Structure of mink immunoglobulin γ chain cDNA

Developmental

Pergamon

and Comparative Immunology, Vol. 20, No. 4, pp. 231-240, 1996 Copyright 0 1996 Elsevier Science Ltd. All rights reserved Printed in Great Britain 014>305X/96 $15.00t0.00

PII: SO145-305X(96)00019-5

STRUCTURE

OF MINK IMMUNOGLOBULIN

y CHAIN cDNA

Alexander M. Najakshin,* Eugenij S. Belousov,’ BorisYu. Alabyev,* Jesper Christensen,t Torben Storgaard,t Bent Aasted,t and AlexanderV.Taranin* ‘Institute of Cytology and Genetics, Novosibirsk, Russia tThe Royal Veterinary and Agricultural University, Copenhagen, Denmark

(Submitted November 1995; Accepted April 1996)

UAbstract-tie cDNA clones, encoding mink Ig 7 chains were characterized. The pIGG47 clone contains a part of the leader segment, VDJ and C regions, and pIGG14 contains a part of the J and a complete C region. The clones differ by only four nucleotides in the C region, and they most probably represent allelic variants of the same gene. The V gene segment of pIGG47 was found to be highly similar to human VHIII subgroup sequences; there was 86-87% similarity for the whole V gene segment and 91% for the VHIII specific regions (codons 65-87). Southern blot analysis demonstrated that a high proportion of mink VH genes is VHIII related. The V gene segment used as a probe revealed 19-23 bands in mink DNA under stringent conditions. This is in agreement with our previous data showing that a high proportion of mink Ig contains an ‘alternative’ binding site for protein A, a feature common to VHIII-related molecules. According to Southern blot analysis there may be 5-7 Cy genes at the mink IgH locus. Copyright Q 1996 Elsevier Science Ltd.

qKeywords-Immunoglobulin; cDNA sequence; VHIII-related Carnivores; Mink.

y chains; genes;

Address correspondence to Alexander V. Taranin, Institute of Cytology and Genetics, Novosibirsk 630090, Russia.

Nomenclature SPA

staphylocoecal protein A

Introduction The basic principles of Ig gene structure have been uncovered mainly in studies on man and mouse (1). During the last decade Igs of some other mammals have been investigated at the genomic level. Involvement of new species in studies provides deeper insight into contemporary evolution of this extraordinary gene family. The accumulated data show that each mammalian taxon may have unique features of Ig gene organization, diversification and expression during ontogeny (2-5). Among representatives of the order Camivora, domestic mink (Mustefu vison) is the species whose Ig molecules and genes have been most thoroughly studied. Recently, we have cloned cDNAs for mink Ig h and K chains (6,7). The structure of the h and K loci of mink were found to be similar to that of man. In mink, there are multiple Ch genes of which at least three are functional, and a single CK gene. The VK gene repertoire seems to be relatively large and this is possibly the reason why the A/K ratio is high (approximately 55/45) in this species (637). 231

232

So far, one isotype of mink Ig y chains has been detected using xenoantisera in both our and other laboratories (37). However, immunogenetic studies have revealed allotypic polymorphism of the Cy locus in this species. Six allotypes of the Cy region have been identified using alloantisera (8-10). Complex patterns of allotype molecular distribution, as well as unexpectedly variable individual expression of allotypes H2, H3 and H4, made a reliable determination of genetic relationships of the allotypes and prediction of the precise structure of the Cy locus difficult (11-l 3). It was suggested that mink may have 2-4 functional Cy genes which have arisen as a result of very recent duplication(s) following allotypic diversification of the primordial gene(s) (8). This paper describes the cloning of cDNAs encoding mink Ig y chains as the first step in studies of mink y chain genes at the molecular level.

Materials and Methods Construction of cDNA Library Poly(A + )-RNA was isolated from total mink spleen RNA by chromatography on oligo(dT)-cellulose as described by Aviv and Leder (14). A cDNA library was constructed with the use of a hZAP cDNA synthesis kit (Stratagene) according to the manufacturer’s instructions.

Analysis of cDNA Library Immunoscreening of the cDNA library was performed using affinity purified rabbit antibodies against mink immunoglobulin gamma chains and ‘251-labelled protein A in compliance with the protocol of Young and Davis (15). The background was reduced by pre-

A. M. Najakshin et al.

adsorption of the antibodies with nitrocellulose filter-immobilized proteins from hgtll E. coii Y1090,,-lysed lawns. Preparation and characterization of rabbit antibodies against mink gamma chains have been described elsewhere (9).

Southern Blot Hybridization High molecular weight DNA was extracted from mink liver using the method of Gustafson et al. (16). DNA was digested to completion with restriction endonuclease PvuII, PstI and HindII1. Samples (10 pg) of DNA digests were electrophoresed on 1% agarose gel for 10-12 h at 1.5-2 V/cm. Resolved DNA was transferred to nylon membranes (Gene Screen Plus, NEN) using the vacuum blotting transfer technique (17). Prehybridization was performed following manufacturer’s instructions. Hybridization was performed as previously described (7). The probes were: (a) a 162bp EcoRI-PstI fragment from pIGG47, henceforth referred to as the VH specific probe; (b) a 380-bp SmaI-SmaI fragment from pIGG47, henceforth referred to as the Cy specific probe (Fig. 1).

DNA Sequencing and Sequence Analysis DNA sequencing was performed according to the base-specific chemical cleavage method of Maxam and Gilbert (18), with the modification of Chuvpilo and Kravchenko, (19) using 8% ureaacrylamide gels (1.5 and 3.5 h at 2400 V) and 4% gels (1 and 2 h at 2400 V). The gels were then dried and exposed on RMV film at - 70°C for 1848 h. The sequences were analysed using the computer program package VOSTORG 2.0 (20).

233

Mink IG y chain cDNA

A EcoRI

c PStI

LI

PstI Cl

IDJI

VH

IHI

I

c2

XhoI

1 UT

c3

.

.

VH

SmaI

sma1

EcoRI

PstI

Cy

probe

probe

B cAcaAocTC!?XTT ARRROOTOTCcAQTl3TOecAQcreGTGGAGTcrO~~~~~~cc

92

~~~~~LysGl~alGlnCyrOluYalGl~ValGluSe~Gl~lyA~~alLysPrffil~lySe~~~S~ -4 10 IPRl> TGTGcAGccTeIaGATTcAccTTCa3TAAcT

20 182

ACGGCAWAGcTGGGTcC~GGGTcGCATGGATG

CyaAllRlaserGlyPheThrPheSerAsn~rGl~tSerT~Val~~l~aPr~~yaGly~GlnT~V~~aT~t I amI> 40 IFR2> AOTTATOATC

50 272

CTGTGAAGGGCCGATTCACCATCT~T~ATCTG

SeiPy+AlpOlyS~y~r~n~r~~e~alLySGly~~~rIleSe 60 DTCAGCCT

IcDRz>

~nGlyGluAmThrLeUTyrLe" 70

I_>

90

ccGcCTGCTTcATccrAc

ORliAOCCTAWGTACAAcCIcTAcGTTTCTTGTGTcAGAT

QlnThrIleserLeuAesAla5l~r~aLeu~r~yrCysThrThe~~r~~~Serlrr 90 va1Phe

IJ>

ID>

\T T GGTCTGGACP~CGGT CACCGTGTCCKAGCTTC~TCGGTTTTC~GC Gly~p~rTrpGl~lnGlyThrSerValThrValSerVal~rValSerSer~aSe~~~aProSe~al~ePro~~~O~~S 100 110 120 ICEl> OMOCCRCCCCCGGCCCT

452

CCGGCTCC

~~~~TOOTGTC-T~TCC~-~~~~~~

Gly~a~rPr~lyPro~rVa~~e~aCysLeuValSe~lyPyrPheProGluProValTh~alSerT~n~~lySer 129 133 150 142

154

GCAGAATGTGATATGCT

ProCysThrCySProPrPArg~aGlU~~etLeu01 ICE2>

m--a

290

299

295

CACACGGCCA?UZAC

992

~TT-~T~~TC~T~~T-T~-~T~~~C E1STh~AlaLySThrAsnSer~gOluGlnOlnGlnPh~nSer~rPh~~~alValSerValLeUP~IleGlnHisGlnRspT~~ 310 313317 320 -TCTTCAAGTGCAAGGT LysGlyLySValPheL Bi&

330 1082

~CPCCCAT~CC~TT~_~T~~T~~T P~s~ValAs~s~ys~aLeuPr~SerProlleGlu~~hrIleSerLysValLysGlyGl~~is 341 350 357

CAGCCCAGTGTGTATGT~~CCCATCCCGGGACGAGCT

722

902

GGAAGACccTGAGGTCCAGATCMZCTGGTTcGTGGAcAACcAGGAGATG

IleSs~rPr~luVal~~~tValVa~~Gl~ProGluValGlnIl~e~~~eVa~nGlnGlu~t 270 274 279t292

632

812

~CTTCAGTCTTCATGTTCCCCC~CTCC 01 ProSerValPheMetPheProProLyaPr~r~r~Ser 260

ATTTCCCGAACCCCCGCATGGTGGTGGACCT

542

163

157

TTGACCCcCGTCcGTcCTGcAGTccT cAocAM2ATSGTGACCGTGCCCTCCAGcAGG cm3GGcTCTAcTcTCT LeUThlSeLQlyValAiuThrPhePrOSerValLeuGln~rSerGly~~rSer~S~SO~~tVal~rValPrOSerSer~ 172 169 189 180 183 C TGGCCCAGCGACACCTTCAT~ GCACCGTGGCCCACCCAGCCAGT-CAGG&T~TGcC~TTCCTcCG TLpProSer~pThrPheIleCysThrVaLAlaSisPr~aSerAsnThrArgValA~~ys~~a~Pro~r~lyLysIle~rgPro 208 210 220 I Hinge CCATGCACATGTCCCCCGT

362

36O,cE3

364 1172

~CAGTGTGACCTGcATGGTcAAAGAcTTCTAccCPa

GlnPrOSerValTyNalLeuProProSerRrgAspOluLeuSerLy~s~~alSerVal~r~sMetValLys~PheTyrPr~ 370 377 381 390 CCTGACATTGATGT-TOAOTOGCAOAOCAACOGCCAACA

1262

CAGTGTGC~CGCCCcAGcTGGATGcGGNZGGc

ProkspIl~o~Val~~~T~~~Ser~~GlyGlnGln~l~aSerVa~~rThrProPraGl~~~~ly 415 416

420

=g GAG DDACAAWCCICGCT~ccTTCAcGTGTGcGGTGZGcATGAAGcccTA ThrTyrPheLeuTyrSerLys~uSerVa~pLy~l~~~GlnGl~l~lu~r~eTh~s~aV~~uHisGluRlaLeu 434 440 450 456

427

ACCTACTTCCTCT~CKGGT

cACAAccAccAcAcGcAGAAGACcA

TCTCCCJGTCTCCGSST

EiSAs~iSHlsThrGlnLysThrIleSerGlnSerProGlyLysEnd 470 TTGGGGTCCCCCaAOORCOC CCCTGGGACCCAGCGA

AAATWLOCCGCRC

430

1352 460

GCCCGGCcccCCCGCGAGCCccCAC-C

1442

478

CGGAGCCCCCACCCCTGTGTACGTACCTCC

COOOCAOOCGCCCCTGCGTGAM,TSCAGCACTG

1532

1548

Figure 1. Restriction map (A), nucleotide and deduced amino acid sequences (B) of plGG47 cDNA. Subdivision of sequence is based on homology with mammalian lg VH, JH and Cy sequences. Numbering of amino acid residues is based on Kabat et aL(21) Differences found in pIGG14 cDNA are shown above the plGGl4 sequence. Slash indicates beginning of the plGG14 cDNA. Arrow indicates the location of deletion of two codons present in y chains of other mammalian species. Inserted codons are double underlined. Underlined are FcR-binding motif, conserved N-glycosylation site and Clq-binding motif. Data in EMBL and GenBank databases are underaccession numbers LO7788 and L07789.

234

Results Screening of 7 x lo5 clones of mink spleen cDNA library using affinity purified rabbit antibodies against mink Ig y chains recovered 60 positive cDNA clones. The clones were analysed to determine the insert size. The recombinant phage pIGG-47 containing the largest insert was further characterized by DNA sequence analysis. The nucleotide and deduced amino acid sequences of the cDNA insert are shown in Figure 1. pIGG-47 is 1548 bp long, and contains a single open reading frame of 1397 bp. The search for homologous sequences in the GenBank database revealed that the cDNA represents the rearranged y chain gene lacking the 5pr part of the leader exon. This study also determined the nucleotide sequences of 15 short cDNAs which lacked the VH region. All had an open reading frame. Fourteen clones were identical to pIGG47 in overlapped parts. The clone pIGG14 of 1180 bp was found to differ from pIGG47 by six nucleotides (Fig. 1). The sequence of the pIGG47 clone was subdivided into the VH, DH, JH and C regions and compared with known mammalian Ig sequences. This study compared the V region of pIGG-47 with human VII sequences representing subgroups I-III (2 1,22). The highest similarity at the nucleotide level, 83-85%, was found for VHIII sequences. The similarity with sequences of subgroups I and II ranged from 59 to 74%. Previously, it was shown that two segmental intervals within the FRl and FR3 regions (codons 6-24 and 67-85, respectively) are characteristic of each VH family (23). The cloned mink VH is 91% similar to the human consensus VHIII sequence within the 67-85 codon interval (Fig. 2A). Because genomic data were not available we could not determine the exact location of the V-D and D-J junctions. These are tentatively indicated in Figure 1. The region corresponding to the D

A. M. Najakshin et al.

segment showed little, if any similarity, when its counterparts in human, rat, mouse, and rabbit were analysed. However, the 3pr portion of mink JH segment was found to be highly conserved (Fig. 2B). When amino acid sequences were compared, mink JH and mouse JH4 were identical at 13 of the 15 positions. The CHl, CH2, CH3 exons and hinge region of pIGG47 were delineated by comparison with the nucleotide and deduced amino acid C-y sequences of other mammals. The mink CHl domain contains three cysteine residues. In addition to two conserved cysteine residues forming an intrachain disulphide bridge, there is a cysteine residue at position 128 [numbering throughout this article is according to the method of Kabat et al. (21)] which probably provides a S-S bridge with the light chains, as in human IgG2, IgG3 and IgG4. Like other mammalian Ig hinge regions, the mink y hinge is enriched with proline and cysteine residues. Three cysteine residues may provide three inter-heavy chain S-S bridges. The similarity with known sequences is low in other respects. The precise location of the genetic hinge/CH2 junction is difficult to determine since the NHZend of CH2 is not conserved in mammals. The alignment of the CH2-CH3 y domains (data not shown) in mink and other species demonstrated that mink CH2 lacks two amino acid residues which are present in all the other determined sequences. The CH3 domain has a feature common with bovine and sheep y chains, namely an insertion of two additional residues which are missing in the CH3 of other mammals (Fig. 1). The similarity percentages for Cy nucleotide sequences of mink and other mammals are summarized in Table 1. To estimate the size of the VHIIIrelated gene family and also the number of the C-y genes, mink liver DNA was analysed by Southern blot hybridization using VH and Cy specific probes. The VH

235

Mink IG y chain cDNA

A

Mink VH EIlm VA111

TTCACCATCTCCAGAGACAATGGCGAGAACACGCTGTATCTGCAGAC~T~GCCT~~~C~G -----------------____TC_A__________-________A_T__A__-___-_-____---

B ***SYGLDYWGQGTSVTVSS *******V~-____------

mihj47 mihj14

***MYFQH-----L_____ l**ymF_~_-R--L____*****~-V-----M-----

humhjl humhj2 humhj3 humhjl

**,r*tyF-------L-e--**f,kmF-S-----L-----

humhj5 humhj

6

mouhj2 mouhj3 mouhj4 rabhjl rabhj2 rabhj3 rabhjl rabhj5

yyyy--M-V-----T----**A.*****------TL-me*****WFA__---_~____A **+y_~__-____-----t*,r***t-P--T--L--I_**t*DJQj'-P--P--L----***DTR-_L_--__L_____ *******ymFP--L--m-m ,c***DW--L-----L-----

Figure 2. (A) Comparison of plGG47 VH nucleotide sequence with human VHIII consensus sequence, codons 67-65 (23). (B) Comparison of deduced amino acid sequence of plGG47 and plGG14 JH segments with human,(32) mouse,(33) and rabbit (34) JH segments. Asterisks indicate gaps.

Table 1. Similarity Percentage of Nucleotide Sequences Encoding CHl, CH2, and CH3 Domains of Mink and Other Mammalian Species’ Ig y Chains. Mink Ref. Human yl Human y2 Human y4 Bovine yl Bovine y2 Ovine yl Rabbit y Mouse yl Mouse y2a Mouse y2b Mouse y3

(43) (44)

(45) (46) (46) (47,48) (49) (39) (40) (41) (42)

CHl

CH2

CH3

79’

76

78 78 77

77 77 75

74 74 73 74

77 79 79 74 74 74 75

71 77 75 69 69 89 74

73 73 69 66 64 58 66

‘Percent similarity was calculated as: number of positions where identity occurs x lOO/total number of positions compared. Insertion or deletion of a position was counted as position difference.

probe revealed 19 and 23 bands when hybridized under stringent conditions with PstI and PvuII digests, respectively (Fig. 3). Variations in hybridization intensity may be attributed to the comigration of fragments bearing gene segments of similar size. The Cy probe detected five and seven bands in DNA digested with PstI and Hind111 endonucleases, respectively (Fig. 4). The number of C-y-hybridizing fragments was the same in the DNA of all the examined individuals.

Discussion In this study cDNAs encoding chains of a representative of the Carnivora were cloned for the first It was of interest to compare structure with that of Ig from

Ig y order time. their other

236

A. M. Najakshin

A

B

23.1 9.4 6.7

4.3

2.3 2.0

0.5

Flgure 3. Blot hybridization of mink liver DNAwith VH specific probe. DNA was digested with Pvull (A) and Pstl (B) restriction endonucleases under stringent conditions. Sizes of marker fragments are given in kbp.

mammals. The VH region of the pIGG47 clone was found to be highly similar to the members of the human VIII11 group. This supports the previous data which show that VHIII genes are among the most evolutionarily conserved gene elements in the Ig family (23,24). An interesting feature of VHIII-encoded proteins is their ability to interact with staphylococcal protein A (SPA). It was shown that 22% of human IgA and 15% of human IgG F(ab) bind to SPAagarose and, in both cases, binding to SPA is highly restricted to VIII11 molecules (25). Similar results were obtained

et al.

when human IgM was studied (26). Consistent with this correlation is the observation that ‘alternative’ SPA binding by mouse Ig occurs only among the VHIII-related S107 and 5606 families (27). It has been previously shown that SPA binding may be used for the purification of mink IgA and IgM with a high yield (28). It has also been found that at least 20% of pooled mink IgG Fab fragments bind to SPA-Sepharose (Najakshin et al., unpublished). In humans, VHIII is the largest VH subgroup, since about half of VH germline genes belong to the VH3 family (29). If binding of mink IgM, IgA, and IgG Fab fragments to SPA is, as in humans, mediated by VHIII-related molecules, the corresponding gene family should be one of the largest in mink. The results of Southern blot analysis demonstrate that the mink VHIII-related gene family is indeed complex. A VH probe detected 23 fragments in mink liver DNA digested with PvuII. For comparison, a human VHIII-specific probe hybridizes to 25-30 homologous DNA fragments, yet the size of human VHIII family was estimated at between 100 and 200 members (29). The C regions of mink y chains are most similar to those of man and artiodactiles. The presence of two additional amino acid residues in the CH3 region of mink, sheep and bovine y chains may indicate that carnivores and artiodactyles have diverged after the differentiation of orders such as primates, lagomorphs and rodents; however, the possibility that the insertions represent independent evolutionary events cannot be excluded. Mammalian Ig y chains are known to be involved in functional interactions, such as binding Fc receptors and Clq. The residues 247-LeuLeuGlyGly-250 in the lower hinge of human IgGl are believed to be responsible for binding FcyRI and FcyRII receptors (30,31). The sequence motif of the similar structure

237

Mink IG y chain cDNA

A

B

23.1 9.4 6.7

-

2.3 2.0

0.5

Figure 4. Blot hybridization of mink liver DNAwith Cy specific probe. DNAwas digested with Pstl (A) and Hindlll (B) under stringent conditions. Lanes represent DNA from unrelated individuals. Sizes of marker fragments are given in kbp.

MetLeuGlyGly is also a feature of the mink lower hinge (Fig. 1). Glu 337, Lys 339 and Lys 341, located on the fy2 gb-strand of the CH2 domain, have been shown to contribute to the recognition site for the Clq binding of human and mouse IgG (35,36). Glu 337 is replaced by Val in the deduced amino acid sequence of the mink y chain (Fig. 1). In studies with mouse IgG2b point mutants such a replacement was shown to decrease significantly the ability to bind Clq and mediate complement-dependent lysis (35). Nevertheless, it has been observed that mink IgG allotype-specific antibodies are able to bind rabbit and guinea pig complement and mediate complement-dependent lysis of sheep red blood cells coated with the homologous IgG (Taranin, unpublished). Two explanations may be offered for this disagreement. First, there should be further

determinants compensating for the presence of Val-337 in mink gamma chains. Second, the cloned mink cDNA encodes a particular IgG allotype or subclass which is inefficient in Clq binding, and the previously observed lytic ability was provided by some other IgG variant. Attempts to demonstrate the presence of y chain subclasses using xenoantisera were unsuccessful in both our and other laboratories (37); however, intraspecies alloimmunizations with IgG have revealed that Ig y chains are highly polymorphic in this species. Six allotypes of the Cy region designated as H2, H3, H4, H6, H7, and H8 have been described (9). The genetics of these allotypes was shown to be controversial with respect to allelism and the linkage of corresponding genes (10-12). The controversy seems to be partly due to the complex molecular distribution of the allotypes. Some of the

238

A. M. Najakshin et al.

allotypic epitopes may be located on either the same or distinct molecules in different individuals (38). Immunogenetic data allowed the proposal that mink has 24 highly homologous functional Cy genes. It was suggested that the mink Cy locus has undergone very recent duplication(s) after allotypic diversification of primordial gene(s) (8). The present results of Southem blot analysis support this suggestion. Seven bands were revealed in Hind III digests of DNA from four phenotypically different mink. Five hybridizing fragments were found in PstI digests of three DNA samples. The bands most probably represent distinct Cy genes, because the probe used in this study was a CH3 fragment with a part of the 3pr-untranslated sequence (Fig. 1). These results indicate that there may be 5-7 Cy genes in mink. It is unclear, however, how many are functional. Of 16 determined cDNA sequences, only 2, pIGG47 and pIGG14, were found to differ. Two nucleotide substitutions were located in the J region, one is at the end of the CHl region and three are clustered in the middle of CH3. The CHl substitution is

silent and that in CH3 causes replacement of Glu by Arg. Hinge regions of both clones are identical, and therefore the clones represent most probably allelic variants of the same Cy gene. Since the mink we used to construct the cDNA library was not characterized with respect to IgG allotypes, further studies are necessary to make more definite conclusions. Previously, it has been shown that allotypic determinants H2, H4 and H7 are located near the hinge region and H3, H6 and H8 in the Fcpr fragment of mink gamma chains (9). The sequence data presented in this paper may be used for isolation and analysis of allotype specific regions from phenotypically different mink and elucidation of the structure and evolution of the Cy locus in this species.

AcknowledgementsThis work was supported in part by the Russian State program ‘Frontiers in Genetics’, The Danish Biotechnology Center for Livestock and Fish Production, The Danish Agricultural and Veterinary Research Council.

References Honjo, T.; Ah, F. W.; Rabbitts, T. H., Editors, Immunoglobulin genes. London: Academic Press; 1989. Reynaud, C.-A.; Mackay, C. R.; Muller, R. G.; Weill, J.-C. Somatic generation of diversity in a mammalian primary lymphoid organ: the sheep ileal Peyer’s patches. Cell 64995-1005; 1991. Knight, K. L.; Becker, R. S. Molecular basis of the allelic inheritance of rabbit immunoglobulin VH allotypes: implications for the generation of antibody diversity. Cell 60:963-970; 1990. Allegrucci, M.; Young-Cooper, G. 0.; Alexander, C. B.; Newman, B. A.; Mage, R. G. Pretferential rearrangement in normal rabbits of the 3prVaa allotype gene that is deleted in Alicia somatic hypermutation/conversion mutants; may play a major role in generating the heterogeneity of rabbit heavy chain variable sequences. Eur. J. Immunol. 21:411-417; 1991. Hamers-Casterman, C.; Atarhouch, T.; Muyldermans, S.; Robinson, G.; Hamers, C.; Songa,

E. B.; Bendahman, N.; Harriers, R. Naturally occurring antibodies devoid of light chains. Nature 363446448; 1993. Najakshin, A. M.; Belousov, E. S.; Alabyev, B. Yu.; Bogachev, S. S.; Taranin, A. V. cDNA clones encoding mink immunoglobulin lambda chains. Mol. Immunol. 30:1205-1212; 1993. Bovkun, L. A.; Peremislov, V. V.; Belousov, E. S.; Najakshin, A. M.; Mechetina, L. V.; Aasted, B.; Taranin, A. V. Expression of immunoglobulin gk and h chains in mink. Eur. J. Immunol. 23:192!%1934; 1993. Baranov, 0. K.; Taranin, A. V.; Fomicheva, I. I. In: Shumny, V. K.; Ruvinsky, A. O., Eds. Genetics and evolution of immunoglobulins in Mustelidae. Novosibirsk, Russia: Nauka; 1991: 163-184. Belyaev, D. K.; Fomicheva, I. I.; Baranov, 0. K.; Taranin, A. V. Genetic polymorphism of IgG in mink-I. Identification of 8 allotypes. Exp. Clin. Immunogenet. 3:10-19; 1986.

Mink IG y chain cDNA

10. Belyaev, D. K.; Fomicheva, I. I.; Taranin, A. V.; Baranov, 0. K. Genetic polymorphism of IgG in mink-II. A genetic analysis of allotypes. Exp. Clin. Immunogenet. 3:65-74; 1986. 11. M&hetina, L. V.; Fomicheva, I. I.; Taranin, A. V. Genetic oolvmomhism of IaG in minkVIII. A quantitative study of the expression of Q allotypes in sera. Exp. Clin. Immunogenet. 9124-32; 1992. 12. Taranin, A. V.; Mechetina, L. V.; Volkova, 0. Yu.; Fomicheva, I. I.; Baranov, 0. K. Genetic polymorphism of IgG in mink-III. Instability of expression and the problem of the genetic control of Cy allotypes. Exp. Clin. Immunogenet. 473-80; 1987. 13. Mcchetina, L. V.; Olimova, D.; Taranin, A. V. Genetic polymorphism of IgG in mink-IX. High proportion of allotype-producing lymphocytes in individuals with minor level of allotypes H3 and H4 in serum. Exp. Clin. Immunogenet. 9:141-148; 1992. 14. Aviv, H.; Leder, P. Purification of biologically active globin messenger RNA by chromatography on oligothymidilic acid-cellulose. Proc. Natl. Acad. Sci. USA 69:1408-1412; 1972. 15. Young, R. A.; Davies, R. W. Yeast RNA polymerase II: isolation with antibody probes. Science 222:778-782: 1983. 16. Gustafson, S.; Proper, J. A.; Bowie, E. J. W.; Sommer, S. S. Parameters affecting the yield of DNA from human blood. Analyt. Biochem. 165:294-299; 1987. 17. Medveczky, P.; Chang, C. W.; Oste, C. Rapid vacuum driven transfer of DNA and RNA from gels to solid supports. BioTechniques 5:242246; 1987. 18. Maxam, A. M.; Gilbert, W. Sequencing endlabelled DNA with base-specific chemical cleavages. Methods in Enzymology 65:499560; 1980. 19. Chuvpilo, S. A.; Kravchenko, V. V. A solidphase method for DNA sequencing. Biooreanicheskava chimia 9:1634-1637: 1983. 20. Zharkikh, A.-A.; Rzhetsky, A. Yu.; Morosov, P. S.; Sitnikova, T. L.; Krushkal, J. S. VOSTORG: a package of microcomputer programs for sequence analysis and construction of phyloeenetic trees. Gene 101:251-259: 1991. 21. Rabat, E. A.; Wu, T. T.; Reid-Miller, M.; Perry, H. M.; Gottesman, K. S. Sequences of proteins of immunological interest. Bethesda, MD: U.S. Dept of Health and Human Services; 1987. 22. Milner, E. C. B.; van Dijk, K. W.; Sasso, E. H. The human VH locus. In: Strivastava, R.; Ram, B. P.; Tyle, P., Eds. Molecular mechanisms of immune regulation. New York: VCH Publishers; 1991: 135-142. 23. Shroeder, H. W.Jr.; Hillson, J. L.; Perlmutter, R. M. Structure and evolution of mammalian VH families. Int. Immunol. 241-50; 1990. 24. Tutter, A.; Riblet, R. Conservation of an immunoglobulin variable-region gene family indicates a specific noncoding function. Proc. Natl. Acad. Sci. USA 86:7460-7464; 1988. 25. Sasso, E. H.; Silverman, G. J.; Mannik, M. Human IgA and IgG F(ab)pr* that bind to

239

26.

27.

28.

29.

30.

31.

32.

33.

34.

35. 36.

37.

38.

39.

staphylococcal protein A belong to the VHIII subgroup. J. Immunol. 147:1877-1883; 1991. Sasso, E. H.; Silverman, G. J.; Mannik, M. Human IgM molecules that bind Staphylococcal protein A contain VHIII H chains. J. Immunol. 142:2778-2784; 1989. Seppala, I.; Kaartinen, M.; Ibrahim, S.; Makela, 0. Mouse Ig coded by VH families S107 or 5606 bind to protein A. J. Immunol. 145:298%2993; 1990. Tsertsvadze, D. K.; Belousov, E. S.; Popova, N. A.; Taranin, A. V. Isolation of mink s-&4 and IgM using protein A-Sepharose. Izvestia of Siberian Branch of the USSR Academy of Sciences 2: 117-120; 1989. Berman, J. E.; Mellis, S. J.; Pollock, R.; Smith, C. L.; Suh, H.; Heinke, B.; Kowal, C.; Surti, U.; Chess, L.; Cantor, C. R.; Alt, F. W. Content and organization of the human Ig VI-I locus: definition of three new VH families and linkage to the Ig CH locus. EMBO J. 7:727-738; 1988. Dunkan, A. R.; Woof, J. M.; Partridge, L. J.; Burton, D. R.; Winter, G. Localization of the binding site for the human high affinity Fc receptor on IgG. Nature 332563-564; 1988. Lund, J.; Winter, G.; Jones, P. T.; Pound, J. D.; Tanaka, T.; Walker, M. R.; Artymiuk, P. J.; Arata. Y.: Burton. D. R.: Jefferis. R.: Woof. J. M. Human F&I and ‘FclRII ‘interact with distinct but overlapping sites on human IgG. J. Immunol. 147:2657-2662; 1991. Ravetch, I. V.; Siebenlist, U.; Korsmeyer, S.; Waldmann, T.; Leder, P. Structure of the human immunoglobulin u locus: characterization of the embryonic and rearranged J and D genes. Cell 27:583-591; 1981. Gough, N. M.; Bernard, 0. Sequences of the joining region genes for immunoglobulin heavy chains and their role in generation of antibody diversity. Proc. Natl. Acad. Sci. USA 78:509513; 1981. Becker, R. S.; Zhai, S. K.; Currier, S. J.; Knight, K. L. Ig VH, DH and JH germ-line gene segments linked by overlapping cosmid clones of rabbit DNA. J. Immunol. 142:1351-1355; 1989. Duncan, A. R.; Winter, G. The binding site for the Clq on IgG. Nature 322:738-740; 1988. Tao, M.-H.; Morrison, S. L. Studies of aglycosylated chimeric mouse-human IgG. Role of carbohydrate in the structure and effector functions mediated by the human IgG constant region. J. Immunol. 143:25952601; 1989. Lodmell, D. L.; Portis, J. L. Immunologic and genetic aspects of Aleutian disease. In: Immunologic defects in laboratory animals, Vol. 2. New York: Plenum Press; 1981: 39-53. Fomicheva, I. Molecular distribution of IgG allotypes in domestic mink. Immunologia 1:2325; 1988. Honjo, T.; Yamawaki-Kataoka, Y.; Kataoka, T.; Kawakami, T.; Takahasi, N.; Mano, Y. Cloning and complete nucleotide sequence of mouse immunoglobulin yl chain gene. Cell 18:559-568; 1979.

240

40. Yamawaki-Kataoka, Y.; Miyata, T.; Honjo, T. The complete nucleotide sequence of mouse immunoglobulin y2a gene and evolution of heavy chain genes: further evidence for intervening sequence-mediated domain transfer. Nucleic Acids Res. 9:1365-1381; 1981. 41. Yamawaki-Kataoka, Y.; Kataoka, T.; Naoki, T.; Obata, M.; Honjo, T. Complete nucleotide sequence of immunoglobulin y2b chain gene cloned from newborn mouse DNA. Nature 283:786-789; 1980. 42. Wels, J. A.; Word, C. J.; Rimm, D.; Der-Balan, G. P.; Martinez, H. M.; Tucker, P. W.; Blattner, F. R. Structural analysis of the murine IgG3 constant region. EMBO J. 3:2041-2046, 1984. 43. Ellison, J.; Berson, B. J.; Hood, L. The nucleotide sequence of a human immunoglobulin C,, gene. Nucleic Acids Res. 1040714079; 1982. 44. Ellison, J.; Hood, L. Linkage and sequence homology of two human immunoglobulin y

A. M. Najakshin et al.

45.

46.

47.

48.

49.

heavy chain constant region genes. Proc. Natl. Acad. Sci. USA 79:1984-1988; 1982. Ellison, J.; Buchbamn, J.; Hood, L. Nucleotide sequence of a human immunoglobulin Cy4 gene. DNA l:ll-18; 1981. Symons, D. B. A.; Clarkson, C. A.; Beale, D. Structure of the bovine immunoglobulin constant region heavy chain gamma 1 and gamma 2 genes. Mol. Immunol. 26:841-850; 1989. Foley, R. C.; Beh, K. I. Isolation and sequence of sheep Ig H and L chain cDNA. J. Immunol. 142~708-711; 1989. Clarkson, C. A.; Beale, D.; Coadwell, J. W.; Symons, D. B. A. Sequence of bovine Ig y2 constant region heavy chain cDNA and molecular modelling of ruminant IgG isotypes. Mol. Immunol. 30:1195-1204; 1993. Martens, C. L.; Currier, S. J.; Knight, K. L. Molecular genetic analysis of genes encoding the heavy chains of rabbit IgG. J. Immunol. 133:1022-1027; 1984.