Structure of Bacterial Ribosomes

STRUCTURE OF BACTERIAL RIBOSOMES

.

. .

By ROGER A GARRETT and H G WITTMANN Max-Planck-Institiit fiir Molekulare Genetik. West Berlin. Germony

I . Introduction . . . . . . . . . . . . . . . I1. Proteins . . . . . . . . . . . . . . . . A . The Isolation of Ribosomal Proteins . . . . . . . . B. Number of Proteins . . . . . . . . . . . . C. MoIecular Weights . . . . . . . . . . . . D. Stoichiometry . . . . . . . . . . . . . E. Amino Acid Composition . . . . . . . . . . . F. Isoelectric Points . . . . . . . . . . . . . G. N-Terminal Amino Acids . . . . . . . . . . . H. Peptide Maps . . . . . . . . . . . . . I. Isolation and Analysis of Peptides . . . . . . . . J. Primary Structure . . . . . . . . . . . . . K . Immunochemical Properties . . . . . . . . . . L . Secondary Structure . . . . . . . . . . . . I11. Ribosomal Proteins of Escherichiu coli Mutants and Strains . . . A. Streptomycin Mutants . . . . . . . . . . . B. Spectinomycin Mutants . . . . . . . . . . . C . Erythromycin Mutants . . . . . . . . . . . D. TemperatureSensitive Mutants . . . . . . . . . E . Naturally Occurring Strains . . . . . . . . . . IV. Ribosomal RNA's . . . . . . . . . . . . . A . Sequencing Studies on Escherichia coli 16 and 23 S Ribosomal RNA's B . Secondary Structure . . . . . . . . . . . . C. Tertiary Structure . . . . . . . . . . . . D. 5 5 RNA . . . . . . . . . . . . . . . E . Alteration of RNA's in Mutants and by Colicin E3 . . . . V . Protein-RNA Binding Sites . . . . . . . . . . . A . Early Experiments on Protein-RNA Interaction in the Ribosome . B . Binding of Single Proteins to Ribosomal RNA . . . . . VI . Reconstitution and Biogenesis of Ribosomal Subunits . . . . A . 30s Subunit Reconstitution . . . . . . . . . . B . 50 S Subunit Reconstitution . . . . . . . . . . C . In V&o Ribosome Assembly . . . . . . . . . . VII. The Three-Dimensional Form of the Ribosome . . . . . . A . The Shape and Size of the Ribosome and Its Subunits as Determined by Electron Microscopy and X-Ray Diffraction Analysis . . . B. The Structural Organization of the Ribosome . . . . . . C . Protein Accessibility on 3 0 s Subunits . . . . . . . D . Protein Accessibility on 505 Subunits . . . . . . . E. Cross-Linking of Pairs of Proteins on the 3 0 5 Subunit . . . F. Heterogeneity of the Ribosomal Subunits . . . . . . . G . Protein-RNA Fragments of the 30s Subunit . . . . . . 277

278 278 278 280 280 281

284

284 284 285

285 286 287 287

288 288

290 290 291 291 292 292 297 298 299 301 301 30 1 302 306 307 309 311 313 313 315 317 319 321 321 324

278

ROGER A. GARRETT AND H. G. WITTMANN

H. How Do the Subunits Interact?

.

.

.

.

I. The “Unfolding” Process . . . . . . J. Displacement of Proteins by Cations . . . YIII. Structure-Function Relationships of the Proteins . A. Ribosomal Binding Sites and Active Centers . B. 3 0 s Subunit Proteins . . . . . . . C. 505 Subunit Proteins . . . . . . . IX. Ribosomes and Evolution . . . . . . A. The Ribosome . . . . . . . . B. Proteins . . . . . . . . . . C.RNA. . . . . . . . . . . References . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . .

. . . . . . .

.

. . . . . . .

.

. . . . . . .

.

. . . . . . .

.

. . . . . . .

325 326 327 328 328 330 331 332 332 333 335 337

I. INTRODUCTION The demonstration over the last few years that Escherichia coli ribosomes contain 55 proteins, each different in molecular weight, amino acid composition, and electrical charge, and three different RNA molecules, each with a complex secondary structure, has finally established its structural complexity. Although many of the important structural problems and structure-function relationships remain unsolved, the complexity of the experimental approaches required to resolve these problems can now be assessed realistically. I n this review we have concentrated on recent developments, especially where they tend to clarify long-standing problems. This is especially true for Section 11, where the physical and chemical properties of all the individual ribosomal proteins are summarized. With the exception of the section on ribosome evolutjon, the review is concerned mainly with E. coli ribosomes; they are the most widely investigated, and most of the seminal results on ribosome structure were obtained with these ribosomes. Several reviews give good accounts of earlier work on E . coli ribosomes ( 160a, 208,263) 291, 312) . Only a brief account is given of results on the mechanism of protein synthesis, and this is given (in Section VIII) only when it correlates directly with the involvement of known ribosomal components. The mechanism of protein synthesis has been reviewed recently elsewhere (16) 122) 2S2).

11. PROTEINS

A . The Isolation of Ribosomal Proteins Escherichia coli ribosomes contain 55 proteins in addition to three RNA molecules. The separation and characterization of the individual pro-

279

STRUCTURE OF BACTERIAL RIBOSOMES

teins was important for assessing the complexity of the ribosome and for detailed structural and functional investigations of the ribosomes. Experimentally, the isolation of individual proteins proved to be very difficult: first, because many of the proteins have similar chemical and physical properties (compare for example the isoelectric points in Table IV) ; and second, because the mixture of proteins was relatively insoluble and would dissolve readily only under extreme pH conditions, where there is the possibility of chemical modification of the proteins, or a t high urea concentrations, where the proteins may be denatured. The first step in the isolation procedure was generally to separate the ribosomal subunits in large quantities by zonal ultracentrifugation. Efforts were first concentrated on the 30 S ribosomal subunit, and the proteins were separated by column chromatography on either CM-cellulose (138) or cellulose phosphate (166) followed by gel filtration on Sephadex. The protein moiety of the 50s subunit is much more complex than that of the 30 S subunit and must be prefractionated either by salt treatment of the 5 0 s particle (137) or by ammonium sulfate precipitation of the TABLEI Correlation of SO S Ribosomal Proteins Studied in Four Diferent Laboratories (313) Berlin code [Kaltschmidt and Wittmann (157)3 Sl s2

53

s4 55 S6

57

58 89 s10 Sll s12 s1.3 514 S15 S16 517 S18 s19 s20 s21

Uppsala code [Hardy et al. (1955)i

Madison code [Nomura et al.

Geneva code [Traut et al. (996,.997)]

1 4a 9(+5) 10 3 2

P1 P2 P3 P4a P4 P3b P3c P5 P4b P8 P6 P7 PI0 PlOa P11 PlOb P9 P9 P12 P13 P14 P15

13 11 lob 9 Sa 1Oa 7 8b 5 6 4c

8

2a 12 4 11 15 15b 12b 14 6

7 1213 13 16 15a

(909)I

+

-

4b 4s 3a 2b 2a 1 0

280

ROGER A. GARRETT AND H. 0. WITTMANN

extracted 50 S proteins (195). Each fraction produced is then separated as for the 30s proteins. The bottleneck for the isolation of ribosomal proteins on a large scale is centrifugation in zonal rotors. In an attempt to remove this limitation, large quantities of total proteins extracted from 70 S ribosomes were partially fractionated by salt and were further fractionated by isoelectric precipitation, column chromatography, and gel filtration. Thus, it was possible to isolate individual proteins in relatively large amounts (154). Various methods were then used to establish the identity of the proteins from various preparations. These included amino acid composition analyses, molecular weight determinations, and peptide maps. In addition, two other methods have proved to be extremely useful for identifying the proteins and for correlating proteins isolated in different laboratories (Table I) by different separation methods (513). These are immunological techniques and a two-dimensional electrophoresis method (157). Using the latter method, one can immediately identify any single protein by mixing it with a small amount of total 70 S protein and establishing the position of the intense spot relative to the weak ones (137).

B . Number of Proteim

It first became obvious from the electrophoretic studies of Waller (306) that ribosomes contain a heterogeneous mixture of proteins. I n order to determine the exact number of ribosomal proteins, it was necessary to characterize the isolated proteins, both chemically and physically, and to establish that none were either aggregates, modifications, or degradation products of other proteins. The fastest and best method for resolving each of the ribosomal proteins is two-dimensional polyacrylamide gel electrophoresis (157), by which the protein moiety of the 30s subunit was resolved into 21 spots and that of the 50 S into 34 spots (156). A typical two-dimensional pattern of 70s ribosomal protein is given (Fig. 1 ) . Proteins from the small subunit are prefixed by S, and large subunit proteins by L. It was established that each spot corresponds to only one ribosomal protein by isolating each ribosomal protein by chromatographic methods and characterizing it by two-dimensional electrophoresis. The results, together with an immunological characterization of the isolated proteins (271, 272), showed that all spots correspond to single proteins, not to artifach, such as aggregates or modified proteins (158) . C . Molecular Weights The molecular weights of E. wli ribosomal proteins (Tables I1 and 111) were determined by equilibrium sedimentation (64, 79) and by poly-

STRUCTURE OF BACTERIAL RIBOSOMES

28 1

FIG.1. Characteristic twodimensiond polyacrylamide gel electrophoresis run of total 70s ribosomal protein from Escherichiu coli. Small subunit proteins are prefixed with an S, and large subunit proteins with an L. From Kaltschmidt and Wittmann (166).

acrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (79,296). The values for the 30 S ribosomal proteins lie within the range 10,000-65,000, with a number average of approximately 19,000. Except for one protein (Sl), which has a much higher molecular weight, the molecular weights of a11 other 3 0 s proteins are in a relatively small range between 10,OOO and 30,OOO. This range also applies to the 50s proteins.

D . Stoichwmetry The sum of the molecular weights of the individual proteins of the 30 S subunit (about 400,000) is higher than the molecular weight of the pro-

TAEILE II Comparison of Molecuhr W e ~ h t of s SO S Rihomal Proteins D d m i n e d in Three 1,aboborahies Berlin (79)

Berlin code

s1

sns gels

Equilibrium sedimentstion

Bhqiiilibrium sedimentation

Chemical

code 1

@5,0oO

31,000 27,300 14,200

Cppsda,

65,000 28,300 28,200 26,700 19,600

24,000 23,000

23,000 18,500

4a 9 10 3

57

22,100

26,000

-

S8

15,500 16,200

15,500 14,500 18,000

2a 12

15,000 14,000 14,000 13,000 13,000

5 15b 12b

52 83 54 S5

S6 s9

SlO 511 s12 s13 S14

S15

816

517

S18

s19 d20 521

15,800

12,400

15,500

17,200

14,900 14,000 12,500 11,700 10,900 12,200 13,100 12,000 12,200

Geneva ($96)

Uppsala (84)

I

15,500

10,500 14,000 12,500 13,500

2

4

11

14

6 7 12a 13 16 15a

30,W .33,OOo

25,700

=,ooQ 18 ,ooo -

17,600 21 ,ooo 16,000 18,300 19,Ooo I

15,600 13,200 13,500 10,700 14,600

15,000

14,000 13,000

method

19,300 16,200

18,OOO -

19,OOo 13,500 14,800 16,300

16,000 -

14,200

15,800

11,700

15,600 11,Ooo 13,000 12,000 15,700

Geneva code 13 I

10b -

8b la

-

SDS gels

m8,m

29,900

-

20,200 13,500

-

11

29,800

5

16,200

6 4c -

-

4b 3

4a 2s. 1

10,500 14,500

-

10,700 9,8OO/12,900 9,600

-

11,400 10,800

x

RI

H

td

c

1 P

3 x

I”

4E z

2

283

STRUCTURE OF BACTERIAL RIBOSOMES

TABLEI11

Molecular Weights ( M W ) of 60 S Ribosomal Proteins of Escherichia coli K (79)

Protein

MW (SDSP

L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 L11 L12 L13 L14 L15 L16 L17

26,700 31,500 27,000 25,800 22,000 22,200 13,400 17,300 17,300 19,000 19,600 13,200 17,800 16,200 17,500 17,900 16,700

22,000 28,000 23,000 28,500 17,500 21,000 15,500 19,000 NDc 21,000 19,000 15,500 20,000 18,500 17,000 22,000 15,000

L18 L19 L20 L21 L22 L23 L24 L25 L26 L27 L28 L29 L30 L31 L32 L33 L34

MW (SDS)

MW (Eq. Sed.)

14,300 14,900 17,200 13,900 14,800 12,700 14,300 12,000 12,000 12,700 12,300 10,000 11,200 10,000 10,500 10,500 9,600

17,000 17,500 16,000 14,000 17,000 12,500 17,500 12,500 12,500 12,000 15,000 12,000 10,000 ND ND 9,000 ND

tein moiety in this subunit (260,OOO-300,000). This finding, together with the nonstoichiometric preparative yields for some of the proteins led to a proposal of a heterogeneous 30 S subunit population in E. coli (161). This hypothesis was further supported by direct measurements with chromatographic and electrophoretic techniques (SOS, 307) of the average copy number for each 30 S subunit protein per single 30 S ribosomal subunit. It was shown that, besides proteins which occur in one copy per particle (“unit” proteins), there are also proteins which are not present in all particles (“fractional” proteins). I n contrast to the 3 0 s proteins, there is good agreement between the sum of the molecular weights of the 50s proteins (560,000) and the molecular weight of the protein moiety in the large subunit,. However, direct determination of the copy numbers for the individual 50 S proteins revealed a rather complicated picture (307) : Besides fractional and unit proteins, there are several proteins which are present in more than one copy per 50 S particle. Among them are the almost identical proteins L7 and L12, for which the sum of their copy numbers approaches three (190, 286, SOT).

The possibility that the heterogeneity of the ribosome population is due

284

ROGER A. GARRETT AND H. G . WITTMANN

to artifacts, such as differential loss of individual proteins during the isolation of ribosomes, can be ruled out. It has been shown with differentially labeled E . coli cells grown under different conditions and mixed before grinding that three proteins, namely S6, S21, and L12, are present in about three times greater amount in ribosomes from the rich than from the minimal medium (74, 7 5 ) .

E. Amino Acid Composition Determination of the amino acid compositions of 30 S proteins (64, 97, 153) and of 50 S proteins (153,195) showed that most ribosomal proteins differ in their amino acid compositions. The exception involves two proteins from the 50 S subunit (L7 and L12) which have indistinguishable amino acid compositions but can be separated by column chromatography and gel electrophoresis. Most of the ribosomal proteins have a rather low content of aromatic amino acids and are relatively high in basic amino acids, a property that is reflected in their high isoelectric points. Some proteins are very rich in certain amino acids (153, 189, 196), e.g., arginine (21 moles %) in S21, alanine ('24 moles %) in L7 and L12, lysine (21 moles %) in L33.

F. Isoelectric Points The predominantly basic character of ribosomal proteins was clear from their electrophoretic behavior (157), and from their amino acid compositions, although it was not possible to assess the degree of basicity from the latter because of the difficulty to distinguish between the acid amino acids (glutamic and aspartic acid) and their amides. The isoelectric points of the proteins were determined by two-dimensional polyacrylamide gel electrophoresis. In principle, the method involves the electrophoresis of each protein a t different pH's, and the p H of minimum mobility is taken as the isoelectric point (151). (a) Very few acid proteins with isoelectric points of about pH 5.0 are contained in the 3 0 s and 50 S subunits. (b) About two-thirds of all the proteins are strongly basic with isoelectric points of p H 10 or higher. (c) The remainder of the isoelectric points fall in the neutral to slightly basic range. All of the values are given in Table IV.

G . N-Terminal Amino Acids Waller (308) determined the N-terminal amino acids in the unfractionated mixture of the ribosomal proteins and found that there are very few different N-terminal amino acids. Those found were mainly methionine and alanine. These results have since been extended by investigating isolated proteins. Of 32 proteins investigated twelve had N-terminal methionine, ten had alanine, five contained other amino

285

STRUCTURE O F BACTERIAL RIBOSOMES

TABLEIV

The Isoelectric Points of Ribosomal Proteins from Escherichia w l i (161)

30 S

s1

52 53 s4 S5(K) 85(B) S6 S7W) S7(B) S8 s9 s10 s11 s12 S13 S14 S15 S16 517 S18 s19 s20 s21

50 S ND 6.7 12.0 10.4 9.9 10.4 4.9 12.2 12.3 9.1 >12.0 7.8 >12.0 >12.0 >12.0 >ll.O >12.0 11.6 9.7 >12.0 >12.0 >12.0 >12.0

I, 1

L2 L3 L4 L5 L6 L7 L8 L9 L10 L11 L12 L13 L14 L15 L16 L17

9.2 >12.0 9.7 7.6 9.4 10.0 4.8 6.3 6.4 7.5 9.7 4.9 10.0 12.3 >12.0 >12.0 >11.0

L18 L19 L20 L21 L22 L23 L24 L25 L26 L27 L28 L29 L30 L31 L32 L33 L34

12.0 >12.0 >12.0 8.2

11.5 9.6 10.7 9.4 ND >12.0 ND 10.0 >12.0 ND 11.3 >12.0 ND

acids; for the remaining five proteins, no free amino acids could be demonstrated (314). The latter finding could be due to the presence of N-formylmethionine which has been found as the N-terminal residue in total ribosomal protein (129).

H . Peptide M a p s In order to establish whether there are structural similarities between the various ribosomal proteins, they were digested with trypsin. The peptides were separated either by electrophoresis and chromatography on paper and on thin-layer plates (162, 194) or by column chromatography in peptide analyzers (64, 234). The results obtained clearly indicate that there are marked differences in the peptide patterns of the investigated proteins.

I . Isolation and Analysis of Peptides Direct comparison of the ribosomal protein sequences is possible only after the tryptic peptides have been isolated and sequenced and the peptides are linked together in the correct order. The peptide sepa-

286

ROGER A. GARRETT AND H. G . WITTMANN

ration is done by two methods: first, by cutting out the stained peptides from peptide maps and, second, by separating and purifying the tryptic peptides by combined column and paper chromatography. The first method is quicker and easier, but it is difficult to get consistently good analytical results owing to cross-contamination of the peptides. Furthermore, the yield of peptides is too small for further investigations, while for the second method it is possible to isolate sufficient amounts of uncontaminated tryptic peptides, not only for determining the amino acid composition, but also for sequencing. Using the latter method the tryptic peptides of 20 ribosomal proteins have been isolated and analyzed (315,316). No common peptides longer than three amino acids were present in the investigated proteins with the following exception: All (except one) peptides from proteins L7 and L12 were identical both in their amino acid composition and in their chromatographic and electrophoretic properties. As will be discussed later, these two proteins are identical in their amino acid sequences with exception of their N-terminal residue (284).

J . Primary Structure Determination of the amino acid sequence of ribosomal proteins is done for the following reasons: (a) Many E. coli mutants with altered ribosomal proteins have been isolated and studied genetically. Knowledge of the protein alterations in these mutants helps to understand the structure and function of ribosomes. (b) Complexes of small pieces of ribosomal RNA and proteins can be isolated. Determination of both RNA and protein sequences is a necessary prerequisite for an understanding of RNA-protein interaction. (c) The functions of more and more proteins in the ribosomes are becoming known. Studies on the active sites are facilitated by knowledge of the primary sequence of these proteins. (d) A definite answer about the degree of homologous structures among ribosomal proteins is possible only by comparison of their amino acid sequences. (e) Knowledge of the primary structure is necessary for X-ray analysis of proteins a t high resolution. Intensive studies have begun in our laboratory on the primary structures of those E. coli ribosomal proteins which are interesting because of a t least one of the points mentioned above. The complete amino acid sequence ($84) of protein L7 from the 50 S subunit is given in Fig. 2. It differs from that of protein L12 only in one point: L7 starts with N acetylserine, and L12 with serine. Both proteins are involved in the EF-G mediated GTP hydrolysis (36, 124, 159, $38). They are rich in alanine (24 mole %) and have a high a-helix content. The protein chain with 120 amino acids can be divided in three regions: A negatively

STRUCTURE OF BACTERIAL RIBOSOMES

287

1 5 10 15 (Acety1)-Ser -1le -Thr-Lys-Asp-Gln -1le -1le -Glu-Ala -Val -Ah -Ah-Met-Ser 16 20 25 30 Val -Met-Asp-Val -Val -Glu -Leu-Ile -Ser - A h -Met-Glu-Glu-Lys -Ph+ 31 35 40 45 Gly-Val -Ser - A h - A h - A h - A h -Val-Ala -Val -Ah - A h -Gly-Pro -Val 46 50 55 60 Glu-Ala -Ah -Glu-Glu-Lys -Thr-Glu-Phe-Asp-Val -1le -Leu-Lys -Ala 61 65 70 75 Ah-Gly -Ala-Asn-Lys-Val -Ah-Val-Ile -Lys-Alrt -Val -Arg-Gly -Ah76 80 85 90 Thr-Gly -Leu-Gly -Leu-MML-Glu- Ala-Lys- Asn-Leu -Val -Glu-Ser -Ala 91 95 100 105 Pro-Ala - A h -Leu-Lys-Glu -Gly-Val-Ser -Lys-Asp -Asp-Ala-Glu -Ah 106 110 115 120 Leu-Lys -Lys-Ala -Leu-Glu -Glu-Ala-Gly-Ala -Glu -Val -Glu-Val -Lys

-

-

FIG.2. The complete amino acid sequence of protein L7/L12. Protein L7 has an N-terminal acetylated serine. The protein contains no cysteine, histidine, or tryptophan, and it contains one monomethyllysine (MML). From Terhont et al. (284).

charged and hydrophobic N-terminal region (positions 1-55), a positively charged central section (positions 56-81) and a negatively charged and hydrophilic C-terminal end (positions 82-120). An amino acid derivative, namely e-N-monomethyl-lysine, is present in position 81 (284).

K. Immunochemical Properties Antibodies against the isolated proteins from the E. coli 30 S and 50 S ribosomal subunits have been prepared and tested with the individual proteins for immunological cross-reaction. No cross-reaction has been found among all individual 3 0 s proteins (272) and most of the 5 0 s proteins (271). There are two proteins (L7 and L12) from the 50s subunit which gave a complete immunological cross-reaction (271). This finding was the first hint for homologous structures among E . coli ribosomal proteins. Determination of the complete amino acid sequences of L7 and L12 directly demonstrated the almost identical primary structures of these two proteins (284). Whether there are other pairs of proteins with partial cross-reaction is still under investigation, but it can already be concluded from these studies that the number of proteins with homologous structure, if any, must be very low.

L. Secondary Structure By subtraction of the CD or ORD spectra of ribosomal RNA from those of intact ribosomes, an estimate of about 25% a-helix was obtained

288

ROGER A. GARRETT AND H. G. WITTMANN

for the proteins within the ribosome (52, 244, 245). A similar value was obtained for the mixture of total proteins after extraction from the ribosome (52, 244, 245). It was also found that the secondary structure of the extracted single ribosomal proteins, under acid conditions, was similar to that of the proteins in the intact ribosome (78). Some p-structure were detected in isolated proteins ( 4 9 ) . Circular dichroism studies on 20 homogeneous ribosomal proteins (78) showed that the a-helix content for most of the proteins range between 20 and 40% a t pH 4.3. Two acidic proteins from 50 S,namely L7 and L12, have higher secondary structure with 50-60% a-helix (78, 189).

111. RIBOSOMAL PROTEINS OF Escherichk coli MUTANTSAND STRAINS An efficient and convenient approach to study structure-function relationship in ribosomes is to isolate and characterize mutants with altered ribosomal components. The easiest way to find such mutants is to search for those with altered behavior toward antibiotics, e.g., resistance to, or dependence on, streptomycin, which is known to affect ribosomal function.

A . Streptomycin Mutants There are three groups of mutants with altered behavior to streptomycin: (a) mutants resistant to streptomycin, (b) mutants dependent on streptomycin, and (c) revertants from streptomycin dependence to independence. 1. Streptomycin-Resistant Mutants

I n order to find which ribosomal component is altered in mutants resistant to streptomycin, “hybrid” ribosomes composed of wild-type 30 S subunits and mutant 50s (and vice versa) were constructed and tested for streptomycin resistance in an in vitro system. It was found that only the 3 0 s subunit confers resistance (53, 7 0 ) . This finding opened the possibility of doing reconstitution experiments with 16 S RNA from the wild-type and 30s proteins from the mutant (and vice versa) and to show that the proteins (not the RNA) caused resistance. The determination of which individual 30 S protein confers resistance to streptomycin was done in the following way: The mixture of 30s proteins from the wild type and the mutant was chromatographically separated into the single proteins, and reconstitution of 30 S particles was performed using one protein a t a time from the mutant and the others from wild type. These experiments showed that protein S12 confers resistance to streptomycin (218).

STRUCTURE OF BACTERIAL RIBOSOMES

289

Protein 512 from nine streptomycin-resistant mutants of E . coli belonging to four different allele types were isolated on a large scale and investigated for amino acid replacements. It was found that only two amino acid positions (42 and 87) of the S12 protein chain were affected. The lysine residue in position 42 is replaced by asparagine, threonine, or arginine, respectively, in mutants of the allele types A l , A2, or A60. The lysine residue in position 87 is replaced by an arginine in allele type A40 (99). This result is in full agreement with genetic fine structure analysis of streptomycin-resistant mutants. It has been found that the mutants belonging to allele types A l , A2, and A60 are clustered a t one site of the gene whereas mutants of type A40 map are a t a second site which is 0.3 unit apart from the first site ( 3 3 ) . The distance of 0.3 unit in the genetic map corresponds t o 45 amino acids in protein 512. From the type of mutagens used for the induction of the analyzed mutants, conclusions about the type of mutation (transition or transversion) have been drawn ( 3 3 ) . These conclusions have been fully confirmed by the proteinchemical analysis of the mutants (99). 2. Streptomycin-Dependent Mutants

I n contrast to streptomycin-resistant mutants which grow in the presence or the absence of streptomycin, there are E . coli mutants whose growth depends on streptomycin. Analogous reconstitution and in vitro tests as described for streptomycin-resistant mutants showed that the same ribosomal protein, namely S12, confers dependence on, in addition to resistance to, streptomycin ( 2 2 ) . There are four classes of streptomycin-dependent mutants; these can be grouped according to the antibiotics on which (besides streptomycin) they also depend. Protein S12 from only one of the four classes has been analyzed, and it has been found that the same lysine residue (in position 42) which is replaced in streptomycin-resistant mutants is exchanged by a glutamine residue (99). The analysis of protein S12 from the other three classes of streptomycindependent mutants is in progress. From the results obtained so far on resistant and dependent mutants, it follows that position 42 of protein S12 is very important for the ribosomal function. Not only the ribosomal response to streptomycin (sensitive, resistant, or dependent) but also the translation fidelity of ribosomes which is strongly correlated with the allele type depends on which of the five amino acids lysine, arginine, threonine, asparagine, or glutamine is present in position 42. 3. Revertants from Streptomycin Dep,endence to Independence

Streptomycin dependent mutants can “revert” to independence. This mutation is not a true back mutation but maps relatively close to the

290

ROGER A. GARRETT AND H. G . WITTMANN

chromosomal site of the first mutation from wild type to dependence (128). It was shown by reconstitution with single proteins from streptomycin-dependent and independent mutants and by tests in a cell-free system that protein S4 is responsible for the streptomycin-independent phenotype ( 2 3 ) . This finding is in good agreement with comparison of the properties of ribosomal proteins from the revertants and their parental type by electrophoretic, chromatographic, and immunological methods ( 7 3 ) . From 100 revertants studied by two-dimensional gel electrophoresis, 26 had altered S4 proteins and 15 had altered S5 proteins whereas no altered proteins could be detected in the rest (127). The exchange of a neutral amino acid by another neutral one would not have been electrophoretically detected. Therefore i t is likely th a t much more than the 40% of the mutants with electrophoretically detectable alterations had altered proteins. This conclusion was confirmed for some of the mutants with immunological techniques (127). The alterations in protein S5 are probably single amino acid replacements whereas those in protein S4 lead generally to shorter or longer protein chains (101, 127). All the mutant 54 proteins with an altered molecular weight that have been studied bind much more weakly to the 16s RNA than protein 54 from the wild type or from mutants with S4 of the same length (see also Section V,B,l).

B. Spectinomycin Mutants Reconstitution with separated 30 S ribosomal components from E . Goli wild type and spectinomycin mutants, followed by in vitro tests, has shown that protein S5 confers resistance to spectinomycin ( 2 6 ) . This

result agrees with the finding that in comparative studies on ribosomal proteins from E. coli wild type and spectinomycin-resistant mutants only protein S5 is altered ( 2 7 ) . Protein-chemical studies on protein S5 from several of these mutants have revealed that only one amino acid is replaced per mutant protein chain and that the replacements are clustered within a very short region with only a few amino acids (100, 1OOa). Apparently this region of protein S5 is very important for spectinomycin sensitivity or resistance.

C . Erythromycin Mutants Comparison by column chromatography of the ribosomal protein patterns of E. coli wild type and several mutants resistant to erythromycin revealed an alteration in the 50s protein 50-8 (72, 217) which corresponds to protein L4 ( 3 1 0 ) . The amino acid exchanges in this protein are probably clustered in the same peptide as revealed by comparative peptide maps of the altered proteins (217). This is another example in

STRUCTURE O F BACTERIAL RIBOSOMES

291

which amino acid replacements are clustered within a very short region of the mutant ribosomal protein. Besides protein L4, another 50 S protein, namely protein L22, has been found to be altered in E. coli mutants isolated as resistant to erythromycin (311). Ribosomes from these mutant cells, when tested in an in vitro system, are, in contrast to those with altered S4 proteins, as sensitive to erythromycin as those from the wild type (281). This finding would be easily explained by an alteration in the bacterial membrane that prevents erythromycin from being transported into the cell, but then it is not easily understood why a ribosomal protein is altered. Further studies are necessary for an explanation of this interesting finding.

D. Temperature-Sensitive Mutants I n sts (starvation temperature sensitive) mutants (225) which grow a t low, but not a t high, temperature, protein S8 has been found to be altered by electrophoretic methods (311). The protein alterations in the S8 proteins of the mutants differ from each other. In contrast to the sts mutants, the cold-sensitive mutants grow a t high, but not a t low, temperature. They are assembly-defective and accumulate precursors of 30 S or 50 S subunits. In two of these mutants, protein S5 is altered (25, 205). Further experiments are necessary to clarify the relationship between altered S5 proteins, on the one hand, and assembly-defectivity and cold-sensitivity on the other hand.

E . Naturally Occurring Strains Several E . coli strains, e.g., B, C, K, and M R E 600, are being used in many laboratories. Their ribosomal proteins have been compared by chromatographic and electrophoretic techniques (155, 21 4, 276). No difference could be detected by these methods in any of the 50s proteins whereas two proteins, 55 and S7, differ among the 30 S proteins: 55: B # C = M R E = K S7: €3 = C = MRE # K

Proteins S5 from strains B and K differ by one amino acid: Glutamic acid in peptide T1 of protein S5K is replaced by alanine in T1 of S5B (317). In contrast to this point mutation, proteins S7 from strains B and K are markedly different not only in amino acid composition (21, 155, 274), but also in molecular weight: Protein S7B is about 10% shorter than S7K ( 1 5 5 ) . These differences in properties in the different strains are reflected by their different mobilities in polyacrylamide gels (Fig. 3 ) .

292

ROGER A. GARRETT AND H. G. WITTMANN

FIG.3(A) FIG.3. Patterns of 705 ribosomal proteins from Escherichia coli strains B and K after two-dimensional gel electrophoresis. ( A ) Strain B ; (B) strain K. Protein Ll1 is masked by S5K, and L6 by S5B. From Kaltschmidt et d.(155).

IV. RIBOSOMAL RNA’s

A. Sequencing Studies on Escherichia C a l i 16 and 2 3 s Ribosomal RNA’s Determining the sequence of a very large RNA molecule is an extremely

arduous and demanding task. Indeed, it has become possible only recently, owing to the brilliant technical developments of Sanger and colleagues a t Cambridge. In principle, it involves the separation of partial enzyme degradation products of the labeled RNA molecule, in the length range 25 to a few hundred nucleotides, on acrylamide gels. Individual bands are extracted and separately degraded with pancreatic ribonuclease and T1 ribonuclease; the former cuts specifically at C and U and the

STRUCTURE O F BACTERIAL RIBOSOMES

293

FIG.3(B) latter a t G. The resulting small oligonucleotides are resolved on paper electropherograms, and the nucleotide composition can be determined from the position on the chromatogram. Each of these products is subjected to a partial venom phosphodiesterase (exonuclease) treatment, and, from the chromatogram of the products, it is generally possible to derive unambiguoudy the sequence. The small oligonucleotides derived from the pancreatic and T1 ribonuclease digests overlap in sequence and by comparing the sequences it is possible t o build up a sequence of the whole RNA fragment (240,241). The first sequencing studies on the larger rRNA’s were performed on methylated fragments of 16 S and 23 S RNA’s of up to ten nucleotides in length ( 9 5 ) . Ribonuclease-deficient E. coli ribosomes were used, so as to avoid the complication of nonspecific cuts in the RNA’s. This work has been extended with rapid progress, mainly by Ebel, Fellner, and co-workers in Strasbourg. Their strategy was to resolve, and sequence,

294

ROGER A. GARRETT AND H. G. WITTMANN

as many oligonucleotides as possible, prepared by complete digestion of the RNA molecule with T1 and pancreatic ribonuclease. This approach helped to resolve the following questions: (a) Is each class of rRNA sequence homogeneous in the cell? (b) Does the ‘23s RNA have long nucleotide sequences in common with 16 S rRNA? The first question was answered by investigating the molar yield of each small oligonucleotide using a radioactive counting technique (90, 91). For the large number of oligonucleotides investigated, from both large RNA’s, most of the spots occurred a t an integral molar ratio within the limitn of error of radiation counting; only a small number of spots, less than lo%, did not. This indicates that most of the RNA molecules are sequence homogeneous, but that a few heterogeneous sequences may occur for both large RNA’s. The occurrence of a small number of heterogeneities in 16s RNA is also supported by the isolation of a few purine oligonucleotides in submolar amounts ( 2 U 1 ) . The relatively low degree of chemical heterogeneity is surprising in view of several cistrons that code for the ribosomal RNA’s (95‘7). The second question is important in the context of work on genetic origin of the ribosomal RNA’s. It was proposed, on the basis of the competitive hybridization between 16 S and 23 S RNA for E . coli DNA, that the larger RNA might have been produced by a process of “gene duplication” of the 16 S RNA genes (8, 1’75, 231). This was supported by the presence of similar methylated oligonucleotide sequences in 16 S and 23 S RNA (96). However, oligonucleotides constituting about 80% of the 16 S RNA and 10% of the 23 S VNA have now been sequenced, and there is almost no sequence correspondence (82,83, 90,92). This suggests very strongly that the inferences drawn from the hybridization studies are incorrect and that the two large RNA’s are probably genetically unrelated. The sequencing efforts have now been concentrated on the 1 6 s RNA and directed toward isolating large partial digestion fragments in the size range 30-200 nucleotides with a view to sequencing each fragment (83, 94). Several such sequences have been obtained; they are presented in Fig. 4. These have certain interesting features: (a) They reveal the presence of the “hairpin” loops which have been so extensively characterized by other techniques (see Section IV,B). The lengths of the double helical regions, and the sizes of the single-strand loops fall in the predicted size ranges. (b) The distribution of the bases is nonrandom. Certain of the base-paired regions are relatively rich in G-C base pairs and others in A-U pairs. Moreover, the single-strand loops are relatively rich in A. (c) Section C contains the first genuine heterogeneity detected in a long sequence. In a small percentage of the fragments an additional residue of A was found between position 61 and 62. The probable order

TF,-* -

G-c

T(C)(C') C u A T(C)C'O_C A T(N)C"(C) G-C TC,,,. G-c G-C

c

u

A

A

C-G C--0 C-G U-A

FIG.4. Possible secondary structures of the nucleotide sequences which have so far been determined. These structures are preliminary in that, when more extensive sequences are known, more favorable base-pairing schemes may emerge. The arrows indicate the positions of the enzyme cuts. From Fellner et al. (94).

L

~MAUU(;~CUUG,C~UC~AChUC;,UUUG,UUUG,UAACAG,UAUG,Al~C~.UG.CUCAG,AAC~,AACG,CAAG,~AAG,AGJ, (Mti,AG,CJ, G,C,ti,AG,AUG,CUti,UCG,CG,CAG

N

1 ? . ~ ~ C G , A C ~ ~ A U ( C C U l A c C U ~ , G U C JU~CC.CUAti,AUG,U~C.CCCAC,UC;,CCiC.CiCi.,Ati~AUAUG.. U G 1 ] . . CAACACC.. . . IJCG.. . . - L . C-G - . . ~ . -1

... ~

I

9'

9

R

~

.

~

;f:

~~

F

H

H'

. . . C(IVLM;,~)GGTT;*CCUUCC;titiiC(UC~lU~CUAliCGCAC'tiCCCAC1AUG~~OAUtiUAAilC ( G G A A A C l I G . U C U G , C C U G d ~ ~ ~ , AAUG G l , IAUAACACUUGG4AACOGUAGCU4AUACG. . . A G m rG B . .. .A G C U C C U C U G l A G , A C , C , G ~ A l l G A C C f f i C A ~ ~ A C U G G A A C ~ l G A G A C A C G G U C C A G A C U C C U A C G G C G ~ A G C A G U ~ A A U A l l U G C ~ C M G C A C ~ U G C C U G A W G C A- G ~ ~ A U G l l G

I'

I"

I

-

-CCCUAUGAACCAAGCCUUC~~GUUGUGAATXiGAGUAMCi1ICIIMUATlJU1IGCIJCAUUCi~I1JACCCGA~CiCAT~~~GMGC(ACJCGUACU1ICUAGCG(AC,I\g,AAC,C -h)

C"

N

m7

- ~ G l U ~ C G , G , ( A G , A G , G , G ) , ( A A G , G l C U G , ~ A C G , G l UUAAUCG ~UAAUACG,CAAG,tiAAUUACUG,CCGCG,Cti,CG,UC,UG,~,(AG,G,G,Gl I UAAAG JCUAACUCCGUGCCAG,CAC,CG,., (CACG?)

C'

C

-UCGUUUCUU~GUCACAUGUGAAAUCCCC~CUAACCCUGCGAACUGCAUCUCAUACUGGCAAGCUUG~UAGAAUUCCAG,UAG.G,~C~,,AGl.UCUCG( -

0

-(CUCAC,CCCTCCUC,ATUG,AU~,A~G,CAG.AAG,AAAG,CG,AG

I AGG ICG,G,CCUUCC,UG ~(CUAACG,(AG)G,CG~UU/\AGUCGCCUGACCCG~G,G,G,AGJlG,G,AtilUACGCCGCAAGGUUAAAACUAAAUCG.. .. tG)

0

. . . .IU U C G , CCC.UCCACG,AUA~llCCG.U*G.UGIAUGUCG (G,AC,G)ICACUUGCCCUUG~UG,Cti,AG,G,GICCUUCGAGUGCAUCACGUUUUCAGACAUGAGAAUGUGCUUCCOGGAACGGAAtiUGAGACAG4JUG.uG-

E'

?

7

E

- IIUUUG,CAUG,UCAG,CUG,CUG,UCG,UCCCG,UUC,UUG,CAACC.UG,.,CG,GG.G.G.GIAAGAACCUUACCUGCUCUUG I UG,CG,AG I-

r

-ACCCUAUAAACUCGOGUAGUGGAUUG

p ma

c

c

~

A

ACUCCCG,CC

&

m'

m'

m m,

7

- GACGUCCi%UG/ACUGUGICG

J

"1,

UUG UG

*z e z

2

C, ,JG,CCAG,AG,CG I (GGAACUCAAAGAGAGACUG,(U~ClG,CCAG,(UClG~ I AU

AAG JCAUG 4UC,CCCC,CG~G,ACI,CG,ACC ICACAGAAUIUJGCCCC(C,UG,AAUACG /UUCCCGGGCCUUCUlC, ACJGCCCCG(U1CACACCAUG

3

E

.''.

G,UG,G,CG

UCCCG?

[...AAAUGiUAGAGAUCUGI (G, AGIAA UACCG.CUC,GCCIAaG 1 UUG.m'CAACG.CAACECUUUUU(AU

M

5 3

FA?

CUACAAUC CAUACAAAGAGAGCG

t-

I

i 0

IUCUG,(AC)C.UCCGICNJ, AAC,CIGACUCCAUGAAGUCGGAAUCGCUAG I UG,UAAACG J G A U ~ C A G.. ,.

. .. AWAAACGIAC,MG,G_,JUOGCGAUGACGUCA~GUCAUCAUCGGCCCCCUUCACG CACAGGGCACACACGUG

+

1

AUAUUCICAAAAGAAGUAGGUAGICUUACCACUUUGGGGAGC CUUAACCUUG,CGIAUGIUCG CG UCI-

"5;

- UAACAAGCU(AAC,CICUAGCGGAACCUC(CG,GUUG)CAU~C4 AC.U,lAOII

FIG.5. The nucleotide sequence of 16s RNA which has so far been determined. From Fellner et al. (94).

z

STRUCTURE O F BACTERIAL RIBOSOMES

297

in which these fragments occur within the 16s RNA and the total sequence so far determined are shown in Fig. 5.

B. Secondary Structure There is strong evidence to suggest that the secondary structure of rRNA is the same within the ribosome and in isolated rRNA. This evidence derives mainly from optical rotatory dispersion (ORD) studies (24, 181, 245), infrared spectroscopy (50, 2873, and acid-base titrations (55) on isolated RNA’s and ribosomal subunits. The methods indicate that 60-70% of the nucleotides, in each of the RNA’s, is base-paired in double-stranded RNA, while the remainder exists in a single-stranded form. 1 , Single-Stranded Regions

Of the bases in RNA, 3 0 3 5 % are in single-stranded regions. At least some of these will occupy the loops at the ends of the “hairpins.” Model building studies have indicated that the minimum size for these singlestranded loops is three nucleotides (260); the maximum size is probably about 7-8 nucleotides. The single-stranded regions occur partly in a ‘[stacked” conformation, in which the polynucleotide chain is probably arranged similarly to one chain of a double-stranded RNA structure with overlapping bases (1) . The general properties of this LLstacked”conformation have been well characterized for homopolynucleotides (84) and are outlined briefly. The bases “stack” noncooperatively. The conformation “unstacks” gradually over a wide range of temperature from below 0” to above 100” ( 8 4 ) . The order of stability of the “stacked” conformation for homopolymers is G > A > C > U. The absolute amount of “stacked” conformation in single-stranded regions of rRNA’s under any given set of conditions is uncertain (60,61). Because the single- and double-strand RNA regions “melt,” in part, concurrently, i t is difficult to deduce the relative contributions to the hyperchromicity and the optical rotatory dispersion (ORD) of the two melting processes. Cox and Kanagalingam (61) explored the use of solvents which would preferentially destabilize single-strand “stacked” regions of rRNA. They found that these regions were completely and preferentially destabilized in 4 M guanidinium hydrochloride-0.01 M sodium phosphate buffer, pH 7.2 and, from the difference spectra, they estimated that the “stacked” conformation occurred in both large ribosomal RNA molecules. Control experiments on double-stranded viral RNA under these conditions indicated a slight decrease in the melting

298

ROGER A. GARRETT AND H. G . WITTMANN

range and a 4°C decrease in the melting temperature, but no change in the degree of hyperchromicity. 2. Double-Stranded R N A

By use of Fourier difference analyses of crystalline fiber X-ray diffraction patterns ( 1 ) the important structural parameters of the different conformational forms of many double-helical polynucleotides and doublestranded viral and ribosomal RNA (98) have been deduced [reviewed by Arnott (1, a ) ] . The important general information to emerge from these investigations and from the complementary crystal structure analyses of nucleotides and nucleosides is that the conformational angles of each of the nucleotide bonds found within any one structure generally have one of two or three “allowed” values which differ markedly. Furthermore, for a given conformational angle the “allowed” variation found in different structures is only about + l o ” (4, 27.9). This shows that there are relatively few possible different conformational arrangements in double-stranded ribosomal RNA. The double-helical regions of the RNA occur as “hairpin” loops within the ribosomal RNA (Fig. 4 ) . Two groups have concentrated on characterizing these regions in the isolated RNA’s. Cox and co-workers (58, 59, 60) have used physical-chemical and theoretical methods to estimate the range of sizes of these double-helical regions. Spencer and co-workers (261, 262) have isolated and characterized their primary and secondary properties by X-ray diffraction and physical-chemical methods. The following results summarize their reported work: (a) The “hairpins” constitute 60-70% of the total rRNA for both 1 6 s and 2 3 s rRNA. They contain about 35% G-C pairs and 30% A-U pairs (58, 287, 288). (b) “Hairpins” contain on average 10 base pairs (58, 59, GO), (c) The conformation of the double-stranded regions is the A-form. It appears to be a nonintegral helix of about 11% base-pairs per turn of the double helix (98). Since there is a family of A-conformations, all differing slightly ( 3 , 5 ) , there could be a mixture of the different conformations present (98). (d) The base-pairing is probably of the type proposed by Watson and Crick for DNA, but other base-pairing schemes cannot be eliminated (98).

C. Tertiary Structure Little is known about the three-dimensional organization of RNA within the ribosomal subunits, but the relatively small sizes of the ribosomal subunits suggests that the RNA is in a contracted form. It has been suggested that it forms a helix, but there is no convincing experimental evidence to support this. What is known is that the organization

STRUCTURE O F BACTERIAL RIBOSOMES

299

of the RNA structure is Mg2+ dependent. For example below 105M Mg“ no protein-RNA binding occurs (106, 252) and 30s subunit reconstitution does not occur (294). Moreover, hydrodynamic studies indicate that below M Mg2+the RNA is a very open structure which contracts with increasing Mg2+concentrations (41). Undoubtedly, such a large molecule containing short, rigid, double-stranded RNA regions, confined to the contracted A-conformation by a 2-hydroxy group on the ribose ( 5 ) , linked together by the relatively flexible single-stranded regions could form a contracted and highly complex tertiary structure within thc ribosomal subunits.

D. 5 s R N A 5 s rRNA is the lowest molecular weight rRNA that occurs in the 50s ribosomal subunits of the many organisms so far investigated. It occurs in a ratio of one molecule t o one subunit and remains associated with the subunit throughout its life cycle (148). It differs from the tRNA’s in the following properties: (a) It contains 120 nucleotides (39) compared with about 80 in tRNA. (b) It lacks pseudouracil, dihydrouracil, and methylated bases (59). (c) It has no amino acid accepting activity ( 2 3 5 ) . (d) Hybridization studies indicate that 5s RNA and tRNA cistrons occur in different positions on the chromosome (257). (e) Its rate of radioactive labeling differs from that of tRNA yet closely resembles that of the larger rRNA’s (11,103). The 5s RNA is released from the ribosome only under fairly extreme chemical conditions including (a) sodium lauryl sulfate (42, 199), (b) 2 M LiCl (178), and (c) “unfolding” the ribosome or 50 S subunit by removing the magnesium (9, 199). Only in the presence of high concentrations of free 5 S RNA, and a t low magnesium concentrations (0.1 mM) will the 5 S RNA on the native 50 S subunit exchange (48, 243). A11 of this suggests that the molecule is not very accessible in the native 50 S subunit since considerable disruption of the ribosome structure must precede its release. This is further supported by the high resistance of the 5 S RNA within the 50 S subunit to nuclease degradation even after a number of breaks have occurred in the 23 S RNA (235). The sequence of 5 S RNA from E. coli MRE 600 has long been known (38, 39). There are some sequence similarities between the two halves, and it is possible that 5s RNA evolved by gene duplication. There is some sequence variability for 5 S RNA’s of different strains of E. coli. The changes occur only a t the ends of the 5s RNA molecule. NO differences have been observed between positions 14 and 91. Both C and U were detected a t position 3, C and A a t position 12,G and U a t

300

ROGER A. GARRETT AND H. G. WITTMANN

position 13, C and U a t position 92, and G and U a t position 116 (39,

191).

The experimental results on the secondary structure of 5 S RNA are the following: The number of free adenine residues is slightly less than 10 (62, 1 4 5 ) . Two residues in single-stranded regions are accessible to a carbodiimide reagent, namely a t U,,, and a t one of the four UAG oligonucleotides in the molecule, probably in position 14-16 (163). Four T1 ribonuclease sensitive bonds occur a t positions 4 6 4 5 , 64-65, 76-77, and 79-80 (145). Additional information derives from an oligonucleotide binding method (166) and a partial nuclease hydrolysis method (18, 145, 302). They agree on single-strandedness of the regions, 10-13, 2531, and 58-64. The partial nuclease hydrolysis method indicates further that the sequence 40-44 is single-stranded and very accessible; probably because of its conformation it was unable to bind complementary oligonucleotides. Region 95-98 was shown to be single-stranded by oligonucleotide binding. Recent studies on the modification of bases in singlestranded regions by HNO,, glyoxal-I04-, and methoxamine showed that 35-41 is readily modified and probably also single-stranded ( 1 7 ) . These results are incompatible with the earlier tentative models. The closest base-pairing schemes to the above data was proposed by Madison (173) and Jordan (1.46). An important result from the partial nuclease digestion studies was the finding that region 40-44 is highly accessible. This result strengthened the case for a tRNA-5S RNA interaction in the 5 0 s subunit because this sequence is complementary to the GT.kCt sequence found in all tRNA’s ( 3 1 9 ) . Oligonucleotide binding studies have now confirmed that this sequence is, indeed, accessible on the 50 S subunit ( 8 7 ) . 5 S RNA can form stable “denatured” structures (39); two have so far been resolved both of which move faster than the native form on polyacrylamide gels (110). The transition to the denatured form occurs in urea or on heating in the absence of magnesium ( 9 , l o ) , and there is evidence that this reaction may be catalyzed, during methylated albuminkieselguhr (MAK) chromatography (230). The “native” and “denatured” forms are easily separated on methylated serum albumin or on Sephadex G-100 columns (11), and they are resolved on polyacrylamide gels. The denatured forms can be a t least partly “renatured” by heating to 60°C for 5 minutes in 10 mM magnesium ( 1 6 2 ~ ) .The reaction follows first-order kinetics and requires an activation energy of about . high energy of activation suggests that base60 kcal/mole ( 1 6 2 ~ ) This paired regions must be dissociated before renaturation can occur. Although the “renatured” form has approximately the same degree of basepairing and mobility on polyacrylamide gels as the native form, it does

STRUCTURE O F BACTERIAL RIBOSOMES

301

not reconstitute with the 5 0 s subunit “core” and the 2 M LiC1-protein extract to generate high biological activity (9,10,192). It is likely, therefore, that it has a slightly different secondary structure from the native form. It has been estimated that the “denatured” 5 S RNA has about 20% less base-pairing than the native and “renatured” forms (255).

E. Alteration of RNA’s in Mutants and by Colicin E3 E. coli mutants resistant to the aminoglycosidic antibiotic kasugamycin were shown to have a cluster of bases a t the 3‘ end of the molecule which, unlike the wild-type 16 S RNA, were not dimethylated (132). No structural changes in the proteins were detected (152). Colicin E3 inactivates in vivo (31) and in vitro (29, SO) the E . coli ribosome, by affecting the 3’ terminal end of the 1 6 5 RNA; it cleaves a 50-nucleotide fragment (31) of known sequence (94). Although no changes in the proteins of these colicin-affected ribosomes were detected (254), it was found that reconstitution of the RNA and proteins from such ribosomes resulted in the assembly of all proteins but 521. There was no reaction of colicin E3 on isolated 30 S subunits (30); the presence of 50 S subunits was essential for its action (30,32).

V. PROTEIN-RNABINDINGSITES The chemistry of the rRNA-protein binding sites is likely to be complex, and so far the factors that determine specific and cooperative binding of proteins to RNA are not understood. The early extensive investigations on whole ribosomal subunits are given first, and these are followed by the work on binding single ribosomal proteins to 16 S, 23 S, and 5 s RNA.

A . Early Experiments on Protein-RNA Interaction in the Ribosome Two general conclusions were made from experiments on the specificity of protein-RNA interactions in ribosomes before single protein-RNA interactions were investigated. These were, first, that the proteins preferentially interact with single-strand regions of the RNA, and second, that they bind preferentially to G-C-rich RNA regions. The evidence for these two types of specificity is given below. First, Cotter et al. (52) interpreted the similar hyperchomic effect and melting range of isolated rRNA and dissociated yeast ribosome subunits, on heating in 0.1 M NaCl, 1 mM Tris a t pH 7.2, to mean that the proteins do not bind to and stabilize the double-stranded regions. TWOassumptions are implicit in this conclusion: (a) The proteins, which are predominantly basic, could stabilize the short double-helical regions found in rRNA. (b) The proteins do not change their binding sites during

302

ROGER A. GARRETT AND H. G. WITTMANN

melting. Assumption (a) derives from the stabilizing effect of basic proteins and polypeptides on double-helical DNA and analogs. Assumption (b) is less certain but there is no evidence to the contrary. It was later shown, however, that even if these assumptions are valid, the melting process of partially “unfolded” E . coli subunits involves complex conformational changes in the ribosome and, moreover, the melting temperature (Tm)is critically dependent on the metal ion, and especially the Mg2+concentration (41, 278). The T , values increased with increasing Mg2+up to a t least about lo-‘ M Mg2+. This was the highest Mg2+concentration a t which it was possible to measure the T, values of both ribosomes and rRNA, without the former precipitating. Under these conditions the ribosome subunits are dissociated but not “unfolded.” The ribosome T , value was 7°C higher than that of the rRNA. This difference is significantly higher than the 2°C difference observed by Cotter et al. (62) for dissociated, but not “unfolded,” yeast ribosomal subunits. It suggests that there may be some stabilization of doublestranded regions by the proteins in the E . coli ribosome. The second conclusion concerning the base specificity of the proteinRNA interaction arises from the work of Moller et al. (187). They degraded “unfolded” ribosomes to completion with both specific and nonspecific endonucleases, in low salt, a t pH 8. A precipitate formed which contained 15% of the total rRNA and almost all of the basic proteins. The RNA fragments were heterodisperse and had a nucleotide residue chain length of 28 ( 27) ; the fragments produced by the nonspecific enzymes were relatively rich in G and C compared with total rRNA. The ratio of the number of proteins to the number of RNA fragments was approximately one. It was assumed that the RNA fragments that were protected against nuclease digestion by the proteins were the protein binding sites, and that a specific interaction of the proteins with G-C rich regions of the RNA existed. Later, rRNA fragments which were believed to be the protein binding sites, were isolated from rat liver ribosome subunits that were not “unfolded” (224). The specific fragments obtained by T1 ribonuclease digestion were in the same size range and constituted approximately the same percentage of the total rRNA as for the E. coli ribosomes. These fragments were even richer in G (52%) than the E. coli rRNA fragments (40%).

B. Binding of Single Proteins t o Ribosomal R N A Since the above concepts were developed, more detailed work on binding single proteins to rRNA has been performed. One important aspect of this work is that it provides a means of investigating, and characterizing, the regions of the RNA and protein that interact at the protein

STRUCTURE OF BACTERIAL BIBOSOMES

303

binding site. This is important both for establishing the order of proteins along the RNA, and, eventually, for establishing structural organization of the proteins and RNA within the ribosome. Preliminary work along these lines is now considered. 1 . Binding to 1 6 s RNA

Mizushima and Nomura (185) first studied the binding of the single 30 S proteins to 16 S RNA under the 30 S subunit reconstitution conditions. It was shown that only two proteins, 54 and S8, bound in their native binding stoichiometry of one protein molecule per 16 S RNA, whereas S20 bound a t 50% of its native binding ratio and S7, 513, and S16 plus S17 bound very weakly. None of the remaining proteins bound under these conditions. Cooperative binding effects were observed between some of the binding proteins. More quantitative studies on binding were later performed. Schaup et al. (246, 247) and Garrett e t al. (105) demonstrated that S4, S7, 58, S15, and 520 can all form 1: 1 complexes with 1 6 s RNA. No specific binding of S16 or 517 was detected, nor of any of the other proteins. Cooperative binding effects between some of the binding proteins were also found. It was claimed, independently (320), that S13 also binds directly to 16 S RNA. Some 54 proteins isolated from “revertants” from streptomycin dependence to independence were found to have extensive sequence alterations and changes in length (77, 101). These proteins had much weaker binding affinities for 1 6 s RNA than the wild-type protein (71, 119). The binding affinity of one of these proteins could be stimulated by the presence of other 16 S RNA binding proteins. Some 54 proteins isolated from these mutants had only small alterations, probably single amino acid exchanges, and no decrease in their binding affinity for 16 S RNA was detected. It was demonstrated by Schaup and Kurland (248) that controlled digestion of 54-16 S RNA complexes yielded a protein-RNA fragment consisting of protein 54 and a mixture of RNA fragments with a total length of about 500 nucleotides. It was assumed that this RNA constituted a rather complex binding site for protein S4. Partial sequence work showed that these RNA fragments occurred in sections of the RNA sequence (2-48~).The involvement of a large section of RNA in the 54 binding site was supported by electron microscopy, which showed that up to half of the RNA was wrapped around the protein (204). Specific protein-RNA fragments have now been prepared for the other 16 S RNA binding proteins, namely, S8 (248a, 298), S15, and S20 ( 2 9 8 ) . A different approach was employed by Zimmermann et al. (320). They prepared some large fragments of 1 6 s RNA by mild ribonuclease

304

ROGER A. GARRETT AND H. G. WITTMANN

digestion. Proteins S4, S8, S15, and S20 bound to a 12 S fragment at the 5' end of the molecule, and S7 bound to a 8s fragment a t the 3' end of the RNA. I n addition, protein S15 bound to a smaller 4 s fragment which was isolated from the 12 S fragment a t the 5' end of the 16 S RNA. Although this does not give the complete order of the proteins along the RNA, extending the binding to smaller RNA fragments would. A small fragment of RNA to which proteins S8 and S15 are bound has been isolated from the 30 S subunit by controlled nuclease digestion (179a, 196). 2. Binding to 2 3 s R N A

The 23 S RNA binding properties of the 50s proteins were investigated by Stoffler et al. (269). By means of an electrophoretic and an immunological method, almost all of the 50 S subunit proteins were tested for their binding capacity t o 2 3 s RNA. Positive results were obtained for proteins L2, L6, L16, L17, L20, L23, and L24. L19 was also assigned 8s a 2 3 s RNA binding protein, but it may also bind to 16s RNA specifically (104). Weak binding of L18 to 23 S RNA was later detected (115). The binding of the first group of proteins was considered to be specific by the criterion of exclusive binding to 23 S RNA in the presence of 1 6 s RNA. Also, the binding of these proteins reached a maximum a t about a 1: 1 molar ratio with the 23 S RNA. The assignment of RNA binding properties for two of the proteins was supported by independent evidence. First L2 was shown by immunological cross-reaction (289) to correspond to the protein which remains on Bacillus stearothermophilus 23 S RNA after LiC1-urea extraction of all the other 5 0 s subunit proteins (88). Second, L24 was shown to remain bound to a small fragment of RNA after extensive trypsin and ribonuclease digestion of the E . coli 50 S subunit (65,66). The solution conditions used for binding the 5 0 s subunit proteins to 2 3 s RNA were the same as those used for the 30s protein-16s RNA binding work. And, a recent study of the dependence of binding on the solution conditions indicates that the optimal binding conditions for S4 to 16 S RNA and L24 to 23 S RNA are almost indistinguishable with respect to K', Mg2+,pH, and temperature (106). The optimal binding conditions of another protein, namely S8, to 1 6 s RNA was also very similar with respect to K', Mg2+, and pH, but there was a significant difference in the temperature dependence (252): S4 and L24 bound strongly RNA a t higher temperatures (3045°C) whereas S8 did not; S8 only bound strongly below 20°C (106,252). By controlled trypsin and pancreatic ribonuclease digestion of the 50 S subunit an L.24-RNA fragment complex was isolated (65, 66). The complex contains RNA fragments which have unique sequences

STRUCTURE OF BACTERIAL RIBOSOMES

305

and a total length of about 300 nucleotides. These fragments which occur near the 5‘ end of the 23 S RNA, are currently being sequenced. Other specific RNA fragments complexes have been isolated for proteins L20 and L23 by controlled nuclease digestion of single protein-23 S RNA complexes (299). The number and size of the RNA fragments in each complex are still under investigation. Attempts are also in progress to obtain fragment complexes for the other 23 S RNA binding proteins. The aim of this work, as for the 16 S RNA work just discussed is to find the regions of the RNA to which the proteins attach. This information is essential for building a structural model of the 5 0 s subunit. 3. Binding to 5 S R N A

Gray and Monier (117) showed that a protein-5 S RNA mixture can be split off from 5 0 s subunits by 2 M LiC1-4M urea extraction. When this split fraction was added to 23 S RNA, the 5 S RNA bound on the 3’half of the 23 S RNA (118). The proteins in the split fraction were fractionated by DEAE chromatography and it was shown, by adding different combinations of proteins to a 5 S RNA-23 S RNA mixture, that proteins L6 and L18, or L25 and L18, can effect binding of the 5 S RNA to 23 S RNA (116). Immunological studies suggested that within the complex there are two copies of L18. There was evidence also that L2 could cause some stimulation (116). Direct binding studies to 5 S RNA in the absence of 23 S RNA showed that both L18 and L25 bind whereas L6 does not. It was concluded that L6 and L18, or L25 and L18, can form a complex between 5 S and 23 S RNA (11 6 ) . It was shown that controlled pancreatic ribonuclease digestion of the complex consisting of the split fraction and 23 S RNA (114) and of a 5 S RNA-L6, L18, L252 3 s RNA complex (115) produced a small RNA fragment. A similar fragment was obtained when 2 3 s RNA and L6 were omitted from the mixture, and when L1%5 S RNA and L25-5s RNA were digested separately. The fragment was shown by sequencing to be a 40 nucleotide long piece of 5 S RNA stretching from nucleotide 69 to 110 (Fig. 6 ) . This suggested that proteins L18 and L25 bind to the same region of the 5 s RNA. However, when the RNA fragment, prepared with L18 and L25 separately, was electrophoresed in urea-polyacrylamide gels and the sequence was tested, some hidden breaks were revealed that were different for the two proteins (115). I n addition to the studies on 5 S RNA from E. coli, Horne and Erdmann (140) characterized a 5 S RNA-protein complex which was isolated from the B. stearothermophilus 50 S subunit. The complex contained mainly B-L5 and B-L22 (B denotes B . stearothermophilus) . These proteins probably correspond to L6 and L18 of the E. coli ribosomes. Although a 5 s

306

ROGER A. GARRETT AND H. G. W I T T M A N N

,-\

,

I I I I

__-_--___________

\

\

..........

G A G A G U A G G G A AIyoUG C C A G G C A U o H 120 -- - - -c G * U G * C A

C-G G-U G U U*A A G-C G*C G-C G * Cgo

u u-

FIG.6. A region of 5 s RNA to which two proteins can become associated. L18 and L25 both protect parts of this region of the molecule against pancreatic ribonuclease digestion. From Gray et al. (114, 115). RNA-protein complex could not be isolated from the E . coti 50 S subunit under similar conditions, it was shown that heterologous binding occurs between the 5 S RNA's and proteins of the two bacteria.

VI. RECONSTITUTION A N D B I o G E N E S I S OF RIBOSOMAL SUBUNITS The capacity of nucleoprotein systems to reconstitute from their constituents is a common process in vitro. What is remarkable about ribosomal subunit reconstitution is that it occurs for such a complex mixture of macromolecules. The ribosomal reconstitution procedure is a very effective and readily applicable method for investigating the structural organization of the ribosome. Its considerable scientific importance, aside from the immense chemical interest in how so many complex specific chemical interactions can occur so accurately, is that it provides a means of investigating a number of important aspects of ribosome structure and function. These include: (a) the order of assembly of the proteins and the importance of cooperative protein-protein interactions during the ribosomal assembly (185); (b) the chemistry of the protein-RNA binding sites (Section V) ; (c) which proteins, if any, are stabilized by protein-protein interactions alone; (d) the degree of conservation of protein-RNA binding sites during evolution; (e) that the structural and biological function of individual proteins can be established by eliminating single proteins from the reconstitution mixture or by including modified proteins and establishing the change in the structure

STRUCTURE OF BACTERIAL RIBOSOMES

307

and function of the ribosome. These, together with other uses of the reconstitution technique, are considered in this review.

A . SO S Subunit Reconstitution This was developed from the work of Brenner, Jacob, and Meselson

( S 4 ) , who first demonstrated the presence of protein-deficient “core”

particles in CsCl gradients. These were subsequently identified as 23 S and 40 S particles deriving from the 30 S and 50 S subunits, respectively. Subsequently it was found that the proteins that are dissociated in 2 M LiCl, the so-called “split” proteins, can be reconstituted with the “core” particles to generate biologically active subunits (119, 295). More recently, mainly owing to the efforts of Traub, Nomura, and co-workers, the experimental conditions, the chemical steps, and the kinetics of the in vitro homologous 30 S subunit reconstitution procedure for E. cotti ribosomes starting from both total 3 0 s protein and 1 6 s RNA (29f2, 294), and single proteins and 16s RNA (185) have been defined. The procedure consists of mixing either the single proteins or the total protein with the 16 S rRNA under high-salt conditions so that nonspecific electrostatic interactions between basic amino acid groups and negative phosphate groups are minimized. The conditions for maximum efficiency of reconstitution are: pH range 6.5-8.0; a t least 0.01 M Mg2+;0.3 M K’; and incubation a t 40°C for 15-20 minutes. Prior to heating, one group of 6-8 proteins seems to attach to the RNA (294). During heating, the ribonucleoprotein filament which forms, undergoes a structural change which follows first-order kinetics and is thought t o be a unimolecular rearrangement. Little is known about this rearrangement, except that i t involves a high energy of activation of 37.8 kcal/mole. Only a few sites on the free RNA can bind single proteins (Section V ) , and cooperative protein-binding effects are prevalent during the assembly (105, 185, 947). The efficiency of reconstitution of biologically active 30 S subunits is almost complete when commencing with the total protein (i.e., the same percentage fraction of the 30 S subunits are active after reconstitution as were active in the starting material). Only about half of this fraction of 30s subunits were active after reconstitution, starting with the individual homogeneous proteins. The low result for the latter is probably due to structural changes in the proteins during the lengthy fractionation procedure. The biochemical criteria used for testing the biological activity of the reconstituted 3 0 s subunits were ( a ) activity in poly(U)directed polyphenylalanine synthesis in the presence of native 50 S subunits; (b) the capacity to bind a specific tRNA in the presence of mRNA; (c) the capacity for binding a synthetic messenger RNA; (d) in vitro synthesis of enzymes (80).

308

ROGER A. GARRETT AND H. G. WITTMANN

Nomura and co-workers (209) investigated the function of proteins by omitting one protein at a time from the reconstitution mixture. They showed that six proteins are essential for assembly in that a particle sedimenting a t 30 S was not produced when they were omitted. Omission of proteins S4, 57, 58, S9, or a mixture of S16 and 517 resulted in a particle sedimenting a t less than 26 S. These proteins are present in one copy per subunit (“unit” proteins). Subunits deficient in 53, S5, S10, S11, 514, or S19 sedimented between 26 and 28s. All other proteindeficient subunits sedimented a t about 30 S. I n addition to the “structural proteins,]’ the presence of another group of proteins was essential for function of the 3 0 s subunit in polypeptide synthesis, for mRNA binding and tRNA binding. The presence of S3, S10, S11, S12, S14, and S19 was essential for these functions, and the presence of proteins S2, S5, 513, S18, S20, and S21 strongly stimulated these functions. The functional roles of Sll and S12 were investigated in

I

?

52-

512

r---T I s1 1 t---J ?

FIG.7. Revised assembly map of proteins during in vitro 30s subunit assembly. Arrows indicate cooperative interactions between thc proteins connected. Proteins contained within the dotted line are essential for assembly. From Nashimoto et al. (906).

STRUCTURE OF BACTERIAL RIBOSOMES

309

more detail. The absence of S l l increased markedly the streptomycin induced misreading of poly(U) messenger RNA. S12 had the opposite effect in that its absence produced a decrease in the misreading of the poly(U) ; it was also important for fMet tRNA binding, as was S6. Using a slightly different approach, the cooperative interactions between proteins during the assembly of the 30 S subunit were studied (185), still omitting one protein a t a time, but asking the question: Which other proteins are also not assembled? By this procedure a map of assembly showing the interdependence of the protein-binding reaction could be drawn (Fig. 7 ) . The “structural proteins” essential for assembly are enclosed within a dotted square. 512 could be added to the assembled subunit, and the position of S2 was not determined. It is still unclear whether the arrow joining two proteins in the map reflects a direct interaction of the two proteins during assembly and/or in the assembled particle. This will become clearer when the arrangement of the proteins, especially from topographical studies, is better known. However, the composition of large protein-RNA fragments, isolated from the 30 S subunit after mild nuclease digestion, strongly suggests that a t least some of the proteins joined by arrows do interact directly within the 30 S subunit structure.

B. 50 S Subunit Reconstitution The 50s subunit of E. w l i did not reconstitute readily from isolated proteins and 23 S and 5 S RNA using the same conditions as for the 30 S subunit. Although a relatively complicated reconstitution procedure giving biologically active 50 S subunits was described (179),no successful attempts a t reproducing this method have been reported. The 50s subunit of B. stearothermophilus proved more amenable t o reconstitution using conditions similar to the E. coli 3 0 s subunit conditions (208a). However, there are still considerable problems of cross-correlating the proteins with those of the E . coli ribosome. 1. Partial Reconstitution

It was demonstrated that the 50s subunit could be dissociated stepwise into a series of “cores” by selective loss of proteins a t high CsCl and decreasing Mg2+concentrations (267). These cores, in increasing order of protein dissociation were termed Q, B, Y, and 6 “cores.” A fairly large number of proteins occur in the 6 “core.” These have all been identified by electrophoretic and immunological methods [ (267a), cited in (31.2)1. Most of these proteins which have been demonstrated t o bind directly to 2 3 s RNA (269, 270) are included among these. The y core can be reversibly reconstituted in the presence of the “split” proteins t o produce

310

ROGER A. GARRETT AND H. G . WITTMANN

a 50s sedimenting subunit which associates with 3 0 s subunits t o form 7 0 s ribosomes. Although this ribosome has a rather low activity in protein synthesis it has a high peptide-bond forming activity, as judged by the N-acetyl-leucyl-puromycin reaction (267). I n the absence of a better reconstitution method, this can be used for examining the functions of the individual proteins, by omitting them, one a t a time, from the “split” protein fraction before reconstitution. Both the peptidyltransferase protein, and the chloramphenicol binding protein have been investigated using this approach. Peptidyltransferase activity and chloramphenicol binding capacity are both lost with the p-core 3 7-core transition. Proteins L6, L11, L15, and L16 are dissociated in this transition, and by adding back one a t a time i t was established that L11 is associated with peptidyltransferase activity (207) and L16 with chloramphenicol binding ( 2 0 5 ~ ) .The latter result is in agreement with analog chloramphenicol binding studies (12). Previous to the stepwise dissociation and reconstitution of 50 S subunits other, simpler, partial reconstitutions were performed. It was demonstrated that the proteins removed in 2 M LiCl could be added back to the “core” particle to yield the original level of activity in polypeptide synthesis (112,295). Also it was demonstrated that when 5 S RNA and a small group of proteins were removed by salt from the large subunit the biological activity was lost, but on reconstitution 40% of the activity in polypeptide synthesis was restored (233). 2. Complete Reconstitution

This proved much more elusive than for the 30 S subunit. Nomura and Erdmann ( 2 0 8 ~ )succeeded in reconstituting the 50 S subunit from Bacillus stearothemophilus, after unsuccessfully trying to reconstitute the E. coli 50 S subunit. The procedure was similar t o that of the 30 S subunit of E. coli (293),except that a higher optimum temperature (60” instead of 4OoC), and a longer time (1.5 hours instead of 20 minutes) are required to obtain full biological activity. Thus, the kinetics of reconstitution are slower, and a higher activation energy is required. However, even this was not complete reconstitution because one protein, B. stearothemophilus L3 [which cross-reacts immunologically with the E. coli 23 S binding protein L2 (289)] remained firmly attached to the B. steanothermophilus 2 3 s RNA when the remainder of the protein was removed by the standard LiC1-urea method. This protein was therefore already assembled before the other proteins were added back. I n subsequent studies it was shown that this protein could be removed at pH 2.0 in the presence of 4 M urea and 0.5 M Mgz+ (88). When this protein was omitted from the assembly mixture a 4 5 s sedimenting

STRUCTURE O F BACTERIAL RIBOSOMES

311

particle was produced which contained all the proteins except L3. This particle was inactive in peptidyltransferase activity and G factor and G T P binding, and it did not interact with 3 0 s subunit-Ph+tRNApoly (U) complex. However, subsequent addition of the L3 produced a 4 7 s sedimenting particle which was active in the above functions. I n order to produce such a change in the sedimentation coefficient, a small change in the shape or size of the particle may have occurred. The biochemical criteria used for establishing the biological activity of the 50 S subunit are (a) polypeptide synthesis directed by synthetic or natural mRNA; (b) peptidyltransferase assay; (c) UAA binding that is dependent on the peptide chain termination factor RI; (d) G factordependent GTP binding, and (e) codon-directed tRNA binding assayed in the presence of 3 0 s subunits (86). These tests were used t o demonstrate that although omission of 5 S RNA from the reconstitution mixture results in little or no decrease in the sedimentation coefficient of the reconstituted particle, there is very little residual biological activity by the above criteria; it was not established, however, which proteins if any, were not incorporated into this particle (85).

C. In Vivo Ribosome Assembly A comparison of the partially assembled ribosomal subunits formed both in vitro and in vivo has provided some evidence that the in vivo mechanism of ribosomal subunit assembly may resemble the in vitro mechanism. Ribosomal precursor particles have been isolated from wildtype E. coli cells (139,.206, 212) and assembly defective ribosomes (172) which accumulate in mutants (“sad mutants”) a t low temperatures (120, 121, 2U5). The precursor subparticles of the 30 S subunit sediments a t 21 S and those of the 50 S subunit a t 32 S and 43 S. The protein contents of the 21 S particle (Table V) and of the 32 S and 43 S particles (Table VI) have been characterized. The strong temperature dependence of in vitro assembly of 3 0 s subunits stimulated attempts to isolate mutants with ribosomes which were assembly defective a t low temperatures (20°C). Several such mutants were isolated (120, 275). The mutants fell into three groups: (a) mutants unable to synthesize 50 S subunits which accumulate 32 S particles a t 20°C; (b) mutants unable to synthesize 50s subunits which accumulate 4 3 s particles; and (c) mutants that exhibit a large decrease in the synthesis of both subunits and accumulate 21 S and 32 S particles. Thus, these assembly-defective ribosomes have the same sedimentation coefficients as the precursor particles. The protein composition has been determined only for the 21 S particle (205). There is good agreement between the protein content of this assembly-defective particle and the

312

ROGER A. GARRETT AND H. G. WITTMANN

Tmm v A Comparison o j the Protcin Contcnts of 00 S Subunit Prccztrsor Parliclcs Formrd in Vivo and in Vitro

In vivo 21 S subparticle

Protein

s1 s2

s3

s4 s5 S6 s7 S8 s9 s10 s11 s12 S13 S14 Slfj S16 517 S18 s19 s20 521

From precursor [Nierhaus et al. (806)l

++ +

From “sad” mutant [Nashimoto et a/. (805)l

Homann and Nierhaus (131))

Kaltschmidt ct al., cited in Nashimoto et a/. (605)

(+

-

++ + ++ f

-

-

+ + + +

I n vitro 21 S subparticle

++

I+ f

+

+

+ + +

++ + +

+(?I

+ +

+

precursor 21 S particle except for proteins S1, S5, S6, S7, and S19. It can be concluded that there are structural differences between the two particles. During the in vitro assembly of the 30 S subunit, a 21 S particle can be formed at low temperature (293). The protein content of this particle, reported from two laboratories (Table V) agree except for proteins 55 and S7. Moreover, the results closely compare with the protein content of the assembly defective 21 S particle. Although subparticles that are formed during in vitro 50 S reconstitution and sediment at about 3 2 s and 4 3 s have been detected in many laboratories, their protein contents have not been reported. The RNA’s of the three precursor particles were all shown to be undermethylated (130, 211). Also, the precursor 16 S RNA, in addition, is 150-200 nucleotides longer than the mature RNA (69). The extra length

313

STRUCTURE O F BACTERIAL RIBOSOMES

T.IIXXVI Prolcin Contcnls of 22 S and 42 S Prcc?traor Parlirlcs of fhc 50 S Sitbitnits (206) 32 s precursor

32 S precursor

precursor

+ ++ + + (+I + + + + +

~

’I,1

L2 L3 L4 LFJ L6 L7 L8/L9 L10 L11 L12 L13 L14 L15 L16

L17 L18 L19 L20 L21 L22 L23 1224 L25 L27 L28 L29 L30 L3 1 L32 LX3

43 s precursor

+ + (+1 + + + + + +

(+I

-

+ +

+

has bccn partially sequenced (37, 131, 16‘9, 258). The prccursor 5 S (96‘) and 2 3 s RNA’s are also longer than the mature form. 5 s RNA occurs a t a 1:1 molar ratio with 23 S RNA in both 32 S and 43 S precursor particles (206),whereas variable amounts of precursor RNA’s were detected in different “sad”-type mutants.

VII. THETHREE-DIMENSIONAL FORMOF

THE

RIBOSOME

A. The Shape and Size of the Ribosome and Its Subunits as Determined by Electron Microscopy and X - R a y Diffraction Analysis Applied to ribosome structure, both techniques have yielded general information about the shape and size of the ribosome, but no information about its internal organization. Electron microscopic investigations have served to confirm that the ribosome contains two different sized, compact, subunit structures. Most of the work indicates a round 50 S subunit and a ‘Lcap”-shaped 30 S subunit with a groove between the subunits (12.9, 141). There is no strong evidence for any repeating structure on the surface of either subunit. There was one claim of a 3 5 A periodicity on the 50s subunit (I&?), but this was not seen by other investigators. Projections from the surface of the 50s subunit have been detected in two reports (169a,305). There is increasing evidence, from work on the

314

ROGER A. GARRETT AND H. G . WITTMANN

small subunit of higher organisms that two sections exist (237). Evidence for a similar structure in E. coli has also recently been found (304). Much caution is needed in interpreting electron micrographs of ribosomes because partial dehydration of the highly hydrated ribosome structure may also occur on fixing and staining the ribosome and in the clcctron microscope which would lcad to some structural distortion ( 2 0 3 ) . This could explain the low electron microscopic size estimates of the ribosomal subunits rclativc to X-ray diffraction (136) and physical-chemical estimates (135). Unless there are regular periodicities in the native ribosome that can be preserved and detected, there is little hope of a detailed structural analysis by optical diffraction of ribosome electron micrographs (67). X-ray diffraction studies havc bccn only slight,ly rewarding. Certain

I o2

10 102-2 6 (radians)

FIG.8. Composite X-ray scattering ciirvcs for Exherichin coli 70 S ribosonirs and 505 subunits (-), at n 205'0 ribosome concentrntion. From Vrn:hlc et al. (301). (-----)

STRUCTURE OF BACTERIAL RIBOSOMES

315

possiblc shapcs and a structural periodicity for thc ribosomc was climinatcd on thc basis of low-angle X-ray diffraction studies on ribosomc gels (301). Figurc 8 illustratcs thc characteristic scattering profiles, with thc sccondary maxima indicatcd. It is concluded from an analysis of these profiles (301), assuming that all the ribosomal particles are identical, that the scattering profile is compatible with a spheroid particle of axial ratio of 2: 1, or greater, for both 50 S subunits and 70 S ribosomes. Hill et al. (136) estimated approximate dimensions for the ribosome and subunits from the X-ray scattering data of concentrated gels. For the 30 S and 50 S subunits they inferred that the scattering pattern derived from cllipsoids of respective dimensions 55 x 220 X 220 A and 115 X 230 X 230 A, and that the 70 S ribosome structure corresponded to an elliptical cylindcr of dimensions 135 X 200 X 400A. Furthermore, they estimated the rcspectivc radii of gyration of the 30 S, 50 S, and 70 S subunits as 69 A, 77 A, and 125 A. A recent promising development that could lead to X-ray diffraction studies on the structural organization of the ribosome in higher organisms is the improved method for inducing the ribosome microcrystal growth in the nucleus (13, 14) and cytoplasm of chick tissues (40, 176, l 7 7 ) , and in Entainoeba invadeens (198). Figurc 9 shows an electron micrograph of such microcrystals extracted from the brain tissue of chicks. Such microcrystals may be an excellent object for studying the surface structure of the ribosome by electron microscopic methods. These isolated microcrystals can be used as nuclei for growing relatively large crystals, suitable for X-ray diffraction analysis.

B. T h e Structural Organization of the Ribosome Although the ribosome particle is highly hydrated and contains up to 50% by weight of water (301), it is not very porous. It is impermeable, for example, to sucrose (301). There is a large body of evidence t o show that both RNA and proteins are accessible and inaccessible within the ribosome structure. The main evidence for a large amount of RNA being very accessible is as follows: 1. A large amount of free rRNA on the ribosome can be titrated with basic proteins (1Q2, 221), divalent cations (256) and formaldehydc (56). 2. Up to 30% of the RNA can be degraded away from the ribosome with very little change in the sedimentation coefficient (57, 24Z), a fact which suggests that there is little change in the shape of the ribosome. This is supported by electron microscopy of the degraded particles. 3. Acridinc orange hinds extensively to RNA on the ribosome (197). The fact that the dye can be reversibly removed by high molecular weight poly-L-lysine indicates that it has not penetrated into the ribosome ( 5 2 ) . 4. A nuclear magnetic resonance study of manganese ion exchange in

316

ROGER A. GARRETT AND H. G . WITTMANN

STRUCTURE OF BACTERIAL RIBOSOMES

317

the ribosome showed that 30% of the manganese exchanges extremely quickly; this result is compatible with some of the RNA being very accessiblc within or on the ribosome ( 2 5 6 ) . There is also evidence for specific regions of RNA being inaccessible, mainly from nuclease digestion studies. For example, Ehresmann and EbeI (81), performed partial nuclease digestion studies on 30 S E. coli subunits, and found a large 600 nucleotide fragment constituting about 35% of the 1 6 s rRNA molecule which was relatively resistant to nuclease attack. The following evidence indicates that some proteins are accessible while others are relatively inaccessible. 1. High concentration of salts (4 M LiCl or 6 M CsC1) removes only about one half of the total protein, the so-called “split protein,” whereas the remainder of the protein forms a very stable complex with the rRNA in the “core” particle. This contrasts with the relatively mild chemical conditions of 2 M LiCl or 2 M NaCl (7, 266) required to dissociate all the ribosomal proteins when the ribosome structure is “unfolded” by reducing the magnesium concentration (Section VII ,I). 2. Hydrogen exchange studies showed that about 30% of the exchangeable hydrogens on the protein exchanged extremely slowly, which indicates that some 30% of the protein is shielded extensively by the ribosome structure ( 5 1 ) . 3. Some proteins are much more accessible to chemical modification and trypsin digestion than others (43,6S, 65, 265). 4. Single protein specific antibodies against each of the 3 0 s proteins bind to the 30s subunit, and many of the 5 0 s protein antibodies bind to the 50 S subunit ( 2 0 0 , 2 7 0 ~ ) . I n conclusion the following results are clear for the distribution of proteins and rRNA in the E. coli ribosome: 1. A large proportion of the rRNA is very accessible to small cationic dyes and to nucleases. The accessible rRNA in the 3 0 s subunit is 6070% of the total 16 S rRNA. 2. Most of the proteins are strongly stabilized in the ribosome, and about 30% of the protein appears to be inaccessible within the ribosome.

C. Protein Accessibility o n SO S Subunits Several attempts have been made to establish how many of the 30s proteins are a t least partially accessible on the isolated 30 S subunits. FIG.9. Elcctron micrographs of ribosomr crystals from tlir cytoplasm of chick rmbryos (X100,OOO). (Photogrnph prol-idrd by Drs. M. Bnrbirri 2nd N. M. Maraldi.)

318

ROGER

A.

GARRETT AND H. G . WITTMANN

Three main methods have been used: ( a ) trypsin digestion, in which the approximate order of digestion of protcins is established; (b) chemical modification, in which the 30s subunit is reacted with various amino acid specific reagents. The proteins are then isolated and the modified proteins identified; (c) antibody binding in which the capacity of single protein specific antibodies to bind to the 3 0 s subunit can be tested by several methods. The results using the latter two approaches from various laboratories are summarized in Table VII. The trypsin digestion method gives a qualitative estimate of the relative accessibility of the proteins on the ribosomal subunit. However, it is subject to some drawbacks when applied to more quantitative interpretation. First, for example, the sensitivity of the proteins within the TABLE VII A Comparison of the Results from Different Laboratories on the Aecessibitity of Proteins on the 30 S Sub-unit Immunochemical methods [Stoffler et al. (.WOa)] ~

30 S subunit protein

s1

s2 83 s4 s5 S6 57 58 s9

s10

Sll s12 S13 S14

515 S16 517 S18 819 520 s21

Quantitative immunoprecipitation

+ + + + + + + + + + + + + + + + + + + + +

~

Sedimentation methods

+ + + + + + + + + + + + + + + + + + + + +

-

Inhibition of poly(U)dependent poly Phe synthesis

+ + + + + + + + + + + + + + + + + + + + +

Chemical modification Craven and Kahan and Gupta Kaltschmidt (63) (150)

+ + ++ + + + + + ++ +-

+ ++

In the scheme of Mieushima and Nomwa (185),this protein was studied as a mixture of 513 and 515.

STRUCTURE O F BACTERIAL RIBOSOMES

319

subunit to trypsin digestion is dependent on the protcin-RNA and on protein-protein intcraction (65, 215, 265). Second, the trypsin reaction is difficult to control. It proceeds fairly rapidly and acts on some proteins simultaneously. Although the order of protein digestion observed in different laboratories is similar for many proteins, there are also some marked disagreements. The protein modification method for testing protein accessibility also has some drawbacks. For example, if cysteinc residues are modified (63) there are some ribosomal proteins with no or only one cysteine. Also, when lysines are modified (63) it may be for RNA binding proteins that many of the lysines are interacting with the 16 S RNA, as has been found for the S4-16s RNA complex (227a). It can be concluded, therefore, that while modification of a protein indicates accessibility of the protein, no modification does not necessarily imply inaccessibility. The results are summarized in Table VII for cysteine and lysine modification (63) and for glutaraldehyde binding (150). There are many unmodified proteins, but for the rest there is relatively good agreement. The most satisfactory method appears to be the immunological method. Here single protein specific antibodies are bound to the 30s subunit. The bound antibody is then detected using the Ouchterlony and “sandwich” immunoprecipitation methods, sucrose gradient and analytical ultracentrifugation, in which subunit-antibody aggregates are detected, and inhibition of poly (U)-directed polyphenylalanine synthesis (27Oa). As shown in Table VII, antibody binding was detected for all the proteins in most of the methods. Although there were a few negative results (S15 and S17 in the Ouchterlony method, S3 and S8 in the “sandwich” method, S4 in sucrose gradients and ,319 in the analytical ultracentrifuge) in all the other methods, these proteins were judged accessible, and it was concluded that the reasons for these negative results were probably methodological (270a).

D. Protein Accessibility on 50 S Subunits Although the same three approaches (trypsin digestion, chemical modification, and immunology) have been used to investigate the accessibility of the individual 50 S proteins, there is considerably less certainty than for the 30s subunit. An immunological approach has been used with single-protein specific antisera, but so far, a thorough investigation has been performed only with the analytical ultracentrifuge and sucrose gradient sedimentation methods for most proteins (2QO). Those IgG’s studied are indicated in Table VIII. They all produced 50s subunit aggregates. Protein modification has been reported only for glutaraldehyde modification (150). A large number of proteins were not apparently

320

ROGER A. GARRETT AND H. G. W I T T M A N N

TABLEV I I I

Protein Accessibility on 60 S Subunils

Immunochemical method [Morrison el al.

Chemical modification [Kahan and Kaltschmidt (150)i

+ + + + + + + + + + + + + +

-

@Wl

Ll L2 L3 L4 Id5 L6 L7/L12 L8 L9 Ll0 L11 L13 L14 L15 L16 L17 L18 L19 L20 L21 L22 L23 L24 L25 L26 L27 L28 L29 L30 L31 L32 L33

+ +

+ + + + + +

+

-

+ + + + + + + ++-

+ +-

+ + + + + ++ + + + +

modified, as judged by their electrophoretic properties. Three reports (44, 65, 265) are available giving the relative digestion rates of the proteins by trypsin. One report (44) uses a chromatographic nomenclature that cannot yet be correlated with the two-dimensional gel electrophoresis nomenclature of the other two methods. I n both of the latter reports a group of relatively resistant proteins were found. Protein L24 is by far the most trypsin-resistant protein in the 50s subunit (66,66).

STRUCTURE O F BACTERIAL RIBOSOMES

321

I n summary, the immunological method shows, as for the 30 S subunit, that all of the proteins studied are so far accessible whereas the chemical modification method seems to indicate several inaccessible proteins. The two corrclatable trypsin digestion methods also revealed inaccessible proteins.

E. Cross-Linking of Pairs of Proteilzs on the 30 S Subunit Recently, topographical studies on the ribosome have been directed toward cross-linking and isolating pairs of ribosomal proteins. The isolation of onc such pair, namely S18 and 5321, has been accomplished in two laboratories using the reagent phenylenedimaleimide. Chang and Flaks (45) established this by the decrease in the electrophoresis peaks of the two proteins and the formation of a complex with a molecular weight equivalent to the sum of the two proteins, whereas Lutter et al. (171) first reconstituted a complex of "H-labeled S18 and I'C-labeled S21, and they could isolate a cross-linked complex containing both 3H and 14C. Second, they confirmed this result using single-protein specific antisera which gave a cross-reaction only with these two proteins (171). Using the same detection methods, but with a different cross-linking reagent dirnethyladipimidate, they were also able to demonstrate the cross-linking of S5-S8. Binding a single protein-specific antibody to one of the two proteins in the pair also effected a simple separation from the other cross-linking protein aggregates (171). Bicklc e t al. (2020)reported that S5 can also be cross-linked with S9. An imidoester cross-linking reagent was used, and the cross-linked proteins were related for electrophoretic identification by ammonolysis. Lutter e t al. (171), however, have evidence that this identification may be incorrect and that two separate protein pairs, one containing S5 and thc other S9, were not resolved. The relevance of these experiments to the structure of the ribosome can be questioned, because the yields of the cross-linked protein pairs are low and i t is known that only a fraction of ribosomal subunits are functional in polypeptide synthesis. The question arises : Do these protein pairs originate from functional, or nonfunctional and possibly damaged, ribosomes? The critical experiment is to reconstitute the crosslinked protein pair into a 30 S subunit and show that the subunit functions in protein synthesis. This Lutter and Kurland (170) have done for the S5-S8 protein pair.

F. Heterogeneity of the Ribosomal Subunits Purified ribosomes are heterogeneous with respect to their protein populations in both subunits. This has bcen established now by three

322

ROGER A. GARRETT AND H. G. W I T T M A N N

methods for the 30 S subunit and one method for the 50 S subunit. For the 30 S subunit, first the practical molar recoveries of each protein were determined (305) ; second, the protein stoichiometry was determined by an isotope dilution method (303); and third, total radioactive proteins were separated on 2-D polyacrylamide gel electrophoretograms and each protein was isolated and its radioactive counts were measured (307). The latter method was also applied to the 50s subunit ($07). The proteins were classified according to their stoichiometry. A molar ratio with the subunit of below 0.7: 1 was classified as a “fractional” protein; 0.7 to 0.8:l as “marginal”; 0.8 to 1.2:l as “unit” protein; 1.2 to 1.8:l as “fractional repeat”; and 1.8 to 2.2:l as a “repeat” protein. The stoichiometry results for the 30 S protein and for the 50 S protein are presented in Tables IX and X, respectively. The agreement between TABLE IX Stoichimetric Data for 30 S Subunit Proteins Salt-washed ribosomes [Voynow and Kurland (303)l 30 S Subunit Isotope protein dilution

s1

s2 s3 54 s5 S6 s7 S8 S9

SlO s11 s12 513 514 515 S16 S17 S18 s19 520 s21

0.14 0.55 0.71 0.89 0.80

-

0.89 0.90 1.06 0.79 0.40 0.52

-

0.89 0.83 0.73 0.60 0.61 0.34

Recovery 0.29 0.47 0.77 0.87

-

0.80 0.73

-

0.83 0.70 -

-

0.46

-

0.90 0.73 0.56 0.48 0.31

Crude ribosomes [Voynow and Kurland (503)l Isotope dilution 1.10 0.91 1.10 0.99 0.92 -

-

0.61 -

-

0.74

-

0.41 0.36

Recovery 0.95 0.83 0.84 1.08

-

0.91

-

1.00 0.91

-

0.57

-

0.80 0.48 0.50 0.38

Crude ribosomes [Weber (307)I 2-D electrophoresis 0.10 0.37 0.72 1.20 1.10 0.10 1.00 1.00

-

0.55 0.2 0.7 0.40 13.0 0.3 0.46 0.8

0.11

Assignment

F F M U U M-F U U U M-F F F M F (U 1 U U M-F F M F

323

STRUCTURE O F BACTERIAL RIBOSOMES

TABLE X Sloichiotnetric Data jor 60 S Subunit Proteins (SO'?') 50 S Subunit protein

Stoichiometry

L1 L2 L3 L4 L5 L6 L7 L8 9 L10 L11 L12 L7 L12 L13 L14 L15 L14 L15 L16 L17

1.10 0.90 1.40 0.90 1.43, 1.80 1.15 1.70 1.40 0.95 1.15 0.30 2.10 1.40 0.80 2.40 0.80 1.20

+

+

+

Assignment

U

U FIt U F11 U FR Flt or U

U

+F

U

F

F11

U (U ) U U

50 S Subunit protein

Stoichiometry

L18 L19 L20 L2 1 L22 L23 L24 L25 L26 L27 L28 L29 L30 L31 1132 L33 L34

2.1s 1.05 0.85 1,65,2.00 1.20 1.60 1.40 0.20 0.75 0.45 1.10 0.90 (0.60) (0.50) -

Assignment

R

U

(F) U

It U

FR FIL F M F U U (F) F F

-

I

the three methods is good for most of the 3 0 s proteins. For the crude ribosomes the stoichiometric values tend t o be higher, probably because the salt washing removes small amounts of some proteins, especially S1 (125). There are notable differences between the 2-D electrophoresis method, and the recovery and isotopic dilution method for S1, S2, S6, S10, S18, and S21. The apparent discrepancy for S6 and S21 may be explained by the fact that the cells of Voynow and Kurland (303) wcre grown in a rich medium whereas those of Weber (307) were not: it has been demonstrated, independently, that the stoichiometry of these two proteins depends strongly on the cell growth medium ( 7 4 , 7 5 ) . The heterogeneity results led to two hypotheses for ribosome function: first, that different classes of ribosomes exist with different functions during protein synthesis (heterogeneity concept) ; second, that proteins can move from one ribosome to another in order to facilitate specific steps during protein synthesis. Functional evidence in support of the heterogeneity concept is discussed in Section VII1,B. On the 50s subunit there are several proteins that exist in more than one copy per 50s subunit. The structural or functional importance of this is still unknown. The proteins L7/L12 exist in two to four copies per subunit (190, 286), probably three (286). The amount present, as

324

ROGER A . G A R R E T T A S D H. G. WITTJIANN

for S6 aiid S21 on the 30 S subunit, also depcnds on the growth conditioiis for the cells (74, 7 5 ) .

G. Protein-RiYd Fragments of the SO i3 Subunit Digesting the 30 S subunit with T1 or pancreatic rihonuclcrtsc, in the prcscncc of 2 ili iirca :tiid a t diffcrciit niagncsium conccntratioiis, yicldccl discrctc Init complcx protcin-RNA fragments (35, 196). Tlic protcins on tlic RNA fragments wcrc cliaractcrizcd hy oiic-tliiiiciisioiial gc.1 clcctropliorcsis wliicli rcsolvcd all protciiis cxccl)t S14 and S19. The fragments wcrc coiisitlcrcd to bc spccific bccausc tiic protein-RNA molar ratios wcrc npproximatcly 1: 1 for cncli protcin. The molccular w i g h t s of tlic protein-RNA fragmcnts wcrc dctcrininccl on 5% polyarrylamitle gels (196). Tlic 1)rotcins on tlic diffcrcnt fragmcnts are listcd in Table XI togctlicr with tlic molccular wciglits of tlic protcin-RNA complcxcs. A fragment similar to fragment No. 7 with the attcndant 16 S RNA binding protcins S8 and S15 attaclicd was also isolatcd indepcndcntly by a slightly diffcrcnt incthod ( l 7 9 n ) . Tlic prcscncc of thesc protcins associated with R N A fragments docs not necessarily i n e m that they are primarily bound to RNA; protein-protcin intcractions arc probably also important. Indeed, only four, or possibly fivc, of tlic proteins associatcd with thc fragnicnts bind dircctly to 16 S RNA. Ribosomal protcins Sl, S2, S3, S4, S5, S11, S12, and S18 liavc not yct 1)ccn isolatcd in siicli protein-RNA fragmcnts. It was also claimcd that a corrclation cxists lxtwccn tiic protcin composition of tlicsc protein-RNA complcxcs and tlic corrcctcd 30 S subunit nsscmbly map of 3lizushima aiid Nomura [ (185), also scc (205)] (Fig. 7), in that each discrete fragment contains proteins in one region of the assembly map. Othcr results on thc isolation of proteinT.\IILEXI The Protein Content of SpcciJic Ribosomal Frapncnts Zsolatd from SO S Subunits (106) Ribonuclease used

Fritgment 1 2 3 4 5

6

7 8 9

Proteins in fragment S7, SO, S14, (819)

S7, S9, SlY, S14, (SlO) S7, S9, S10, S13, S14, (SlO) S7, S9, 810, Sl3,S14, (Sl9) S7, S9, S13, S14, (Sl9), S20 87, 69, S10, S13, Sl4, (SlO), 520 S8, 515 S6, S20, S21?, Sl6, (817) S8, S6, S20, S21?, Sl5, S16(17)

TI

+ + + + +

Pancreatic

+ +

+ + +

STRUCTURE OF BACTERIAL RIBOSOMES

325

RNA complexes from the 3 0 s subunits (236, 249) were reported, but in case were control experiments ~xrformed,for example protein :RNA stoichiomctric measurements, to establish that the fragments were specific complexes. I n two 30 S subunit fragmentation studies, three (249) and four (236) fragments were isolated. I n the first study, fragments sedimenting a t 22 S, 15 S, and 7 S were isolated (249). There was marked protein overlap between the three fragments. The 22 S particle contained most of the proteins, the 15 S particle slightly less and the 7 S particle only about half of the 3 0 s proteins. I n the second study, fragments sedimenting at 28S, 20S, 12S, and 4 s were isolated ( 2 3 6 ) . The 28 S particle contained all of the 30 S proteins. The 20 S particle contained about half of the proteins, and the 12 S particle Contained most of the same proteins in reduced amounts. The 4 S sedimenting fragment contained 8 proteins. 110

H . How Do the Subunits Interact? E . coli ribosomes reversibly dissociate a t approximately physiological magnesium ion concentrations (0.001 M Alg2') in vitro. Ribosome dissociation increases (a) at lower Mg" concentrations; (b) with increasing temperature; (c) increasing Kt concentrations. The 70 S ribosome is stabilized by the presence of peptidyl and amino acyl tRNA's (16, 321) and by polyamines (321). Thermodynamic constants have been evaluated for the subunit-ribosome equilibrium studies in 50 mM Tris buffer (pH 7.8) and 50 m M KCI ( 3 2 1 ) . They are AGO = -35.5 kcal/ mole (at 25"C), A H o = -70 kcal/mole, and AS = 120 e.u. The enthalpic change is dominant. The detailed chemistry of the subunit interaction is clearly complex. It must a t least be sufficiently specific to prohibit like-subunit interactions. It has been inferred that conformational changes in the subunits, which involve the perturbation of hydrophobic groups or disruption of hydrogen honds, precede subunit interaction (51, 184). It was also concluded that disulfide bridges are involved in the subunit intcraction (280) ; thiol group blocking reagents p-chlorornercuribenzoate, 5,5'-dithiobis-2nitrobenzoic acid and N-ethylmalcimide all caused subunit dissociation. Although there are some 45 thiol groups in the total ribosomal proteins there arc probably none in the RNA (89). Recently, some proteins and protein-RNA interactions that occur a t the subunit interface have been identified. One 30 S subunit protein, S11, appears to bind specifically to 23 S RNA (269), and one 50 S subunit protein, L19, may also l)ind to 16s RNA (104). In addition, cxpcriments were performed in which 70s ribosomes were dissociated in the presence of protein Fah's, specific for almost all of the 70s ribo-

326

ROGER A. GARRETT AND H. G. WITTMANN

soma1 proteins. The ribosomes were reassociated and the percentage reassociation was estimated from absorbance measurements in the analytical ultracentrifuge. For the 3 0 s proteins S9, S11, 512, and S20, and for the 50 S proteins three Fab’s a marked decrease in the percentage of reassociation occurred ; other proteins gave smaller effects. Complementary experiments were performed to establish whether proteins which occur a t the subunit interface also exist partially on both subunits. IgG’s specific for single 30 S proteins were mixed, a t immunological equivalence, with the 50s and the extent of aggregation of 50s subunit was determined (104). The corresponding experiments were done t o test the presence of 50 S proteins on the 30 S subunit (104). For some of the proteins that occur a t the subunit interface, slight aggregation occurred; this suggests that when the ribosomal subunits dissociate some of the interface proteins could remain on both subunits. Evidence for these proteins being involved a t the subunit interface also derives from G T P hydrolysis inhibition by single protein specific antibodies against most of the above proteins. The G T P hydrolysis reaction requires the presence of 70 S ribosomes, and inhibition suggests that the subunits could not reassociate owing to antibody steric hindrance (134).

I. The “Unfolding” Process This process occurs when magnesium is removed from the ribosome solution by dialysis against EDTA solutions. It is characterized by a lowering of the sedimentation coefficient. The term “unfolding” is meant to imply that a large increase in the internal hydration of the ribosome occurs with, presumably, a large decrease in the number of intermacromolecular interactions (202). The gross chemical effects of the “unfolding” are that the RNA becomes more susceptible to nuclease degradation (187) and to dye and solvent binding (58, 102, 182). Furthermore, the proteins become more accessible to proteolytic enzymes (215) and to solvents (219). Ostner and Hultin (215) showed further that the resistance of ribosomal proteins to proteolytic enzymes is gradually lost as the RNA is degraded away by ribonuclease. Finally, all the proteins can be removed a t 2 M NaCl (7, 266). For both E . coli subunits, stepwise changes in the physical properties of the ribosome have been observed during “unfolding.” For the 30 S subunit, dialysis against EDTA revealed the following discrete changes in the sedimentation coefficient (111, 264, 308) : 30 S e 27 S e 17 S --+ 20 S. Although the first two steps are reversible, the 20 S particle upon increasing of Mg2+produces a subunit which sediments at rather less than 30S, with no biological activity. Changes in the 5 0 s subunit on “unfolding” have been better defined. Dialysis against EDTA produces three distinct

STRUCTURE OF BACTERIAL RIBOSOMES

327

+

steps: 50 S e (38 S to 42 S) + 29 S 19 S. The first step has been well characterized and is reversible physically (111, 264, 308). The second step is irreversible and may involve the loss of 5 s rRNA from the subunits (9). A 34-36 S intermediate that would not revert to a 50 S subunit was also reported (108). In the final stage of “unfolding” the 29 S particle reversibly decreased to 19 S as more magnesium was extracted. Tal (277, 278) has investigated these E. coli ribosome conformational changes extensively in the presence of other divalent cations. He has shown that whereas Ca2+,Sr2+,and Ba2+ (like Mg2+,and a t similar concentrations) would not reverse the “unfolding” process completely, NiZ+, Fez+, Mn‘+, and Co2+, a t the same concentrations, produced subunits sedimenting relatively normally a t 31 S and 48 S. However, it was not established whether these latter particles are biologically active. Proteins do become detached from the ribosomal subunits during the “unfolding” process. It was demonstrated electrophoretically that proteins L4 and L25, in addition to 5 S RNA, are released from the 50 S subunit (10%). The detachment of these proteins may explain why some steps during “unfolding” are apparently irreversible, in that the proteins are not reassembled in their correct positions in the ribosome structure.

J . Displacement of Proteins by Cations It has long been recognized that one can achieve preferential extraction of proteins from ribosomal particles under certain salt and p H conditions (7, 112, 139, 142, 165, 178, 253). A rapid identification of the proteins released and of the degree of preferential displacement of the individual proteins was easily possible with the development of the two-dimensional gel electrophoresis method (157). It is now clear that the “core” particles are not completely discrete in the sense that a protein is either present or absent; on the contrary, there are a range of intermediate protein stoichiometries in the core particles (139,2006). “Unfolded” ribosomes, on the other hand, produce no such “core” particles; the proteins are all gradually, not discretely, displaced by cations (7, 266). This suggests that within the native ribosome structure some proteins were strongly stabilized by protein-protein, and possibly by additional protein-RNA, interactions. The questions arise therefore: What is the relation between proteins released a t a given cationic concentration and the arrangement of proteins in the ribosome? Do proteins removed a t a given intermediate cationic strength tend to be clustered together in the ribosome? An answer to both questions, a t present, is not possible because insufficient data are available to warrant definite conclusions.

328

ROGER A. GARRETT AKD 11. G . WITTMANN

VIII. STRUCTUREFUKCTION RELATIONSHIPS OF

THE

PROTEINS

A . Ribosomal Binding Sites and Active Centers Some progress has recently been made in identifying the components involved in the binding of the various extraribosomal components which participate in protein synthesis. Some general information was discussed in the reconstitution section concerning which proteins are essential for the functioning of the ribosome. However, this approach yielded very little information about the proteins involved in the different binding sites.

I. t R N A Binding Sites There is strong experimental evidence to suggest that there are two tRNA binding sites on the ribosome, namely the acceptor (A) site and the peptidyl (P) site. The former overlaps both subunits and the latter appears to occur exclusively on the 50s subunit. Two main approaches have been used to identify the proteins involved in these binding sites. I n the first, the protein content of the 30 S subunit part of the A site was investigated by adding proteins to the subunit and establishing which caused stimulation of aminoacyl-tRNA binding; proteins S2, S3, and S14 produced a stimulation, and it was concluded that these proteins are involved in the A site (229). I n the second approach, the 50 S binding sites were investigated using covalent affinity label. I n one report (68) phenylalanyl-tRNA was modified a t the amino acid with a reactive and radioactivity labeled p-nitrophenyl carbamyl group. This was bound to the 5 0 s subunit in the presence of poly(U). After ribonuclease digestion of the tRNA, radioactive label was found in two pairs of bands in 1-D gel electrophoresis. More than one protein occurs in some of these bands and the number of radioactively labeled proteins and their identity in the 2-D gel electrophoresis nomenclature are under investigation. It was not established whether the modified tRNA was bound in the A or the P site. I n an independent study ( d 2 0 ) , the radioactively labeled peptidyl tRNA analog bromoacetylphenylalanyl tRNA was bound specifically to the 50s subunit and was demonstrated to occupy the P site. After nuclease digestion of the tRNA, radioactive label was found in two of the bands which were labeled in the other study. These two bands contained three proteins. An approximately equal amount of radioactive label was associated with the 23 S RNA.

6. Poly ( U ) Binding Addition of S1 to 30 S subunits under reconstitution conditions produced stimulation of poly(U) binding (300). It was later demonstrated that protein S1 can bind to poly(U), and that aurintricarboxylic acid, which

STRUCTURE O F RACTERIAL RIBOSOMES

329

inhibits binding of poly(U) to ri1)osomcs has the same effect on the binding of poly(U) to protein S1 ($79). It was inferred that protein S1 constitutes a t least part of the mRNA binding site on the 30 S subunit. 3. Peptidyltransferase Activity

It was first shown that stcpwisc dissociation of 50 S subunits in 4 M CsCl and dccreasing Mg?+ leads to a loss of pcptidyl tRNA activity with the detachment of a small group of proteins from p cores (267) which include L6, L11, and L15 ( 2 6 7 ~ ) .Similar more discrete cores are also produced a t different LiCl concentrations (139), and the peptidyltransferase activity was lost between 0.4 and 0.8 M LiCl when the same group of proteins were detached (139, 207). By adding back the detached proteins one at a time, it was shown that L11 confers peptidyltransferase activity. Whether this is the peptidyltransferase enzyme itself or whether it stimulates the eiizymc remains unccrtain (207).

4.

Translocation

The acidic protein L7/L12 (Fig. 2) which occurs in about three copies per 50 S subunit (190, 286) has been implicated in the translocation process. This protein with its high alanine and a-helix content and one monomethyllysine has properties in common with contractile proteins. Moreovcr, a change in its a-helix content has been detected in the presence of a large excess of G D P and G T P (36). A 50 S core particle, deficient in a few proteins, including L7/L12 is inactive in EF-G and EF-T factor dependent GTPase activity, This activity can be restored by adding back purified L7/L12 (36, 124, 159, 239, 259). It was also demonstrated (159) that antibodies specific for this protein inhibited the G-factor dependent GTPase reaction, and, later, that the EF-G-GTP-70 S ribosome complex which is stabilized by fusidic acid was inhibited only by Fab’s and IgG’s directed against L7/L12 ; those against twenty-six other 5 0 s proteins gave no inhibition ( 1 3 3 ) . These results all suggest that both elongation factors bind to L7/L12. 5. Antibiotic Binding Sites

Apart from the sites of action of kasugamycin and colicin E3 on the 1 6 s RNA, the binding sites of other antibiotics have been investigated. Iodochloramphenicol, an analog of chloramphenicol, was prepared and shown to bind only to protein L16 on the 50s subunit (12). Also, the addition of L16 to 50 S subunit core particles restored chloramphenicol binding capacity (2U5a). The binding sites of streptomycin and spectinomycin on the 3 0 s subunit have been investigated by inhibition with single protein specific Fab antibodies (28, 164). For streptomycin five

330

ROGER A. GARRETT AND H. G. WITTMANN

Fab’s inhibited binding, namely S11, S18, S19, 520, and S21; for spectinomycin four Fab’s against 518, S19, S20, and 521 inhibited binding. The most likely interpretation of these results is that these proteins occur in a cluster in the ribosome (S18 and 521 are neighbors), and the antibiotic binding site is only on one or two of them. The large Fab molecule overlaps more than one protein.

B. S O X Subunit Proteins S1. Largest ribosomal protein (MW 65,000). Partially removed from the ribosome by 0.5M NH,Cl. Added to the 3 0 s subunit under reconstitution conditions, it stimulates polyuridylic acid binding. X2, SS and 814. Fractional, marginal, and fractional proteins, respectively, which form part of the aminoacyl-tRNA binding site on the 30 S subunit (A site). Addition of a mixture of these three proteins to 30 S particles stimulates T-factor dependent binding of aminoacyl-tRNA and has no effect on poly(U) binding. All three proteins are judged very accessible on 30 S subunits (Table VII). Sd. Unit protein which is essential for 3 0 s subunit assembly. It attaches to the 5’ end of 16 S RNA and may have multiple binding sites on the RNA; it appears to be relatively inaccessible in the 30s subunit. It is altered often in length in “revertants” from streptomycin dependence to independence and its binding affinity for 16 S RNA is then decreased. It is also altered in ribosomal ambiguity mutants (ram). S5. Unit Protein. Adjacent to protein S8, and possibly also to S9. It is altered in assembly-defective ribosomal particles and appears to influence 50 S subunit assembly. Altered in spectinomycin resistant mutants and in “revertants” from streptomycin dependence to independence; probably all point mutations. Also, altered in E . coli strains. Part of the catalytic site on the 3 0 s subunit for G T P dependent Gfactor binding. S6. Most acidic 3 0 s protein with an isoelectric point of about p H 5 . Fractional protein. It is present in a 2-3 times higher amount in ribosomes from rich than in those of poor media. Its presence in the subunit is essential for the binding of formylmethionyl-tRNA. X7. Unit protein, binds to 16 S RNA and is essential for subunit assembly. Its length is different in different E . coli strains. 88. Unit protein, binds to 5’-half of 16 S RNA close to S15 and is essential for subunit assembly. It is adjacent to S5. It is altered in some temperature-sensitive mutants. 89. Unit protein, important for assembly. Occurs a t subunit interface. Probably adjacent to S5. Part of catalytic site on 30 S suhunit for GTP dependent G-factor binding.

STRUCTURE OF BACTERIAL RIBOSOMES

331

S11. Fractional protcin, binds to 23 S RNA and occurs at subunit interface. Omission of S l 1 in reconstituted 30 S subunits increases misreading of poly(U) in the presence of streptomycin. Anti-S11 can inhibit streptomycin binding to the 30 S snbunit. Sl2. Fractional protcin, binds to 2 3 s RNA hut specificity of interaction is still uncertain. It is located at subunit interface. Point mutations in S12 occur a t very few amino acid positions. It confers resistance to, and dependence on, streptomycin. Its absence in reconstituted 30 S subunits results in less streptomycin-induced misreading of poly (U) , and also in diminished formylmethionyl tRNA binding. 813. M a y bind to 16 S RNA. S15. Unit protein, binds to 16 S RNA near the center of the molecule. It is essential for assembly. 818. Fractional protein. It is adjacent to 521. Mutants with an altered 518 have been isolated. Anti-S18 inhibits streptomycin and spectinomycin binding. Modification of one cysteinc in S18 on thc 30s subunit leads t o a large reduction in tested ribosomal functions (193). S19. Fractional protcin. Anti-S19 inhibits streptomycin and spectinomycin binding. S20. Marginal protein binds to 5’ half of 1 6 s RNA. It is probably located a t the subunit interface. It has the same amino acid composition and may have homologous structure with L2G. Relatively inaccessible in the 30 S subunit. Anti-S20 inhibits streptomycin and spcctinomycin binding. S21, Smallest and most basic protein. Fractional protein. Like SG its stoichiometry varies with the cell growth conditions. Anti-S21 inhibits streptomycin and spectinomycin binding. The interaction of tRNA and mRNA is altered by modification of S21 or S11.

C. 5 0 s Subunit Proteins L2. Unit protein, binds to 23 S RNA. Cross-reacts immunologically with thc B. stenrothe,),iophilzrs 1)rotein L3 which is rcquircd for the function of the 50 S subunit. L4. Very accessible protein, released from ribosome during “unfolding.” It is altered in crythromycin-resistant mutants and in erythromycin-sensitive mutants, which are resistant to spiramycin, leucomycin, and tylosin. L6. Involved in complcxing 5s RNA to 2 3 s RNA; binds to 2 3 s RNA. It is very accessible on the 50 S subunit. L7/Ill2. Very acidic proteins, pK = 4.8; very accessible on 5 0 s su1)unit. They occur in about three copies per subunit, but the stoichiometry of L12 varies with the ccll growth conditions. They are the

332

ROGER A. GARRETT AND 13. G. WITTMANN

5 0 s subunit proteins that are esscntial for the G factor- and T factorcatalyzed reactions. L11. Unit protein, important for peptidyltransferasc activity. Ll4. Very accessible unit protein. L16. 2 3 s RNA binding protein, which is the binding site for chloramphenicol. L17. Relatively inaccessible unit protein which binds relatively weakly t o 23 S RNA. L18. Occurs in two copies per 50 S subunit, binds to 5 S RNA, and is essential for 5 s RNA-23s RNA complex formation. It binds adjacent t o I25 on 5 S RNA. L19. Very accessible unit protein; it binds to 23 S RNA and may also bind to 16s RNA. L.20, Accessible 23 S RNA binding protein. L.2.2. Two erythromycin-resistant mutants have been isolated with alterations in this protein. Ld3. Very accessible unit protein; it binds to 23 S RNA and its RNA binding site has been isolated. L Z 4 . Relatively inaccessible 23 S RNA binding protein. It is highly resistant to trypsin digestion. It binds near 5’ end of 23 S RNA. L.25. Very accessible protein; it binds to 5 S RNA. Like L4, it is removed from the ribosome during “unfolding.” L.27. Accessible marginal protein. L.28-L34. Small, very basic proteins probably all accessible on the 50 S subunit. Their functional importance is unknown. IX. RIBOSOMES AND EVOLUTION

A . The Ribosome Although the mechanism of protein synthesis in higher organisms is the same as in bacteria, marked differences in both the proteins and the RNA occur. In eukaryotic organisms, where cells are differentiated, a greater variety of proteins must he synthesized, and therefore some changes in the structure of the ribosome might be expected. This complexity is manifest in the tendency to have larger molecular weight subunits which sediment faster (46,76). This increase in molecular weight is due not only to an increase in the two larger RNA molecuIar weights (167, 168), but also to a considerable increase in the percentage of protein in the ribosome from about 357% in most bacteria to 50% in rabbit reticulocytes (76). Other properties are also different; for example, the concentration of Mg2+required for an integral ribosome decreases considerably in higher organisms whereas the degree of hydration

STRUCTURE OF BACTERIAL RIBOSOMES

333

and the size of the hydrated ribosome both increasc markedly. The physical properties of ribosomes from E . coli, yeast, rat liver, and rabbit reticulocytes and pea seedlings are summarized in Table XII.

B . Pro teins The genetic and taxonomic relationship between organisms-for example, different bacteria-are reflected in the structure of their ribosomal proteins. The ribosome structures of closely related bacteria resemble each other much more than those of distantly related ones. Thcse findings have been obtained by the comparison of ribosomal proteins from several bacteria by three independent methods : (a) column chromatography in carboxymethyl cellulose (214, 216 ) , ( b ) immunological methods ( l o g ) , and (c) two-dimensional polyacrylamide gel electrophoresis (109). The structural resemblance of ribosomes from various strains of E . coli has been described in Section II1,E. Differences in only two proteins of the 30 S subunit, namely S5 and S7, have been detected whereas the 50 S subunit proteins are indistinguishable by current methods (155, 214). A comparison of the ribosomes of one bacterial family, e.g., Enterobacteriaceae, reveals similar protcin structures as judged by thc elution profiles of the proteins from chromatography columns, by immunological techniques, and by two-dimensional polyacrylamide gel electrophoresis patterns. The protein patterns of the various genera and species of Enterobacteriaceae including Salmonella typhimurium, Shigellu dispar, Aerobacter aerogenes, Proteus vulgaris, Serratia marcescens, and Erwinia carotovora, show considerable similarities (109, 216'). Furthermore, i t was demonstrated immunochemically that the many 23. coli anti single protein sera tested reacted with ribosomes from other Enterobacteriaceae. Salmonella, Shigella, and Aerobacter ribosomal proteins were more closely related to those of E . coli than Eruinia, Proteus, and Serratia. Plesiom o m s shigelloides also shows some similarities with Enterobacteriaceae, and it has been suggested that it should be included in the latter family rather than in Pseudomonadaceae (109). Compared with Enterobacteriaceae, the bacterial family Bacillaceae is relatively heterogeneous. This was first demonstrated by column chromatography elution profiles of the proteins (216') and was confirmed by two-dimensional gel electrophoresis and immunological cross-reaction (109). On the basis of results from the latter two methods, ten members of Bacillaceae were classified into five groups. These were: (a) Bacillus Zicheniformis and B. subtilis; (b) B. megaterium; (c) 13. pumilis and B. stearothermophilus; (d) B . circulans and B. coagulans; (e) Clostridium perfringens, C. septicurn, and C . tetanomorphum. The three Clostridium species were markedly different from all the other members of this family, but they also showed marked differences from each other.

w w

rp

TABLE XI1 The Vuriation of the Physical Properties of Ribmom and Their Cmtituenls with Evolution Escheriehia

Yeast

Wli

Ribosome MW x lob Ribosomal subunits

*MW x 106 RNA subunits MW x 106

RNA:protein (Wt.%) Npl' requirements for integral ribosome

Eib","

Buoyant density (g/cm-s) Diameter of hydrated ribosome (A)

70 S (2m) 2.65 (135) 5 0 s 3 0 s (290) 1.55 0 . 9 (135) 23 S 1 6 s (160) 1 . 1 0.55 (268) 63:37 (290) 15 mill 145 (1%) 1.64 ( J l b ) 270 (136)

s

Rat liver

Rabbit reticulocyte

kd

8

Pea seedlings

9

G)

83 S (283)

78 S (76)

6 0 s 4 0 s (46) 2.7 1.4 2 5 s 19 S (174) 1.41 0.71 40:60 (47) 2 mM (46)

5.0 4 7 s 3 2 s (41b) 3.0 1.5 32 S 1 6 s (223) 1.65 0.35 50:50 (219) 1 mM (219)

4.1

50: 50 1 mM

51:49 (41b) 1 mM (41a)

113 1 . 2 (180) 280 (180)

139 ($18) 1.56 ( J i b ) -

135 ( 6 4 ) 2 . 5 (76) 340 (76)

1.57 (41b)

80 (46) 4.0

3

585 40 S 28 S 1.5

17 S (222) 0.5

78 S (41b) 3.9 55 s 35 s (41a) 2.4 1.5 -

&

2 9.

2:

t?

x

0

8

-

3cj

F

2

1:

STRUCTURE OF BACTERIAL RIBOSOMES

335

Bacterial ribosoinrs differ in important properties (e.g., in sizc, in behavior toward specific antibiotic inhibitors, in optimal Mg2+ concentration for amino acid incorporation and for dissociation into subunits) from cytoplasmic and nuclear ribosomes of eukaryotes. However, they resemble ribosomes from cell organelles (chloroplasts and mitochondria) in these properties. These and othcr findings suggested the hypothesis that there are relatively close phylogenetic relationships between bacterial ribosomes and those of chloroplasts and mitochondria. Therefore, it was of interest to establish whether or not protein structural relationships were detectable by immunological methods. These studies have so far provided no evidence for common antigenic determinants between bacterial ribosomes on one hand and those from chloroplasts on the other (144). If there are homologous structures in these two types of ribosomes, their reactions with antisera are so weak that they cannot be unambiguously demonstrated by the current immunological techniques. There are relatively weak immunological cross reactions between ribosomes from chloroplasts and from cytoplasm of the same plant species or its close relatives, e.g., bean and pea (144). Rather strong immunological relationships exist between cytoplasmic ribosomes from various plant species (e.g., tobacco, bean, spinach, wheat) whereas there are no common antigenic determinants detectable between cytoplasmic ribosomes from higher plants, on the one hand, and those from yeast, algae, invertebrates, and vertebrates on the other (144, 3’09). It can be concluded from these studies that ribosomes from different phyla (e.g., bacteria, fungi, angiosperms, anthropods, mammals) differ very much in the structure of their protein and RNA components, whereas ribosomes from different genera of the same family are structurally related, as shown for bacteria, higher plants, and mammals. The structural relationships between ribosomes from various groups of organisms have so far been investigated only to a small extent. Undoubtedly studies with ribosomes from many more species are necessary before general conclusions about thc relationship between ribosomal structure and taxonomy are possible.

C . RNA Much cvidencc is available to show that marked changes in the structure of rRNA’s havc occurred during evolution. First, gene hybridization studies provided approximate estimates of the percentage change in the base sequence of the RNA during evolution, by cross-hybridizing rRNA’s and DNA’s of different organisms (19, 210, 228, 231, 257). Second, reconstitution of heterologous ribosomal components have yielded information about the changes in both protein and RNA structure from the level of biological activity and the physical properties of

336

ROGER A. GARRETT AND H. G . WITTMANN

the subunit produced. I n the early studies i t was shown that neither 16 S rRNA from yeast nor 18 S rRNA from rat liver (210) could replace E. coli 16 S RNA in the reconstitution of biologically active E. coli 30 S subunit; indeed particles with different physical characteristics were produced. However, for some bacterial hetcrologous reconstitutions marked biological activity was observed, even when the lmcteria were genetically distant as judged by their different DNA base compositions. For example, A . vinelandii and B. stearotherinophilus 16 S RNA’s were as efficient as E . coli 16 S RNA in reconstituting with E. coti 30 S proteins t o form biologically active 30 S subunits. Also the sedimentation properties of the different heterologous particles were similar. However, the picture is complicated by the fact that the reverse lieterologous reconstitution, namely between E. wli 1 6 s RNA and A . vinelandii and B. stearothermophilus proteins was not efficient in producing biologically active subunits. Nevertheless, one can reasonably infer that the structures of E. coli, A . vinelandii, and B. stearotherinophilus 16 S RNA’s are qualitatively similar. I n order to investigate the similarity of the 1 6 s RNA sequences, experiments were performed in which each of the above bacteria was hybridized with E . coli DNA. The result was that A . vinelandii 1 6 s RNA competed very effectively with E. coli whereas that of B. stearothermophilus competed less effectively. As expected from hybridization experiments yeast 1 6 s RNA offered no competition. It was concluded from these results that the conservation of the complete RNA sequence is not required for the formation of active subunits, but that regions of RNA, presumably those interacting with protein, must be conserved. On the other hand, the whole sequence must also be important in the reconstitution since the modification of only six to eight bases in the total E. coli 16 S RNA by nitrous acid can inhibit normal reconstitution (210). I n the ribosomes of higher organisms the base composition varies and the molecular weight of the RNA is larger (Table X I I ) . One criterion developed for estimating primary and secondary structure changes in the rRNA is to compare the partial nuclease digest patterns on aerylamide gels. Partial digestion of rRNA, first observed by Aronson and McCarthy (6),was attributed to endogenous nucleases in ribosomes (188). These fragments were characterized chiefly by hydrodynamic methods (183, 188). McPhie et al. (180a) first characterized the specific degradation products of yeast rRNA molecules, by endonuclease, on acrylamide gels, and showed that patterns of RNA fragments could be reproducibly generated. Such studies were extended by Gould, Pinder, and co-workers t o other RNA’s (113, 2.27), and extensive differences were observed for RNA molecules of different genera, whereas relatively small differences

STRUCTURE OF BACTERIAL RIBOSOMES

337

were observed for the members of one genus (227). Any quantitative interpretation of the structural differences is not possible until the nature of the enzyme specificity is understood. Although for T1 ribonuclease there is a secondary structure specificity, there is also evidence from formaldehyde-denatured rRNA digestion experiments to suggest nucleotide sequence specificity (226).

ACKNOWLEDGMENTS We thanli the people who provided unpublished results. One of us (R. G . ) is grateful for many helpful discussions from colleagues a t the Medical Research Council Biophysics Research Unit, London, during the preparation of an early draft of part of this manuscript. We arc grateful to Dr. R. Cottcr for help in compiling Table M I . REFERENCES

1. rlrnott, S. (1970). Progr. Biophys. Mot. Biol. 21, 265. 2. Arnott, S. (1971). Piogr. Biophys. Mol. Biol. 22, 179. 3. Arnott, S.,Fuller, W., Hodgson, A,, and Prutton, I. (1968). Nntiiw (Lotitloti) 220, 561. 4. Arnott, S.,Hukins, D. Wr. I,. (1969). Nattue (London) 224, 886. 5. Arnott, S., Hutchinson, F., Spencer, M., Wilkins, M. H. F., Fuller, W., and Langridgc, R. (1966). Nature (Lotidon) 211, 227. 6. Aronson, A. I., and McCartliy, B. J. (1961). Biophys. J . 1, 215. 7. Atsomon, A., Spitnik-Elson, P., and Elson, D. (1969). J . Mol. Biol. 45, 125. 8. Attardi, G., Huang, P. C., and Kabnt, S. (1965). Proc. Nat. Acnd. Sci. U. S. 53, 1490. 9. Aubert, M., Monier, R., Reynicr, M., and Scott, J. F. (1967). I n “Structure and Function of tRNA and 5s RNA” (L. 0. Froholm and S. G. Laland, eds.), 1111. 151. Univcrsitetsforlaget, Oslo. 10. Aubert, M., Scott, J. F., Reynicr, M., nnd Monier, R. (1968). Ptoc. Nat. Acncl. Sci. U . S. 61, 292. 11. Bachraroff, R. J., antl Tongur, V. (1966). Nature (London) 211, 248. 12. Bald, R., Erdmann, V. A,, antl Pongs, 0. (1972). FEBS ( F e d . Euv. Biocltem. SOC.),Lett. 28, 149. 13. Barbieri, M., Pettazzoni, P., Bersani, F., and Maraldi, N. M. (1970). J. Mol. Biol. 54, 121. 14. Barbieri, M., Simonelli, L., Simoni, P., and Maraldi, N. M. (1970). J . Submiciosc. Cytol. 2, 33. 15. Beaudet, A. I,., and Caskey, C. T. (1972). I n “The Mechanism of Protein Synthesis and its Regulation” (I,. Bosch, ed.), p. 133. North-Holland Publ., Amsterdam. 16. Belitsina, N. V., and Spirin, A. S. (1970). J. MoZ. Biol.52, 45. 17. Bellemare, G., and Jordan, B. R . (1972). Unpublished observations. [Cited by R. Monicr in Fed. Eiir. Bzocliem. Soc. Syrnp. 23, 88 (1972).1 18. Bellemare, G., Jordm, I3. R., and Monier, R . (1972). J . Mol. Biol. 71, 307. 19. Bendich, A. J., and McCartliy, B. J. (1970). Pioc. Nut. Acad. Sci. U. S. 65, 349.

338

ROGER A. GARRETT AND H. G . WITTMANN

20. Bickle, T. A., Hershey, J. W. B., and Traut, R. R. (1972). Proc. Nat. Acad. Sci. U.S. 69, 1327. 21. Birge, E. A., Craven, G. R., Hardy, S. J. S., Kurland, C. G., and Voynow, P. (1969). Science 164, 1285. 22. Birge, E. A., and Kurland, C. G. (1969). Science 166, 1282. 23. Birge, E. A., and Kurland, C. G. (1970). Mol. Gen. Genet. 109, 356. 24. Blake, A., and Peacocke, A. R. (1965). Nature (London) 208, 1319. 25. Bock, A., and Wittmann, H. G. (1973). Unpublished observations. 26. Bollen, A., Davies, J., Ozaki, M., and Mizusbima, S. (1969). Science 165, 85. 27. Bollen, A., Herzog, A., and Ghysen, A. (1972). Symp. Mol. Mech. Antibiot.

Action Protein Syn. Membranes, Granada Abstr. Elsevier, Amsterdam. Bollen, A., Maschler, R., and Stoffler, G. (1972). Unpublished obsrrvations. Boon, T. (1971). Proc. Nat. Acad. Sci. U . S. 68,2421. Boon, T. (1971). Proc. Nut. Acad. Sci. U.8.69,549. Bowman, C. M., Dahlberg, J. E., Ikemura, T., Konisky, J., and Nomura, M. (1971). Proc. Nut. Acad. Sci. U . 8.68, 964. 32. Bowman, C. M., Sidikaro, J., and Nomura, M. (1971). Nature (London), New Biol. 234, 133. 33. Breckenridge, L., and Gorini, L. (1970). Genetics 65, 9. 34. Brenner, S., Jacob, F., and Meselson, M. (1961). Nature (London), 190, 576. 35. Brimacombe, R., Morgan, J., and Cox, R. A. (1971). Eur. J . Biochem. 23, 52. 36. Brot, N., Yamasaki, E., Redfield, B., and Weissbach, H. (1972). Arch. Biochem. Biophys. 148, 148. 37. Brownlee, G. G., and Cartwright, E. (1971). Nature (London),New Biol. 232, 28. 29. 30. 31.

50. 38. Brownlee, G. G., Sanger, F., and Barrell, B. G. (1967). Nature (London) 215, 735. 39. Brownlee, G. G., Sanger, F., Barrell, B. C. (1968). J. Mol. Biol. 34, 379. 40. Byers, B. (1967). J Mol. Biol. 26, 55. 41. Cammack, K. A., Miller, D. S., and Grinstead, K. H. (1970). Biochem. J. 117, 745. 41a. Cammarano, P., Pons, S., Romeo, A., Galdieri, M., and Gualerzi, C. (1972). Biochim. Biophys. Acta 281, 571. 41b. Cammarano, P., Romeo, A., Gentile, M., Felsani, A., and Gualerzi, C. (1972). Biochim. Biophys. Acta 281, 597. 42. Cannon, M., and Richards, E. G. (1967). Biochem. J. 103,23c. 43. Chang, F. N., and Flaks, J. G. (1970). Proc. Nat. Acad. Sci. U . S. 67, 1321. 44. Chang, F. N., and Flaks, J. G. (1971). J . MoE. &oE. 61,387. 45. Chang, F. N., and Flaks, J. G. (1972). J . Mol. Biol. 68, 177. 46. Chao, F. C. (1957). Arch. Biochem. Biophys. 70, 426. 47. Chao, F. C., and Schachmann, H. K. (1956). Arch. Biochem. Biophys. 61, 220. 48. Comb, D. G., and Sarkar, N. (1967). J. Mol. Biol. 25,317. 49. Cotter, R. I., and Gratzer, W. B. (1969). Eur. J. Biochem. 8, 352. 50. Cotter, R. I., and Gratzer, W. B. (1969). Nature (London) 221, 154. 51. Cotter, R. I., and Gratzer, W. B. (1971). Em.J . Biochem. 23, 468. 52. Cotter, R. I., McPhie, P., and Gratzer, W. B. (1967). Nature (London) 216, 864. 53. Cox, E. C., White, J. R., and Flaks, J. G. (19641. Proc. Nut. Acad. Sci. U . 8. 51, 703.

STRUCTURE OF BACTERIAL RIBOSOMES

339

54. Cox, R. A.

(1965). Fed. Eur. Biochem. SOC.Symp., Vienna p. 65. Pergamon, Oxford. 55. Cox, R. A. (1966). Biochem. J . 98, 841. 56. Cox, R. A. (1969). Biochem. J . 114, 743. 57. Cox, R. A. (1969). Biochem. J . 114, 753. 58. Cox, R. A. (1970). Biochem. J . 117, 101. 59. Cox, R. A., Gould, H., and Kanagalingam, K. (1968). Biochem. J . 106, 733. 60. Cox, R. A., and Kanagalingam, K. (1967). Biochem. J. 103, 431. 61. Cox, R. A., and Kanagalingam, K. (1968). Biochem. J . 108, 599. 62. Cramer, F., and Erdmann, V. A. (1968). Nature (London) 218, 92. 63. Craven, G. R., and Gupta, V. (1970). Proc. Nut. Acad. Sci. U . S. 67, 1329. 64. Craven, G. R., Voynow, P., Hardy, S. J. S., and Kurland, C. G. (1969). Biochemistry 8, 2906. 65. Crichton, R. R., and Wittmann, H. G. (1971). Mol. Gen. Genet. 114, 95. 66. Crichton, R. R., and Wittmann, H. G. (1973). Proc. Nut. Acad. Sci. U. S. 70, 665. 67. Crowther, R. A., Amos, L. A., Finch, J. T., de Rosier, D. J., and Klug, A. (1970). Nature (London) 226, 421. 68. Czernilovsky, A. P., and Kuechler, E. (1972). Biochem. Bwphys Res. Commun. 272, 667. 69. Dahlberg, A. E., and Peacock, A. C. (1971). J . Mol. Biol. 55, 61. 70. Davies, J. E. (1964). Proc. Nut. Acad. Sci. U. S. 51, 659. 71. Daya-Grosjean, L., Garrett, R. A,, Pongs, O., Stoffler, G., and Wittmann, H. G. (1972). Mol. Gen. Genet. 119, 277. 72. Dekio, S., Takata, R., Osawa, S., Tanaka, K., and Tamaki, M. (1970). Mol. Gen. Genet. 107, 39. 73. Deusser, E., Stoffler, G., Apirion, D., and Wittmann, H. G. (1970). Mol. Gen.

109,298. 74. Deusser, E., and Wittmann, H. G. (1972). Nature (London) 238, 269. 75. Deusser, E. (1972). Mol. Gen. Genet. 119, 249. 76. Dinteis, H. M., Borsook, H., nnd Vinograd, J. (1969). I n “Microsoma1 Particles and Protein Synthesis” (R. B. Roberts, ed.), p. 95. Pergamon, Osford. 77. Donner, D., and Kurland, C. G. (1972). Mol. Gen. Genet. 115, 49. 78. Dzionara, M. (1970). FEBS (Fed. Eur. Biochem. Soc.), Lett. 8, 197. 79. Dzionara, M., Kaltschmidt, E., and Wittmann, H. G. (1970). Proc. Nut. Acad. Sci. U . S. 67, 1909. 80. Egberts, E., Traub, P., Herrlich, P., and Sehweiger, M. (1972). Biochim. Biophys. Acta 277, 681. 81. Ehresmann, C., and Ebel, J.-P. (1970). Eur. J . Biochem. 13, 577. 82. Ehresmann, C., Fellner, P., and Ebel, J.-P. (1970). Nature (London) 227, 1321. 83. Ehresmann, C., Stiegler, P., Fellner, P., and Ebel, J.-P. (1972). Biochimze 54, 901. 84. Eisenberg, H., and Felsenfeld, G. (1967). J . Mol. Biol. 30, 17. 85. Erdmann, V. A., Fahnestock, S., Higo, K , and Nomura, M. (1972). Proc. Nat. Acad. Sci. U. S. 68, 2932. 86. Erdmann, V. A,, Fahncstock, S., and Nomura, M. (1973). Methods in Enzymology, Academic Press, New York. (to be published). 87. Erdmann, V. A., and Pongs, 0. (1973). Unpublished observations. 88. Fahnestock, S., Erdmann, V. A,, and Nomura, M. (1973). Biochemistry 12, 220.

340

ROGER A. GARRETT AND H . C. WITTMANN

89. Fellner, P. (1972). Unpublished obscrvations. 90. Fellner, P., and Ebel, J.-P. (1970). Nntitre (Lonrlo?~)225, 1131. 91. Fellner, P., Ehresmann, C., and Ebel, J.-P. (1970). Nature (London) 225, 26. 92. Fellner, P., Ehresmann, C., and Ebel, J.-P. (1972). Biochimie 54, 853. 93. Fellner, P., Ehresmann, C., Ebel, J.-P., and Blasi, 0. (1970). Eur. J. Biochem. 13, 583. 94. Fellner, P., Ehrcsmapn, C., Sticglcr, P., and Ebel, J.-P. (1972). N a t w e (London), New Biol. 239, 1. O T L236. ) 95. Fellner, P., and Sangei, F. (1968). Nutnie ( L O ~ Z ~219, 96. Feunteun, J., Jordan, B. R., and Monier, R. (1972). J. Mol. Biol. 70, 465. 97. Fogel, S., and Sypherd, P. S. (1968). Proc. Nut. Acad. Sci. U . S. 59, 1329. 98. Fuller, W., Hutchinson, F., Spencer, M., and Wilkins, M. H. F. (1967). J. Mol. Biol. 27, 507. 99. Funatsu, G., and Wittmann, H. G. (1972). J . Mol. Biol. 68, 547. 100. Funatsu, G., Nierhaus, K., and Wittmann-Liebold, B. (1972). J . Mol. Biol. 64, 201. 100a. Funatsu, G., Schiltz, E., and Wittmann, H. G. (1971). Mol. Gen. Genet. 114, 106. 101. Funatsu, G., Puls, W., Schiltz, E., Reinbolt, J., and Wittmann, H. G. (1972). Mol. Gen. Genet. 115, 131. 102. Furano, A. V., Bradley, D. F., and Childcrs, L. G. (1966). Biochembtry 5, 3044. 103. Galibert, F., Lelong, J. C., Larsen, C. J., and Boiron, M. (1967). Biochim. Biophys. Acta 142, 89. 103a. Garrett, R. A., Gray, P., Stofflcr, G., and Monier, R. (1972). Unpublished observations. 104. Garrett, R. A., Morrison, C., Tischcndorf, G., Zeichardt, H., and Stoffler, G. (1972). Unpublished observations. 105. Garrett, R. A., Rak, K. H., Daya, L., and Stoffler, G. (1971). MoZ. Gen. Genet. 114, 112. 106. Garrett, R. A., and Schultc, C. (1972). Unpublished observations. 107. Garrett, R. A., and Stoffler, G. (1972). Unpublished observations. 108. Gavrilova, L. P., Ivanov, D. A., and Spirin, A. S. (1966). J. Mol. Biol. 16, 473. 109. Geisser, M., Stoffler, G., and Wittmann, H. G. (1972). Unpublished observations. 110. Geroch, M. E., and Richards, E. G. (1970). Unpublished observations. 111. Gesteland, R. F. (1966). J. Mol. Biol. 18, 356. 112. Gesteland, R . F., and Staehelin, T. (1967). J. Mol. Biol. 24, 149. 113. Gould, H. J. (1968). I n “Chemotaxonomy and Scrotaxonomy” (J. G. Hamkes, ed.), p. 131. Academic Press, New York. 114. Gray, P. N., Bellemare, G., and Monier, R. (1972). FEBS (Fed. Eur. Biochem. Soc.), L e t t . 24, 156. 115. Gray, P. N., Bellemare, G., Monier, R., Garrett, R. A., and Stoffler, G. (1973). J . Mol. B b l . (in press). 116. Gray, P. N., Garrett, R. A., Stoffler, G., and Monier, R. (1972). Eur. J, Biochem. 28, 412. 117. Gray, P. N., and Monirr, R. (1971). FEBS (Fed. Eur. Biochem. SOC.),L e t t . 18, 145. 118. Gray, P. N., and Monier, R. (1972). Biochimie 54,41.

STRUCTURE O F BACTERIAL RIBOSOMES

341

119. Grccn, M., and Kurland, C. G. (1971). Nature (London), New Biol. 234, 273. 120. Guthrie, C., Nashimoto, H., and Nomura, M. (1969). Proc. Nut. Acnd. Sci. U.S. 63, 384. 121. Guthrie, C., Nashimoto, H., and Nomura, M. (1969). Cold Sp&g Harbor Symp. Quant. Biol. 34, 69. 122. Haenni, A. (1972). I n “Tlic Mcchanisin of Protcin Synthesis and its Regulation” (IA. Bosch, ed.), p. 33. North-Holland Publ., Amsterdam. 123. Hall, C. E., and Slaytcr, H. S. (1959). J. Mol. Biol. 1,329. 124. Hamcl, E., Koka, M.. and Nakamoto. T. (1972). J . Biol. Chem. 247, 805. 125. Hardy, S. J. S., Kurland, C. G., Voynom, P., and Mora, G. (1969). Biochemistry 8, 2897. 126. Hart, R. G. (1965). Pioc. Nut. Acad. Sci. U . S. 23, 1415. 127. Hasenbank, R., Guthrie, C., Stiiffler, G., Wittmann, H. G., Roscn, A., and Apirion, D. (1973). Unpublishcd observations. 128. Hashimoto, K. (1960). Genetics 45, 49. 129. Hauschild-Rogat, P. (1968). Mol. Gen. Getlet. 102, 95. 130. Hayes, F., and Hayes, D. H. (1971). Biochimie 53, 369. 131. Hayes, F., Hayes, D. H., Fellner, P., and Eliresmann, C. (1972). Nature (London), N e w Biol. 232, 54. 132. Hclscr, T. I,., Davics, J. E., and Dalilbcrg, J . E. (1971). Nnlrcre (London), New Biol. 233, 12. 133. Highland, J., Bodley, J. N., Gordon, J., Hascnbank, R., and Stofflcr, G. (1973). Proc. Nut. Acnd. Sci. U.S. 70, 147. 134. Highland, J., Bodley, J. N., Gordon, J., Hnsrnbank, R., and Stofflcr, G. (1973). Unpublished observations. 135. Hill, W. E., Rossetti, G. P., and van Holde, K. E. (1969). J. Mol. Biol. 44, 263. 136. Hill, W. E., Thompson, J. D., and Andcregg, J. W. (1969). J. Mol. Biol. 44, 89. 137. Hindennach, I., Kaltschmidt, E., and Wittmann, H. G. (1971). Etcr. J . Biochem. 23, 12. 138. Hindennach, I., Stoffler, G., and Wittmann, H. G. (1971). Ew. J. Biochem. 23, 7. 139. Homann, H., and Nicrhaus, K. (1971). Eur. J. Biochem. 20, ‘249. 140. Horne, J. E., and Erdmann, V. A. (1972). Mol. Gm. Genet. 119, 337. 141. Huxley, H. E., and Zubay, G. (1960). J . Mol. Biol. 2, 10. 142. Itoh, T., Otaka, E., and Osawa, S. (1968). J. MoZ. Biol. 2, 10. 143. Janda, H. G., and Wittmann, H. G. (1968). Mol. Gen. Genet. 103, 238. 144. Janda, H. G., Gualrrzi, C., Stofflri, G., and Wittmann, H. C. (1972). Unpublished observations. 145. Jordan, B. R. (1971). J. Mol. Biol. 55, 423. 146. Jordan, B. R. (1971). J. Theor. Biol. 34, 363. 147. Jordan, B. R., and Forget, B. G. (1971). J . Mol. Biol. 55, 407. 148. Kaempfer, R. 0. R., and Mesclson, M. (1969). J. Mol. Biol. 34, 703. 149. Kagawa, H., Jishulren, I,., and Tokimatsu, T. (1972). Nature (London) 237, 72. 150. Xahan, L., and Kaltschmidt, E. (1972). Biochemishg 11, 2691. 151. Kaltschmidt, E. (1971). Anal. Biochem. 43, 25. 152. Kaltschmidt, E., Dzionara, M., Donncr, D., and Wittmann, H. G. (1967). Mol. Gen. Genet. 100, 364.

342

ROGER A. GARRETT AND H. G. WITTMANN

153. Kaltsclimidt, E., Dzionara, M., and Wittmann, H. G. (1970). Mol. Gen. Genet. 109, 292. 154. Kaltschmidt, E., Rudloff, V., Janda, H. G., Cech, M., Nierhaus, K., and Wittmann, H. G. (1971). Hoppe-Seyler’s Z. Physiol. Chem. 352, 1545. 155. Kaltschmidt, E., Stoffler, G., Dzionara, M., and Wittmann, H. G. (1970). Mol. Gen. Genet. 109, 303. 156. Kaltschmidt, E., and Wittmann, H. G. (1970). Ploc. Nut. Acad. Sci. U. S. 67, 1276. 157. Kaltschmidt, E., and Wittmann, H. G. (1970). Anal. Biochem. 36, 401. 158. Kaltschmidt, E., and Wittmann, H. G. (1972). Biochimie 54,167. 159. Kischa, K., Moller, W., and Stoffler, G. (1971). Nature (London) 233, 62. 160. Kurland, C. G. (1960). J. Mol. Biol. 2, 83. 160a. Kurland, C. G. (1972). Annu. Rev. Biochem. 41, 377. 161. Kurland, C. G., Voynow, P., Hardy, S. J. S., Randall, L., and Luttcr, 12. (1969). Cold Spring Harbor Symp. Quunt. Biol. 34, 17. 162. Langridge, R., and Holmes, K. C. (1962). J . Mol. Biol. 5, 611. 162a. Lecanidou, R., and Richards, E. G. (1970). IJnpublished obscrvations. 163. Lee, J. C., and Ingram, V. M. (1969). J . Mol. Bid. 41, 431. 164. Lelong, J. C., Gros, F., Bollcn, A., Masclilrr, R., and Stoffler, G. (1973). Vnpublished observations. 165. Lerman, M. I., Spirin, A. S., Gavrilora, L. P., and Colon, V. F. (1966). J . Mol. Biol. 15, 268. 166. Lewis, J. B., and Doty, P. (1970). Nature (London) 225, 510. 167. Loening, U. E. (1968). J . Mol. Biol. 38, 355. 168. Loening, U. E. (1969). Biochem. J . 113, 131. 169. Lowry, C. V., and Dahlberg, J. E. (1972). Nutwe (London), New Biol. 232, 52. 169a. Lubin, M. (1968). Proc. Nat. Acad Sci. U . S. 61, 1454. 170. Lutter, L., and Kurland, C. G. (1972). Unpublished observations. 171. Lutter, L., Zeichardt, H., Kurland, C. G., and Stoffler, G. (1972). Mol. Gen. Genet. 119, 357. 172. MacDonald, R. E., Turnock, G., and Forchammer, J. (1967). Proc. Nat. Acad. Sci. U. S. 57, 141. 173. Madison, J. T. (1968). Annu. Rev. Biochem. 37, 131. 174. Maeda, A. (1961). J. Biochem. (Tokyo) 50, 377. 175. Mangiarotti, G., Apirion, D., Schle&nger, D., and Silengo, I,. (1968). Biochemistry 7, 456. 176. Maraldi, N. M., and Barbieri, M. (1969). J. Submicrosc. Cytol. 1, 159. 177. Maraldi, N. M., Simonelli, L., Pettazzoni, P., and Barbicri, M. (1970). J. Submicrosc. Cytol. 2, 51. 178. Marrot-Queiroz, J., and Monier, R. (1967). Bull. Soc. Chim. Biol. 49, 477. 179. Maruta, H., Tsuchiya, T., and Mizuno, D. (1971). J. Mol. Bid. 61, 123. 179a. Matheson, A. T. (1972). Personal communication. 180. McPhie, P. (1966). Ph.D. Thesis, Univ. of London, London. 180a. McPhie, P., Hounsell, J., and Gratzer, W. B. (1966). Biochemistry 5, 988. 181. McPhie, P., and Gratzer, W. B. (1966). Biochemistry 5, 1310. 182. Miall, S. H., and Walker, I. 0. (1967). Biochim. Biophys. Acta 145, 82. 183. Midgley, J. E. M. (1962). Biophys. 1. 2, 57. 184. Miyazawa, F., and Tamaoki, T. (1967). J. Mol. Biol. 24,485. 185. Mizushima, S., and Nomura, M. (1970). Nature (London) 226, 1214.

STRUCTURE O F BACTERIAL RIBOSOMES

343

186. Modolell, J., Cabrer, B., Parmcggiani, A,, and Vazqucz, D. (1971). Proc. Nut. Acad. Sci. U.S. 68, 1796. 187. Moller, W., Amons, R., Groene, J. C. L., Garrett, R. A., and Terhorst, C. P. (1969). Biochim. Biophys. Acta 190, 381. 188. Moller, W., and Boedtker, H. (1961). Acides Ribonzicleiqzies Polyphosphales: Struct., Syn. Fonct., Strasbourg p. 99. 189. Moller, W., Castleman, H., and Terhorst, C. P. (1970). FEBS (Fed. Eur. Biochem. Soc.), Lett. 8, 192. 190. Moller, W., Groene, A,, Terhorst, C., and Amons, R. (1972). Eiir. J . Biochem. 25, 5. 191. Monier, R. (1972). Fed. Eur. Biochem. SOC.Symp. 23, 85. 192. Monier, R., Fcunteun, J.? Forgct, B., Jordan, B., Reynicr, M., and Varricchio, F. (1969). Cold Spring Harbor S y m p . Quairt. Biol. 34, 139. 193. Moore, P. B. (1970). J . Mol. Biol. 60, 169. 194. Moore, P. B., Traut, R. R., Nollcr, H., Pcarson, P., and Dclius, H. (1967). J. Mol. Biol. 31, 441. 195. Mom, G., Palaih, T., Lutter, Id., Cravcn, C., Donncr, D., and Kurland, C. G. (1971). Mol. Gen. Genet. 112, 229. 196. Morgm, J., and Brimacombc, R. (1972). Eiu. J . Biochem. 29, 542. 197. Morgan, R. S., and Rhoads, D. G. (1966). Biochim. Uiophys. Acta 102, 311. 198. Morgan, R. S., Barker, D. C., and dc Rosicr, D. (1969). I?it. Congr. Crvstallogr. New York. 199. Morrell, P., and Marmur, J. (1968). Biochemistry 7, 1141. 200. Morrison, C., Zeichhardt, H., Garrclt, R. A,, and Stiifflcr, G. (1973). Unpublished observations. 201. Muto, A. (1970). Biochemistry 9, 3683. 202. Nanninga, N. (1970). J. Mol. Biol. 48, 367. 203. Nanninga, N. (1973). Int. Rev. Cytol. (in press). 201. Nanninga, N., Garrett, R. A., Stoffler, G., and Klotz, G. (1972). A.101. Geri. Genet. 119, 175. 205. Nashimoto, H., Held, W., Kaltschniidt, E., and Nomura, M. (1971). J. 21.101. Biol. 62, 121. 205a. Nierliaus, K. H., and Nierhaus, D. (1973). Pioc. Not. Acad. Sci. (1. S. (in press). 206. Nicrhaus, K. H., Bordasch, K., and Homann, H. E. (1973). J. Il.101. Biol. (in press). 207. Nierhaus, K. H., and Monte,io, V. (1973). Proc. Nnt. Acad. Sci. U . S. (in press). 208. Nomura, M. (1970). Bactem'ol. Rev. 34, 228. 20th. Nomura, M., and Erdmann, V. A. (1970). Nature (London) 228, 744. 209. Nomura, M., Mizushima, S., Ozaki, M.. Tmub, P., and Lowry, C. V. (1969). Cold Spring Harbor Symp. Qunnt. Biol. 34,49. 210. Nomura, M., Traub, P., and Bechmann, H. (1968). Nature (London) 219, 793. 211. Osawa, S. (1968). Annic. Rev. Biochem. 37, 109. 212. Osawa, S., Otaka, E., Itoh, T., and Fnkui, T. (l(969). J. Mol. B i d 40, 321. 213. Osawa, S., Otaka, E., Muto, A., Takata, R., Itoh, T., Dekio, S., Tanaka, K., Teraoka, H., and Tamaki, M. (1970). Proc. InL. Congr. Biochem., Sth, Abstr. p. 189. 214. Osawa, S., Takata, R., and Dekio, S. (1970). Mol. Gen. Genet. 107, 32.

344

ROGER A. GARRETT AND H. G. WITTMANN

215. Ostncr, U., and Hultin, T. (1968). Fed. Eur. Biochem. SOC.Meet., Prague Abstr. No. 3. 216. Otaka, E., Itoh, T., and Osawa, S. (1968). J. 21101. Biol. 33,93. 217. Otaka, E., Teraoko, H., Tamaki, M., Tanaka, K., and Osawa, S. (1970). J. Mol. Biol. 48, 499. 218. Ozaki, M., Mizushima, S., and Nomura, M. (1969). Nature (London) 222, 333. 219. Page, L. A., Englander, S. W., and Simpson, M. V. (1967). Biochemistry 6, 968. 220. Pellegrini, M., Ocn, H., and Cantor, C. It. (1972). Proc. Nut. Acntl. Sci. U . S. 69, 837. 221. Petermann, M. L. (1964). “Thc Physical and Chcmical Properties of Ribosomes.” Elsevier, Amsterdam. 222. Petermann, M. L., and Hamilton, M. G. (1967). ZNL. Symp. Biochem. Ribosomes mR NA. Schloss Reichardsbrunn. 223. Petermann, M. L., and Pavlovec, A. (1963). J. B b l . Chem. 238, 3717. 224. Petrovic, S., and Bokic, B. (1970). Biochim. Biophys. Acta 217,95. 225. Phillipps, S. L., Schlessingcr, D., and Apirion, D. (1969). Proc. Nut. Acutl. Sci. U . S. 62, 772. 226. Pinder, J. C., and Gratzcr, W. B. (1972). Eur. J . Biochem. 26, 73. 227. Pinder, J. C., Gould, H. J., and Smith, I. (1969). J. Mol. Biol. 40, 289. 227a. Pongs, O., Daya, L., Reinbolt, J., Stoffler, G., and Garrett, R. A. (1971). Unpublished observations. 228. Purdom, I., Bishop, J. O., and Birnstiel, M. L. (1970). Nature (London) 227, 239. 229. Randall-Hazelbauer, L., and Kurlnnd, C. G. (1972). MoZ. Gen. Genet. 115, 234. 230. RauC, H. A., and Gruber, M. (1970). F E B S (Fed. Eur. Biochem. SOC.), Letts. 8, 45, 231. Retel, J., and Planta, R. J. (1968). Biochim. Biophys. Acta 169,416. 232. Revel, M. (1972). In “Thc Mechanism of Protein Synthesis and its Regulation” (L. Bosch, ed.), p. 87. North-Holland Puhl., Amstcrdnm. 233. Reynier, M., and Forget, B. (1970). Biochem. Biophys. Res. Commun. 39, 114. 234. Rombauts, W., Peeters, B., and Wittmann, H. G. (1971). F E B S (Fed. Eur. Biochem. Soc.), Lett. 18, 164. 235. Rosset, R., Monier, R., and Julicn, J. (1964). BdZ. SOC.Chim. Biol. 46, 87. 236. Roth, H. E., and Nierhaus, K. H. (1973). F E B S (Fed. Eur. Biochem. Soc.), Lett. (in press). 237. Sabatini, D., Nonomura, Y., Morimoto, T., Blobel, G., and Ulrich, B. I,. (1972). Fed. Eur. Biochem. SOC.Symp. 23, 147. 238. Sander, G., Marsh, R. C., and Parmeggiani, A. (1972). Biochem. Biophys. Res. Commun. 47, 866, 239. Sander, G., Marsh, R. C., and Parnieggiani, A. (1972). Fed. Eur. Biochem. Sac. Symp., Amsterdam Abstr. 240. Sanger, F., and Brownlee, G. G. (1967). I n “Methods in Nucleic Acids,” Part A (L. Grossman and I<.Moldave, cds.), Methods in Enzymology, Vol. 12, p. 361. Academic Press, New York. 241. Sanger, F., Brownlee, G. G., and Barrcll, B. G. (1965). J . Mol. Biol. 12, 373. 242. Santcr, M., and Smith, J. R. (1966). J. BncterioZ. 92, 1099. 243. Sarkar, N., and Comb, D. G. (1969). J. Mol. Biol. 39, 31.

STRUCTURE O F BACTERIAL RIBOSOMES

345

244. Sarkar, P. K., and Yang, J. T. (1067). Zn “Conformation of Biopolyincrs” (G. N. Ramnchandran, cd.), Vol. 2, p. 197. Academic Press, S e w York. 245. Sarkar, P. I<.,Yang, J. T., and Dot?, P. (1967). Biopolymers 5, 1. 246. Scliaup, H. W., Grccn, M., and Kurland, C. G. (1970). d f o l . Gen. Getlet. 109, 193. 247. Scliaup. H . W., Grccn, M., ant1 Kurland, C. G. (1971). dfol. Gen. Geuet. 112, 1. 248. Schaup, H. W., and Iiurlnnd, C. G. (1072). dfol. Geti. Getiet. 114, 350. 248:~Schaup, H. W., and Iiiirlund. C. C. (1972). I~npnblislietlobscwatioiis. 249. Schendcl, P., Macbn, P., and Crnvcn, G. (1972). PTOC.N o t . Acad. Sci. U . S. 69, 544. 250. Sclilcssingcr, D. (1960). J . illol. Biol. 2, 92. 251. Schlcssingcr, D., Mimginrotii, G., and Apirion, D. (1967). Proc. Not. Acatl. Sci. U . S. 58, 1782. 252. Scliulte. C., and Garrctt, R. A . (19731. d f o f . Geri. Getlet. 119, 345. 253. ScIiw:ibc. R. (1972). Hoppe Seyler’s Z. P/i ysiol. Chem. 353, 1899. 254. Scliwcigrr, M. (1972). Unl)ublishccl obscrvntions. 255. Scott, J. F., Monier, R., .4uhcrt, M., and Iteynicr, M. (1968). Biocltena. Biophys. Res. Commitn. 33, 794. 256. Shcard, I<., Miall, S. H., Pcncockr, -4.R., Walkcr, I. O., and I
346

ROGER A. GARRETT AND H. G . WIlTMANN

272. Stijffler, G., and Wittmann, H. G. (1971). Proc. Nut. Acad. Sci. U . S. 68, 2283. 273. Sundaralingam, M. (1969). Biopolymers 7, 821. 274. Sypherd, P. (1969). J . Bacteriol. 99,379. 275. Tai, P., Kessler, D. P., and Ingraham, J. (1969). J. Bacteriol. 97, 1298. 276. Takato, R., Dekio, S., Otaka, E., and Osawa, S. (1969). Mol. Gen. Genet. 105, 113. 277. Tal, M. (1969). Biochim. Biophys. Acta 195, 76. 278. Tal, M. (1969). Biochemistry 8, 424. 279. Tal, M., Aviram, M., Kanarek, A,, and Weiss, A. (1972). Biochim. Biophys. Acta 281, 381. 280. Tamaoki, T., and Miyazawa, F. (1967). J. MoZ. Biol. 23, 25. 281. Tanaka, K. (1972). Unpublished observations. 282. Tanaka, K., Teraoka, H., Tamaki, M., Otaka, E., and Osawa, S. (1968). Science 162, 576. 283. Tashiro, Y., and Yphantis, D. A. (1965). J. MoZ. BioZ. 11, 174. 284. Terhorst, C., Moller, W., Laursen, R. A., and Wittmann-Liebold, B. (1972). FEBS (Fed. Eur. Biochem. SOC.),Letts. 28, 325. 285. Terhorst, C., Wittmann-Liebold, B., and Moller, W. (1972). Eur. J. Biochem. 25, 13. 286. Thammana, P., Weber, H. J., Deusser, E., Maschler, R., Kurland, C. G., Stoffler, G., and Wittmann, H. G. (1973). Nature (London) 242, 47. 287. Thomas, G. J. (1969). Biopolymers 7,325. 288. Thomas, G. J., and Spencer, M. (1969). Biochim. Biophys. Acta 179,360. 289. Tischendorf, G., and Stijffler, G. (1972). Unpublished observations. 290. Tissikres, A., Watson, J. D., Schlessinger, D., and Hollingworth, B. R. (1959). J . Mol. Biol. 1, 221. 291. Traub, P. (1970). Curr. Top. Microbiol. ZmmunoZ. 52, 1. 292. Traub, P., and Nomura, M. (1968). Science 160, 198. 293. Traub, P., and Nomura, M. (1968). Proc. Nut. Acad. Sci. U . S. 59,777. 294. Traub, P., and Nomura, M. (1969). J . Mol. Biol. 40, 391. 295. Traub, P., Nomura, M., and Tu, L. (1966). J. Mol. Biol. 19, 215. 296. Traut, R. R., Delius, H., Ahmad-Zadeh, C., Bickle, T. A., Pearson, P., and Tissikres, A. (1969). Cold Spring Harbor Symp. Quant. Biol. 34. 297. Traut, R. R., Moore, P. B., Delius, H., Noller, H., and Tissihres, A. (1967). Proc. Nut. Acad. Sci. U.S. 57, 1294. 298. Ungewickell, E., and Garrett, R. A. (1972). Unpublished observations. 299. Ungewickell, E., Yuki, A., and Garrett, R. A. (1972). Unpublished observations. 300. Van Duin, J., and Kurland, C. G. (1970). MoZ. Gen. Genet. 109, 169. 301. Venable, J. H., Spencer, M., and Ward, E. (1970). Biochim. Biophys. Acta 209, 493. 302. Vigne, R., and Jordan, B. R. (1971). Biochimie 53, 981. 303. Voynow, P., and Kurland, C. G. (1971). Biochemistry 10, 517. 304. Wabl, M., Ljung, L., and Hoglund, S. (1973). Cytobiologie (in press). 305. Wabl, M., Barends, P., and Nanninga, N. (1973). Cytobiologie (in press). 306. Waller, J. P. (1964). J. MoZ. Biol. 10, 319. 307. Weber, H. J. (1972). MoZ. Gen. Genet. 119, 233. 308. Weller, D. L., Schlechter, Y., Musgrave, D., Rungvie, M., and Horowitz, J. (1968). Biochemistry 7, 3668.

STRUCTURE OF BACTERIAL RIBOSOMES

347

Wittmann, H. G. (1970). Symp. SOC.Gen. Microbiol. 20, 55. Wittmann, H. G., and Osawa, S. (1971). Unpublished observations. Wittmann, H. G., and Apirion, D. (1972). Unpublished observations. Wittmann, H. G., and Stoffler, G. (1972). I n “The Mechanism of Protein Synthesis and its Regulation” (I,. Bosch, ed.), p. 285. North-Holland Publ., Amsterdam. 313. Wittmann, H. G., Stiiffler, G., Hindennach, I., Kurland, C. G., RandallHazelbauer, L., Birge, E. A,, Nomura, M., Kaltschmidt, E., Mizushima, S., Traut, R. R., and Bickle, T. A. (1971). Mol. Gen. Genet. 111, 327. 314. Wittmann, H. G., Stoffler, G., Kaltschmidt, E., RudloE, V., Janda, H. G., Dzionara, M., Donner, D., Nierhaus, K., Cech, M., Hindennach, I., and Wittmann-Liebold, B. (1970). Fed. Eur. Biochem. SOC. Symp. 21, 33. 315. Wittmann-Liebold, B. (1971). Unpublished observations. 316. Wittmann-Liebold, B. (1971). Hoppe Seyler’s Z. Physiol. Chem. 352, 1705. 317. Wittmann-Liebold, B., and Wittmann, H. G. (1971). Biochim. Biophys. Acta 251, 44. 318. Yin, F. H. (1960). Ph.D. Thesis, Univ. of Wisconsin, Madison. 319. Zachau, H. G. (1972). I n “The Mechanism of Protein Synthesis and its Regulation” (L. Bosch, ed.), p. 173. North-Holland Publ., Amsterdam. 320. Zimmermann, R. A., Muto, A., Fellner, P., Ehresmann, C., and Branlant, C. (1972). Proc. Nat. Acad. Sci. U . S. 69, 1282. 321. Zitomer, R. S., and Flaks, J. G. (1972). J. MoZ. Biol. 71, 263.

309. 310. 311. 312.