil genes. It was observed that after the expression of the hok gene of the plasmid R1 there is a rapid decrease in the rate of oxygen consumption and a decrease in the membrane electrochemical potential (Gerdes et al., 1986). The morphological changes associated with the expression of hok (ghost cell appearance) were hypothesized to be due to the permeabilization of the cell membrane. The morphological changes were also associated with the expression of the kil genes of the plasmid RK2 (Saltman et al., 1991; Turner et al., 1994). It thus appear that the kikA represents a different killing system (see also Rodrı´guez et al., 1995). An interesting observation is that the Kik/ phenotype is observed only in Klebsiella and not in E. coli. It has been shown previously (Hengen et al., 1992) that if a plasmid containing the 500-bp kikA region under the control of the tac promoter was established in E. coli and kikA was induced by addition of IPTG, this did not lead to detectable lethality. The same experiment performed in Klebsiella, however, led to the reduction of viability of the host cell. These results thus imply that even though the augmenting region is required for the full expression of kikA, the lack

AID

Plasmid 1240

/

6606$$$$64

of kikA expression is not the reason E. coli is not susceptible to this phenotype. From the genetic experiments presented it is clear that the presence of both proteins is required for the Kik/ phenotype. As noted above, however, the Orf104 and Orf70 proteins were isolated from different cell compartments. We therefore propose that the Orf104 and Orf70 proteins interact via a third, presumably membrane, protein. The interaction of either Orf104 or Orf70 alone with the putative membrane protein is not sufficient since neither the overexpression of orf104 nor the overexpression of orf70 caused reduction of Klebsiella viability. orf104 and orf70 constitute two separate genes of the kikA locus. The Orf104 protein also plays a role in the entry of the bacteriophage PRD1 and we previously proposed to call it the Pep protein (PRD1 entry protein) (Holcˇ´ık and Iyer, accompanying paper). It is possible that the difference in susceptibility to Kik/ is due to the difference in the target (putative membrane protein) of kikA. This hypothesis is also supported by the finding that mutant Klebsiella which are resistant to Kik/ have been isolated (Gill, 1985; RodrıB guez et al., 1995). The nature of this chromosomal mutant(s) needs to be investigated. ACKNOWLEDGMENTS We thank D. Watson, NRC Canada, for help with protein sequencing and the mass spectrometer analysis, D. Sprott, NRC Canada, for assistance and advice on the uptake experiments, and S. Paterson for the synthesis of the oligonucleotide primers. This study forms part of the Ph.D. dissertation of M.H. It was supported by an operating research grant from the Medical Research Council of Canada and by an equipment grant from the Natural Sciences and Engineering Research Council of Canada.

REFERENCES ALTSCHUL, S. F., GISH, W., MILLER, W., MEYERS, E. W., AND LIPMAN, D. J. (1990). Basic Local Alignment Search Tool. J. Mol. Biol. 215, 403–410. BAIROCH, A. (1993). The PROSITE dictionary of sites and patterns in proteins, its current status. Nucleic Acids Res. 21, 3097–3103. BALZER, D., ZIEGELIN, G., PANSAGRAU, W., KRUFT, V., AND LANKA, E. (1992). KorB protein of promiscuous

06-12-96 13:45:48

plasa

AP: Plasmid

ˇ ´IK AND IYER HOLC

202

plasmid RP4 recognizes inverted sequence repetitions in region essential for conjugative plasmid transfer. Nucleic Acids Res. 20, 1851–1858. BIRNBOIM, H. C., AND DOLY, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, 1513–1523. CHANG, A. C. Y., AND COHEN, S. N. (1978). Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134, 1141–1156. CHAO, L., AND LEVIN, B. (1981). Structural habitats and evolution of anticompetitors in bacteria. Proc. Natl. Acad. Sci. USA 78, 6324–6328. COHEN, S. N., CHANG, A. C. Y., AND HSU, L. (1972). Nonchromosomal antibiotic resistance in bacteria: Genetic transformation in Escherichia coli by R-factor DNA. Proc. Natl. Acad. Sci. USA 69, 2110–2114. DAVIS, B. D., AND MINGIOLI, E. S. (1950). Mutants of Escherichia coli requiring methionine or vitamin B1 2. J. Bacteriol. 60, 17–28. FIGURSKI, D. H., POHLMAN, R. F., BECHHOFER, D. H., PRINCE, A. S., AND KELTON, C. A. (1982). Broad host range plasmid RK2 encodes multiple kil genes potentially lethal to Escherichia coli host cells. Proc. Natl. Acad. Sci. USA 79, 1935–1939. FU¨RSTE, J. P., PANSEGRAU, W., FRANK, R., BLO¨CKER, H., SCHOLZ, P., BAGSASARIAN, M., AND LANKA, E. (1986). Molecular cloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector. Gene 48, 119–131. GARFIN, D. E. (1990). One-dimensional gel electrophoresis. Methods Enzymol. 182, 425–441. GERDES, K., BECH, F. W., JORGENSEN, S. T., LOBNEROLESEN, A., RASMUSSEN, P. B., ATLUNG, T., BOE, L., KARLSTRON, O., MOLIN, S., AND VON MEYENBURG, K. (1986). Mechanism of postsegregational killing by the hok gene product of the parB system of plasmid R1 and its homology with the relF gene product of the E. coli relB operon. EMBO J. 5, 2023–2029. GILL, S. S. (1985). M.Sc. thesis, Carleton University, Ottawa, Ontario, Canada. GILL, S. S., AND IYER, V. N. (1982). Nalidixic acid inhibits the conjugal transfer of conjugative N incompatibility group plasmids. Can. J. Microbiol. 28, 256–258. HAMES, B. D. (1981). ‘‘Gel Electrophoresis of Proteins: A Practical Approach.’’ IRL Press, Oxford/Washington DC. HENGEN, P. N. (1991). Ph.D. thesis, Carleton University, Ottawa, Canada. HENGEN, P. N., DENICOURT, D., AND IYER, V. N. (1992). Isolation and characterization of kikA, a region on IncN group plasmids that determines killing of Klebsiella oxytoca. J. Bacteriol. 174, 3070–3077. HIGUCHI, R. (1990). Recombinant PCR. In ‘‘PCR Protocols: A Guide to Methods and Applications’’ (Innis et al., Eds.), pp. 177–18 3. Academic Press, San Diego. HOLCˇ´IK, M., AND IYER, V. N. (1996). A novel plasmid

AID

Plasmid 1240

/

6606$$$$64

gene involved in bacteriophage PRD1 infection and conjugative host range. Plasmid 35, 204–210. IYER, V. N. (1989). IncN group plasmids and their genetic systems. In ‘‘Promiscuous Plasmids of Gram-Negative Bacteria.’’ (C. M. Thomas, Ed.), pp. 165–18 3. Academic Press, New York. JAGURA-BURDZY, G., KHANIM, F., SMITH, C. A., AND THOMAS, C. M. (1992). Crosstalk between plasmid vegetative replication and conjugative transfer: repression of the trfA operon by trbA of broad host range plasmid RK2. Nucleic Acids Res. 20, 3939–3944. JESSEE, J. (1986). New subcloning efficiency competent cells: ú1 1 106 transformants/mg. Bethesda Research Laboratories FOCUS 8, 4. KONARSKA-KOZLOWSKA, M., AND IYER, V. N. (1981). Physical and genetic organization of the IncN-group plasmid pCU 1. Gene 14, 195–204. KORNACKI, J. A., CAHNG, C.-H., AND FIGURSKI, D. H. (1993). kil-kor regulon of promiscuous plasmid RK2: Structure, products, and regulation of two operons that constitute the kilE locus. J. Bacteriol. 175, 5078–5090. KRISHNAN, B. R., AND IYER, V. N. (1988). Host ranges of the IncN group plasmid pCU1 and its minireplicon in Gram-negative purple bacteria. Appl. Environ. Microbiol. 54, 2273–2276. MACNEIL, D., ZHU, J., AND BRILL, W. J. (1981). Regulation of nitrogen fixation in Klebsiella pneumoniae: Isolation and characterization of strains with nif-lac fusions. J. Bacteriol. 145, 348–357. MANIATIS, T., FRITSCH, E. F., AND SAMBROOK, J. (1982). ‘‘Molecular Cloning: A Laboratory Manual.’’ Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. MCMORROW, I., CHIN, D. T., FIEBIG, K., PIERCE, J. L., WILSON, D. M., REEVE, E. C. R., AND WILSON, T. H. (1988). The lactose carrier of Klebsiella pneumoniae M5a1: The physiology of transport and the nucleotide sequence of the lacY gene. Biochim. Biophys. Acta 945, 315–323. NORDSTRO¨M, K., AND AUSTIN, S. J. (1989). Mechanisms that contribute to the stable segregation of plasmids. Annu. Rev. Genet. 23, 37–69. PATERSON, E. S., AND IYER, V. N. (1992). The oriT Region of the conjugative transfer system of plasmid pCU1 and specificity between it and the mob region of other N tra plasmids. J. Bacteriol. 174, 499–507. PEARSON, W. R., AND LIPMAN, D. J. (1988). Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85, 2444–2448. POHLMAN, R. F., GENETTI, H. D., AND WINANS, S. C. (1994). Common ancestry between IncN conjugal transfer genes and macromolecular export systems of plant and animal pathogens. Mol. Microbiol. 14, 655– 668. PRENTKI, P., AND KRISCH, H. M. (1984). In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29, 303–313. RIGBY, P. W. J., DIECKMANN, M., RHODES, C., AND BERG,

06-12-96 13:45:48

plasa

AP: Plasmid

STRUCTURE AND MODE OF ACTION OF kikA P. (1977). Labelling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 113, 237–251. RODRI´GUEZ, M., AND IYER, V. N. (1981). Killing of Klebsiella pneumoniae mediated by conjugation with bacteria carrying antibiotic-resistance plasmids of the group N. Plasmid 6, 141–147. RODRI´GUEZ, M., HOLCˇI´K M., AND IYER, V. N. (1995). Lethality and survival of Klebsiella oxytoca evoked by conjugative IncN group plasmids. J. Bacteriol. 177, 6352–6361. ROSENBERG, A. H., LADE, B. N., CHUI, D., LIN, S., DUNN, J. J., AND STUDIER, F. W. (1987). Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56, 125–135. ROTHEIM, M. B., LOVE, B., THATTE, V., AND IYER, V. N. (1988). A demonstration that pCU1 tra gene products are not required in the killing of Klebsiella pneumoniae. Plasmid 19, 161–163. SALTMAN, L. H., KIM, K.-S., AND FIGURSKI, D. H. (1991). The kilA operon of promiscuous plasmid RK2: The use of transducing phage (lpklaA-1) to determine the effect of the lethal klaA gene on Escherichia coli cells. Mol. Microbiol. 5, 2673–2683. SCHAFFER, H. E., AND SEDEROFF, R. R. (1981). Improved estimation of DNA fragments length from agarose gels. Anal. Biochem. 115, 113–122. SELVARAJ, G., AND IYER, V. N. (1984). Suicide plasmid vehicles for insertion mutagenesis in Rhizobium meliloti and related bacteria. J. Bacteriol. 156, 1292–1300. STUDIER, F. W., AND MOFFATT, B. A. (1986). Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189, 113–130.

203

SUHR, M., AND KLEINER, D. (1993). Genetic analysis of the regulatory putP region (coding for proline permease) in Klebsiella pneumoniae M5a1: Evidence for regulation by the nac system. FEMS Microb. Lett. 114, 191–194. THATTE, V., GILL, S. S., AND IYER, V. N. (1985). Regions on plasmid pCU1 required for the killing of Klebsiella pneumoniae. J. Bacteriol. 163, 1296–1299. THOMSON, V. J., JOVANOVIC, O. S., POHLMAN, R. F., CHANG, C.-H., AND FIGURSKI, D. H. (1993). Structure, function, and regulation of the kilB locus of promiscuous plasmid RK2. J. Bacteriol. 175, 2423–2435. TURNER, R. J., WEINER, J. H., AND TAYLOR, D. E. (1994). Characterization of the growth inhibition phenotype of the kilAtelAB operon from the IncPa plasmid RK2Ter. Biochem. Cell Biol. 72, 333–342. VON HEIJNE, G. (1986). A new method for predicting signal sequence cleavage site. Nucleic Acids Res. 14, 4683–4690. WATSON, R. J. (1972). ‘‘Expression of the Rel Gene 7 during R17 Phage Infection.’’ M.Sc. thesis, Carleton University, Ottawa, Canada. WINANS, S. C., AND WALKER, G. C. (1985). Identification of pKM101-encoded loci specifying potentially lethal gene products. J. Bacteriol. 161, 417–424. WINDLE, B. E. (1986). Phage lambda and plasmid expression vectors with multiple cloning sites and lacZ acomplementation. Gene 45, 95–99. WOOD, P. M. (1978). Periplasmic location of the terminal reductase in nitrate respiration. FEBS Lett. 92, 214– 218. YOCUM, R. (1989). Proposed amendment of the NIH guidelines regarding Klebsiella oxytoca. Fed. Register USA 54, 36703–36704.

Communicated by David H. Figurski

AID

Plasmid 1240

/

6606$$$$64

06-12-96 13:45:48

plasa

AP: Plasmid