- Email: [email protected]
Structure of the low-density lipoprotein receptor-related protein (LRP) promoter
Biochimica et Biophysica A cta, 1009(1989) 229-236
229
Elsevier BBAEXP 92006
Structure of the low-density lipoprotein receptor-related protein (LRP) promoter Heike Ktitt, Joachim Herz * and Keith K. Stanley European Molecular Biology Laboratory, Heidelberg (F.R.G.)
(Received4 July 1989) Key words: Lowdensitylipoprotein;Lipoproteinreceptor; Promoter;ApolipoproteinE receptor; LRP promoter T h e low-density Hpoprotein receptor-related protein (LRP) is a 45,~-amin~acid membrane protein which c|ose|y resembles the | , D L receptor in its arrangement of cysteine-rich motifs. Binding studies have suggested that one function
of the molecule is as a receptor for Hgands containing apo|ipoprotein E. We present here the sequence and stn|cture of the promoter region of the LRP. These data show that the LRP contains no sterol regulatory e|ement, and is not down-regulated by sterois like the LDL receptor. This [ends further support to the identity of the LRP as a chyiomicron remnant receptor. Introduction
Lipoprotein receptors are important for controlling the concentration of plasma lipoprotein particles. Defects in the structure or regulation of the genes encoding these proteins can account for familial iipoprotein disorders leading to atherosclerosis. Studies on the lowdensity lipoprotein (LDL) receptor sequence in patients having familial hypercholesteroleemia have led to the definition of four classes of mutant with impaired LDL uptake [1]. These mutations affect the synthesis, intracellular transport, LDL binding and clustering into coated pits of the receptor molecule. Plasma L D L levels are also affected by the gene regulation of the L D L receptor, high intracellular cholesterol giving rise to a down-regulation of receptor transcription [2]. The molecular mechanism for this regulatior~ has been ascribed to a sterol regulatory element which is found in the promoter region of the LDL receptor gene [2]. Similar elements have also been found in the genes for
* Present address: Department of MolecularGenetics and Internal
Medicine, Universityof Texas Health ScienceCenter, 5823 Harry Hines Boulevard,Dallas,TX 75235, U.S.A. Abbreviations: LRP, low-density lipoprotein receptor-like protein; HMG, hydroxymethylglutaryl;CAT, chloroamphenicolacetyitransferase (EC 2.3.1.28); PBS,phosphate-bufferedsaline; PMSF, phenylmethylsulphonylfluoride; MEM, minimumessential medium; DT~7, dithiothreitol; SRE, sterol regulatoryelement. Correspondence(present address): K.K. Stanley,The Heart Research Institute, 145-147 Missenden Road, Camperdown,NSW 2050, Sydney, Australia.
HMG-CoA reductase [3] and HMG-CoA synthase promoters [4]. This enables a co-ordinated regulation of the genes controlling cholesterol homeostasis. Recently, a cell surface receptor has been described with a predicted polypeptide molecular mass of 503 kDa and a sequence highly related to the LDL receptor [5]. From this homology it was named the LDL receptor-related protein or LRP. This protein contains four extracellular domains which resemble the ligand-binding region of the LDL receptor, including clusters of the highly acidic class A cysteine-rich motifs which have been postulated to be directly involved in the interaction with apoE and apoB in LDL particles [6,7]. ApoEcontaining ligands have indeed been shown to interact preferentially with LRP molecules on the surface of cells [8], and in cells devoid of a functional LDL receptor the LRP is capable of mediating the uptake of apoE-enriched lipoproteins [9], making it probable that one function of the LRP is as an apoE receptor. A possible iigand for the LRP is therefore the chylomicron remnant, although no direct binding has yet been demonstrated. It is unlikely that the sole function of the LRP is in remnant binding, however, because it is found in most tissues [5] and tissue culture cell lines (unpublished data) even though chylomicron remnant uptake occurs principally in liver. Direct experiments to investigate the function of the LRP are technically difficult due to the large size of the protein (for purification) and cDNA (for transfection), but circumstantial evidence in favour of LRP binding to chylomicron remnants comes from the EDTA resistance of binding to apoE iiposomes [8] which is a property of remnant uptake [10]. One further expected property of a
0167-4781/89/$03.50 © 1989 ElsevierSciencePublishersB.V.(Biomedical Division)
230 chylomicron remnant receptor would be a lack of regulation by sterols [11]. We have therefore determined the structure of the LRP promoter and its regulation by cholesterol. Although the promoter contains an Spl binding site in common with the LDL receptor, there are no consensus sterol regulatory elements, and there is no evidence for down-regulation by cholesterol. Materials and Methods
Isolation of the promoter region of the LRP gene. A human genomic library of blood leukocyte DNA, constructed in the cosmid pcos 2EMBL [12] was kindly provided by A. Frischauf. Colony screening and plasmid isolation were performed according to standard procedures. Nucleotide sequencing. 5'-deletions of the promoter region cloned in pSPT18-CAT, a derivative of pSPT18 (Boehringer) having the CAT gene downstream of the T7 promoter, were obtained using the exonuclease Ill method (Ref. 13; Erase-a-base, Promega). Deletions were ordered by size determination on agarose gels and the 5' sequence of each clone was then determined using the dideoxy chain termination method [24] with modified T7 polymerase (Sequenase, United States Biochemical Corporation) on a denatured plasmid template. The double-stranded plasmid was denatured essentially as described [14], except that an additional phenol and chloroform extraction were performed after treatment with alkali and neutralisation. Ths significantly improved the quality of sequencing gels, allowing 300-400 bases to be read from each clone. Gene regulation in cultured cells, Regulation of the apolipoprotein receptor gene expression was investigated in mouse fibroblast (3T3) and macrophage derived (P388) cell lines in the presence or absence of high cholesterol medium. 31"3 cells were grown in DMEM containing 105 FCS aerated with 105 CO,, the mouse macrophage cell line P388 was grown in aMEM suppiemerited with 10~ foetal calf serum aerated with 5~ CO2. Cell lines were seeded at 2.105 cells/100 mm dish on day 0. On day 1 the cells were washed with 5 ml of PBS and fed with 8 ml of the above medium containing 5~ foetal calf serum with no addition or mixture of cholesterol and 25-hydroxycholesterol (20:1 (w/w) dissolved in ethanol). After 20 h incubation the cells were washed twice with PBS, and once with methionine-free medium. Then 5 ml methionine-free medium (containing 0.5~ foetal calf serum and fresh glutamine) were added, the cells were incubated for 20 rain (37°C 10~ CO 2) and then labelled by adding 100 /tCi [3SS]methionine. After 6 h incubation in labelling medium, the cells were lysed (lysis buffer: 1~ Nonidet P40, 20 mM Tris-HCl (pH 7.5), 150 mM NaCI, 2 mM MgCl 2, 80/Lg/ml PMSF) and the nuclei were spun out. The cleared lysates were incubated with 10 /~1 of an
antiserum raised against the carboxy-terminal 15 amino acids of the protein [5] for 2 h on ice, then 60/tl of a 1:1 slurry of Protein A-Sepharose, prewashed in PBS and buffer B (20 mM Tris-HCl (pH 7.5), 150 mM NaCI, 2 mM MgCI 2, 0.2~ Nonidet P40), were added. After 20 min incubation on a rotating wheel at 4°C the samples were washed three times with buffer B, once with buffer C (as buffer B but with 500 mM NaCI) and twice with PBS. The pellets were resuspended in 25/tl PBS and 25 /tl sample buffer (20 mM Tris-HCl (pH 8.8), 0.5 mM EDTA, 4~ SDS, 50 mM DTT), boiled for 3 rain and loaded onto a 5~; SDS-polyacrylamide gel [15]. CA T assay and luciferase assay. HepG2 ceils were grown in DMEM containing 10~$ foetal calf serum aerated with 10~ CO2 to 75~ confluence in 35 mm dishes. Supercoiled plasmid DNA was purified by isopycnic centrifugation on cesium chloride gradients and introduced into the cells by calcium phosphate precipitation [16,17] or by microinjection of 5.10 -14 litre of plasmid at a concentration of 50/tg/ml [18]. 20 h after injection the cells were harvested in 200/tl of 250 mM Tris-HCl (pH 7.5), disrupted by sonication and spun down for 15 rain at 4°C in an Eppendorf microfuge. The supernatants were removed and assayed for CAT and luciferase enzyme activity. CAT assay. The assay mixture contained 100/tl of cell extract, 1 /~Ci of [14C]chloramphenicol (50 ~tCi/ retool), 20/tl of 3.5 mM acetylcoenzyme A and 250 raM Tris-HCl (pH 7.5) to a final volume of ] 80 ~tl [19]. All reagents were incubated for 70 rain at 37 o C. The reaction was stopped with 1 mi ethyl acetate, which was also used to extract chloramphenicol. The organic layer was dried and taken up in 15 ml of ethyl acetate, spotted on silica-gel thin-layer chromatography plates, and run with chloroform/methanol (95:5, v/v). After autoradiography spots were cut out and counted. Luciferase assay. 20/tl of the extract was added to 350 ~tl of 25 mM glycycglycine (pH 7.8) containing 5 mM ATP and 15 mM MgSO4. The tube was placed in an LKB luminometer (562 nm), and the reaction was initiated by the injection of 100/tl of 1 mM luciferin in glycylglycine buffer [20]. DNA-protein binding assays. DNase I footprints and oligonucleotide binding experiments were performed on rat liver nuclear extracts prepared as described [21,22]. Gel retardation. Gel retardation experiments were carried out by incubating 2-3 ng of labelled doublestranded oligonucleotide with 4 - 6 / t g of a nuclear extract in a buffer containing 60 mM KCI, 7.5~ glycerol (v/v), 0.1 mM EDTA, 0.75 mM DTT 5 mM MgCI 2. After 30 rain incubation on ice, 5/tl of 205 Ficoll were added and the samples were loaded directly onto a 4~ acrylamide gel in 0.25 x TBE buffer and electrophoresed at 10 V/cm for 2-3 h at 4°C. The gel was pre-electrophoresed for 1 h at 4°C. For competition experiments, 200 ng of a double-stranded oligonucleo-
231
CD~
St~
s LI~G1
! ÷
-
÷
+
! I
PD2 (-1458)
PD3 (-i175)
PD4
(-:zogo)
PD5
(-gg6)
PD6
(-908)
PD7
(-816)
PD8
(-806)
|
_ _ _
..
!
I
r ~n
r'l
M
i'l
I l:::::::::::~: ::::~::;'.:'.':':': ~, :~~:::~:~:' ~' ~' :,~.:
PD9 (-709)
PDI0 (-692)
Fig. 1. Cloning of the promoter region of the LRP gene. LRPGI, an 9.8 kb EcoR! fragment was obtained from cosmid clones which hybridise to LRP cDNA. LRPG2 consists of a Sacl fragment from LRPGI cloned into pSPTIgCAT. PDI to PDI0 are 5' resections of LRPG2 in pSPTIgCAT (numbers refer to the first base of the clone in the sequence shown in Fig. 2). The hatched area represents the CAT gene, ORF is the open reading frame of the LRP cDNA, S the Sacl sites flanking the sequenced fragment, and FPl to FP5 mark the positions of DNase 1 footprints. The proposed transcriptional regulation conferred by these elements is also indicated.
232 2) corresponding to bases 23-40 of the LRP cDNA, a common 9800 bp band was observed in each digest showing that this DNA fragment contained the exon corresponding to the 5'-end of the LRP cDNA. The 9.8 kb EcoRI band was excised from an agarose gel and cloned into pGEM 4 (LRPG1, Fig. 1). A small region of LRPG1 was sequenced using SEQ57 as primer in order to confirm that the clone contained the known sequence of the 5'-end of the LRP cDNA. From this sequence an ofigonucleotide was synthesised upstream of the Sacl site at position 10 in the LRP cDNA sequence and used as a hybridisation probe for Southern '.,lots of LRPG1 using different restriction enzymes. A Sacl restriction enzyme fragment of 1.3 kb, which hyb;idised with this probe, was cloned into pSFF18 CAT. The orientation of the fragment was determined by nucleotide sequencing using universal primers close to the cloning linker of the
tide were added to the reaction mixture prior to the addition of the nuclear extract. DNase footprinting. Footprinting was performed as described [22] on a 451 bp fragment excised from the deletion mutant clone PD6 in the pSPT18 CAT vector. Results
Approx. 300 000 clones of a human genomic cosmid library were screened with a cDNA fragment correspo,ding to bases 1-2230 of the LRP cDNA (LRP3 in Ref. 5). Cosmid DNA was purified from 14 colonypurified positive clones and analysed by EcoRl restriction. Seven distinguishable patterns of restriction fragments were observed. When these restriction enzyme fragments were transferred to nitrocellulose filters and hybridised with an oligonucleotide probe (SEQ57, Fig.
-901
-960
TGTCCCCACCCCGGGCAGAGGAGGCACCTTCAGGGTTCCCCTAGAAAATCG~GCCTCGGC
-900
OOAGAOOAO GAGTOCOGG OGOOOOOGG GGAGOOTG ;.ATOOTAGAG ATGAOAO -8Gi re1 GTTTCAAAGGGGAGCCGCTCAGC~TCCGCCCACTG~CCAAT~CCACCCTCGAC~CCTTC •
-84O
.
.
-780
.
.
.
.
.
-781
R81.
TGCTCTCTGGAGCACCAGGGAGGAGGGCCCAGCCAGGGGAGAGGGCGCCCCAGGCCCCAA F~S •
-720
•
I
!
~
I
-721 "
ACTAGCCAGCGAGTCCCCG~GACCCTCACTCTTGGACCGCTTTCCAGAACTCCGAAC~CT •
•
e
FP4
~
.
-661 .
-660
GTCGCGGGTCCGCGTCGCCCTCCCC~GGGCAGCGCGTCAAATCGGCG~ATGCGCACTCAC
-601
-600
TGGATTGCCGCGTAGCTCTTTCTCCCCCCACCAACCAACCTTTTTTCTTTCCCCGCCCCT
-541
-540 -480
TCCCTCCCTCCCTCCTCAACCCGTCCCCTC~CTCTCCCCCATCA~CCCCCCCCTCGGCAC • r----A~.cOtqA 8 t s r t . . 81Q57 . TTCAGTCCGGGGARCAGCGGTGCGAGCTCCAGGCCC~£GCACTGAGGAGGCGGAAACAAG
-420
GGGAGCCCCCAGAGCTCCATCAAGCCCCCTCCAAAGGCTCCCCTACCCGGTCCACGCCCC '8sc
-360
-481 .
-421 -361
l
CCACCCCCCCTCCCCGCCT6CTCCCAATTGTGCATTTTTGCAGCCGGAGGCGGCTCCGAG •
•
•
-301 m
-300
ATGGGGCTGTGAGCTTCGCCCGGGGAGGGGGAAAGAGCAGCGAGGAGTGAAGCGGGGGGG
-241
-240
TGGGGTGAAGGGTTTGGATTTCGGGGCAGGGGGCGCACCCCCGTCAGCAGGCCCTCCCCA
-181
-180
AGGGGCTCGGAACTCTACCTCTTCACCCACGCCCCTGGTGCGCTTTGCCGAAGGAAAGAA
-121
-120
TAAGAACAGAGAAGGAGGAGGGGGAAAGGAGGAAAAGGGGGACCCCCCAACTGGGGGGGG
-61
-60
TGAAGGAGAGAAGTAGCAGGACCAGAGGGGAAGGGGCTGCTGCTTGCATCAGCCCACACC 1 ~01~
-1
N~ 2. Nucl~fide sequenceof the pmmo~r region of the LRP ~ne. Boxed sequencesshow f~tpNnts identifi~ ~ DNase ! mapping,s~ 57 marks the position of ~ ofi~nudm~e used ~r identification of DNA fragmentscontmmng the promoter, and ORF shows the start of the presum~ open r e a ~ frameof ~e LRP. An upstreamAT(} in the 5'-untr~slat~ re,on is double undedin~. ~ e start of the PD6 clone used ~ r f~tpnnting is also mark~.
233 vector. This confirmed that the fragment started at the Sacl site at position 10 in the LRP cDNA [5] and extended in the 5' direction. A clone was selected in which the Sacl fragment was in the same orientation as the CAT gene (LRPG2, Fig. 1), and a set of 5' deletions were created using E. coli exonuclease III (PD1 to PD10, Fig. 1). The ends of each of these deletions were then sequenced using the SP6 universal primer for pSPT18 CAT and the sequence of the promoter region and position of each deletion clone were determined. The sequence of part of this fragment together with the start of the cDNA sequence is shown in Fig. 2 (the complete sequence has been submitted to the EMBL nucleotide sequence data library, accession number X15424). Nucleotides are numbered from the start of the open reading frame of the LRP. From this it may be seen that the LRP has an unusually long 5' untranslated region which contains an upstream ATG that is not utilised as the ;nitiating codon. This ATG is in the same reading frame as the ATG used for initiation, but is only followed by a short open reading frame and does not contain a consensus sequence for initiation of translation [23]. Two different cDNA clones were found which started at the position shown in Fig. 2, suggesting that this could be the transcription start of the gene or a frequent stop site for reverse transcriptase on the mRNA. Due to the extremely long length (15 kb) and relatively low abundance of the LRP mRNA, however, we were unable to confirm this as the transcription start by primer extension.
:/ili~ili:,i~i~:ii!,,i:i~il! ~
TABLE l
CA T activity of transfected promoter deletion clones Only PD7. PD8 and PDI0 have activities above a non-transfected control. Clone
Luciferase
CAT
Ratio
PDI PD2 PD3 PD6 PD7 PD8 PDI0
405! 1806 2466 5494 370 4 326 2643
606 613 418 429 1229 1054 955
0.15 0.34 0.17 0.08 3.32 0.24 0.36
76
714
9.4
Control
The complete 1.3 kb Sacl fragment (LRPG2) and several clones having different deletions into the 5' upstream region of the promoter (PD3 to PD10) were selected and used for CAT assays in transient transfections of HepG2 cells. Fig. 3 shows one experiment using calcium phosphate transfection of the cells. In order to exclude the possibility that the differences of CAT expression were due to different efficiencies of transfection, we also performed co-transfections with a second vector containing the luciferase gene under the control of the RSV promoter (Table I). In this case the DNA was introduced by microinjection. Essentially the same result was obtained. Although some promoter activity was visible in LRPG2 (Fig. 3, lane 2) this activity was not present in the deletions PD3 to PD6. Only after resetting beyond base - 8 1 6 (PDT, Fig. 3, lane 7,~ is some promoter activity restored. Direct measurement of
•
im
Fig. 3. Promoter activity of various deletions of the LRP measured by CAT assay. Arrows show position of acetylated chloramphenicoi generated by expression of CAT under the direction of LRP promoter fragments. Lane 2. LRPG2; lanes 3 to 10. PD3 to PDI0. Lane 1 is a control transfection with pSV2CAT in which the CAT expression is controlled by the SV40 early promoter.
234
I:P4
.I,B!
I:P3
CAT activity (Fig. 3) suggests tha~. a peak of CAT activity in found after further deletion to produce PDg, but when transfection efficiency is taken into account (Table I) it appears that PD7 has a higher promoter strength than PDg. The promoter activity of the deletions, however, never reached the level of LRPG2, which itself was only approx. 8~ of th~ activity of the SV40 early promoter (Fig. 3, lane 1). Further deletion to generate PD9 and PD10 thet~ caused a reduction in promoter activity (Fig. 3, lane 9, 10, and Table I). This suggests an arrangement of positive and negative control elements in the promoter as shown diagramatie~dly in Fig. 1. The principal positive elements in the promoter therefore occur between bases -816 and -693. DNase I footprinting was used to determine the location of DNA binding proteins in the LRP promoter (Fig. 4). For this, a 451 bp fragment (from PD6 excised by Hindlll digestion of the pSPT18CAT linker ~nd Sacl site at - 4 5 4 in fig. 2) was labelled by filling in the Hindlll site at the 3'-end with the Klenow fragment of E. coli DNA polymerase. Five DNase-l-protected regions and one hypersensitive site were found in the 350 bp to the 5' side of the cDNA start (Fig. 4). The position of these footprints FP1 to FP5 are shown in Figs. 1 and 2. The position of FP1 coincides with the principa! positive element of the promoter as defined by the CAT assays. PD~ is resc~ted to the first base of this footprint and PD8 cleaves within it. Footprint FP1 contains a consensus sequence for an Spl binding site. We therefore investigated the ability of the major footprint sequences FP1 to FP3 to bind to proteins in a rat liver nuclear extract by using a gel retardation assay (Fig. 5). As an control we also included oligonucleotides encoding the Spl binding site from the Xenopus laeuis U2 snRNA gene and examined the relationship between binding proteins by competition experiments. Proteins from the rat liver nuclear extract in all three footprint sequences tested were capable of binding in a manner competed by unlabelled oligonucleotides (Fig. 5 lane 1-3 in each panel). In panels A and B it can also be seen that FP1 and Spl can compete with each other (lane 4, panels A, B), while FP3 was not able to compete (lane 5, panels A, B). Binding of proteins in the nuclear extract to FP2 and FP3 was not as strong as with the Spl or FP1 oligonucleotides and is not competed by oligonucleotides encoding the Spl bioding site. Although FP3 was particularly weak, it was able to compete with binding of labelled FP2 and also vice versa, suggesting that these two footprints bind to the same protein.
Fig. 4. DNase I footprint analysis of DNA binding proteins in the LRP promoter region. Lane 1, (3 4-A sequencing reaction mix using labelled fragment; lanes 2 and 8, DNase 1 digest without nuclear extract; lanes 3-7, 10, 20, 50, 75 and 100 ttg of nuclear extract.
235 A 1
2
3
'i
B 5 1
4
2
3
4
C 5 1
2 3
4
D 5 1 2
3 4
ii /ii iiiiii i
o '
i~ i i ¸~ ~!
~ ¸¸¸!4 ,
~'i
Fig. 5. Band shift assay of footprint sequences of the LRP promoter region. Panel A: Spl control, panel B: FPI, panel C: FP2, panel D: FP3. In each panel lane 1 shows the end-labelled, double-stranded oligonucleotide, lane 2 the labelled oligonucleotide incubated with nuclear extract and lane 3 binding of labelled oligonucleotide in the presence of unlabelled oligonucleotide. The remaining lanes show competition experiments as follows. (A) Lane 4, FP1 oligonucleotide; lane 5, FP'-~oligonucleotide. (B) Lane 4, Spl oligonucleotide; lane 5, FP3 oligouucleotide. (C) Lane 4, Spl oligonucleotide; lane 5, FP3 oligonucleotide. (D) Lane 4, Spl oligonucleotide; lane 5, FP2 oligonucleotide. Panel (A) was e~tposed for 18 h and panels (B)-(D) for 7 days.
Analysis of the promoter regions for the L D L receptor gene, the HMG-CoA reductase and the HMG-CoA synthase genes has shown that a common regulatory element is present which confers regulation by sterol concentrations in the cell [2-4]. The mechanism by which regulation is achieved, however, appears to be different in the three genes [4]. In particular, the LDL
TABLE 11
Effects of sterols on LRP expression
The LRP and LDL receptor were immunoprecipitatedfrom the same iysates of normal or cholesterol loaded cells. After separation on SDS-polyacrylamidegels, bands of the appropriate molecular weight were quantitated by scanning of the autoradiogram and gravimetric analysis of the peak areas. Valuesare expressed as a percentageof the peak area in unloaded cells. LRP Cholesterol P388 3T3
100 100
LDL receptor + 132 187
100 100
+ 69 34
receptor contains an SRE in combination with a reverse orientation Spl site. Since the LRP also contains a reverse orientation Spl site (footprint FPl) which gives the major transcriptionai activity of the promoter, we looked for SRE-like sequences in the LRP promoter, but none could be found in the footprints or flanking DNA sequence. In order to check experimentally if sterols could down-regulate the LRP promoter, we supplemented the medium used for growing P388 or 3T3 cells with a mixture of cholesterol and 25-hydroxycholesterol as prev'ously described [2]. The cells were then metabolically labelled and both the LDL receptor and LRP were immunoprecipitated. While a down-regulation was evident in the L D L receptor in both cell types, the LRP actually increased in concentration in the presence of added sterols (Table It). Mouse fibroblast and macrophage cell lines were chosen because down-regulation of the L D L receptor provided a control for effective cholesterol loading. When similar experiments were performed on whole animals, no downregulation of hepatic LRP was observed (data not shown).
236 Discussion
We have isolated a genomic DNA fragment which encodes the promoter of the LRP and analysed its structure and regulation. DNase 1 footprinting suggests the presence of several DNA binding protein binding sites in the 350 bp upstream of the cDNA start position. The most important of these in terms of promoter activity is an Spl binding site in reverse orientation (FPl). Weaker transcriptional activity remained after the Spl site had been deleted, suggesting the presence of other components in the promoter. CAT expression decreases after part of FP3 is lost in the PD9 deletion. Thus at least FP1 and FP3 must contribute to the transcriptional activity of the promoter. The oligonucleotides corresponding to the binding sites of FP2 and FP3 were also capable of weakly binding to the same nuclear protein which was shown to be different from Spl by competition experiments in a gel retardation assay. Both footprints contained the sequence 5' ACCCTC 3' which might account for their common binding activity. Little further promoter activity was associated with the footprints FP4 and FP5, so these were not analysed by gel-retardation experiments. To the 5' side of the Spl binding site is a negative control element, since inclusion of this region in the CAT constructs (PD3 to PD6) abolished the activity of the promoter fragment in CAT assays. It must be situated in the 92 bp between the 5' end of the PD6 and PD7 deletions. This negative element is presumably a conditional negative element, since in the complete LRPG2 clone the highest promoter activity was observed. A further positive element must therefore be situated inbetween the Sacl site of LRPG2 and the 5' end of PD3. Surprisingly, no TATA box or CAAT box was evident in the sequence flanking the 5' side of the cDNA start, although the footprint FP5 was located in the expected position ( - 3 0 ) for a TATA box. It is not uncommon for housekeeping genes to have poorly discernible TATA box sequences. Perhaps as a result of the lack of a TATA box the activity of the LRP promoter was very low, representing only about 8~; of the activity of the SV40 early promoter. This makes it difficult to dissect the promoter elements by measuring the CAT activity of promoter deletions, since only small increases above background activity are observed. Tht: only sequence similarity with the LDL receptor was one reverse orientation Spl binding site. Thus, despite the similarity of protein sequence between the LRP and LDL receptor it is apparent that the two genes have different transcription units and are most likely expressed under different conditions. In particular, no sterol regulatory elements could be found in the promo-
ter sequence and no evidence for down-regulation of the promoter in the presence of sterols was observed in mouse fibroblast or macrophage-like cell lines. The absence of sterol regulation in the LRP promoter supports a role of the protein as a chylomicron remnant receptor, since uptake of chylomicron remnants in macrophage derived cell fines has been shown to be independent of cholesterol feeding [11]. Acknowledgements We thank A. Frishauf for giving us the human geo nomic DNA cosmid library H2, R. Pepperkok for help with the microinjection experiments and P. Monaci and A. Nicosia for help with the footprint and gel-retardation experiments, pSPT18CAT was kindly provided by P. Charvier. References 1 Brown, M.S. and Goldstein, J.L. (1986) Science 232, 34-47. 2 Sfidhof, T.C., Van der Westhuyzen, D.R., Goldstein, J.L., Brown, M.S. and Russell, D.W. (1987) J. Biol. Chem. 262, 10773-10779. 3 Osborne, T.F., Gol, G., Browns, M.S., Kowal, R.C. and Go|dstein, J.L. (1987) Proc. Natl. Acad. Sci. USA 84, 3614-3618. 4 Smith, J.R., Osborne, T.F., Brown, M.S., Goldstein, J.L. and Gil, G. (1988) J. Biol. Chem. 263, 18480-18487. 5 Herz, J., Hamann, U., Rogne, S., Myklebost, O., Gausepohl, H. and Stanley, K.K. (1988) EMBO J. 7, 4119-4127. 6 Yamamoto, T., Davis, C.G., Brown, M.S., Schneider, W.J., Casey, M.L., Goldstein, J.L. and Russell, D.W. (1984) Cell 39, 27-38. 7 Lalazar, A., Weisgraber, K.H., Rail, S.C., Giladi, H., lnnerarity, T.L., Levanon, A.Z., Boyles, J.K., Amit, B., Gorecki, M., Mahley, R.W. and Vogel, T. (1988) J. Biol. Chem. 263, 3542-3545. 8 ikisiegel, U., Weber, W., lhrke, G., Herz, .I. and Stanley, K.K. (1989) Nature 341,162-164. 9 Kowal, R.C., Herz, J., Goldstein, J.L., Esser, V. and Brown, M.S. (1989) Proc. Natl. Acted. Sci. USA 86, 5810-5814. 10 Cooper, A.D., Erickson, S.K., Nutik, R. and Shrewsbury, M.A. (1982) J. Lipid Res. 23, 42-52. 11 Elisworth, J.L., Cooper, A.D. and Kraemer, F.B. (1986) J. Lipid Res. 27, 1062-1072. 12 Poustka, A., Rackwitz, H.R., Frishauf, A.M., Hohn, B. and Lehrach, H. (1984) Proc. Natl. Acad. Sci. USA 81, 4129-4133. 13 Henikoff, S.C. (1984) Gene 28, 357-359. 14 Chen, E.Y. and Seeburg, P.H. (1985) DNA 4, 165-170. 15 Laemmli, U.K. (1970) Nature 227, 680-685. 16 Graham, F.L. and Van der Eb, A.J. (1977) Virology 52, 456. 17 Chu, G. and Sharp, P.A. (1981) Gene 13, 197-217. 18 Pepperkok, R., Schneider, C., Philipson, L. and Ansorge, W. (1988) Exp. Cell Res. 178, 369-376. 19 Gorman, C.M., Moffat, J.F. and Howard, B.H. (1~2) Mol. Cell Biol. 2, 1044-1051 20 Do Wet, .r.R., Wood K.V., DeLuca, M., Hellinski, D.R. and Subramanai, S. (1987) Mol. Cell Biol. 7, 725-737. 21 Gorski, K., Carneiro, M. and Schibler, U. (1986) Cell 47, 767-776. 22 Lichtsteiner, S., Wuarin, J. and Schibler, U. (1987) Cell 5, 963-973. 23 Kozak, M. (1989) J. Cell Biol. 108, 229-241. 24 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467.
229
Elsevier BBAEXP 92006
Structure of the low-density lipoprotein receptor-related protein (LRP) promoter Heike Ktitt, Joachim Herz * and Keith K. Stanley European Molecular Biology Laboratory, Heidelberg (F.R.G.)
(Received4 July 1989) Key words: Lowdensitylipoprotein;Lipoproteinreceptor; Promoter;ApolipoproteinE receptor; LRP promoter T h e low-density Hpoprotein receptor-related protein (LRP) is a 45,~-amin~acid membrane protein which c|ose|y resembles the | , D L receptor in its arrangement of cysteine-rich motifs. Binding studies have suggested that one function
of the molecule is as a receptor for Hgands containing apo|ipoprotein E. We present here the sequence and stn|cture of the promoter region of the LRP. These data show that the LRP contains no sterol regulatory e|ement, and is not down-regulated by sterois like the LDL receptor. This [ends further support to the identity of the LRP as a chyiomicron remnant receptor. Introduction
Lipoprotein receptors are important for controlling the concentration of plasma lipoprotein particles. Defects in the structure or regulation of the genes encoding these proteins can account for familial iipoprotein disorders leading to atherosclerosis. Studies on the lowdensity lipoprotein (LDL) receptor sequence in patients having familial hypercholesteroleemia have led to the definition of four classes of mutant with impaired LDL uptake [1]. These mutations affect the synthesis, intracellular transport, LDL binding and clustering into coated pits of the receptor molecule. Plasma L D L levels are also affected by the gene regulation of the L D L receptor, high intracellular cholesterol giving rise to a down-regulation of receptor transcription [2]. The molecular mechanism for this regulatior~ has been ascribed to a sterol regulatory element which is found in the promoter region of the LDL receptor gene [2]. Similar elements have also been found in the genes for
* Present address: Department of MolecularGenetics and Internal
Medicine, Universityof Texas Health ScienceCenter, 5823 Harry Hines Boulevard,Dallas,TX 75235, U.S.A. Abbreviations: LRP, low-density lipoprotein receptor-like protein; HMG, hydroxymethylglutaryl;CAT, chloroamphenicolacetyitransferase (EC 2.3.1.28); PBS,phosphate-bufferedsaline; PMSF, phenylmethylsulphonylfluoride; MEM, minimumessential medium; DT~7, dithiothreitol; SRE, sterol regulatoryelement. Correspondence(present address): K.K. Stanley,The Heart Research Institute, 145-147 Missenden Road, Camperdown,NSW 2050, Sydney, Australia.
HMG-CoA reductase [3] and HMG-CoA synthase promoters [4]. This enables a co-ordinated regulation of the genes controlling cholesterol homeostasis. Recently, a cell surface receptor has been described with a predicted polypeptide molecular mass of 503 kDa and a sequence highly related to the LDL receptor [5]. From this homology it was named the LDL receptor-related protein or LRP. This protein contains four extracellular domains which resemble the ligand-binding region of the LDL receptor, including clusters of the highly acidic class A cysteine-rich motifs which have been postulated to be directly involved in the interaction with apoE and apoB in LDL particles [6,7]. ApoEcontaining ligands have indeed been shown to interact preferentially with LRP molecules on the surface of cells [8], and in cells devoid of a functional LDL receptor the LRP is capable of mediating the uptake of apoE-enriched lipoproteins [9], making it probable that one function of the LRP is as an apoE receptor. A possible iigand for the LRP is therefore the chylomicron remnant, although no direct binding has yet been demonstrated. It is unlikely that the sole function of the LRP is in remnant binding, however, because it is found in most tissues [5] and tissue culture cell lines (unpublished data) even though chylomicron remnant uptake occurs principally in liver. Direct experiments to investigate the function of the LRP are technically difficult due to the large size of the protein (for purification) and cDNA (for transfection), but circumstantial evidence in favour of LRP binding to chylomicron remnants comes from the EDTA resistance of binding to apoE iiposomes [8] which is a property of remnant uptake [10]. One further expected property of a
0167-4781/89/$03.50 © 1989 ElsevierSciencePublishersB.V.(Biomedical Division)
230 chylomicron remnant receptor would be a lack of regulation by sterols [11]. We have therefore determined the structure of the LRP promoter and its regulation by cholesterol. Although the promoter contains an Spl binding site in common with the LDL receptor, there are no consensus sterol regulatory elements, and there is no evidence for down-regulation by cholesterol. Materials and Methods
Isolation of the promoter region of the LRP gene. A human genomic library of blood leukocyte DNA, constructed in the cosmid pcos 2EMBL [12] was kindly provided by A. Frischauf. Colony screening and plasmid isolation were performed according to standard procedures. Nucleotide sequencing. 5'-deletions of the promoter region cloned in pSPT18-CAT, a derivative of pSPT18 (Boehringer) having the CAT gene downstream of the T7 promoter, were obtained using the exonuclease Ill method (Ref. 13; Erase-a-base, Promega). Deletions were ordered by size determination on agarose gels and the 5' sequence of each clone was then determined using the dideoxy chain termination method [24] with modified T7 polymerase (Sequenase, United States Biochemical Corporation) on a denatured plasmid template. The double-stranded plasmid was denatured essentially as described [14], except that an additional phenol and chloroform extraction were performed after treatment with alkali and neutralisation. Ths significantly improved the quality of sequencing gels, allowing 300-400 bases to be read from each clone. Gene regulation in cultured cells, Regulation of the apolipoprotein receptor gene expression was investigated in mouse fibroblast (3T3) and macrophage derived (P388) cell lines in the presence or absence of high cholesterol medium. 31"3 cells were grown in DMEM containing 105 FCS aerated with 105 CO,, the mouse macrophage cell line P388 was grown in aMEM suppiemerited with 10~ foetal calf serum aerated with 5~ CO2. Cell lines were seeded at 2.105 cells/100 mm dish on day 0. On day 1 the cells were washed with 5 ml of PBS and fed with 8 ml of the above medium containing 5~ foetal calf serum with no addition or mixture of cholesterol and 25-hydroxycholesterol (20:1 (w/w) dissolved in ethanol). After 20 h incubation the cells were washed twice with PBS, and once with methionine-free medium. Then 5 ml methionine-free medium (containing 0.5~ foetal calf serum and fresh glutamine) were added, the cells were incubated for 20 rain (37°C 10~ CO 2) and then labelled by adding 100 /tCi [3SS]methionine. After 6 h incubation in labelling medium, the cells were lysed (lysis buffer: 1~ Nonidet P40, 20 mM Tris-HCl (pH 7.5), 150 mM NaCI, 2 mM MgCl 2, 80/Lg/ml PMSF) and the nuclei were spun out. The cleared lysates were incubated with 10 /~1 of an
antiserum raised against the carboxy-terminal 15 amino acids of the protein [5] for 2 h on ice, then 60/tl of a 1:1 slurry of Protein A-Sepharose, prewashed in PBS and buffer B (20 mM Tris-HCl (pH 7.5), 150 mM NaCI, 2 mM MgCI 2, 0.2~ Nonidet P40), were added. After 20 min incubation on a rotating wheel at 4°C the samples were washed three times with buffer B, once with buffer C (as buffer B but with 500 mM NaCI) and twice with PBS. The pellets were resuspended in 25/tl PBS and 25 /tl sample buffer (20 mM Tris-HCl (pH 8.8), 0.5 mM EDTA, 4~ SDS, 50 mM DTT), boiled for 3 rain and loaded onto a 5~; SDS-polyacrylamide gel [15]. CA T assay and luciferase assay. HepG2 ceils were grown in DMEM containing 10~$ foetal calf serum aerated with 10~ CO2 to 75~ confluence in 35 mm dishes. Supercoiled plasmid DNA was purified by isopycnic centrifugation on cesium chloride gradients and introduced into the cells by calcium phosphate precipitation [16,17] or by microinjection of 5.10 -14 litre of plasmid at a concentration of 50/tg/ml [18]. 20 h after injection the cells were harvested in 200/tl of 250 mM Tris-HCl (pH 7.5), disrupted by sonication and spun down for 15 rain at 4°C in an Eppendorf microfuge. The supernatants were removed and assayed for CAT and luciferase enzyme activity. CAT assay. The assay mixture contained 100/tl of cell extract, 1 /~Ci of [14C]chloramphenicol (50 ~tCi/ retool), 20/tl of 3.5 mM acetylcoenzyme A and 250 raM Tris-HCl (pH 7.5) to a final volume of ] 80 ~tl [19]. All reagents were incubated for 70 rain at 37 o C. The reaction was stopped with 1 mi ethyl acetate, which was also used to extract chloramphenicol. The organic layer was dried and taken up in 15 ml of ethyl acetate, spotted on silica-gel thin-layer chromatography plates, and run with chloroform/methanol (95:5, v/v). After autoradiography spots were cut out and counted. Luciferase assay. 20/tl of the extract was added to 350 ~tl of 25 mM glycycglycine (pH 7.8) containing 5 mM ATP and 15 mM MgSO4. The tube was placed in an LKB luminometer (562 nm), and the reaction was initiated by the injection of 100/tl of 1 mM luciferin in glycylglycine buffer [20]. DNA-protein binding assays. DNase I footprints and oligonucleotide binding experiments were performed on rat liver nuclear extracts prepared as described [21,22]. Gel retardation. Gel retardation experiments were carried out by incubating 2-3 ng of labelled doublestranded oligonucleotide with 4 - 6 / t g of a nuclear extract in a buffer containing 60 mM KCI, 7.5~ glycerol (v/v), 0.1 mM EDTA, 0.75 mM DTT 5 mM MgCI 2. After 30 rain incubation on ice, 5/tl of 205 Ficoll were added and the samples were loaded directly onto a 4~ acrylamide gel in 0.25 x TBE buffer and electrophoresed at 10 V/cm for 2-3 h at 4°C. The gel was pre-electrophoresed for 1 h at 4°C. For competition experiments, 200 ng of a double-stranded oligonucleo-
231
CD~
St~
s LI~G1
! ÷
-
÷
+
! I
PD2 (-1458)
PD3 (-i175)
PD4
(-:zogo)
PD5
(-gg6)
PD6
(-908)
PD7
(-816)
PD8
(-806)
|
_ _ _
..
!
I
r ~n
r'l
M
i'l
I l:::::::::::~: ::::~::;'.:'.':':': ~, :~~:::~:~:' ~' ~' :,~.:
PD9 (-709)
PDI0 (-692)
Fig. 1. Cloning of the promoter region of the LRP gene. LRPGI, an 9.8 kb EcoR! fragment was obtained from cosmid clones which hybridise to LRP cDNA. LRPG2 consists of a Sacl fragment from LRPGI cloned into pSPTIgCAT. PDI to PDI0 are 5' resections of LRPG2 in pSPTIgCAT (numbers refer to the first base of the clone in the sequence shown in Fig. 2). The hatched area represents the CAT gene, ORF is the open reading frame of the LRP cDNA, S the Sacl sites flanking the sequenced fragment, and FPl to FP5 mark the positions of DNase 1 footprints. The proposed transcriptional regulation conferred by these elements is also indicated.
232 2) corresponding to bases 23-40 of the LRP cDNA, a common 9800 bp band was observed in each digest showing that this DNA fragment contained the exon corresponding to the 5'-end of the LRP cDNA. The 9.8 kb EcoRI band was excised from an agarose gel and cloned into pGEM 4 (LRPG1, Fig. 1). A small region of LRPG1 was sequenced using SEQ57 as primer in order to confirm that the clone contained the known sequence of the 5'-end of the LRP cDNA. From this sequence an ofigonucleotide was synthesised upstream of the Sacl site at position 10 in the LRP cDNA sequence and used as a hybridisation probe for Southern '.,lots of LRPG1 using different restriction enzymes. A Sacl restriction enzyme fragment of 1.3 kb, which hyb;idised with this probe, was cloned into pSFF18 CAT. The orientation of the fragment was determined by nucleotide sequencing using universal primers close to the cloning linker of the
tide were added to the reaction mixture prior to the addition of the nuclear extract. DNase footprinting. Footprinting was performed as described [22] on a 451 bp fragment excised from the deletion mutant clone PD6 in the pSPT18 CAT vector. Results
Approx. 300 000 clones of a human genomic cosmid library were screened with a cDNA fragment correspo,ding to bases 1-2230 of the LRP cDNA (LRP3 in Ref. 5). Cosmid DNA was purified from 14 colonypurified positive clones and analysed by EcoRl restriction. Seven distinguishable patterns of restriction fragments were observed. When these restriction enzyme fragments were transferred to nitrocellulose filters and hybridised with an oligonucleotide probe (SEQ57, Fig.
-901
-960
TGTCCCCACCCCGGGCAGAGGAGGCACCTTCAGGGTTCCCCTAGAAAATCG~GCCTCGGC
-900
OOAGAOOAO GAGTOCOGG OGOOOOOGG GGAGOOTG ;.ATOOTAGAG ATGAOAO -8Gi re1 GTTTCAAAGGGGAGCCGCTCAGC~TCCGCCCACTG~CCAAT~CCACCCTCGAC~CCTTC •
-84O
.
.
-780
.
.
.
.
.
-781
R81.
TGCTCTCTGGAGCACCAGGGAGGAGGGCCCAGCCAGGGGAGAGGGCGCCCCAGGCCCCAA F~S •
-720
•
I
!
~
I
-721 "
ACTAGCCAGCGAGTCCCCG~GACCCTCACTCTTGGACCGCTTTCCAGAACTCCGAAC~CT •
•
e
FP4
~
.
-661 .
-660
GTCGCGGGTCCGCGTCGCCCTCCCC~GGGCAGCGCGTCAAATCGGCG~ATGCGCACTCAC
-601
-600
TGGATTGCCGCGTAGCTCTTTCTCCCCCCACCAACCAACCTTTTTTCTTTCCCCGCCCCT
-541
-540 -480
TCCCTCCCTCCCTCCTCAACCCGTCCCCTC~CTCTCCCCCATCA~CCCCCCCCTCGGCAC • r----A~.cOtqA 8 t s r t . . 81Q57 . TTCAGTCCGGGGARCAGCGGTGCGAGCTCCAGGCCC~£GCACTGAGGAGGCGGAAACAAG
-420
GGGAGCCCCCAGAGCTCCATCAAGCCCCCTCCAAAGGCTCCCCTACCCGGTCCACGCCCC '8sc
-360
-481 .
-421 -361
l
CCACCCCCCCTCCCCGCCT6CTCCCAATTGTGCATTTTTGCAGCCGGAGGCGGCTCCGAG •
•
•
-301 m
-300
ATGGGGCTGTGAGCTTCGCCCGGGGAGGGGGAAAGAGCAGCGAGGAGTGAAGCGGGGGGG
-241
-240
TGGGGTGAAGGGTTTGGATTTCGGGGCAGGGGGCGCACCCCCGTCAGCAGGCCCTCCCCA
-181
-180
AGGGGCTCGGAACTCTACCTCTTCACCCACGCCCCTGGTGCGCTTTGCCGAAGGAAAGAA
-121
-120
TAAGAACAGAGAAGGAGGAGGGGGAAAGGAGGAAAAGGGGGACCCCCCAACTGGGGGGGG
-61
-60
TGAAGGAGAGAAGTAGCAGGACCAGAGGGGAAGGGGCTGCTGCTTGCATCAGCCCACACC 1 ~01~
-1
N~ 2. Nucl~fide sequenceof the pmmo~r region of the LRP ~ne. Boxed sequencesshow f~tpNnts identifi~ ~ DNase ! mapping,s~ 57 marks the position of ~ ofi~nudm~e used ~r identification of DNA fragmentscontmmng the promoter, and ORF shows the start of the presum~ open r e a ~ frameof ~e LRP. An upstreamAT(} in the 5'-untr~slat~ re,on is double undedin~. ~ e start of the PD6 clone used ~ r f~tpnnting is also mark~.
233 vector. This confirmed that the fragment started at the Sacl site at position 10 in the LRP cDNA [5] and extended in the 5' direction. A clone was selected in which the Sacl fragment was in the same orientation as the CAT gene (LRPG2, Fig. 1), and a set of 5' deletions were created using E. coli exonuclease III (PD1 to PD10, Fig. 1). The ends of each of these deletions were then sequenced using the SP6 universal primer for pSPT18 CAT and the sequence of the promoter region and position of each deletion clone were determined. The sequence of part of this fragment together with the start of the cDNA sequence is shown in Fig. 2 (the complete sequence has been submitted to the EMBL nucleotide sequence data library, accession number X15424). Nucleotides are numbered from the start of the open reading frame of the LRP. From this it may be seen that the LRP has an unusually long 5' untranslated region which contains an upstream ATG that is not utilised as the ;nitiating codon. This ATG is in the same reading frame as the ATG used for initiation, but is only followed by a short open reading frame and does not contain a consensus sequence for initiation of translation [23]. Two different cDNA clones were found which started at the position shown in Fig. 2, suggesting that this could be the transcription start of the gene or a frequent stop site for reverse transcriptase on the mRNA. Due to the extremely long length (15 kb) and relatively low abundance of the LRP mRNA, however, we were unable to confirm this as the transcription start by primer extension.
:/ili~ili:,i~i~:ii!,,i:i~il! ~
TABLE l
CA T activity of transfected promoter deletion clones Only PD7. PD8 and PDI0 have activities above a non-transfected control. Clone
Luciferase
CAT
Ratio
PDI PD2 PD3 PD6 PD7 PD8 PDI0
405! 1806 2466 5494 370 4 326 2643
606 613 418 429 1229 1054 955
0.15 0.34 0.17 0.08 3.32 0.24 0.36
76
714
9.4
Control
The complete 1.3 kb Sacl fragment (LRPG2) and several clones having different deletions into the 5' upstream region of the promoter (PD3 to PD10) were selected and used for CAT assays in transient transfections of HepG2 cells. Fig. 3 shows one experiment using calcium phosphate transfection of the cells. In order to exclude the possibility that the differences of CAT expression were due to different efficiencies of transfection, we also performed co-transfections with a second vector containing the luciferase gene under the control of the RSV promoter (Table I). In this case the DNA was introduced by microinjection. Essentially the same result was obtained. Although some promoter activity was visible in LRPG2 (Fig. 3, lane 2) this activity was not present in the deletions PD3 to PD6. Only after resetting beyond base - 8 1 6 (PDT, Fig. 3, lane 7,~ is some promoter activity restored. Direct measurement of
•
im
Fig. 3. Promoter activity of various deletions of the LRP measured by CAT assay. Arrows show position of acetylated chloramphenicoi generated by expression of CAT under the direction of LRP promoter fragments. Lane 2. LRPG2; lanes 3 to 10. PD3 to PDI0. Lane 1 is a control transfection with pSV2CAT in which the CAT expression is controlled by the SV40 early promoter.
234
I:P4
.I,B!
I:P3
CAT activity (Fig. 3) suggests tha~. a peak of CAT activity in found after further deletion to produce PDg, but when transfection efficiency is taken into account (Table I) it appears that PD7 has a higher promoter strength than PDg. The promoter activity of the deletions, however, never reached the level of LRPG2, which itself was only approx. 8~ of th~ activity of the SV40 early promoter (Fig. 3, lane 1). Further deletion to generate PD9 and PD10 thet~ caused a reduction in promoter activity (Fig. 3, lane 9, 10, and Table I). This suggests an arrangement of positive and negative control elements in the promoter as shown diagramatie~dly in Fig. 1. The principal positive elements in the promoter therefore occur between bases -816 and -693. DNase I footprinting was used to determine the location of DNA binding proteins in the LRP promoter (Fig. 4). For this, a 451 bp fragment (from PD6 excised by Hindlll digestion of the pSPT18CAT linker ~nd Sacl site at - 4 5 4 in fig. 2) was labelled by filling in the Hindlll site at the 3'-end with the Klenow fragment of E. coli DNA polymerase. Five DNase-l-protected regions and one hypersensitive site were found in the 350 bp to the 5' side of the cDNA start (Fig. 4). The position of these footprints FP1 to FP5 are shown in Figs. 1 and 2. The position of FP1 coincides with the principa! positive element of the promoter as defined by the CAT assays. PD~ is resc~ted to the first base of this footprint and PD8 cleaves within it. Footprint FP1 contains a consensus sequence for an Spl binding site. We therefore investigated the ability of the major footprint sequences FP1 to FP3 to bind to proteins in a rat liver nuclear extract by using a gel retardation assay (Fig. 5). As an control we also included oligonucleotides encoding the Spl binding site from the Xenopus laeuis U2 snRNA gene and examined the relationship between binding proteins by competition experiments. Proteins from the rat liver nuclear extract in all three footprint sequences tested were capable of binding in a manner competed by unlabelled oligonucleotides (Fig. 5 lane 1-3 in each panel). In panels A and B it can also be seen that FP1 and Spl can compete with each other (lane 4, panels A, B), while FP3 was not able to compete (lane 5, panels A, B). Binding of proteins in the nuclear extract to FP2 and FP3 was not as strong as with the Spl or FP1 oligonucleotides and is not competed by oligonucleotides encoding the Spl bioding site. Although FP3 was particularly weak, it was able to compete with binding of labelled FP2 and also vice versa, suggesting that these two footprints bind to the same protein.
Fig. 4. DNase I footprint analysis of DNA binding proteins in the LRP promoter region. Lane 1, (3 4-A sequencing reaction mix using labelled fragment; lanes 2 and 8, DNase 1 digest without nuclear extract; lanes 3-7, 10, 20, 50, 75 and 100 ttg of nuclear extract.
235 A 1
2
3
'i
B 5 1
4
2
3
4
C 5 1
2 3
4
D 5 1 2
3 4
ii /ii iiiiii i
o '
i~ i i ¸~ ~!
~ ¸¸¸!4 ,
~'i
Fig. 5. Band shift assay of footprint sequences of the LRP promoter region. Panel A: Spl control, panel B: FPI, panel C: FP2, panel D: FP3. In each panel lane 1 shows the end-labelled, double-stranded oligonucleotide, lane 2 the labelled oligonucleotide incubated with nuclear extract and lane 3 binding of labelled oligonucleotide in the presence of unlabelled oligonucleotide. The remaining lanes show competition experiments as follows. (A) Lane 4, FP1 oligonucleotide; lane 5, FP'-~oligonucleotide. (B) Lane 4, Spl oligonucleotide; lane 5, FP3 oligouucleotide. (C) Lane 4, Spl oligonucleotide; lane 5, FP3 oligonucleotide. (D) Lane 4, Spl oligonucleotide; lane 5, FP2 oligonucleotide. Panel (A) was e~tposed for 18 h and panels (B)-(D) for 7 days.
Analysis of the promoter regions for the L D L receptor gene, the HMG-CoA reductase and the HMG-CoA synthase genes has shown that a common regulatory element is present which confers regulation by sterol concentrations in the cell [2-4]. The mechanism by which regulation is achieved, however, appears to be different in the three genes [4]. In particular, the LDL
TABLE 11
Effects of sterols on LRP expression
The LRP and LDL receptor were immunoprecipitatedfrom the same iysates of normal or cholesterol loaded cells. After separation on SDS-polyacrylamidegels, bands of the appropriate molecular weight were quantitated by scanning of the autoradiogram and gravimetric analysis of the peak areas. Valuesare expressed as a percentageof the peak area in unloaded cells. LRP Cholesterol P388 3T3
100 100
LDL receptor + 132 187
100 100
+ 69 34
receptor contains an SRE in combination with a reverse orientation Spl site. Since the LRP also contains a reverse orientation Spl site (footprint FPl) which gives the major transcriptionai activity of the promoter, we looked for SRE-like sequences in the LRP promoter, but none could be found in the footprints or flanking DNA sequence. In order to check experimentally if sterols could down-regulate the LRP promoter, we supplemented the medium used for growing P388 or 3T3 cells with a mixture of cholesterol and 25-hydroxycholesterol as prev'ously described [2]. The cells were then metabolically labelled and both the LDL receptor and LRP were immunoprecipitated. While a down-regulation was evident in the L D L receptor in both cell types, the LRP actually increased in concentration in the presence of added sterols (Table It). Mouse fibroblast and macrophage cell lines were chosen because down-regulation of the L D L receptor provided a control for effective cholesterol loading. When similar experiments were performed on whole animals, no downregulation of hepatic LRP was observed (data not shown).
236 Discussion
We have isolated a genomic DNA fragment which encodes the promoter of the LRP and analysed its structure and regulation. DNase 1 footprinting suggests the presence of several DNA binding protein binding sites in the 350 bp upstream of the cDNA start position. The most important of these in terms of promoter activity is an Spl binding site in reverse orientation (FPl). Weaker transcriptional activity remained after the Spl site had been deleted, suggesting the presence of other components in the promoter. CAT expression decreases after part of FP3 is lost in the PD9 deletion. Thus at least FP1 and FP3 must contribute to the transcriptional activity of the promoter. The oligonucleotides corresponding to the binding sites of FP2 and FP3 were also capable of weakly binding to the same nuclear protein which was shown to be different from Spl by competition experiments in a gel retardation assay. Both footprints contained the sequence 5' ACCCTC 3' which might account for their common binding activity. Little further promoter activity was associated with the footprints FP4 and FP5, so these were not analysed by gel-retardation experiments. To the 5' side of the Spl binding site is a negative control element, since inclusion of this region in the CAT constructs (PD3 to PD6) abolished the activity of the promoter fragment in CAT assays. It must be situated in the 92 bp between the 5' end of the PD6 and PD7 deletions. This negative element is presumably a conditional negative element, since in the complete LRPG2 clone the highest promoter activity was observed. A further positive element must therefore be situated inbetween the Sacl site of LRPG2 and the 5' end of PD3. Surprisingly, no TATA box or CAAT box was evident in the sequence flanking the 5' side of the cDNA start, although the footprint FP5 was located in the expected position ( - 3 0 ) for a TATA box. It is not uncommon for housekeeping genes to have poorly discernible TATA box sequences. Perhaps as a result of the lack of a TATA box the activity of the LRP promoter was very low, representing only about 8~; of the activity of the SV40 early promoter. This makes it difficult to dissect the promoter elements by measuring the CAT activity of promoter deletions, since only small increases above background activity are observed. Tht: only sequence similarity with the LDL receptor was one reverse orientation Spl binding site. Thus, despite the similarity of protein sequence between the LRP and LDL receptor it is apparent that the two genes have different transcription units and are most likely expressed under different conditions. In particular, no sterol regulatory elements could be found in the promo-
ter sequence and no evidence for down-regulation of the promoter in the presence of sterols was observed in mouse fibroblast or macrophage-like cell lines. The absence of sterol regulation in the LRP promoter supports a role of the protein as a chylomicron remnant receptor, since uptake of chylomicron remnants in macrophage derived cell fines has been shown to be independent of cholesterol feeding [11]. Acknowledgements We thank A. Frishauf for giving us the human geo nomic DNA cosmid library H2, R. Pepperkok for help with the microinjection experiments and P. Monaci and A. Nicosia for help with the footprint and gel-retardation experiments, pSPT18CAT was kindly provided by P. Charvier. References 1 Brown, M.S. and Goldstein, J.L. (1986) Science 232, 34-47. 2 Sfidhof, T.C., Van der Westhuyzen, D.R., Goldstein, J.L., Brown, M.S. and Russell, D.W. (1987) J. Biol. Chem. 262, 10773-10779. 3 Osborne, T.F., Gol, G., Browns, M.S., Kowal, R.C. and Go|dstein, J.L. (1987) Proc. Natl. Acad. Sci. USA 84, 3614-3618. 4 Smith, J.R., Osborne, T.F., Brown, M.S., Goldstein, J.L. and Gil, G. (1988) J. Biol. Chem. 263, 18480-18487. 5 Herz, J., Hamann, U., Rogne, S., Myklebost, O., Gausepohl, H. and Stanley, K.K. (1988) EMBO J. 7, 4119-4127. 6 Yamamoto, T., Davis, C.G., Brown, M.S., Schneider, W.J., Casey, M.L., Goldstein, J.L. and Russell, D.W. (1984) Cell 39, 27-38. 7 Lalazar, A., Weisgraber, K.H., Rail, S.C., Giladi, H., lnnerarity, T.L., Levanon, A.Z., Boyles, J.K., Amit, B., Gorecki, M., Mahley, R.W. and Vogel, T. (1988) J. Biol. Chem. 263, 3542-3545. 8 ikisiegel, U., Weber, W., lhrke, G., Herz, .I. and Stanley, K.K. (1989) Nature 341,162-164. 9 Kowal, R.C., Herz, J., Goldstein, J.L., Esser, V. and Brown, M.S. (1989) Proc. Natl. Acted. Sci. USA 86, 5810-5814. 10 Cooper, A.D., Erickson, S.K., Nutik, R. and Shrewsbury, M.A. (1982) J. Lipid Res. 23, 42-52. 11 Elisworth, J.L., Cooper, A.D. and Kraemer, F.B. (1986) J. Lipid Res. 27, 1062-1072. 12 Poustka, A., Rackwitz, H.R., Frishauf, A.M., Hohn, B. and Lehrach, H. (1984) Proc. Natl. Acad. Sci. USA 81, 4129-4133. 13 Henikoff, S.C. (1984) Gene 28, 357-359. 14 Chen, E.Y. and Seeburg, P.H. (1985) DNA 4, 165-170. 15 Laemmli, U.K. (1970) Nature 227, 680-685. 16 Graham, F.L. and Van der Eb, A.J. (1977) Virology 52, 456. 17 Chu, G. and Sharp, P.A. (1981) Gene 13, 197-217. 18 Pepperkok, R., Schneider, C., Philipson, L. and Ansorge, W. (1988) Exp. Cell Res. 178, 369-376. 19 Gorman, C.M., Moffat, J.F. and Howard, B.H. (1~2) Mol. Cell Biol. 2, 1044-1051 20 Do Wet, .r.R., Wood K.V., DeLuca, M., Hellinski, D.R. and Subramanai, S. (1987) Mol. Cell Biol. 7, 725-737. 21 Gorski, K., Carneiro, M. and Schibler, U. (1986) Cell 47, 767-776. 22 Lichtsteiner, S., Wuarin, J. and Schibler, U. (1987) Cell 5, 963-973. 23 Kozak, M. (1989) J. Cell Biol. 108, 229-241. 24 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467.