- Email: [email protected]
Structure, DNA sequence variation and phylogenetic implications of the mitochondrial control region in horseshoe bats
ARTICLE IN PRESS
www.elsevier.de/mambio
ORIGINAL INVESTIGATION
Structure, DNA sequence variation and phylogenetic implications of the mitochondrial control region in horseshoe bats Keping Suna,b, Jiang Fenga,b,, Longru Jina, Ying Liua, Limin Shia, Tinglei Jianga a
Key Laboratory for Wetland Ecology and Vegetation Restoration of National Environmental Protection, Northeast Normal University, Changchun 130024, China b Key Laboratory of Vegetation Ecology of Education Ministry, Institute of Grassland Science, Northeast Normal University, Changchun 130024, China Received 30 November 2007; accepted 19 September 2008
Abstract There have been few studies of the structural and evolutionary characteristics of the mitochondrial control region (CR) in rhinolophids, yet this could have important consequences for the interpretation of phylogenetic relationships within this group. Here we sequenced and analyzed the CR of 37 individuals from 12 Rhinolophus species, including 2 species from GenBank. The length of the CR ranged from 1335 to 1514 bp, and the base composition was very similar among species. The CR of horseshoe bats, like that of other mammals, could be subdivided into a central conserved domain (CD) and two flanking variable domains, extended termination associated sequences (ETAS), and conserved sequence blocks (CSB). Besides the common conserved blocks (ETAS1, ETAS2, F-B boxes, CSB1, CSB2 and CSB3) found in 3 domains, an ETAS2-like and a CSB1-like element were also detected in the ETAS and CSB domains, respectively, in all individuals. Notwithstanding a short tandem repeat (11 or 13 bp) between CSB1 and CSB2 in all specimens, the base composition, copy number and arrays are all variable. A long tandem repeat (79 bp) was only identified in the ETAS domain in one individual of R. pusillus. Phylogenetic reconstructions based on the CR sequences indicated that the molecular phylogenetic relationships among some Rhinolophus species were inconsistent with the results of phenetic analyses, but similar to phylogenetic constructions using cytochrome b. An unidentified species R. sp and 3 species from the philippinensis-group that were clearly morphologically different comprised a monophyletic group, which could have resulted from morphological independent evolution. Crown Copyright r 2008 Published by Elsevier GmbH on behalf of Deutsche Gesellschaft fu¨r Sa¨ugetierkunde. All rights reserved. Keywords: Conserved element; Control region; Phylogeny; Rhinolophus; Tandem repeat
Introduction Corresponding author at: Key Laboratory for Wetland Ecology
and Vegetation Restoration of National Environmental Protection, Northeast Normal University, Changchun 130024 China. Tel.: 86 0431 85098097; fax: 86 0431 85098098. E-mail address: [email protected] (J. Feng).
The mitochondrial DNA (mtDNA) control region (CR), the major non-coding region of the animal mtDNA molecule, is also called the D-loop because of the three-stranded displacement (D) loop structure created by the nascent short H strand that displaces
1616-5047/$ - see front matter Crown Copyright r 2008 Published by Elsevier GmbH on behalf of Deutsche Gesellschaft fu¨r Sa¨ugetierkunde. All rights reserved. doi:10.1016/j.mambio.2008.09.002 Mamm. biol. 74 (2009) 130–144
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
the parental H strand (Saccone et al. 1987). The mammalian CR is commonly divided into three domains, including the extended termination-associated sequences (ETAS) domain (spanning from the tRNAPro to the central domain), the central domain (CD), and the conserved sequence blocks (CSB) domain (from the CD to the tRNAPhe), which differ depending on the pattern of variation and mode of evolution (Lee et al. 1995; Baker and Marshall 1997; Sbisa` et al. 1997). The ETAS and CSB domains evolve rapidly, while the CD maintains a high degree of conservation across species (Sbisa` et al. 1997; Pesole et al. 1999). The ETAS domain contains the TAS elements, first identified by Doda et al. (1981) as being associated with the termination of the nascent H strand during replication. Sbisa` et al. (1997) subsequently identified two conserved blocks, ETAS1 and ETAS2, and suggest that they play roles in the regulation of replication and transcription. The CD is most highly conserved in all species, but its function is still largely obscure (Sbisa` et al. 1997). The CSB domain as a functionally important region containing the replication origin of the heavy strand (OH), promoters for the transcription of both the heavy and light strands (HSP and LSP), as well as three conserved blocks, CSB1, CSB2 and CSB3, presumably involved in the processing of the RNA primers for heavy strand replication (Walberg and Clayton 1981). Long and short tandem repeats were detected in the ETAS and CSB domains, respectively, in many mammals (Hoelzel et al. 1994; Fumagalli et al. 1996; Petri et al. 1996; Sbisa` et al. 1997; Wilkinson et al. 1997; Larizza et al. 2002; Ketmaier and Bernardini 2005). However, the base composition, length and copy number of the repeats were variable, which provided a source of intraspecific and interspecific length heteroplasmy (Wilkinson and Chapman 1991; Sbisa` et al. 1997; Wilkinson et al. 1997; Larizza et al. 2002). Some studies have provided a detailed characterization of the overall structure of the CR in mammals and other vertebrates. They have identified conserved sequences of putative functional importance, and have provided valuable information on phylogeny, phylogeography and population genetics (Brown et al. 1986; Saccone et al. 1987; Sbisa` et al. 1997; Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Ketmaier and Bernardini 2005; Iyengar et al. 2006). However, due to different times of divergence and evolution rates, the CR had different characteristic structures among mammals (Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Iyengar et al. 2006). Within bats, few investigations on the detailed characterizations of the CR have been conducted (Wilkinson and Chapman 1991; Wilkinson et al. 1997), although CR 50 variable sequences have been used to study population structure and phylogeography of many species (Ruedi and Castella 2003; Juste et al. 2004; Salgueiro et al. 2004;
131
Armstrong 2006; Chen et al., 2006). The CR has been used infrequently to study phylogenetic relationships within genera or families. Rhinolophidae (Chiroptera: Microchiroptera) includes only one genus, Rhinolophus, with ca. 77 recognized species of Old World horseshoe bats (Simmons, 2005). In China, about 20 species of horseshoe bats were recorded (Wang 2003; Wu et al. 2004; Zhang et al. 2005). Andersen (1905a, b, 1918) first reviewed this family and constructed a phylogenetic tree. Most subsequent scholars have either accepted it or have made only minor changes in his classification (e.g., Tate and Archbold 1939; Tate 1943; Ellerman and Morrison-Scott 1951; Koopman 1975; Hill and Yoshiyuki 1980; Yoshiyuki 1989, 1990; Hill 1992). Bogdanowicz (1992) and Bogdanowicz and Owen (1992) assessed evolutionary relationships among species using a large set of cranial and external characteristics to construct a new classification of this family. However, little research on the phylogenetic relationships of horseshoe bats has been conducted at the molecular level (Cooper et al. 1998; Guille´n-Servent et al., 2003; Sakai et al. 2003; Wang et al., 2003). Guille´n-Servent et al. (2003) proposed a new taxonomic arrangement of a number of species of Rhinolophus based on the sequences of the mitochondrial cytochrome b (Cyt b) gene, which was different from that of Bogdanowicz (1992). In the present study, we obtained the complete CR sequences from 35 captured individuals representing 10 species in China, and reconstructed the phylogenetic trees by including the complete or 50 variable CR sequences available in GenBank from other horseshoe bats. Our objectives were to (i) characterize the structural features and patterns of evolution of the horseshoe bats’ CR in comparison with similar regions in other mammal species, and (ii) explore the implications of the CR for the phylogenetic relationships among Rhinolophus species by comparison to the results of morphological and mitochondrial Cyt b studies.
Materials and methods Sampling and DNA extraction All of the specimens were collected from China (Table 1) and were identified following standard keys (Csorba et al., 2003). A piece of wing tissue (3 mm in diameter) from live animals was punched and stored in 95% ethanol. The bats were then returned to their habitats. Total genomic DNA of each individual was extracted using a UNIQ-10 Column Animal Genomic DNA Isolation Kit (Sangon, China).
ARTICLE IN PRESS 132
Table 1.
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
Horseshoe bat species sampled and analyzed in this study
Genus/species
Common name
Locality
GenBank accession No.
Length (bp)
No. of RS1
Rhinolophus R. sinicus (1) R. sinicus (2) R. sinicus (3) R. affinis (1) R. affinis (2) R. macrotis (1) R. macrotis (2) R. macrotis (3) R. macrotis (4) R. ferrumequinum (1) R. ferrumequinum (2) R. ferrumequinum (3) R. pearsoni R. marshalli R. sp (1) R. sp (2) R. thomasi R. rex (1) R. rex (2) R. pusillus (1) R. pusillus (2) R. pusillus (3) R. pusillus (4) R. pusillus (5) R. pusillus (6) R. pusillus (7) R. pusillus (8) R. pusillus (9) R. pusillus (10) R. pusillus (11) R. pusillus (12) R. pusillus (13) R. pusillus (14) R. pusillus (15) R. pusillus (16) R. c. pumilus R. monoceros
Chinese horseshoe bat Chinese horseshoe bat Chinese horseshoe bat Intermediate horseshoe bat Intermediate horseshoe bat Large-eared horseshoe bat Large-eared horseshoe bat Large-eared horseshoe bat Large-eared horseshoe bat Greater horseshoe bat Greater horseshoe bat Greater horseshoe bat Pearson’s horseshoe bat Marshall’s horseshoe bat Unidentified horseshoe bat Unidentified horseshoe bat Thomas’ horseshoe bat King horseshoe bat King horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Okinawa least horseshoe bat Formosan lesser horseshoe bat
Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Jiangxi, China Yunnan, China Yunnan, China Yunnan, China Jiangxi, China Guangxi, China Yunnan, China Yunnan, China Jiangxi, China Chongqing, China Chongqing, China Chongqing, China Jiangxi, China Jiangxi, China Yunnan, China Yunnan, China Jiangxi, China Chongqing, China Chongqing, China Guangdong, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Chongqing, China Japan Taiwan, China
DQ642887 DQ642888 DQ642889 DQ642890 DQ642891 DQ642892 DQ642893 DQ642894 EU053156 DQ642895 EU053157 EU053158 EU053159 EU053160 EU053161 EU053162 EU053163 DQ642896 DQ642897 DQ642898 DQ642899 DQ642900 DQ642901 DQ916119 DQ916120 DQ916121 DQ916122 DQ916123 EF217373 EF217374 EF217375 EF217376 EF217377 EF217378 EF217379 AB061526 AF406806
1405 1471 1482 1441 1472 1410 1438 1409 1407 1380 1371 1370 1374 1422 1367 1422 1436 1355 1387 1424 1401 1401 1389 1401 1444 1434 1391 1367 1390 1378 1444 1335 1422 1401 1514 1424 1405
15 20 21 16 21 20 23 20 20 17 16 16 14 21 15 20 18 14 17 21 19 19 18 19 23 22 18 16 18 17 23 13 21 19 15 21 19
(1251) (1262) (1262) (1276) (1252) (1201) (1196) (1200) (1198) (1204) (1206) (1205) (1205) (1202) (1213) (1213) (1249) (1212) (1211) (1204) (1203) (1203) (1202) (1203) (1202) (1203) (1204) (1202) (1203) (1202) (1202) (1203) (1202) (1203) (1202) (1204) (1207)
The sequences of Rhinolophus cornutus pumilus and R. monoceros were obtained from GenBank. The numbers in the parentheses are the length of the CR without repeats. RS1 represents short repeated sequence.
DNA amplification and sequencing The CR sequences of 35 individuals from 10 Rhinolophus species were amplified using primers Pro and Phe (Table 2), which were designed according to the conserved sequences of tRNApro and tRNAphe flanking the CR. We also amplified the CR sequences of two Hipposideros species (H. armiger and H. pratti) using these two primers, which were used as outgroups. The sequences of 15 light-strand extended primers were designed (Table 2) for sequencing the entire CR. Due to the extremely long repeated sequences of H. armiger and H. pratti, not all the repeats of the CR were completely
sequenced. The CR sequences have been deposited in DQ642887–DQ642901, DQ916119–DQ916123 and EU053156–EU053165. Reactions were performed in 50 ml volumes, containing 50–100 ng of genomic DNA, 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 mM of each dNTP, 0.4 mM of each primer, and 2.5 U of Taq DNA polymerase. The cycling parameters were as follows: 94 1C for 5 min; 94 1C for 45 s, 58–62 1C for 45 s and 72 1C for 90 s, for 35 cycles; 72 1C for 10 min. The PCR products were purified on an EZ-10 Spin Column DNA Gel Extraction Kit (BBI) and sequenced using an ABI PRISM 3730 sequencer (Applied Biosystems).
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
Table 2.
133
Primer names, sequences and the corresponding species sequenced
Primer
Sequence (50 –30 )
Species
Pro Phe 1115255 0920098 1205497 03232305 0329128 0420036 0517563 0614546 04241057 1122040 12061385 1128982 1130468 0628849 1211925
CAAGTTCCACCATCAGCACC ACTCATCTAGGCATTTTCAGTG TTTCTTCAGGACCATCTCAC GTACGCAACGTGTACGCAAC GCCCATGCCGACACATAACT CAGCCCATGCCGACACATAA TAATCAGCCCATGCCGACAC AGCCCATGCCGACACATAAC ATGCCGACACATAACTGTGG GGTGTCATGCCTTTGGTATC TCAGCTATGGCCGTCAGAGG CATCTCGATGGGTTAGTGAC ACGCATATCACCTCCGATAG ATTGAACCATGCTTGGAACT TTGTAGCTGGACTTACAGTT GGACGAGGAATCTACTATGG ATGCGTATCACCTCCATTAG
All All Rhinolophus sinicus (2) R. macrotis (1), R. sinicus (1), R. sinicus (3) R. ferrumequinum (1), R. thomasi R. pusillus (1), R. rex (1), R. affinis (1) R.affinis (2), R. sp (2) R. rex (2) R. macrotis (2), R. macrotis (3) R. pusillus (2), R. pusillus (3), R. pusillus (4) R. pusillus (6), R. pusillus (8) R. pusillus (7), R. pusillus (9) R. pusillus (5), R. pusillus (16) R. marshalli R. sp (1) R. macrotis (4) R. ferrumequinum (2), R. ferrumequinum (3) R. pusillus (11), R. pusillus (12), R. pusillus (13) R. pusillus (15) Hipposideros armiger, H. pratti
DNA sequence analysis Sequences were aligned using ClustalX ver. 1.8 (Thompson et al. 1997) with the published sequences of R. cornutus pumilus (AB061526) and R. monoceros (AF406806), then carefully examined and edited manually. The base composition, nucleotide variation, and corrected genetic distance were calculated. The base frequency stationarity was evaluated by a w2 test implemented in PAUP* 4.0 (Swofford 2002). Saturation was explored for the CR sequence by plotting the pair-wise value of corrected genetic distances against the pair-wise number of the inferred substitutions. The CR domains and elements were demarcated and identified on the basis of data from mammals (Saccone et al. 1987; Sbisa` et al. 1997; Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Ketmaier and Bernardini 2005; Iyengar et al. 2006). Phylogenetic reconstructions were performed with the maximum parsimony (MP) and maximum likelihood (ML) methods, implemented in PAUP* and PHYML v2.4.4 (Guindon and Gascuel 2003). The most parsimonious tree was estimated through a heuristic search with 100 random additions of taxa, and complete treebisection-reconnection branch swapping for each iteration with equally weighted characters. Gaps were treated as the fifth character state. Reliability of nodes was assessed with non-parametric bootstraps (Felsenstein 1985). One thousand bootstraps were generated, each with 20 stepwise random additions and complete treebisection-reconnection branch swapping. In the PHYML procedure, the starting tree was obtained with BIONJ (Gascuel 1997). The model of DNA substitution that best fitted the data was estimated using the
Akaike Information Criterion (AIC) in the program MODELTEST v3.06 (Posada and Crandall 1998). HKY+G+I model of evolution was selected, which allowed rate variation among sites and included a proportion of invariable sites. The parameters were estimated and optimized during the search (transition/ transversion ¼ 8.880, G ¼ 0.659, I ¼ 0.308). Node support was assessed with 500 bootstrap replicates. Nodes that received X70% bootstrap support were considered well supported. Additional phylogenetic analyses were implemented using sequences for R. arcuatus (AF065091), R. euryotis (AF065089), R. megaphyllus (AF065088), R. euryale (AY923062), R. sedulus (U95336), R. clivosus (U95339), R. hipposideros (DQ297610), R. philippinensis (1) (AY568638), R. philippinensis (2) (AY568642), R. philippinensis (3) (AY568646), R. cornutus (1) (DQ297617), R. cornutus (2) (DQ297621), R. monoceros (1) (DQ297604), R. monoceros (2) (DQ297605), R. monoceros (3) (DQ314619), R. monoceros (4) (DQ314624), R. monoceros (5) (DQ314634), R. monoceros (6) (DQ314654), R. monoceros (7) (DQ314657), R. monoceros (8) (DQ314664), R. monoceros (9) (DQ314677), R. monoceros (10) (DQ314686), R. monoceros (11) (DQ314688), R. monoceros (12) (DQ314697), R. monoceros (13) (DQ314698), R. monoceros (14) (DQ314703), R. monoceros (15) (DQ314709), R. monoceros (16) (DQ314710) and R. monoceros (17) (DQ314719) from GenBank. In this case, only 430 bases were successfully used, since stretches of the sequences that could not be satisfactorily aligned had to be deleted. Once again, both MP and ML approaches were used. The HKY+G+I model of evolution was selected by hierarchical likelihood-ratio test (hLRT) implemented in MODELTEST
ARTICLE IN PRESS 134
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
v3.06. The parameters were estimated and optimized during the search (transition/transversion ¼ 7.571, G ¼ 0.543, I ¼ 0.221). Tree search and bootstrapping were performed as described above. To test whether the mtDNA data were consistent with monophyly of each of the R. pusillus populations, we employed the Templeton test (Templeton, 1983) to evaluate MP trees obtained with and without topological constraint and employed the Shimodaira-Hasegawa test (S-H, Shimodaira and Hasegawa 1999) using 1000 RELL bootstraps replicates to evaluate unconstrained and constrained ML trees. The complete CR sequences, excluding the repeats and CR 50 variable sequences, were used to construct the constrained MP and ML trees using the above evolutional models. Both the Templeton and S-H tests were implemented in PAUP*.
Results Control region structure and length variation The CR of horseshoe bats flanked by tRNAPro and tRNAPhe was subdivided into the ETAS domain, CD, and CSB domain according to previous surveys in mammals (Figs. 1 and 2). In the ETAS domain, three conserved blocks were found: ETAS1, ETAS2 and ETAS2-like. The ETAS1 and ETAS2-like elements were found to be contiguous, with only one nucleotide separating the two elements (Fig. 2). The putative point of arrest of CR synthesis is proposed to be an ACCCC element within ETAS1 in rhinolophids (Fig. 2). Furthermore, only in R. pusillus (16) were long tandem repeats found (Figs. 1 and 2, Table 3). In the CD, five conserved blocks (F, E, D, C and B boxes) were clearly identified (Fig. 2). In the CSB domain, four conserved blocks, CSB1, CSB2, CSB3 and CSB1-like, and short tandem repeats were identified (Figs. 1 and 2, Table 3). This CSB1-like element was located upstream of the CSB1 element, originating from 40 to 46 bp downstream of the CD. After all repeats were excluded, the degree of nucleotide variation was variable among different domains and elements in the CR of horseshoe bats (Figs. 2 and 3). The most highly variable domain
was the CSB domain, with 62.8% variable sites (including indels), followed by the ETAS domain (51.1%) (Fig. 3). The CD was the most conserved domain (15.1% variability). In the ETAS domain, the degree of variation of the ETAS1 sequence (44.3%) was higher than that of ETAS2 (26.7%), whereas the ETAS2-like sequence was the most highly variable, with 19 conserved in 61 alignment positions. The consensus of the ETAS2-like sequence showed 39.3% dissimilarity with the consensus ETAS1 of horseshoe bats. In the CSB domain, the degree of variability of the CSB1 element (24%) was higher than that of the CSB2 element (11.8%). The CSB3 element was most conserved and no variable position was detected. The CSB1-like element was less conserved than the CSB1, with 40% variable sites. The consensus CSB1-like sequence showed 16% dissimilarity with the CSB1 for horseshoe bats. For 37 specimens of 12 species examined, CR length ranged from 1335 bp (R. pusillus (13)) to 1514 bp (R. pusillus (16)). All individuals showed different lengths of CR sequences. The CR length heterogeneity could be ascribed to the two peripheral ETAS (349–508 bp) and CSB (668–812 bp) domains. The variable length of the CD was only two bases (316–318 bp). After excluding the long tandem repeats, the variable length of the ETAS domain was only five bases (350–354 bp). The short tandem repeats in the CSB domain also led to the length variation (Table 1, Fig. 2). Without these short repeats, the length of the CSB domain reduced to 527–605 bp.
Base composition heterogeneity Regardless of whether or not the repeats were considered, the base compositions of the CR and its three domains did not vary significantly among 12 Rhinolophus species (w2 test, p40.05). In the 3 domains of the CR, all species showed similarly biased base composition: A4T4C4G in the ETAS domain, T4C4A4G in the CD, and A4C4T 4G in the CSB domain (Table 4). The horseshoe bats followed the general mammalian mitochondrial CR pattern of A+T4C+G in all domains (Sbisa` et al. 1997). In the CR and three domains of all individuals, G content was the lowest, but it was higher in the CD than in the two peripheral domains (Table 4), which was in agreement with previous observations in other mammals.
Fig. 1. Schematic diagram of the mitochondrial CR of rhinolophid bats. Locations of RS1, ETAS1, ETAS2 and ETAS2-like elements within the ETAS domain, conserved boxes, F, E, D, C and B within the central domain, and CSB1-like, CSB1, CSB2, CSB3 and RS2 elements within the CSB domain are shown. (n) indicates that the copy number of RS2 is variable.
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
135
Fig. 2. Alignment of the CR sequences (excluding repeated sequences) of 12 Rhinolophus species. The three domains (ETAS, CD, and CSB) are shown. ETAS1, ETAS2 and ETAS2-like elements within the ETAS domain, conserved boxes F-B within the CD, CSB1-like, CSB1, CSB2 and CSB3 elements within the CSB domain are highlighted. The putative point of arrest of replication (/stopS) is indicated. The location of arrows in the CSB domain indicates where short tandem repeats are inserted. The repeated motifs are summarized in Table 3.
Tandem repeats The long repeated motif (79 bp) including the ETAS1 and partial ETAS2-like elements was only examined in the ETAS domain of R. pusillus (16), with a copy number of 3 (Tables 1 and 3, Figs. 1 and 2). Short
repeated motifs with a length of 11 bp (all taxa excluding R. pearsoni) or 13 bp (R. pearsoni) were identified between the CSB1 and CSB2 elements. There was a clear difference in the copy number of short repeats at the intraspecific and interspecific levels (Table 1). The arrangements of short repeats were variable even though
ARTICLE IN PRESS 136
Table 3.
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
The types of repeated motifs of horseshoe bats in the study and their distribution among the samples
Repeated motifs (RS1)
Species
Aacgtatacgc ¼ A - - - -c- - - - - - ¼ B Cgtatacgcaa ¼ C - - -g- - - - - - - ¼ D - - -g- - - - - -g ¼ E tgtacgcaacg ¼ F- - - - - - - -g- - ¼ G -a- - - - - - - - - ¼ H ca- - - - - - - - - ¼ I ta- - - - - - - - - ¼ J atacgcaacgc ¼ K acgcaacgtgt ¼ L tacacacagcg ¼ M- - - - -g- - - - - ¼ N - - - - - - -t- - - ¼ O - - - - -g- - - -a- - ¼ P- - -g- - - - - - - ¼ Q gcaacgcatacac ¼ R
Rhinolophus sinicus (1), R. sinicus (2), R. sinicus (3) R. sinicus (1) R. affinis (1), R. affinis (2), R. macrotis (1), R. macrotis (2), R. macrotis (3) R. macrotis (1), R. macrotis (2), R. macrotis (3) R. macrotis (1) R. macrotis (4) R. marshalli R. thomasi R. R. R. R. R. R.
ferrumequinum (1), R. ferrumequinum (2), R. ferrumequinum (3) rex (1), R. rex (2), R. sp (1), R. sp (2) pusillus (1)-R. pusillus (16), R. c. pumilus, R. monoceros pusillus (6) monoceros pearsoni
Repeated motif (RS2) R. pusillus (16) tagtacatattatgtataattatacattaatgatttaccccatgcatataagcaagtacaataaaattataacagtaca Dashes indicate nucleotide identity; the first sequence is the consensus sequence.
Fig. 3. Distribution and frequency of variable nucleotides (including indels) across the mitochondrial CR of 37 individuals of 12 Rhinolophus species. The long and short repeated sequences in ETAS and CSB domains were excluded from the multiple alignment of the CR sequences.
the repeated motif and copy number were identical among individuals (data not shown). Short repeats were always found to be based on a core motif of ACGC. Different arrays have resulted from the differential repetition of a single or several elements; nucleotide substitutions among different variants have arisen by a mechanism of insertion/deletion and transitions. In our study, transitions of A and G, C and T were observed, but no transversion was observed within an individual horseshoe bat (Table 3).
Phylogenetic reconstruction To rule out the possibility that atypical evolution of the tandem repeats could lead to biased results, phylogenetic analyses were performed on the complete
CR sequence alignment excluding the repeats (1342 bp). However, to keep datasets more tractable, only sequences differing by more than 1% were used in the final analyses. Additional phylogenetic analyses were carried out using CR 50 variable sequence alignment (430 bp) and more Rhinolophus species from GenBank. Of the 1342 and 430 nucleotide alignment positions, 650 and 236 were variable sites, respectively. Base frequencies did not deviate from stationarity among all individuals (1342 bp: w2 ¼ 48.35, df ¼ 87, p ¼ 0.9997; 430 bp: w2 ¼ 53.71, df ¼ 174, p ¼ 1.0). Numbers of transitions and transversions when plotted against HKY+G+I distances suggested a lack of extensive saturation for the above two data sets (data not shown). Tree topologies obtained using ML and MP methods were similar except for several positions with low bootstrap supports (o70%), regardless of whether they were based on the 1342 bp alignment of 12 Rhinolophus species (Fig. 4) or the 430 bp alignment of 20 Rhinolophus species (Fig. 5). All trees showed the monophyly of horseshoe bats (Figs. 4 and 5, bootstrap values: 100%). Rhinolophus pusillus, R. monoceros and R. c. pumilus of the pusillus-group formed a monophyletic clade (Fig. 4) and interspecific HKY+G+I distances among them were very low, ranging from 3.7% to 7.4% (Appendix I). In Fig. 5, R. pusillus, R. monoceros, R. cornutus and R. c. pumilus also formed a monophyletic group, and the interspecific HKY+G+I distances among them ranged from 5.2% to 11.1% (Appendix II). Within R. pusillus, the HKY+G+I distances were 1.2–5.2% (1342 bp) and 4.5–12.1% (430 bp), respectively (Appendices I and II). Within R. monoceros, the maximum distance was 3.5%
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
Table 4.
Base composition of the CR, and respective domains of 12 Rhinolophus species
Control regiona Control regionb ETASa ETASb CD CSBa CSBb a
137
A (%)
C (%)
G (%)
T (%)
w2
df
p
31.970.753 31.770.533 35.970.994 35.870.950 24.370.187 33.271.232 33.370.990
27.170.603 26.370.527 23.270.816 23.370.759 26.370.406 29.470.953 28.270.950
16.570.677 15.870.520 12.070.891 12.070.881 21.470.211 16.771.182 14.970.896
24.470.667 26.370.669 28.970.878 28.870.872 28.070.317 20.770.997 23.671.277
73.3 48.1 41.6 34.6 2.4 93.2 71.4
108 108 108 108 108 108 108
0.996 1.000 1.000 1.000 1.000 0.845 0.997
Including repeats. Excluding repeats.
b
Fig. 4. The maximum-parsimony (MP) and the maximum-likelihood (ML) trees (ln L ¼ 9189.66964) of 30 individuals of 14 bat species based on mitochondrial CR sequences without repeats. In this analysis, only sequences differing by more than 1% were used to construct the phylogenetic tree. Each geometric shape represents the specimen of Rhinolophus pusillus sampled from a different region, as follows: white circles, Jiangxi Province; dark circles, Yunnan Province; white triangles, Chongqing City; dark triangles, Guangdong Province. The MP tree (B) was constructed using the gap as the fifth character site. MP and ML bootstrap values (450%) are shown above nodes.
for the 430 bp alignment (Appendix II). Rhinolophus pusillus and R. monoceros formed a reciprocal monophyly group (Fig. 5), but R. pusillus from the same population did not cluster together with low bootstrap supports (Figs. 4 and 5). Tree topologies forcing the monophyly of each of R. pusillus populations were significantly worse than the optimal trees obtained in Figs. 4 and 5 (Templeton and S-H tests, po0.05). An unidentified species R. sp and 3 species of the philippinensis-group (R. macrotis, R. rex and R. marshalli)
composed a monophyletic group (Figs. 4 and 5), but the relationships among 4 species were not well resolved. The genetic distances (1342 bp: 6.7–8.5%; 430 bp: 9.8–13.0%) between R. sp and 3 species of the philippinensis-group were similar to those (1342 bp: 7.0–9.3%; 430 bp: 9.7–13.2%) among 3 species of the philippinensis-group (Appendices I and II). Rhinolophus sinicus and R. thomasi of the rouxi-group formed a sister species (BP: 100%), with 6.9–7.5% divergence (1342 bp) and 9.2–10.6% divergence (430 bp) (Appendices I and
ARTICLE IN PRESS 138
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
Fig. 5. Phylogenetic tree of 59 individuals from 22 species based on the mitochondrial CR 50 sequences using maximum likelihood (ML) by PHYML program. In this analysis, the sequences in Fig. 4 and more sequences available from GenBank were used to construct the phylogenetic tree. Each geometric shape represents the specimen of Rhinolophus pusillus sampled from a different region, as in Fig. 4. The bootstrap values at the nodes of 450% are shown. The differences between the maximum-parsimony (MP) tree (not shown) and ML tree (ln L ¼ 4821.00865) are indicated with light lines, which had low bootstrap supports (o70%).
II). These two species formed a monophyletic clade (BP: 100%) with R. affinis of the megaphyllus-group (Figs. 4 and 5). From Fig. 5, additional information is also shown: R. affinis of the megaphyllus-group and R. arcuatus and R. euryotis of the euryotis-group formed a clade (100%), and R. euryale of the euryale-group and R. ferrumequinum of the ferrumequinum-group clustered together (93%).
Discussion Organization of the CR in horseshoe bats The CR of horseshoe bats followed the general structure previously described in mammals (e.g., Brown
et al. 1986; Sbisa` et al. 1997; Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003). The presence of conserved regions, base composition, and frequency of variable nucleotides, all supported the separation of the CR sequence into three characteristic domains, ETAS, Central, and CSB, in horseshoe bats (Figs. 1 and 2, Table 4). The ETAS and CSB domains were found to be highly variable, with the CD being highly conserved (Figs. 1 and 2). Within the three conserved elements identified in the ETAS, the ETAS1 element may contain recognition signals for the termination of the nascent DNA or RNA, whereas the ETAS2 was proposed to bind termination factors (Sbisa` et al. 1997). A recent survey carried out in rodents showed that only ETAS1 was present in all species while ETAS2 was not always present (Larizza et al. 2002). In horseshoe bats, these two elements were both present, and ETAS1 was more variable than ETAS2 (44.3% and 26.7% variable sites, respectively). Nevertheless, a higher degree of conservation within ETAS1 was found in rodents and oryx, which indicated that ETAS1 might be functionally more important in mtDNA replication than ETAS2 (Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Iyengar et al. 2006). The higher degree of conservation within ETAS2 in horseshoe bats suggested that ETAS2 could play a critical role in mtDNA replication or showed a species-specific evolutionary pattern. Within ETAS1, the putative point of arrest of D-loop synthesis was proposed to be an ACCCC element in rhinolophids, but was proposed to be a TCCCC element in pig and oryx (Douzery and Randi 1997; Iyengar et al. 2006), and a GCCCC element in cow and cervids (Douzery and Randi 1997). An ETAS2-like element has not been described in a range of species of mammals (Sbisa` et al. 1997; Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Kierstein et al. 2004; Iyengar et al. 2006). The relatively low degree of dissimilarity with ETAS2 (39.3%) suggested that they could have been derived from this element by a slippage event. The ETAS2-like element was present in all of the examined horseshoe bats and was highly variable, which suggested a single slippage event after speciation. Additionally, an ETAS1like element in the ETAS domain has been reported in Spalax ehrenbergi superspecies (Reyes et al., 2003), but it was not found in horseshoe bats. The degree of variation of the most conserved domain, CD, was 15.1%, which is almost the same level of variability found in mitochondrial rRNA genes in several mammalian groups (Pesole et al. 1999). The biological role of CD is still unknown, but it is known that it could contain specific sequences capable of binding mitochondria-associated cytoskeletal elements (Jackson et al. 1996). F, E, D, C and B boxes were identified within the CD of horseshoe bats, which were previously reported in some other mammals (e.g. bovids
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
and cervids (Douzery and Randi 1997), Crocodylidae (Ray and Densmore 2003), Eurasian otter (Ketmaier and Bernardini 2005; Pe´rez-Haro et al. 2005), and oryx (Iyengar et al. 2006), but their function remains unclear. Within the CSB domain, 4 conserved elements were identified in the horseshoe bats. Sbisa` et al. (1997) suggested that CSB1 was present in all species and was functionally the most important block, albeit the least observed block (Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003), which was consistent with that observed in rhinolophids. However, CSB2 and CSB3 were sometimes missing, or were only partial present (Gemmell et al. 1996; Sbisa` et al. 1997). In horseshoe bats, these two elements were also present, and CSB3 was the most conserved. A CSB1-like element identified further upstream of the CSB1 element (Figs. 1 and 2) showed a low level, of variability with CSB1 (16%) in the CSB domain. It has been suggested that DNA/RNA transitions in this region may facilitate the occurrence of slippage events (Larizza et al. 2002). However, the location of the CSB1-like element and the level of sequence conservation with the CSB1 element were different to those observed in other animal groups. For instance, this element was downstream of the CSB1 element in the CSB domain (and more conserved than CSB1) in oryx (Iyengar et al. 2006), while it was in the ETAS domain in red backed voles (Matson and Baker 2001) and subterranean mole rats (Reyes et al., 2003), with a higher and lower conserved levels than that of the CSB1 element, respectively. The mechanism underlying this difference remains obscure. The CR length heterogeneity in horseshoe bats could be ascribed to the presence of repeated sequences and indels (Fig. 2). CR size differences within the same genus and also within the same subspecies have been previously reported (Sbisa` et al. 1997; Larizza et al. 2002). In this study, the long repeated motif (79 bp) was only detected within the ETAS domain of R. pusillus (16) (Fig. 1, Table 3). Wilkinson et al. (1997) did not find the long repeated sequences in the ETAS domain of 4 Rhinolophus species, but found the long repeated motif (81 bp) in the vespertilionid bats which showed below 50% similarity with our study (data not shown). Short tandem repeats identified between CSB1 and CSB2 have been described in many mammalian species (Gemmell et al. 1996; Sbisa` et al. 1997; Larizza et al. 2002; Pe´rezHaro et al. 2005), but the length, base composition and copy number were variable, even within the same species, such as R. pusillus (Tables 1 and 3). The formation of these repeats was likely to be caused by replication slippage (Levinson and Gutman 1987; Madsen et al. 1993). In all the bats examined, the substitution of repeated motifs was caused by transition, which was in agreement with findings in the Eurasian Otter (Ketmaier and Bernardini 2005).
139
Phylogenetic implications of the CR Our phylogenetic analyses based on the CR gene confirmed the monophyletic group of horseshoe bats, which was in agreement with previous surveys on morphological characters and mitochondrial Cyt b gene (Bogdanowicz and Owen, 1992; Wang et al., 2003). The molecular phylogenetic relationships among some Rhinolophus species conflicted with those of reported based on the phenetic analyses (Bogdanowicz, 1992; Bogdanowicz and Owen, 1992). Bats of the genus Rhinolophus have been classically subdivided into approximately 15 groups (Csorba et al., 2003), each of which comprise many species with similar morphological and ecological adaptations. However, the phylogenetic analyses in this study show that species from the same group did not always cluster together (Figs. 4 and 5). In other words, the classification by external characteristics could not completely reflect the phylogenetic relationships. Guille´n-Servent et al. (2003) proposed a new arrangement of taxa based on the phylogeny of two thirds species of Rhinolophidae, which differed from that of Bogdanowicz (1992) and Bogdanowicz and Owen (1992). In this study, the phylogenetic relationships among Rhinolophus species based on the CR gene were similar to those of Guille´n-Servent et al. (2003), although fewer species were included in our research. Each of our trees showed that R. pusillus, R. monoceros and R. cornutus (including R. c. pumilus) formed a monophyletic clade (Figs. 4 and 5). Data from the mtDNA CR also support the close genetic similarity of these three species, and the partial values of interspecific divergence (1342 bp: 3.7–7.4%; 430 bp: 5.2–11.1%) among them were at the level of intraspecific variation within R. pusillus (1342 bp: 1.2–5.2%; 430 bp: 4.5–12.1%) (Appendices I and II), which suggested that these three species might have a recent common ancestor. This result was consistent with the results of Li et al. (2006). Reciprocal monophyly of R. pusillus and R. monoceros (Fig. 5) showed that R. monoceros may be or may be not a true species. The only way to test that hypothesis would be to hybridize R. monoceros and R. pusillus. However, these two species are allopatric and spatially separated; whether they would hybridize could not be proven. The data presented here neither supports nor contradicts the hypothesis that R. pusillus and R. monoceros are separate species that diverged relatively recently. Sequencing of their genomic, rather than mitochondrial, DNA might help resolve their evolutionary relationship. Rhinolophus monoceros however, could be a nascent species. Furthermore, the minimum interspecific divergence (4.5% for the 430 bp alignment) between R. monoceros and R. pusillus was higher than the maximum intraspecific divergence (3.5% for the 430 bp alignment) within R. monoceros (Appendix II), which indicated that the divergent time
ARTICLE IN PRESS 140
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
between R. monoceros and R. pusillus was above the R. monoceros population expansion time estimated by Chen et al. (2006), and also suggested that R. monoceros might have diverged recently. Additionally, our results revealed incongruence between the phylogeny and geography of the R. pusillus samples (Figs. 4 and 5) because the constrained monophyly of each of the R. pusillus populations were rejected (Templeton and S-H tests, po0.05). The incongruence indicated that there has been gene flow over these geographic populations of R. pusillus used in this study. Further research on the population genetic structure and evolutionary history using more representative samples is necessary. The molecular data for R. rex and R. sinicus in our results were not obtained by Guille´n-Servent et al. (2003). But Wang et al. (2003) sequenced the partial Cyt b sequence of R. rex, and suggested that this species was a sister species of R. macrotis. Our phylogenetic results showed that the molecular phylogenetic positions of R. rex and R. sinicus were consistent with the putative positions determined by Guille´n-Servent et al. (2003). Rhinolophus rex clustered together with R. macrotis and R. marshalli with similar morphology. Rhinolophus sinicus was originally designated as a subspecies of R. rouxii (Andersen, 1905a), it was promoted as a distinct species as a result of phenetic analysis and DNA techniques (Thomas 1997), and its external characteristics are similar to those of R. thomasi (Csorba et al., 2003). Our molecular trees and low interspecific genetic divergences (1342 bp: 6.9–7.5%; 430 bp: 9.2–10.6%) (Appendices I and II) showed that these two species, R. sinicus and R. thomasi were sister species (Figs. 4 and 5). Furthermore, the unidentified species R. sp was similar to R. lepidus of the pusillus-group due to their similar morphological characteristics. However, we
could not correctly identify this species due to the small sample sizes (n ¼ 2) and lack of cranial measurements. Rhinolophus sp clustered in a monophyletic clade and had close genetic distances (1342 bp: 6.7–8.5%; 430 bp: 9.8–13.0%) with 3 species of the philippinensis-group R. macrotis, R. marshalli and R. rex (Figs. 4 and 5, Appendices I and II). From external characteristics, R. sp was completely different from the bats of the philippinensis-group, because the former had obviously smaller ears (R. sp: length, approximately 14.26 mm (in this study); philippinensis-group: length 18.5–35 mm (Csorba et al., 2003)) but higher echolocation call frequency than the latter (R. sp: 91 kHz; philippinensisgroup:o60 kHz (in this study)). Both the phylogenetic positions of R. sp and the close genetic distances between R. sp and 3 species of the philippinensis-group might have resulted from recent divergence (Mayer and von Helversen, 2001) and morphologically independent evolution through some deterministic processes (Losos et al. 1998; Ruedi and Mayer 2001).
Acknowledgements We are grateful to Professor B. Liu in China for his advice on the analysis and manuscript. We thank the anonymous reviewers and the editor-in-chief for very helpful and detailed comments on our manuscript. This study was financed by the National Natural Science Foundation of China (Grant No. 30570311, 30770361), Scientific Research Foundation for the Returned Overseas Chinese Scholars of Ministry of Education and Doctoral Foundation of Ministry of Education (20060200007).
Appendices Appendix I. HKY+G+I genetic distance measures based on the complete CR sequences alignment without tandem repeats (1342 bp) between bats shown in the phylogenetic tree (Fig. 4)
ARTICLE IN PRESS
K. Sun et al. / Mamm. biol. 74 (2009) 130–144 141
HKY+G+I genetic distance measures based on the CR 50 variable sequence alignment (430 bp) between bats shown in the phylogenetic tree (Fig. 5)
142
Appendix II.
ARTICLE IN PRESS
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
References Andersen, K., 1905a. A list of the species and subspecies of the genus Rhinolophus, with some notes on their geographical distribution. Ann. Mag. Nat. Hist. 7, 648–662. Andersen, K., 1905b. On some bats of the genus Rhinolophus, with remarks on their mutual affinities, and descriptions of twenty-six new forms. Proc. Zool. Soc. (London) 2, 75–145. Andersen, K., 1918. Diagnoses of new bats of the families Rhinolophidae and Megadermatidae. Ann. Mag. Nat. Hist. 9, 374–384. Armstrong, K.N., 2006. Phylogeographic structure in Rhinonicteris aurantia (Chiroptera: Hipposideridae): implications for conservation. Acta Chiropterol. 8, 63–81. Baker, A.J., Marshall, H.D., 1997. Mitochondrial control region sequences as tools for understanding evolution. In: Mindell, D.P. (Ed.), Avian Molecular Evolution and Systematics. Academic Press, San Diego, CA, pp. 51–79. Bogdanowicz, W., 1992. Phenetic relationships among bats of the family Rhinolophidae. Acta Theriol. 37, 213–240. Bogdanowicz, W., Owen, R.D., 1992. Phylogenetic analyses of the bat family Rhinolophidae. Zeitschrift fu¨r zoologische Systematik und Evolutionsforschung 30, 142–160. Brown, G.G., Gadaleta, G., Pepe, G., Saccone, C., Sbisa, E., 1986. Structural conservation and variation in the D-loopcontaining region of vertebrate mitochondrial DNA. J. Mol. Biol. 192, 503–511. Chen, S.F., Rossiter, S.J., Faulkes, C.G., Jones, G., 2006. Population genetic structure and demographic history of the endemic Formosan lesser horseshoe bat (Rhinolophus monoceros). Mol. Ecol. 15, 1643–1656. Cooper, S.J.B., Reardon, T.B., Skilins, J., 1998. Molecular systematics of Australian rhinolophid bats (Chiroptera: Rhinolophidae). Aust. J. Zool. 46, 203–220. Csorba, G., Ujhelyi, P., Thomas, N., 2003. Horseshoe Bats of the World (Chiroptera: Rhinolophidae). Alana Books, Shropshire. Doda, J.N., Wright, C.T., Clayton, D.A., 1981. Elongation of displacement-loop strands in human and mouse mitochondrial DNA is arrested near specific template sequences. Proc. Natl. Acad. Sci. USA 78, 6116–6120. Douzery, E., Randi, E., 1997. The mitochondrial control region of Cervidae: evolutionary patterns and phylogenetic content. Mol. Biol. Evol. 14, 1154–1166. Ellerman, J.R., Morrison-Scott, T.C.S., 1951. Checklist of Palaearctic and Indian Mammals. British Museum (Natural History), London. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Fumagalli, L., Taberlet, P., Favre, L., Hausser, J., 1996. Origin and evolution of homologous repeated sequences in the mitochondrial DNA control region of shrews. Mol. Biol. Evol. 13, 31–46. Gascuel, O., 1997. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Mol. Biol. Evol. 14, 685–695. Gemmell, N.J., Western, P.S., Watson, J.M., Graves, J.A., 1996. Evolution of the mammalian mitochondrial control region–comparisons of control region sequences between
143
monotreme and therian mammals. Mol. Biol. Evol. 13, 798–808. Guille´n-Servent, A., Francis, C.M., Ricklefs, R.E., 2003. Phylogeny and biogeography of the horseshoe bats. In: Csorba, G., Ujhelyi, P., Thomas, N. (Eds.), Horseshoe Bats of The World. Alana Books, Bishop’s Castle, United Kingdom, pp. xii–xxiv. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704. Hill, J.E., 1992. Order Chiroptera. In: Corbet, G.B., Hill, J.E. (Eds.), The Mammals of The Indomalayan Region: A Systematic Review. Natural History Museum Publications and Oxford University Press, New York, pp. 54–161. Hill, J.E., Yoshiyuki, M., 1980. A new species of Rhinolophus (Chiroptera, Rhinolophidae) from Iriomote Island, Ryukyu Islands, with notes on the Asiatic members of the Rhinolophus pusillus group. Bulletin of National Science Museum 6, 179–189. Hoelzel, A.R., Lopez, J.V., Dover, G.A., O’Brien, S.J., 1994. Rapid evolution of a heteroplasmic repetitive sequence in the mitochondrial DNA control region of carnivores. J. Mol. Evol. 39, 191–199. Iyengar, A., Diniz, F.M., Gilbert, T., Woodfine, T., Knowles, J., Maclean, N., 2006. Structure and evolution of the mitochondrial control region in oryx. Mol. Phylogenet. Evol. 40, 305–314. Jackson, D.A., Bartlett, J., Cook, P.R., 1996. Sequences attaching loops of nuclear and mitochondrial DNA to underlying structures in human cells: the role of transcription units. Nucleic. Acids. Res. 24, 1212–1219. Juste, J., Ibanez, C., Munoz, J., Trujillo, D., Benda, P., Karatas, A., Ruedi, M., 2004. Mitochondrial phylogeography of the long-eared bats (Plecotus) in the Mediterranean Palaearctic and Atlantic Islands. Mol. Phylogenet. Evol. 31, 1114–1126. Ketmaier, V., Bernardini, C., 2005. Structure of the mitochondrial control region of the Eurasian otter (Lutra lutra; Carnivora, Mustelidae): patterns of genetic heterogeneity and implications for conservation of the species in Italy. J. Hered. 96, 318–328. Kierstein, G., Vallinoto, M., Silva, A., Schneider, M.P., Iannuzzi, L., Brenig, B., 2004. Analysis of mitochondrial D-loop region casts new light on domestic water buffalo (Bubalus bubalis) phylogeny. Mol. Phylogenet. Evol. 30, 308–324. Koopman, K.F., 1975. Bats of the Sudan. B. Am. Mus. of Nat. Hist. 154, 355–443. Larizza, A., Pesole, G., Reyes, A., Sbisa, E., Saccone, C., 2002. Lineage specificity of the evolutionary dynamics of the mtDNA D-Loop region in rodents. J. Mol. Evol. 54, 145–155. Lee, W.J., Conroy, J., Howell, W.H., Kocher, T.D., 1995. Structure and evolution of teleost mitochondrial control regions. J. Mol. Evol. 41, 54–66. Levinson, G., Gutman, G.A., 1987. Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol. Biol. Evol. 4, 203–221. Li, G., Jones, G., Rossiter, S.J., Chen, S.F., Parsons, S., Zhang, S.Y., 2006. Phylogenetics of small horseshoe bats
ARTICLE IN PRESS 144
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
from East Asia based on mitochondrial DNA sequence variation. J. Mammal. 87, 1234–1240. Losos, J.B., Jackman, T.R., Larson, A., Queiroz, K., Rodriguez-Schettino, L., 1998. Contingency and determinism in replicated adaptive radiations of island lizards. Science 279, 2115–2118. Madsen, C.S., Ghivizzani, S.C., Hauswirth, W.W., 1993. In vivo and in vitro evidence for slipped mispairing in mammalian mitochondria. Proc. Natl. Acad. Sci. USA 90, 7671–7675. Matson, C.W., Baker, R.J., 2001. DNA sequence variation in the mitochondrial control region of red-backed voles (Clethrionomys). Mol. Biol. Evol. 18, 1494–1501. Mayer, F., von Helversen, O., 2001. Cryptic diversity in European bats. Proc. Biol. Sci. 268, 1825–1832. Pe´rez-Haro, M., Vin˜as, J., Man˜as, F., Batet, A., Ruiz-Olmo, J., Pla, C., 2005. Genetic variability in the complete mitochondrial control region of the Eurasian otter (Lutra lutra) in the Iberian Peninsula. Biol. J. Linn. Soc. 86, 397–403. Pesole, G., Gissi, C., De Chirico, A., Saccone, C., 1999. Nucleotide substitution rate of mammalian mitochondrial genomes. J. Mol. Evol. 48, 427–434. Petri, B., von Haeseler, A., Paabo, S., 1996. Extreme sequence heteroplasmy in bat mitochondrial DNA. Biol. Chem. 377, 661–667. Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14, 817–818. Ray, D.A., Densmore, L.D., 2003. Repetitive sequences in the crocodilian mitochondrial control region: poly-A sequences and heteroplasmic tandem repeats. Mol. Biol. Evol. 20, 1006–1013. Reyes, A., Nevo, E., Saccone, C., 2003. DNA sequence variation in the mitochondrial control region of subterranean mole rats, Spalax ehrenbergi superspecies, in Israel. Mol. Biol. Evol. 20, 622–632. Ruedi, M., Castella, V., 2003. Genetic consequences of the ice ages on nurseries of the bat Myotis myotis: a mitochondrial and nuclear survey. Mol. Ecol. 12, 1527–1540. Ruedi, M., Mayer, F., 2001. Molecular systematics of bats of the genus Myotis (Vespertilionidae) suggests deterministic ecomorphological convergences. Mol. Phylogenet. Evol. 21, 436–448. Saccone, C., Attimonelli, M., Sbisa, E., 1987. Structural elements highly preserved during the evolution of the Dloop-containing region in vertebrate mitochondrial DNA. J. Mol. Evol. 26, 205–211. Sakai, T., Kikkawa, Y., Tsuchiya, K., Harada, M., Kanoe, M., Yoshiyuki, M., Yonekawa, H., 2003. Molecular phylogeny of Japanese Rhinolophidae based on variations in the complete sequence of the mitochondrial cytochrome b gene. Genes Genet. Syst. 78, 179–189. Salgueiro, P., Coelho, M.M., Palmeirim, J.M., Ruedi, M., 2004. Mitochondrial DNA variation and population structure of the island endemic Azorean bat (Nyctalus azoreum). Mol. Ecol. 13, 3357–3366. Sbisa`, E., Tanzariello, F., Reyes, A., Pesole, G., Saccone, C., 1997. Mammalian mitochondrial D-loop region structural analysis: identification of new conserved sequences and their functional and evolutionary implications. Gene 205, 125–140.
Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116. Simmons, N.B., 2005. Order Chiroptera. In: Wilson, D.E., Reeder, D.M. (Eds.), Mammal Species of the World: A Taxonomic and Geographical Reference, third ed. The Johns Hopkins University Press, Baltimore, pp. 312–529. Swofford, D.L., 2002. PAUP* 4.0. Phylogenetic analysis using parsimony (*and other methods). Beta version 4.0b4a. Sinauer Associates, Inc., Publishers, Sunderland, Massachusetts. Tate, G.H.H., 1943. Results of the Archbold expeditions. No. 49. Further notes on the Rhinolophus phylippinensis group (Chiroptera). Am. Mus. Novit. 1219, 1–5. Tate, G.H.H., Archbold, R., 1939. Results of the Archbold expeditions. No. 24. Oriental Rhinolophus, with special reference to material from the Archbold collections. Am. Mus. Novit. 1036, 1–12. Templeton, A.R., 1983. Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution of humans and apes. Evolution 37, 221–244. Thomas, N.M., 1997. A systematic review of selected AfroAsiatic Rhinolophidae (Mammalia: Chiroptera): an evaluation of taxonomic methodologies. Unpublished PhD. Thesis, Harrison Zoological Museum, Sevenoaks. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic. Acids. Res. 25, 4876–4882. Walberg, M.W., Clayton, D.A., 1981. Sequence and properties of the human KB cell and mouse L cell D-loop regions of mitochondrial DNA. Nucleic. Acids. Res. 9, 5411–5421. Wang, Y.X., 2003. A Complete Checklist of Mammal Species and Subspecies in China: A Taxonomic and Geographic Reference. China Forestry Publishing House, Beijing, China (in Chinese). Wang, H., Liang, B., Feng, J., Sheng, L.X., Zhang, S.Y., 2003. Molecular phylogenetic of hipposiderids (Chiroptera: Hipposideridae) and rhinolophids (Chiroptera: Rhinolophidae) in China based on mitochondrial cytochrome b sequences. Folia Zool. 52, 259–268. Wilkinson, G.S., Chapman, A.M., 1991. Length and sequence variation in evening bat D-loop mtDNA. Genetics 128, 607–617. Wilkinson, G.S., Mayer, F., Kerth, G., Petri, B., 1997. Evolution of repeated sequence arrays in the D-loop region of bat mitochondrial DNA. Genetics 146, 1035–1048. Wu, Y., Yang, Q.S., Xia, L., Peng, H.Y., Zhou, Z.M., 2004. New record of Chinese bats: Rhinolophus marshalli. Chinese J. Zool. 39 (5), 109–110 (in Chinese). Yoshiyuki, M., 1989. A Systematic Study of the Japanese Chiroptera. National Science Museum, Tokyo. Yoshiyuki, M., 1990. Notes on Thai mammals. 2. Bats of the pusillus and philippinensis groups of the genus Rhinolophus (Mammalia, Chiroptera, Rhinolophidae). Bull. Natl. Sci. Mus. (Tokyo) 16, 21–40. Zhang, J.S., Zhang, L.B., Zhao, H.H., Liang, B., Zhang, S.Y., 2005. First record of Chinese bats: Rhinolophus stheno. Chinese J. Zool. 40 (2), 96–98 (in Chinese).
www.elsevier.de/mambio
ORIGINAL INVESTIGATION
Structure, DNA sequence variation and phylogenetic implications of the mitochondrial control region in horseshoe bats Keping Suna,b, Jiang Fenga,b,, Longru Jina, Ying Liua, Limin Shia, Tinglei Jianga a
Key Laboratory for Wetland Ecology and Vegetation Restoration of National Environmental Protection, Northeast Normal University, Changchun 130024, China b Key Laboratory of Vegetation Ecology of Education Ministry, Institute of Grassland Science, Northeast Normal University, Changchun 130024, China Received 30 November 2007; accepted 19 September 2008
Abstract There have been few studies of the structural and evolutionary characteristics of the mitochondrial control region (CR) in rhinolophids, yet this could have important consequences for the interpretation of phylogenetic relationships within this group. Here we sequenced and analyzed the CR of 37 individuals from 12 Rhinolophus species, including 2 species from GenBank. The length of the CR ranged from 1335 to 1514 bp, and the base composition was very similar among species. The CR of horseshoe bats, like that of other mammals, could be subdivided into a central conserved domain (CD) and two flanking variable domains, extended termination associated sequences (ETAS), and conserved sequence blocks (CSB). Besides the common conserved blocks (ETAS1, ETAS2, F-B boxes, CSB1, CSB2 and CSB3) found in 3 domains, an ETAS2-like and a CSB1-like element were also detected in the ETAS and CSB domains, respectively, in all individuals. Notwithstanding a short tandem repeat (11 or 13 bp) between CSB1 and CSB2 in all specimens, the base composition, copy number and arrays are all variable. A long tandem repeat (79 bp) was only identified in the ETAS domain in one individual of R. pusillus. Phylogenetic reconstructions based on the CR sequences indicated that the molecular phylogenetic relationships among some Rhinolophus species were inconsistent with the results of phenetic analyses, but similar to phylogenetic constructions using cytochrome b. An unidentified species R. sp and 3 species from the philippinensis-group that were clearly morphologically different comprised a monophyletic group, which could have resulted from morphological independent evolution. Crown Copyright r 2008 Published by Elsevier GmbH on behalf of Deutsche Gesellschaft fu¨r Sa¨ugetierkunde. All rights reserved. Keywords: Conserved element; Control region; Phylogeny; Rhinolophus; Tandem repeat
Introduction Corresponding author at: Key Laboratory for Wetland Ecology
and Vegetation Restoration of National Environmental Protection, Northeast Normal University, Changchun 130024 China. Tel.: 86 0431 85098097; fax: 86 0431 85098098. E-mail address: [email protected] (J. Feng).
The mitochondrial DNA (mtDNA) control region (CR), the major non-coding region of the animal mtDNA molecule, is also called the D-loop because of the three-stranded displacement (D) loop structure created by the nascent short H strand that displaces
1616-5047/$ - see front matter Crown Copyright r 2008 Published by Elsevier GmbH on behalf of Deutsche Gesellschaft fu¨r Sa¨ugetierkunde. All rights reserved. doi:10.1016/j.mambio.2008.09.002 Mamm. biol. 74 (2009) 130–144
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
the parental H strand (Saccone et al. 1987). The mammalian CR is commonly divided into three domains, including the extended termination-associated sequences (ETAS) domain (spanning from the tRNAPro to the central domain), the central domain (CD), and the conserved sequence blocks (CSB) domain (from the CD to the tRNAPhe), which differ depending on the pattern of variation and mode of evolution (Lee et al. 1995; Baker and Marshall 1997; Sbisa` et al. 1997). The ETAS and CSB domains evolve rapidly, while the CD maintains a high degree of conservation across species (Sbisa` et al. 1997; Pesole et al. 1999). The ETAS domain contains the TAS elements, first identified by Doda et al. (1981) as being associated with the termination of the nascent H strand during replication. Sbisa` et al. (1997) subsequently identified two conserved blocks, ETAS1 and ETAS2, and suggest that they play roles in the regulation of replication and transcription. The CD is most highly conserved in all species, but its function is still largely obscure (Sbisa` et al. 1997). The CSB domain as a functionally important region containing the replication origin of the heavy strand (OH), promoters for the transcription of both the heavy and light strands (HSP and LSP), as well as three conserved blocks, CSB1, CSB2 and CSB3, presumably involved in the processing of the RNA primers for heavy strand replication (Walberg and Clayton 1981). Long and short tandem repeats were detected in the ETAS and CSB domains, respectively, in many mammals (Hoelzel et al. 1994; Fumagalli et al. 1996; Petri et al. 1996; Sbisa` et al. 1997; Wilkinson et al. 1997; Larizza et al. 2002; Ketmaier and Bernardini 2005). However, the base composition, length and copy number of the repeats were variable, which provided a source of intraspecific and interspecific length heteroplasmy (Wilkinson and Chapman 1991; Sbisa` et al. 1997; Wilkinson et al. 1997; Larizza et al. 2002). Some studies have provided a detailed characterization of the overall structure of the CR in mammals and other vertebrates. They have identified conserved sequences of putative functional importance, and have provided valuable information on phylogeny, phylogeography and population genetics (Brown et al. 1986; Saccone et al. 1987; Sbisa` et al. 1997; Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Ketmaier and Bernardini 2005; Iyengar et al. 2006). However, due to different times of divergence and evolution rates, the CR had different characteristic structures among mammals (Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Iyengar et al. 2006). Within bats, few investigations on the detailed characterizations of the CR have been conducted (Wilkinson and Chapman 1991; Wilkinson et al. 1997), although CR 50 variable sequences have been used to study population structure and phylogeography of many species (Ruedi and Castella 2003; Juste et al. 2004; Salgueiro et al. 2004;
131
Armstrong 2006; Chen et al., 2006). The CR has been used infrequently to study phylogenetic relationships within genera or families. Rhinolophidae (Chiroptera: Microchiroptera) includes only one genus, Rhinolophus, with ca. 77 recognized species of Old World horseshoe bats (Simmons, 2005). In China, about 20 species of horseshoe bats were recorded (Wang 2003; Wu et al. 2004; Zhang et al. 2005). Andersen (1905a, b, 1918) first reviewed this family and constructed a phylogenetic tree. Most subsequent scholars have either accepted it or have made only minor changes in his classification (e.g., Tate and Archbold 1939; Tate 1943; Ellerman and Morrison-Scott 1951; Koopman 1975; Hill and Yoshiyuki 1980; Yoshiyuki 1989, 1990; Hill 1992). Bogdanowicz (1992) and Bogdanowicz and Owen (1992) assessed evolutionary relationships among species using a large set of cranial and external characteristics to construct a new classification of this family. However, little research on the phylogenetic relationships of horseshoe bats has been conducted at the molecular level (Cooper et al. 1998; Guille´n-Servent et al., 2003; Sakai et al. 2003; Wang et al., 2003). Guille´n-Servent et al. (2003) proposed a new taxonomic arrangement of a number of species of Rhinolophus based on the sequences of the mitochondrial cytochrome b (Cyt b) gene, which was different from that of Bogdanowicz (1992). In the present study, we obtained the complete CR sequences from 35 captured individuals representing 10 species in China, and reconstructed the phylogenetic trees by including the complete or 50 variable CR sequences available in GenBank from other horseshoe bats. Our objectives were to (i) characterize the structural features and patterns of evolution of the horseshoe bats’ CR in comparison with similar regions in other mammal species, and (ii) explore the implications of the CR for the phylogenetic relationships among Rhinolophus species by comparison to the results of morphological and mitochondrial Cyt b studies.
Materials and methods Sampling and DNA extraction All of the specimens were collected from China (Table 1) and were identified following standard keys (Csorba et al., 2003). A piece of wing tissue (3 mm in diameter) from live animals was punched and stored in 95% ethanol. The bats were then returned to their habitats. Total genomic DNA of each individual was extracted using a UNIQ-10 Column Animal Genomic DNA Isolation Kit (Sangon, China).
ARTICLE IN PRESS 132
Table 1.
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
Horseshoe bat species sampled and analyzed in this study
Genus/species
Common name
Locality
GenBank accession No.
Length (bp)
No. of RS1
Rhinolophus R. sinicus (1) R. sinicus (2) R. sinicus (3) R. affinis (1) R. affinis (2) R. macrotis (1) R. macrotis (2) R. macrotis (3) R. macrotis (4) R. ferrumequinum (1) R. ferrumequinum (2) R. ferrumequinum (3) R. pearsoni R. marshalli R. sp (1) R. sp (2) R. thomasi R. rex (1) R. rex (2) R. pusillus (1) R. pusillus (2) R. pusillus (3) R. pusillus (4) R. pusillus (5) R. pusillus (6) R. pusillus (7) R. pusillus (8) R. pusillus (9) R. pusillus (10) R. pusillus (11) R. pusillus (12) R. pusillus (13) R. pusillus (14) R. pusillus (15) R. pusillus (16) R. c. pumilus R. monoceros
Chinese horseshoe bat Chinese horseshoe bat Chinese horseshoe bat Intermediate horseshoe bat Intermediate horseshoe bat Large-eared horseshoe bat Large-eared horseshoe bat Large-eared horseshoe bat Large-eared horseshoe bat Greater horseshoe bat Greater horseshoe bat Greater horseshoe bat Pearson’s horseshoe bat Marshall’s horseshoe bat Unidentified horseshoe bat Unidentified horseshoe bat Thomas’ horseshoe bat King horseshoe bat King horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Least horseshoe bat Okinawa least horseshoe bat Formosan lesser horseshoe bat
Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Jiangxi, China Yunnan, China Yunnan, China Yunnan, China Jiangxi, China Guangxi, China Yunnan, China Yunnan, China Jiangxi, China Chongqing, China Chongqing, China Chongqing, China Jiangxi, China Jiangxi, China Yunnan, China Yunnan, China Jiangxi, China Chongqing, China Chongqing, China Guangdong, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Yunnan, China Chongqing, China Japan Taiwan, China
DQ642887 DQ642888 DQ642889 DQ642890 DQ642891 DQ642892 DQ642893 DQ642894 EU053156 DQ642895 EU053157 EU053158 EU053159 EU053160 EU053161 EU053162 EU053163 DQ642896 DQ642897 DQ642898 DQ642899 DQ642900 DQ642901 DQ916119 DQ916120 DQ916121 DQ916122 DQ916123 EF217373 EF217374 EF217375 EF217376 EF217377 EF217378 EF217379 AB061526 AF406806
1405 1471 1482 1441 1472 1410 1438 1409 1407 1380 1371 1370 1374 1422 1367 1422 1436 1355 1387 1424 1401 1401 1389 1401 1444 1434 1391 1367 1390 1378 1444 1335 1422 1401 1514 1424 1405
15 20 21 16 21 20 23 20 20 17 16 16 14 21 15 20 18 14 17 21 19 19 18 19 23 22 18 16 18 17 23 13 21 19 15 21 19
(1251) (1262) (1262) (1276) (1252) (1201) (1196) (1200) (1198) (1204) (1206) (1205) (1205) (1202) (1213) (1213) (1249) (1212) (1211) (1204) (1203) (1203) (1202) (1203) (1202) (1203) (1204) (1202) (1203) (1202) (1202) (1203) (1202) (1203) (1202) (1204) (1207)
The sequences of Rhinolophus cornutus pumilus and R. monoceros were obtained from GenBank. The numbers in the parentheses are the length of the CR without repeats. RS1 represents short repeated sequence.
DNA amplification and sequencing The CR sequences of 35 individuals from 10 Rhinolophus species were amplified using primers Pro and Phe (Table 2), which were designed according to the conserved sequences of tRNApro and tRNAphe flanking the CR. We also amplified the CR sequences of two Hipposideros species (H. armiger and H. pratti) using these two primers, which were used as outgroups. The sequences of 15 light-strand extended primers were designed (Table 2) for sequencing the entire CR. Due to the extremely long repeated sequences of H. armiger and H. pratti, not all the repeats of the CR were completely
sequenced. The CR sequences have been deposited in DQ642887–DQ642901, DQ916119–DQ916123 and EU053156–EU053165. Reactions were performed in 50 ml volumes, containing 50–100 ng of genomic DNA, 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 mM of each dNTP, 0.4 mM of each primer, and 2.5 U of Taq DNA polymerase. The cycling parameters were as follows: 94 1C for 5 min; 94 1C for 45 s, 58–62 1C for 45 s and 72 1C for 90 s, for 35 cycles; 72 1C for 10 min. The PCR products were purified on an EZ-10 Spin Column DNA Gel Extraction Kit (BBI) and sequenced using an ABI PRISM 3730 sequencer (Applied Biosystems).
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
Table 2.
133
Primer names, sequences and the corresponding species sequenced
Primer
Sequence (50 –30 )
Species
Pro Phe 1115255 0920098 1205497 03232305 0329128 0420036 0517563 0614546 04241057 1122040 12061385 1128982 1130468 0628849 1211925
CAAGTTCCACCATCAGCACC ACTCATCTAGGCATTTTCAGTG TTTCTTCAGGACCATCTCAC GTACGCAACGTGTACGCAAC GCCCATGCCGACACATAACT CAGCCCATGCCGACACATAA TAATCAGCCCATGCCGACAC AGCCCATGCCGACACATAAC ATGCCGACACATAACTGTGG GGTGTCATGCCTTTGGTATC TCAGCTATGGCCGTCAGAGG CATCTCGATGGGTTAGTGAC ACGCATATCACCTCCGATAG ATTGAACCATGCTTGGAACT TTGTAGCTGGACTTACAGTT GGACGAGGAATCTACTATGG ATGCGTATCACCTCCATTAG
All All Rhinolophus sinicus (2) R. macrotis (1), R. sinicus (1), R. sinicus (3) R. ferrumequinum (1), R. thomasi R. pusillus (1), R. rex (1), R. affinis (1) R.affinis (2), R. sp (2) R. rex (2) R. macrotis (2), R. macrotis (3) R. pusillus (2), R. pusillus (3), R. pusillus (4) R. pusillus (6), R. pusillus (8) R. pusillus (7), R. pusillus (9) R. pusillus (5), R. pusillus (16) R. marshalli R. sp (1) R. macrotis (4) R. ferrumequinum (2), R. ferrumequinum (3) R. pusillus (11), R. pusillus (12), R. pusillus (13) R. pusillus (15) Hipposideros armiger, H. pratti
DNA sequence analysis Sequences were aligned using ClustalX ver. 1.8 (Thompson et al. 1997) with the published sequences of R. cornutus pumilus (AB061526) and R. monoceros (AF406806), then carefully examined and edited manually. The base composition, nucleotide variation, and corrected genetic distance were calculated. The base frequency stationarity was evaluated by a w2 test implemented in PAUP* 4.0 (Swofford 2002). Saturation was explored for the CR sequence by plotting the pair-wise value of corrected genetic distances against the pair-wise number of the inferred substitutions. The CR domains and elements were demarcated and identified on the basis of data from mammals (Saccone et al. 1987; Sbisa` et al. 1997; Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Ketmaier and Bernardini 2005; Iyengar et al. 2006). Phylogenetic reconstructions were performed with the maximum parsimony (MP) and maximum likelihood (ML) methods, implemented in PAUP* and PHYML v2.4.4 (Guindon and Gascuel 2003). The most parsimonious tree was estimated through a heuristic search with 100 random additions of taxa, and complete treebisection-reconnection branch swapping for each iteration with equally weighted characters. Gaps were treated as the fifth character state. Reliability of nodes was assessed with non-parametric bootstraps (Felsenstein 1985). One thousand bootstraps were generated, each with 20 stepwise random additions and complete treebisection-reconnection branch swapping. In the PHYML procedure, the starting tree was obtained with BIONJ (Gascuel 1997). The model of DNA substitution that best fitted the data was estimated using the
Akaike Information Criterion (AIC) in the program MODELTEST v3.06 (Posada and Crandall 1998). HKY+G+I model of evolution was selected, which allowed rate variation among sites and included a proportion of invariable sites. The parameters were estimated and optimized during the search (transition/ transversion ¼ 8.880, G ¼ 0.659, I ¼ 0.308). Node support was assessed with 500 bootstrap replicates. Nodes that received X70% bootstrap support were considered well supported. Additional phylogenetic analyses were implemented using sequences for R. arcuatus (AF065091), R. euryotis (AF065089), R. megaphyllus (AF065088), R. euryale (AY923062), R. sedulus (U95336), R. clivosus (U95339), R. hipposideros (DQ297610), R. philippinensis (1) (AY568638), R. philippinensis (2) (AY568642), R. philippinensis (3) (AY568646), R. cornutus (1) (DQ297617), R. cornutus (2) (DQ297621), R. monoceros (1) (DQ297604), R. monoceros (2) (DQ297605), R. monoceros (3) (DQ314619), R. monoceros (4) (DQ314624), R. monoceros (5) (DQ314634), R. monoceros (6) (DQ314654), R. monoceros (7) (DQ314657), R. monoceros (8) (DQ314664), R. monoceros (9) (DQ314677), R. monoceros (10) (DQ314686), R. monoceros (11) (DQ314688), R. monoceros (12) (DQ314697), R. monoceros (13) (DQ314698), R. monoceros (14) (DQ314703), R. monoceros (15) (DQ314709), R. monoceros (16) (DQ314710) and R. monoceros (17) (DQ314719) from GenBank. In this case, only 430 bases were successfully used, since stretches of the sequences that could not be satisfactorily aligned had to be deleted. Once again, both MP and ML approaches were used. The HKY+G+I model of evolution was selected by hierarchical likelihood-ratio test (hLRT) implemented in MODELTEST
ARTICLE IN PRESS 134
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
v3.06. The parameters were estimated and optimized during the search (transition/transversion ¼ 7.571, G ¼ 0.543, I ¼ 0.221). Tree search and bootstrapping were performed as described above. To test whether the mtDNA data were consistent with monophyly of each of the R. pusillus populations, we employed the Templeton test (Templeton, 1983) to evaluate MP trees obtained with and without topological constraint and employed the Shimodaira-Hasegawa test (S-H, Shimodaira and Hasegawa 1999) using 1000 RELL bootstraps replicates to evaluate unconstrained and constrained ML trees. The complete CR sequences, excluding the repeats and CR 50 variable sequences, were used to construct the constrained MP and ML trees using the above evolutional models. Both the Templeton and S-H tests were implemented in PAUP*.
Results Control region structure and length variation The CR of horseshoe bats flanked by tRNAPro and tRNAPhe was subdivided into the ETAS domain, CD, and CSB domain according to previous surveys in mammals (Figs. 1 and 2). In the ETAS domain, three conserved blocks were found: ETAS1, ETAS2 and ETAS2-like. The ETAS1 and ETAS2-like elements were found to be contiguous, with only one nucleotide separating the two elements (Fig. 2). The putative point of arrest of CR synthesis is proposed to be an ACCCC element within ETAS1 in rhinolophids (Fig. 2). Furthermore, only in R. pusillus (16) were long tandem repeats found (Figs. 1 and 2, Table 3). In the CD, five conserved blocks (F, E, D, C and B boxes) were clearly identified (Fig. 2). In the CSB domain, four conserved blocks, CSB1, CSB2, CSB3 and CSB1-like, and short tandem repeats were identified (Figs. 1 and 2, Table 3). This CSB1-like element was located upstream of the CSB1 element, originating from 40 to 46 bp downstream of the CD. After all repeats were excluded, the degree of nucleotide variation was variable among different domains and elements in the CR of horseshoe bats (Figs. 2 and 3). The most highly variable domain
was the CSB domain, with 62.8% variable sites (including indels), followed by the ETAS domain (51.1%) (Fig. 3). The CD was the most conserved domain (15.1% variability). In the ETAS domain, the degree of variation of the ETAS1 sequence (44.3%) was higher than that of ETAS2 (26.7%), whereas the ETAS2-like sequence was the most highly variable, with 19 conserved in 61 alignment positions. The consensus of the ETAS2-like sequence showed 39.3% dissimilarity with the consensus ETAS1 of horseshoe bats. In the CSB domain, the degree of variability of the CSB1 element (24%) was higher than that of the CSB2 element (11.8%). The CSB3 element was most conserved and no variable position was detected. The CSB1-like element was less conserved than the CSB1, with 40% variable sites. The consensus CSB1-like sequence showed 16% dissimilarity with the CSB1 for horseshoe bats. For 37 specimens of 12 species examined, CR length ranged from 1335 bp (R. pusillus (13)) to 1514 bp (R. pusillus (16)). All individuals showed different lengths of CR sequences. The CR length heterogeneity could be ascribed to the two peripheral ETAS (349–508 bp) and CSB (668–812 bp) domains. The variable length of the CD was only two bases (316–318 bp). After excluding the long tandem repeats, the variable length of the ETAS domain was only five bases (350–354 bp). The short tandem repeats in the CSB domain also led to the length variation (Table 1, Fig. 2). Without these short repeats, the length of the CSB domain reduced to 527–605 bp.
Base composition heterogeneity Regardless of whether or not the repeats were considered, the base compositions of the CR and its three domains did not vary significantly among 12 Rhinolophus species (w2 test, p40.05). In the 3 domains of the CR, all species showed similarly biased base composition: A4T4C4G in the ETAS domain, T4C4A4G in the CD, and A4C4T 4G in the CSB domain (Table 4). The horseshoe bats followed the general mammalian mitochondrial CR pattern of A+T4C+G in all domains (Sbisa` et al. 1997). In the CR and three domains of all individuals, G content was the lowest, but it was higher in the CD than in the two peripheral domains (Table 4), which was in agreement with previous observations in other mammals.
Fig. 1. Schematic diagram of the mitochondrial CR of rhinolophid bats. Locations of RS1, ETAS1, ETAS2 and ETAS2-like elements within the ETAS domain, conserved boxes, F, E, D, C and B within the central domain, and CSB1-like, CSB1, CSB2, CSB3 and RS2 elements within the CSB domain are shown. (n) indicates that the copy number of RS2 is variable.
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
135
Fig. 2. Alignment of the CR sequences (excluding repeated sequences) of 12 Rhinolophus species. The three domains (ETAS, CD, and CSB) are shown. ETAS1, ETAS2 and ETAS2-like elements within the ETAS domain, conserved boxes F-B within the CD, CSB1-like, CSB1, CSB2 and CSB3 elements within the CSB domain are highlighted. The putative point of arrest of replication (/stopS) is indicated. The location of arrows in the CSB domain indicates where short tandem repeats are inserted. The repeated motifs are summarized in Table 3.
Tandem repeats The long repeated motif (79 bp) including the ETAS1 and partial ETAS2-like elements was only examined in the ETAS domain of R. pusillus (16), with a copy number of 3 (Tables 1 and 3, Figs. 1 and 2). Short
repeated motifs with a length of 11 bp (all taxa excluding R. pearsoni) or 13 bp (R. pearsoni) were identified between the CSB1 and CSB2 elements. There was a clear difference in the copy number of short repeats at the intraspecific and interspecific levels (Table 1). The arrangements of short repeats were variable even though
ARTICLE IN PRESS 136
Table 3.
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
The types of repeated motifs of horseshoe bats in the study and their distribution among the samples
Repeated motifs (RS1)
Species
Aacgtatacgc ¼ A - - - -c- - - - - - ¼ B Cgtatacgcaa ¼ C - - -g- - - - - - - ¼ D - - -g- - - - - -g ¼ E tgtacgcaacg ¼ F- - - - - - - -g- - ¼ G -a- - - - - - - - - ¼ H ca- - - - - - - - - ¼ I ta- - - - - - - - - ¼ J atacgcaacgc ¼ K acgcaacgtgt ¼ L tacacacagcg ¼ M- - - - -g- - - - - ¼ N - - - - - - -t- - - ¼ O - - - - -g- - - -a- - ¼ P- - -g- - - - - - - ¼ Q gcaacgcatacac ¼ R
Rhinolophus sinicus (1), R. sinicus (2), R. sinicus (3) R. sinicus (1) R. affinis (1), R. affinis (2), R. macrotis (1), R. macrotis (2), R. macrotis (3) R. macrotis (1), R. macrotis (2), R. macrotis (3) R. macrotis (1) R. macrotis (4) R. marshalli R. thomasi R. R. R. R. R. R.
ferrumequinum (1), R. ferrumequinum (2), R. ferrumequinum (3) rex (1), R. rex (2), R. sp (1), R. sp (2) pusillus (1)-R. pusillus (16), R. c. pumilus, R. monoceros pusillus (6) monoceros pearsoni
Repeated motif (RS2) R. pusillus (16) tagtacatattatgtataattatacattaatgatttaccccatgcatataagcaagtacaataaaattataacagtaca Dashes indicate nucleotide identity; the first sequence is the consensus sequence.
Fig. 3. Distribution and frequency of variable nucleotides (including indels) across the mitochondrial CR of 37 individuals of 12 Rhinolophus species. The long and short repeated sequences in ETAS and CSB domains were excluded from the multiple alignment of the CR sequences.
the repeated motif and copy number were identical among individuals (data not shown). Short repeats were always found to be based on a core motif of ACGC. Different arrays have resulted from the differential repetition of a single or several elements; nucleotide substitutions among different variants have arisen by a mechanism of insertion/deletion and transitions. In our study, transitions of A and G, C and T were observed, but no transversion was observed within an individual horseshoe bat (Table 3).
Phylogenetic reconstruction To rule out the possibility that atypical evolution of the tandem repeats could lead to biased results, phylogenetic analyses were performed on the complete
CR sequence alignment excluding the repeats (1342 bp). However, to keep datasets more tractable, only sequences differing by more than 1% were used in the final analyses. Additional phylogenetic analyses were carried out using CR 50 variable sequence alignment (430 bp) and more Rhinolophus species from GenBank. Of the 1342 and 430 nucleotide alignment positions, 650 and 236 were variable sites, respectively. Base frequencies did not deviate from stationarity among all individuals (1342 bp: w2 ¼ 48.35, df ¼ 87, p ¼ 0.9997; 430 bp: w2 ¼ 53.71, df ¼ 174, p ¼ 1.0). Numbers of transitions and transversions when plotted against HKY+G+I distances suggested a lack of extensive saturation for the above two data sets (data not shown). Tree topologies obtained using ML and MP methods were similar except for several positions with low bootstrap supports (o70%), regardless of whether they were based on the 1342 bp alignment of 12 Rhinolophus species (Fig. 4) or the 430 bp alignment of 20 Rhinolophus species (Fig. 5). All trees showed the monophyly of horseshoe bats (Figs. 4 and 5, bootstrap values: 100%). Rhinolophus pusillus, R. monoceros and R. c. pumilus of the pusillus-group formed a monophyletic clade (Fig. 4) and interspecific HKY+G+I distances among them were very low, ranging from 3.7% to 7.4% (Appendix I). In Fig. 5, R. pusillus, R. monoceros, R. cornutus and R. c. pumilus also formed a monophyletic group, and the interspecific HKY+G+I distances among them ranged from 5.2% to 11.1% (Appendix II). Within R. pusillus, the HKY+G+I distances were 1.2–5.2% (1342 bp) and 4.5–12.1% (430 bp), respectively (Appendices I and II). Within R. monoceros, the maximum distance was 3.5%
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
Table 4.
Base composition of the CR, and respective domains of 12 Rhinolophus species
Control regiona Control regionb ETASa ETASb CD CSBa CSBb a
137
A (%)
C (%)
G (%)
T (%)
w2
df
p
31.970.753 31.770.533 35.970.994 35.870.950 24.370.187 33.271.232 33.370.990
27.170.603 26.370.527 23.270.816 23.370.759 26.370.406 29.470.953 28.270.950
16.570.677 15.870.520 12.070.891 12.070.881 21.470.211 16.771.182 14.970.896
24.470.667 26.370.669 28.970.878 28.870.872 28.070.317 20.770.997 23.671.277
73.3 48.1 41.6 34.6 2.4 93.2 71.4
108 108 108 108 108 108 108
0.996 1.000 1.000 1.000 1.000 0.845 0.997
Including repeats. Excluding repeats.
b
Fig. 4. The maximum-parsimony (MP) and the maximum-likelihood (ML) trees (ln L ¼ 9189.66964) of 30 individuals of 14 bat species based on mitochondrial CR sequences without repeats. In this analysis, only sequences differing by more than 1% were used to construct the phylogenetic tree. Each geometric shape represents the specimen of Rhinolophus pusillus sampled from a different region, as follows: white circles, Jiangxi Province; dark circles, Yunnan Province; white triangles, Chongqing City; dark triangles, Guangdong Province. The MP tree (B) was constructed using the gap as the fifth character site. MP and ML bootstrap values (450%) are shown above nodes.
for the 430 bp alignment (Appendix II). Rhinolophus pusillus and R. monoceros formed a reciprocal monophyly group (Fig. 5), but R. pusillus from the same population did not cluster together with low bootstrap supports (Figs. 4 and 5). Tree topologies forcing the monophyly of each of R. pusillus populations were significantly worse than the optimal trees obtained in Figs. 4 and 5 (Templeton and S-H tests, po0.05). An unidentified species R. sp and 3 species of the philippinensis-group (R. macrotis, R. rex and R. marshalli)
composed a monophyletic group (Figs. 4 and 5), but the relationships among 4 species were not well resolved. The genetic distances (1342 bp: 6.7–8.5%; 430 bp: 9.8–13.0%) between R. sp and 3 species of the philippinensis-group were similar to those (1342 bp: 7.0–9.3%; 430 bp: 9.7–13.2%) among 3 species of the philippinensis-group (Appendices I and II). Rhinolophus sinicus and R. thomasi of the rouxi-group formed a sister species (BP: 100%), with 6.9–7.5% divergence (1342 bp) and 9.2–10.6% divergence (430 bp) (Appendices I and
ARTICLE IN PRESS 138
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
Fig. 5. Phylogenetic tree of 59 individuals from 22 species based on the mitochondrial CR 50 sequences using maximum likelihood (ML) by PHYML program. In this analysis, the sequences in Fig. 4 and more sequences available from GenBank were used to construct the phylogenetic tree. Each geometric shape represents the specimen of Rhinolophus pusillus sampled from a different region, as in Fig. 4. The bootstrap values at the nodes of 450% are shown. The differences between the maximum-parsimony (MP) tree (not shown) and ML tree (ln L ¼ 4821.00865) are indicated with light lines, which had low bootstrap supports (o70%).
II). These two species formed a monophyletic clade (BP: 100%) with R. affinis of the megaphyllus-group (Figs. 4 and 5). From Fig. 5, additional information is also shown: R. affinis of the megaphyllus-group and R. arcuatus and R. euryotis of the euryotis-group formed a clade (100%), and R. euryale of the euryale-group and R. ferrumequinum of the ferrumequinum-group clustered together (93%).
Discussion Organization of the CR in horseshoe bats The CR of horseshoe bats followed the general structure previously described in mammals (e.g., Brown
et al. 1986; Sbisa` et al. 1997; Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003). The presence of conserved regions, base composition, and frequency of variable nucleotides, all supported the separation of the CR sequence into three characteristic domains, ETAS, Central, and CSB, in horseshoe bats (Figs. 1 and 2, Table 4). The ETAS and CSB domains were found to be highly variable, with the CD being highly conserved (Figs. 1 and 2). Within the three conserved elements identified in the ETAS, the ETAS1 element may contain recognition signals for the termination of the nascent DNA or RNA, whereas the ETAS2 was proposed to bind termination factors (Sbisa` et al. 1997). A recent survey carried out in rodents showed that only ETAS1 was present in all species while ETAS2 was not always present (Larizza et al. 2002). In horseshoe bats, these two elements were both present, and ETAS1 was more variable than ETAS2 (44.3% and 26.7% variable sites, respectively). Nevertheless, a higher degree of conservation within ETAS1 was found in rodents and oryx, which indicated that ETAS1 might be functionally more important in mtDNA replication than ETAS2 (Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Iyengar et al. 2006). The higher degree of conservation within ETAS2 in horseshoe bats suggested that ETAS2 could play a critical role in mtDNA replication or showed a species-specific evolutionary pattern. Within ETAS1, the putative point of arrest of D-loop synthesis was proposed to be an ACCCC element in rhinolophids, but was proposed to be a TCCCC element in pig and oryx (Douzery and Randi 1997; Iyengar et al. 2006), and a GCCCC element in cow and cervids (Douzery and Randi 1997). An ETAS2-like element has not been described in a range of species of mammals (Sbisa` et al. 1997; Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003; Kierstein et al. 2004; Iyengar et al. 2006). The relatively low degree of dissimilarity with ETAS2 (39.3%) suggested that they could have been derived from this element by a slippage event. The ETAS2-like element was present in all of the examined horseshoe bats and was highly variable, which suggested a single slippage event after speciation. Additionally, an ETAS1like element in the ETAS domain has been reported in Spalax ehrenbergi superspecies (Reyes et al., 2003), but it was not found in horseshoe bats. The degree of variation of the most conserved domain, CD, was 15.1%, which is almost the same level of variability found in mitochondrial rRNA genes in several mammalian groups (Pesole et al. 1999). The biological role of CD is still unknown, but it is known that it could contain specific sequences capable of binding mitochondria-associated cytoskeletal elements (Jackson et al. 1996). F, E, D, C and B boxes were identified within the CD of horseshoe bats, which were previously reported in some other mammals (e.g. bovids
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
and cervids (Douzery and Randi 1997), Crocodylidae (Ray and Densmore 2003), Eurasian otter (Ketmaier and Bernardini 2005; Pe´rez-Haro et al. 2005), and oryx (Iyengar et al. 2006), but their function remains unclear. Within the CSB domain, 4 conserved elements were identified in the horseshoe bats. Sbisa` et al. (1997) suggested that CSB1 was present in all species and was functionally the most important block, albeit the least observed block (Matson and Baker 2001; Larizza et al. 2002; Reyes et al., 2003), which was consistent with that observed in rhinolophids. However, CSB2 and CSB3 were sometimes missing, or were only partial present (Gemmell et al. 1996; Sbisa` et al. 1997). In horseshoe bats, these two elements were also present, and CSB3 was the most conserved. A CSB1-like element identified further upstream of the CSB1 element (Figs. 1 and 2) showed a low level, of variability with CSB1 (16%) in the CSB domain. It has been suggested that DNA/RNA transitions in this region may facilitate the occurrence of slippage events (Larizza et al. 2002). However, the location of the CSB1-like element and the level of sequence conservation with the CSB1 element were different to those observed in other animal groups. For instance, this element was downstream of the CSB1 element in the CSB domain (and more conserved than CSB1) in oryx (Iyengar et al. 2006), while it was in the ETAS domain in red backed voles (Matson and Baker 2001) and subterranean mole rats (Reyes et al., 2003), with a higher and lower conserved levels than that of the CSB1 element, respectively. The mechanism underlying this difference remains obscure. The CR length heterogeneity in horseshoe bats could be ascribed to the presence of repeated sequences and indels (Fig. 2). CR size differences within the same genus and also within the same subspecies have been previously reported (Sbisa` et al. 1997; Larizza et al. 2002). In this study, the long repeated motif (79 bp) was only detected within the ETAS domain of R. pusillus (16) (Fig. 1, Table 3). Wilkinson et al. (1997) did not find the long repeated sequences in the ETAS domain of 4 Rhinolophus species, but found the long repeated motif (81 bp) in the vespertilionid bats which showed below 50% similarity with our study (data not shown). Short tandem repeats identified between CSB1 and CSB2 have been described in many mammalian species (Gemmell et al. 1996; Sbisa` et al. 1997; Larizza et al. 2002; Pe´rezHaro et al. 2005), but the length, base composition and copy number were variable, even within the same species, such as R. pusillus (Tables 1 and 3). The formation of these repeats was likely to be caused by replication slippage (Levinson and Gutman 1987; Madsen et al. 1993). In all the bats examined, the substitution of repeated motifs was caused by transition, which was in agreement with findings in the Eurasian Otter (Ketmaier and Bernardini 2005).
139
Phylogenetic implications of the CR Our phylogenetic analyses based on the CR gene confirmed the monophyletic group of horseshoe bats, which was in agreement with previous surveys on morphological characters and mitochondrial Cyt b gene (Bogdanowicz and Owen, 1992; Wang et al., 2003). The molecular phylogenetic relationships among some Rhinolophus species conflicted with those of reported based on the phenetic analyses (Bogdanowicz, 1992; Bogdanowicz and Owen, 1992). Bats of the genus Rhinolophus have been classically subdivided into approximately 15 groups (Csorba et al., 2003), each of which comprise many species with similar morphological and ecological adaptations. However, the phylogenetic analyses in this study show that species from the same group did not always cluster together (Figs. 4 and 5). In other words, the classification by external characteristics could not completely reflect the phylogenetic relationships. Guille´n-Servent et al. (2003) proposed a new arrangement of taxa based on the phylogeny of two thirds species of Rhinolophidae, which differed from that of Bogdanowicz (1992) and Bogdanowicz and Owen (1992). In this study, the phylogenetic relationships among Rhinolophus species based on the CR gene were similar to those of Guille´n-Servent et al. (2003), although fewer species were included in our research. Each of our trees showed that R. pusillus, R. monoceros and R. cornutus (including R. c. pumilus) formed a monophyletic clade (Figs. 4 and 5). Data from the mtDNA CR also support the close genetic similarity of these three species, and the partial values of interspecific divergence (1342 bp: 3.7–7.4%; 430 bp: 5.2–11.1%) among them were at the level of intraspecific variation within R. pusillus (1342 bp: 1.2–5.2%; 430 bp: 4.5–12.1%) (Appendices I and II), which suggested that these three species might have a recent common ancestor. This result was consistent with the results of Li et al. (2006). Reciprocal monophyly of R. pusillus and R. monoceros (Fig. 5) showed that R. monoceros may be or may be not a true species. The only way to test that hypothesis would be to hybridize R. monoceros and R. pusillus. However, these two species are allopatric and spatially separated; whether they would hybridize could not be proven. The data presented here neither supports nor contradicts the hypothesis that R. pusillus and R. monoceros are separate species that diverged relatively recently. Sequencing of their genomic, rather than mitochondrial, DNA might help resolve their evolutionary relationship. Rhinolophus monoceros however, could be a nascent species. Furthermore, the minimum interspecific divergence (4.5% for the 430 bp alignment) between R. monoceros and R. pusillus was higher than the maximum intraspecific divergence (3.5% for the 430 bp alignment) within R. monoceros (Appendix II), which indicated that the divergent time
ARTICLE IN PRESS 140
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
between R. monoceros and R. pusillus was above the R. monoceros population expansion time estimated by Chen et al. (2006), and also suggested that R. monoceros might have diverged recently. Additionally, our results revealed incongruence between the phylogeny and geography of the R. pusillus samples (Figs. 4 and 5) because the constrained monophyly of each of the R. pusillus populations were rejected (Templeton and S-H tests, po0.05). The incongruence indicated that there has been gene flow over these geographic populations of R. pusillus used in this study. Further research on the population genetic structure and evolutionary history using more representative samples is necessary. The molecular data for R. rex and R. sinicus in our results were not obtained by Guille´n-Servent et al. (2003). But Wang et al. (2003) sequenced the partial Cyt b sequence of R. rex, and suggested that this species was a sister species of R. macrotis. Our phylogenetic results showed that the molecular phylogenetic positions of R. rex and R. sinicus were consistent with the putative positions determined by Guille´n-Servent et al. (2003). Rhinolophus rex clustered together with R. macrotis and R. marshalli with similar morphology. Rhinolophus sinicus was originally designated as a subspecies of R. rouxii (Andersen, 1905a), it was promoted as a distinct species as a result of phenetic analysis and DNA techniques (Thomas 1997), and its external characteristics are similar to those of R. thomasi (Csorba et al., 2003). Our molecular trees and low interspecific genetic divergences (1342 bp: 6.9–7.5%; 430 bp: 9.2–10.6%) (Appendices I and II) showed that these two species, R. sinicus and R. thomasi were sister species (Figs. 4 and 5). Furthermore, the unidentified species R. sp was similar to R. lepidus of the pusillus-group due to their similar morphological characteristics. However, we
could not correctly identify this species due to the small sample sizes (n ¼ 2) and lack of cranial measurements. Rhinolophus sp clustered in a monophyletic clade and had close genetic distances (1342 bp: 6.7–8.5%; 430 bp: 9.8–13.0%) with 3 species of the philippinensis-group R. macrotis, R. marshalli and R. rex (Figs. 4 and 5, Appendices I and II). From external characteristics, R. sp was completely different from the bats of the philippinensis-group, because the former had obviously smaller ears (R. sp: length, approximately 14.26 mm (in this study); philippinensis-group: length 18.5–35 mm (Csorba et al., 2003)) but higher echolocation call frequency than the latter (R. sp: 91 kHz; philippinensisgroup:o60 kHz (in this study)). Both the phylogenetic positions of R. sp and the close genetic distances between R. sp and 3 species of the philippinensis-group might have resulted from recent divergence (Mayer and von Helversen, 2001) and morphologically independent evolution through some deterministic processes (Losos et al. 1998; Ruedi and Mayer 2001).
Acknowledgements We are grateful to Professor B. Liu in China for his advice on the analysis and manuscript. We thank the anonymous reviewers and the editor-in-chief for very helpful and detailed comments on our manuscript. This study was financed by the National Natural Science Foundation of China (Grant No. 30570311, 30770361), Scientific Research Foundation for the Returned Overseas Chinese Scholars of Ministry of Education and Doctoral Foundation of Ministry of Education (20060200007).
Appendices Appendix I. HKY+G+I genetic distance measures based on the complete CR sequences alignment without tandem repeats (1342 bp) between bats shown in the phylogenetic tree (Fig. 4)
ARTICLE IN PRESS
K. Sun et al. / Mamm. biol. 74 (2009) 130–144 141
HKY+G+I genetic distance measures based on the CR 50 variable sequence alignment (430 bp) between bats shown in the phylogenetic tree (Fig. 5)
142
Appendix II.
ARTICLE IN PRESS
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
ARTICLE IN PRESS K. Sun et al. / Mamm. biol. 74 (2009) 130–144
References Andersen, K., 1905a. A list of the species and subspecies of the genus Rhinolophus, with some notes on their geographical distribution. Ann. Mag. Nat. Hist. 7, 648–662. Andersen, K., 1905b. On some bats of the genus Rhinolophus, with remarks on their mutual affinities, and descriptions of twenty-six new forms. Proc. Zool. Soc. (London) 2, 75–145. Andersen, K., 1918. Diagnoses of new bats of the families Rhinolophidae and Megadermatidae. Ann. Mag. Nat. Hist. 9, 374–384. Armstrong, K.N., 2006. Phylogeographic structure in Rhinonicteris aurantia (Chiroptera: Hipposideridae): implications for conservation. Acta Chiropterol. 8, 63–81. Baker, A.J., Marshall, H.D., 1997. Mitochondrial control region sequences as tools for understanding evolution. In: Mindell, D.P. (Ed.), Avian Molecular Evolution and Systematics. Academic Press, San Diego, CA, pp. 51–79. Bogdanowicz, W., 1992. Phenetic relationships among bats of the family Rhinolophidae. Acta Theriol. 37, 213–240. Bogdanowicz, W., Owen, R.D., 1992. Phylogenetic analyses of the bat family Rhinolophidae. Zeitschrift fu¨r zoologische Systematik und Evolutionsforschung 30, 142–160. Brown, G.G., Gadaleta, G., Pepe, G., Saccone, C., Sbisa, E., 1986. Structural conservation and variation in the D-loopcontaining region of vertebrate mitochondrial DNA. J. Mol. Biol. 192, 503–511. Chen, S.F., Rossiter, S.J., Faulkes, C.G., Jones, G., 2006. Population genetic structure and demographic history of the endemic Formosan lesser horseshoe bat (Rhinolophus monoceros). Mol. Ecol. 15, 1643–1656. Cooper, S.J.B., Reardon, T.B., Skilins, J., 1998. Molecular systematics of Australian rhinolophid bats (Chiroptera: Rhinolophidae). Aust. J. Zool. 46, 203–220. Csorba, G., Ujhelyi, P., Thomas, N., 2003. Horseshoe Bats of the World (Chiroptera: Rhinolophidae). Alana Books, Shropshire. Doda, J.N., Wright, C.T., Clayton, D.A., 1981. Elongation of displacement-loop strands in human and mouse mitochondrial DNA is arrested near specific template sequences. Proc. Natl. Acad. Sci. USA 78, 6116–6120. Douzery, E., Randi, E., 1997. The mitochondrial control region of Cervidae: evolutionary patterns and phylogenetic content. Mol. Biol. Evol. 14, 1154–1166. Ellerman, J.R., Morrison-Scott, T.C.S., 1951. Checklist of Palaearctic and Indian Mammals. British Museum (Natural History), London. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Fumagalli, L., Taberlet, P., Favre, L., Hausser, J., 1996. Origin and evolution of homologous repeated sequences in the mitochondrial DNA control region of shrews. Mol. Biol. Evol. 13, 31–46. Gascuel, O., 1997. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Mol. Biol. Evol. 14, 685–695. Gemmell, N.J., Western, P.S., Watson, J.M., Graves, J.A., 1996. Evolution of the mammalian mitochondrial control region–comparisons of control region sequences between
143
monotreme and therian mammals. Mol. Biol. Evol. 13, 798–808. Guille´n-Servent, A., Francis, C.M., Ricklefs, R.E., 2003. Phylogeny and biogeography of the horseshoe bats. In: Csorba, G., Ujhelyi, P., Thomas, N. (Eds.), Horseshoe Bats of The World. Alana Books, Bishop’s Castle, United Kingdom, pp. xii–xxiv. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704. Hill, J.E., 1992. Order Chiroptera. In: Corbet, G.B., Hill, J.E. (Eds.), The Mammals of The Indomalayan Region: A Systematic Review. Natural History Museum Publications and Oxford University Press, New York, pp. 54–161. Hill, J.E., Yoshiyuki, M., 1980. A new species of Rhinolophus (Chiroptera, Rhinolophidae) from Iriomote Island, Ryukyu Islands, with notes on the Asiatic members of the Rhinolophus pusillus group. Bulletin of National Science Museum 6, 179–189. Hoelzel, A.R., Lopez, J.V., Dover, G.A., O’Brien, S.J., 1994. Rapid evolution of a heteroplasmic repetitive sequence in the mitochondrial DNA control region of carnivores. J. Mol. Evol. 39, 191–199. Iyengar, A., Diniz, F.M., Gilbert, T., Woodfine, T., Knowles, J., Maclean, N., 2006. Structure and evolution of the mitochondrial control region in oryx. Mol. Phylogenet. Evol. 40, 305–314. Jackson, D.A., Bartlett, J., Cook, P.R., 1996. Sequences attaching loops of nuclear and mitochondrial DNA to underlying structures in human cells: the role of transcription units. Nucleic. Acids. Res. 24, 1212–1219. Juste, J., Ibanez, C., Munoz, J., Trujillo, D., Benda, P., Karatas, A., Ruedi, M., 2004. Mitochondrial phylogeography of the long-eared bats (Plecotus) in the Mediterranean Palaearctic and Atlantic Islands. Mol. Phylogenet. Evol. 31, 1114–1126. Ketmaier, V., Bernardini, C., 2005. Structure of the mitochondrial control region of the Eurasian otter (Lutra lutra; Carnivora, Mustelidae): patterns of genetic heterogeneity and implications for conservation of the species in Italy. J. Hered. 96, 318–328. Kierstein, G., Vallinoto, M., Silva, A., Schneider, M.P., Iannuzzi, L., Brenig, B., 2004. Analysis of mitochondrial D-loop region casts new light on domestic water buffalo (Bubalus bubalis) phylogeny. Mol. Phylogenet. Evol. 30, 308–324. Koopman, K.F., 1975. Bats of the Sudan. B. Am. Mus. of Nat. Hist. 154, 355–443. Larizza, A., Pesole, G., Reyes, A., Sbisa, E., Saccone, C., 2002. Lineage specificity of the evolutionary dynamics of the mtDNA D-Loop region in rodents. J. Mol. Evol. 54, 145–155. Lee, W.J., Conroy, J., Howell, W.H., Kocher, T.D., 1995. Structure and evolution of teleost mitochondrial control regions. J. Mol. Evol. 41, 54–66. Levinson, G., Gutman, G.A., 1987. Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol. Biol. Evol. 4, 203–221. Li, G., Jones, G., Rossiter, S.J., Chen, S.F., Parsons, S., Zhang, S.Y., 2006. Phylogenetics of small horseshoe bats
ARTICLE IN PRESS 144
K. Sun et al. / Mamm. biol. 74 (2009) 130–144
from East Asia based on mitochondrial DNA sequence variation. J. Mammal. 87, 1234–1240. Losos, J.B., Jackman, T.R., Larson, A., Queiroz, K., Rodriguez-Schettino, L., 1998. Contingency and determinism in replicated adaptive radiations of island lizards. Science 279, 2115–2118. Madsen, C.S., Ghivizzani, S.C., Hauswirth, W.W., 1993. In vivo and in vitro evidence for slipped mispairing in mammalian mitochondria. Proc. Natl. Acad. Sci. USA 90, 7671–7675. Matson, C.W., Baker, R.J., 2001. DNA sequence variation in the mitochondrial control region of red-backed voles (Clethrionomys). Mol. Biol. Evol. 18, 1494–1501. Mayer, F., von Helversen, O., 2001. Cryptic diversity in European bats. Proc. Biol. Sci. 268, 1825–1832. Pe´rez-Haro, M., Vin˜as, J., Man˜as, F., Batet, A., Ruiz-Olmo, J., Pla, C., 2005. Genetic variability in the complete mitochondrial control region of the Eurasian otter (Lutra lutra) in the Iberian Peninsula. Biol. J. Linn. Soc. 86, 397–403. Pesole, G., Gissi, C., De Chirico, A., Saccone, C., 1999. Nucleotide substitution rate of mammalian mitochondrial genomes. J. Mol. Evol. 48, 427–434. Petri, B., von Haeseler, A., Paabo, S., 1996. Extreme sequence heteroplasmy in bat mitochondrial DNA. Biol. Chem. 377, 661–667. Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14, 817–818. Ray, D.A., Densmore, L.D., 2003. Repetitive sequences in the crocodilian mitochondrial control region: poly-A sequences and heteroplasmic tandem repeats. Mol. Biol. Evol. 20, 1006–1013. Reyes, A., Nevo, E., Saccone, C., 2003. DNA sequence variation in the mitochondrial control region of subterranean mole rats, Spalax ehrenbergi superspecies, in Israel. Mol. Biol. Evol. 20, 622–632. Ruedi, M., Castella, V., 2003. Genetic consequences of the ice ages on nurseries of the bat Myotis myotis: a mitochondrial and nuclear survey. Mol. Ecol. 12, 1527–1540. Ruedi, M., Mayer, F., 2001. Molecular systematics of bats of the genus Myotis (Vespertilionidae) suggests deterministic ecomorphological convergences. Mol. Phylogenet. Evol. 21, 436–448. Saccone, C., Attimonelli, M., Sbisa, E., 1987. Structural elements highly preserved during the evolution of the Dloop-containing region in vertebrate mitochondrial DNA. J. Mol. Evol. 26, 205–211. Sakai, T., Kikkawa, Y., Tsuchiya, K., Harada, M., Kanoe, M., Yoshiyuki, M., Yonekawa, H., 2003. Molecular phylogeny of Japanese Rhinolophidae based on variations in the complete sequence of the mitochondrial cytochrome b gene. Genes Genet. Syst. 78, 179–189. Salgueiro, P., Coelho, M.M., Palmeirim, J.M., Ruedi, M., 2004. Mitochondrial DNA variation and population structure of the island endemic Azorean bat (Nyctalus azoreum). Mol. Ecol. 13, 3357–3366. Sbisa`, E., Tanzariello, F., Reyes, A., Pesole, G., Saccone, C., 1997. Mammalian mitochondrial D-loop region structural analysis: identification of new conserved sequences and their functional and evolutionary implications. Gene 205, 125–140.
Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116. Simmons, N.B., 2005. Order Chiroptera. In: Wilson, D.E., Reeder, D.M. (Eds.), Mammal Species of the World: A Taxonomic and Geographical Reference, third ed. The Johns Hopkins University Press, Baltimore, pp. 312–529. Swofford, D.L., 2002. PAUP* 4.0. Phylogenetic analysis using parsimony (*and other methods). Beta version 4.0b4a. Sinauer Associates, Inc., Publishers, Sunderland, Massachusetts. Tate, G.H.H., 1943. Results of the Archbold expeditions. No. 49. Further notes on the Rhinolophus phylippinensis group (Chiroptera). Am. Mus. Novit. 1219, 1–5. Tate, G.H.H., Archbold, R., 1939. Results of the Archbold expeditions. No. 24. Oriental Rhinolophus, with special reference to material from the Archbold collections. Am. Mus. Novit. 1036, 1–12. Templeton, A.R., 1983. Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution of humans and apes. Evolution 37, 221–244. Thomas, N.M., 1997. A systematic review of selected AfroAsiatic Rhinolophidae (Mammalia: Chiroptera): an evaluation of taxonomic methodologies. Unpublished PhD. Thesis, Harrison Zoological Museum, Sevenoaks. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic. Acids. Res. 25, 4876–4882. Walberg, M.W., Clayton, D.A., 1981. Sequence and properties of the human KB cell and mouse L cell D-loop regions of mitochondrial DNA. Nucleic. Acids. Res. 9, 5411–5421. Wang, Y.X., 2003. A Complete Checklist of Mammal Species and Subspecies in China: A Taxonomic and Geographic Reference. China Forestry Publishing House, Beijing, China (in Chinese). Wang, H., Liang, B., Feng, J., Sheng, L.X., Zhang, S.Y., 2003. Molecular phylogenetic of hipposiderids (Chiroptera: Hipposideridae) and rhinolophids (Chiroptera: Rhinolophidae) in China based on mitochondrial cytochrome b sequences. Folia Zool. 52, 259–268. Wilkinson, G.S., Chapman, A.M., 1991. Length and sequence variation in evening bat D-loop mtDNA. Genetics 128, 607–617. Wilkinson, G.S., Mayer, F., Kerth, G., Petri, B., 1997. Evolution of repeated sequence arrays in the D-loop region of bat mitochondrial DNA. Genetics 146, 1035–1048. Wu, Y., Yang, Q.S., Xia, L., Peng, H.Y., Zhou, Z.M., 2004. New record of Chinese bats: Rhinolophus marshalli. Chinese J. Zool. 39 (5), 109–110 (in Chinese). Yoshiyuki, M., 1989. A Systematic Study of the Japanese Chiroptera. National Science Museum, Tokyo. Yoshiyuki, M., 1990. Notes on Thai mammals. 2. Bats of the pusillus and philippinensis groups of the genus Rhinolophus (Mammalia, Chiroptera, Rhinolophidae). Bull. Natl. Sci. Mus. (Tokyo) 16, 21–40. Zhang, J.S., Zhang, L.B., Zhao, H.H., Liang, B., Zhang, S.Y., 2005. First record of Chinese bats: Rhinolophus stheno. Chinese J. Zool. 40 (2), 96–98 (in Chinese).