Structure of two cecropin B-encoding genes and bacteria-inducible DNA-binding proteins which bind to the 5′-upstream regulatory region in the silkworm, Bombyx mori

Gene, 163 (1995) 215-219 ©1995 Elsevier Science B.V. All rights reserved. 0378-1119/95/$09.50

215

GENE 09126

Structure of two cecropin B-encoding genes and bacteria-inducible DNAbinding proteins which bind to the 5'-upstream regulatory region in the silkworm, Bombyx mori (Antibacterial protein; Bml; IL-6 response element; LPS response element)

Kiyoko Taniai a, Keiko Kadono-Okuda a, Yusuke Kato a, Masanori Yamamoto a, Michio Shimabukuro a, Subrata Chowdhury a, Jinhua Xu a, Eiji Kotani a'*, Shiro Tomino b and Minoru Yamakawa a aNational Institute of Sericultural and Entomological Science, Tsukuba, lbaraki 305, Japan; and bTokyo Metropolitan University, Hachioji, Tokyo 192-03, Japan. Tel (81-426) 77-Ili1 Received by T. Sekiya: 7 Deceml:ier 1994; Revised/Accepted: 29 March/10 April 1995; Received at publishers 26 May 1995

SUMMARY

Two genomic DNAs encoding cecropin B (CecB), an antibacterial protein from Bombyx mori, were cloned and sequenced. The number c,f CecB genes was estimated to be more than four copies per haploid by genomic Southern blotting. Two genes, CecB1 and CecB2, were located tandemly within 12 kb in the same orientation. These two genes encoded identical amino ~Lcids,though 15 nucleotides (nt) were different in the coding region and the intron size varied. About 90% of the nt spanning 800 bp in the 5'-untranslated region (UTR) were identical between the two genes. This 5'-flanking region contained characteristic sequences such as a repetitive element of B. mori (Bml), an interleukin-6 response element (IL-6 RE), and two putative lipopolysaccharide (LPS) response elements (LPS RE). An electrophoretic mobility shift assay (EMSA) showed that the fat body contains at least three different nuclear proteins inducible by bacteria which bind to the 5'-UTR, suggesting that these proteins may be involved in CecB expression triggered by bacteria.

INTRODUCTION

Insects produce several kinds of antibacterial peptides in response to bacterial invasion (reviewed by Kimbrell, Correspondence to: Dr. M. Yamakawa, Laboratory of Biological Defense, National Institute of S,~rieultural and Entomological Science, 1-2 Owashi, Tsukuba, Ibaraki 305, Japan. Tel (81-298) 38-6154; Fax (81-298) 38-6028. *Present address: Kyoto Institute of Technology, Sakyo-ku, Kyoto 606, Japan. Tel. (81-075) 724-7776. Abbreviations: aa, amino acid(s); Bin, Bombyx mori; Bml, Bm repetitive element 1; bp, base pair(s); Cec, cecropin(s); CecB, gene (DNA) encoding CecB; EMSA, electrophoresis mobility shift assay; F1-5, DNA fragment 1 5; IL-6, interleukin 6; kb, kilobase(s) or 1000 bp; LPS, lipopolysaccharide; NF-KB, nuclear transcriptional factor riB; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; RE, response element(s); SDS, sodium dodecyl sulfate; SSC, 0.15 M NaCI/0.017 M Na3"citrate pH 7.0; UTR, untranslated region(s). SSD! 0378-1119(95)00408-4

1991). In general, the proteins are induced rapidly after injection of bacteria or their cell-wall components such as LPS and peptidoglycan. The regulation mechanisms of the protein genes have been investigated using three insect species, Hyalophora cecropia (Engstrrm et al., 1993), Drosophila melanogaster (Dimarcq et al., 1994) and Sarcophaga peregrina (Kobayashi et al., 1993). In mammals, NF-~B, one of the rel family transcription factors, play an important role in the regulation of immunerelated genes (Thanos and Maniatis, 1995). In the insect self-defense protein genes, the NF-KB binding site-like sequence was commonly found on the 5'-UTR and the nuclear proteins which bind to the sequence were isolated from these insects (reviewed by Hultmark, 1993). We are interested in Bombyx mori (Bin) self-defense systems and have previously reported the nucleotide sequence of CecB cDNA (Taniai et al., 1992). Cecropin is the first discov-

216

1

Larvae:

E

B

2 H

E

B

2 H

gene and suggest that several proteins m a y be involved in the gene regulation.

S EXPERIMENTAL AND DISCUSSION

9.42

--

6.56

--

4.38

(a) Genomic Southern blot analysis for CecB genes To determine the CecB gene n u m b e r per haploid, we performed genomic Southern blotting using a CecB c D N A as a probe. The genomic D N A separately isolated from two different larvae was digested with BamHI, EcoRI and HindIII. The results of the Southern blotting indicated that BamHI, EcoRI and HindIII gave three, four and four positive bands, respectively (Fig. 1). There was no difference between the two larvae. In the case of SalI digestion of D N A sample from one larva, seven positive bands were detected with the probe (Fig. 1). Since there are no SalI sites in the four CecB c D N A s and other insect Cec genes reported so far have only one intron, four genes per haploid were estimated as the m i n i m u m n u m b e r in the case that all CecB genes would have SalI site(s) in the intron region. The results suggest that Bm CecB gene forms a multiple gene family which m a y contribute to the effective protection against bacterial invasion.

I

Fig. 1. Genomic Southern blotting for CecB genes. Chromosomal DNA was extracted separately from silkglands of 5th instar Bm larvae (Tokai x Asahi strain). Of each DNA sample, 10 ~tg was digested with EcoRI (E), HindIII (H), BamHI (B) and SalI (S). The DNA fragments were separated by electrophoresis in 0.3% agarose H gel (Nippon Gene) and transferred onto the Gene Screen Plus membrane. The membrane was hybridized with a CecB cDNA labeled with [ct-32p]dCTP using a DNA Labeling Kit (Nippon Gene). The procedure for hybridization was as described previously (Kato et al., 1993). Molecular sizes (in kb) are indicated on the left margin.

ered antibacterial peptide in insects ( H u l t m a r k et al., 1980) and since then it has been reported from a variety of insect species and also from pig intestine (Lee et al., 1989). In this study, we analyzed Bm CecB genomic D N A to elucidate the regulation mechanism of the gene. The results of E M S A showed that there are at least three different nuclear factors which bind to the 5'-UTR of the

14B

E

(h) Cloning of genomic CecB D N A We have screened 3.6 × 105 plaques of Bm genomic library (Fujii et al., 1989) using a Bm CecB c D N A (Taniai et al., 1992) as a probe and obtained 275 positive clones. The total n u m b e r of the screened plaques corresponded

14Z

14C

E2

CecBl

E

CecB2

Fig. 2. Restriction map and the organization of two genes in clone No. 14. The DNA isolated from clone No. 14 (about 12-kb fragment inserted into ;tEMBL3 vector) was partially digested with SalI, EcoRI, HindIII, KpnI, SacI and XhoI and each fragment was annealed with the end-labeled oligo at the cos site of the )~ vector right arm using a kit, LAMBDA PLAN (Nippon Gene). The fragments were electrophoresed as in Fig. 1 and exposed to X-ray film for the determination of the cleavage sites. The same enzymes were used for the digestion analysis of the subcloned 14B, 14C and 14Z fragments. The sequencing strategy is indicated under the map with short arrows. The position of the two genes was determined based on the results of the restriction mapping and nt sequencing.

217 to six times the Bm genomic size. We selected several positive clones at random and digested with SalI. As a result, ten different digestion patterns were obtained (data not shown). Southern blot hybridization was carried out using Bm CecB cDNA as a probe. Clone No. 14 was selected for the determination of the nt sequence, since the clone contained three relatively short positive Sal1 fragments. (c) Sequence of the two CecB genes

Three fragments of the clone No. 14 which hybridized with a CecB cDNA probe were termed as 14B (1.8 kb), 14C (2.3 kb) and 142 (4.7 kb), respectively, and subcloned into pBluescript vectors. As a result of nt sequencing, one CecB gene was found in 14B fragment that lacked 3’-UTR (Fig. 3A) and the other exon 1 and 2 were dispersed in 14C and 142 fragment (Fig. 3B). The two genes which were designated as CecBl and CecB2 were located in the same orientation and the distance between these two genes was about 3.5 kb. The deduced aa sequence of two genes were identical. However, 15 nt were different in the coding region of the genes. The intron size was, 868 bp and 2,318 bp in CecBl and CecB2, respectively. Although a typical polyadenylation signal was not found in the 3’4JTR of CecB2 , two resemble sequences (ATTAAA) were observed. About 90% of the nt sequence in S-UTR (800 bp) ranging from the start codon to the end of Sal1 site were identical between the two genes. In this region, a 82.5% identical sequence with Bml (Adams et al., 1986), a complete mammalian IL-6 RE (Hocke et al., 1992) and two LPS REs were present in each gene. Southern blot hybridization of the ten different CecB genomic clones using Bml probe showed that all CecB exonl fragments contain Bml (data not shown). Concerning the induction of CecB genes by LPS (Kato

Fig. 3. Nucleotide

sequences

of two CecB genes, CecBl (A) and CecB2

(B), and deduced aa sequences. CecBZ extended over two Sal1 fragments, 14C and 142, and the Sal1 site in the flanking region of these two fragments is shown with boxed nt. The typical TATA box is shown with underlines

in the S-UTR

of each gene. The start points

of two

cDNAs are indicated as ‘cDNA’ above the nt with an arrow. The stop codons are shown as ‘stop’ under the nt. Two putative polyadenylation signals

(ATTAAA)

are

indicated

with

bold

underlines.

Note

that

typical polyadenylation signal was not found in 3’-UTR of CecB genes. Bml is shown with dotted line, LPS RE and IL-6 RE are shown with a double underline and a bold underline, respectively. The GeneBank/EMBL accession Nos. for CecBI and CecB2 are D2.5320 and D25321, respectively. Methods: Three Sal1 fragments (designated as 14B, 14C and 142) from clone No. 14 were subcloned separately with pBluescript II (SK+) vector. The plasmids were digested with two restriction enzymes and produced several deletion mutants using a Kilo Sequencing Deletion Kit (Takara). The nt sequence of each plasmids were determined with a dye primer cycle sequencing method using a DNA sequencer

(ABI 373A).

218

A

I

IL 6 PIE CTC~-aA

~ I

LPS RE GGGG~TTAAC LPSR[ GGGAAGTACCICecB' , GCGGTACTTCICecB2

C

'(3"])--(33) F5

.... F4""'.....£S.8).

(46)

F3

(40)

.........

F2

B

F1 120

FI

F2 +

F3 +

F4 +

$9

F2

immunized

TATAAA

-320

extracts

competitor

....... extracts

FI

F2

[-control

Fls

÷ +

+

Fls +

+

F4

F1

+

+

+

F5 +

+

F-~~F

1 2 3 4 5

F~ 1

2

3

4

5

6

7

8

9

1

0

1 2 3

Fig. 4. Analysis of nuclear binding protein to 5'-UTR of CecB. Panel A shows the autoradiography of the EMSA with labeled probes containing various sequences encoding different sites of 5'-UTR and the nuclear extracts from immunized larval fat bodies (+) or no nuclear extracts (-). F1 to F5 indicate the probe numbers and derived sites from the 5'-UTR. The positions and sequences of IL 6-RE and LPS RE are shown in panel A. The sequences of F1 to F5 were as follows (only the sequences of a complementary strand are shown and IL-6 RE and LPS RE are indicated with bold letters): FI: 5'-TCAGAGCGGGCGAGGGAAGTACCCCTCTCGTGTTTGTGTT (40 met); F2: 5'-AATCCTCATTAACTGGGAGAGCATTAATTGAGGGGATTAACTTTTA (46 mer); F3: 5'-CCTCTCAAACGTGAGGAACAGATTTTCCTGTTGACCTTTGTTAAAAATGTGCAATCCT (58 mer); F4: 5'-CCGTTGTGGTTATCTAAGCCGCGATTGCCTCTC (33 met); F5: 5'-GAATGACTTTATTAACAAGTTCGAACCGTTG (31 mer). Panel B shows EMSA with F1, F2 and Fls, and nuclear extracts from immunized larval fat bodies. Fls was the 8 bp shorter probe of F1 and its sequence was as followS: Fls: 5'-AGAGCGGGCGAGGGAAGTACCCCTCTCTCGTG(32 mer). 32p-labeled F2 or F4 (panel C) was incubated with or without the nuclear extracts from immunized or non-immunized control larval fat bodies in the presence or absence of a competitor such as F2 and Fls or F4 and F1. Eighty-fold excess amount of the above described competitors were used. 'F' indicates the position of the free a2P-labeled probe. Methods: The nuclear proteins were extracted according to the method of Kobayashi et al. (1993). Briefly, the proteins were extracted in the presence of various protease inhibitors such as leupeptin (5 Ilg/ml), pepstatin A (4 gg/ml) and aprotinine (0.5 gg/ml) from fat bodies of the non-immunized 5tb instar larvae and of the larvae immunized with autoclaved Escherichia coli (107 cells) and kept at 26°C for 12 h. The double stranded oligos (F1 to F5 and Fls) were labeled with [¢t-aZP]dCTP using Klenow fragment and about 10 4 cpm of the DNA was mixed with or without 25 gg of nuclear extracts. The binding reaction was carried out at 0°C for 30 min in 20 gl of the buffer containing 10 mM Tris-HC1 pH 7.5/50mM NaC1/10% glycerol/0.05% NP-40/10mM EDTA/1.75mM dithiothreitol/1 gg poly (dI-dC) poly (dI-dC)/1 mM (p-amidinophenyl)methane-sulfonyl fluoride hydrochloride. The 5% native polyacrylamide gel was prepared with low ion-strength buffer (7 mM Tris.HC1 pH 7.5/3 mM Na.acetate/1 mM EDTA) and pre-run was carried out at 70 V for 30 rain at 4°C in low ion-strength buffer. After the gel electrophoresis of the sample at 140 V for 150 min at 4°C, the gel was exposed to X-ray film at -80°C.

et al., 1994), L P S RE m a y be indispensable for the gene

factors, we tried to detect binding proteins to the 5'-UTR.

expression.

F o r this, [ ~ - 3 2 p ] d C T P labeled oligo probes (40, 46, 58, 33 and 31 mer) c o r r e s p o n d i n g to different sites in the

(d) Organization of CecB genes in clone No. 14

5'-UTR (Fig. 4A, F 1 - F 5 , respectively) were p r e p a r e d a nd

T h e restriction sites of EcoRI, KpnI, HindIII, SacI, SalI

each p r o b e was m i x ed with the nuclear p r o t ei n extracts

and XhoI an d the localization of tw o CecB genes in clone

f r o m i m m u n i z e d larval fat bodies. After electrophoresis

N o. 14 are s h o w n in Fig. 2. T h e results revealed that two

of the mixture, the gel was a u t o r a d i o g r a p h e d . Th e distinct

CecB genes are present near each o th e r in the same

D N A - p r o t e i n complexes were observed in the reaction

orientation.

mixtures c o n t a i n i n g the n u cl ear extracts and F1, F 2 or

(e) D N A binding proteins which bind to 5'-UTR of CecB gene

is 8 bp shorter t h a n F1 an d contains a L P S RE also

F 4 p r o b e (Fig. 4A, lane 2, 4 an d 8). T h e p r o b e F l s which f o r m e d a D N A - p r o t e i n c o m p l e x m i g r a t i n g to the same

O u r results showed that CecB genes c o n t a i n two L P S

p o s i t i o n (Fig. 4B, lane 3). Based on these results, we

RE s and an IL-6 R E (Fig. 3). These elements were present within 320 bp of the 5'-UTR (Fig. 4). To ex am i n e the i n t eract i o n between the 5'-UTR a n d trans-regulating

assu m ed that a n u cl ear p r o t ei n m a y bind to the site containing c o m m o n sequence such as L P S RE. To c onf i r m this p r e s u m p t i o n , a c o m p e t i t i o n assay was p e r f o r m e d

219 (Fig. 4C). Note that a DNA-protein complex (first 32p_ labeled band from the top of the gel in Fig. 4C, lane 3) did not appear constantly (compare with the result shown in Fig. 4B, lane 2). When excess amount of cold F2 probe was added to the reaction mixture, a slow migrating F2-protein complex (second 32p-labeled band from the top of the gel in Fig. 4C, l~me 3) disappeared and the fast migrating complex was considerably competed (Fig. 4C, lane 5). The results suggest that the two nuclear proteins specifically bind to F2 probe, supporting the above presumption. Interestingly, the slow migrating DNAprotein complex was not affected by Fls, although the fast migrating complex was completely competed (Fig. 4C, lane 5). This result suggests that a nuclear protein may bind to the site containing other than common sequence among F1, Fls and F2. This presumption was also supported by the fact that the slow migrating F2-protein complex (Fig. 4B, lane 2) was not seen when F1 or Fls probe was used (Fig. 4B, lane 1 and 3). The reason why cold F2 did not completely compete with 32p-labeled counterpart probe in the case of fast migrating complex was not clear. Since the two bands in the control sample (non-immtmized larval extracts) were very faint (Fig. 4C, lane 2), both proteins might be translocated from cytoplasm to nuclei by bacterial infection as was observed in the case of 59-kDa protein from S. peregrina (Kobayashi et al., 1993). The similar competition assay was performed witl~ F4 probe. F4 probe also gave two DNA-protein complexes (Fig. 4C, lane 8). The excess amount of cold F1 probe partially competed the formation of the first migrating DNA-protein complex but did not affect the formation of the slow migrating complex (Fig. 4C, lane 10). Because LPS-RE is not identified in F4, the reason why the fast migrating complex was competed with F1 is unclear. The fast or slow migrating complex disappeared when the excess amount of the cold F4 probe was added (Fig. 4C, lane 9). The results suggest that at least a nuclear protein specifically binds to F4 probe which might contain an important regulatory region except for LPS RE and IL-6 RE. We detected by EMSA three bacteria-inducible nuclear proteins which bind to the 5'-UTR of CecB1. We speculate that these proteins may have important roles in the expression of CecB genes. To understand the regulation of CecB gene expression, we presently try to determine the precise sequence for the nuclear protein binding and to purify the DNA bindi:ag proteins.

ACKNOWLEDGEMENTS

This work was suppo:rted in part by a Grant-in-Aid (Bio Media Program) of the Ministry of Agriculture,

Forestry and Fisheries, Japan (BMP 95-V-1-5-6) and by a special coordination fund for promoting science and technology (SCF) in the basic research core system by the Science and Technology Agency (STA), Japan.

REFERENCES Adams, D.S., Eickbush, T.H., Herrera, R.J. and Lizardi, P.M.: A highly reiterated family of transcribed oligo(A)-terminated, interspread DNA elements in the genome of Bombyx mori. J. Mol. Biol. 187 (1986) 465-478. Dimarcq, J.-L., Hoffmann, D., Meister, M., Bulet, P., Lanot, R., Reichhart, J.-M. and Hoffmann, J.A.: Characterization and transcriptional profiles of a Drosophila gene encoding an insect defensin. Eur. J. Biochem. 221 (1994)201-209. Engstr6m, Y., Kadalayil. L., Sun, S.-C., Samakovlis, S., Hultmark, D. and Faye, I.: •B-like motifs regulate the induction of immune genes in Drosophila. J. Mol. Biol. 232 (1993) 327-333. Fujii, T., Sakurai, H., Izumi, S., and Tomino, S.: Structure of the gene for the arylphorin-type storage protein SP2 of Bombyx mori. J. Biol. Chem. 264 (1989) 11020-11025. Hocke, G.M., Barry, D. and Fey, G.H.: Synergistic action of interleukin-6 and glucocorticoids is mediated by the interleukin-6 response element of the rat ~2 macroglobulin gene. Mol. Cell. Biol. 12(5) (1992) 2282-2294. Hultmark, D.: Immune reactions in Drosophila and other insects: a model for innate immunity. Trends Genet. 9 (1993) 178-183. Hultmark, D., Steiner, H., Rasmuson, T. and Boman, H.G.: Insect immunity. Purification and properties of three inducible bactericidal proteins from hemolymph of immunized pupae of Hyalophora cecropia. Eur. J. Biochem. 106 (1980) 7-16. Kato, Y., Taniai, K., Hirochika, H. and Yamakawa, M.: Expression and characterization of cDNAs for cecropin B, an antibacterial protein of the silkworm, Bombyx mori. Insect Biochem. MoL Biol. 23 (1993) 285-290. Kato, Y., Motoi, Y., Taniai, K., Kadono-Okuda, K., Hiramatsu, M. and Yamakawa, M.: Clearance of lipopolysacchride in hemolymph of the silkworm Bombyx mori: its role in the termination of cecropin mRNA induction. Insect Biochem. Mol. Biol. 24 (1994) 539-545. Kimbrell, D.A.: Insect antibacterial proteins: not just for insects and against bacteria. Bioessays 13 (12) (1991) 657-663. Kobayashi, A., Matsui, M., Kubo, T. and Natori, S.: Purification and characterization of a 59-kilodalton protein that specifically binds to NF-•B-binding motifs of the defense protein genes of Sarcophaga peregrina (the flesh fly). Mol. Cell. Biol. 13 (7) (1993) 4049-4056. Lee, J.-Y., Boman, A., Sun, S.-C., Andersson, M., Jornvall, H., Mutt, V. and Boman, H.G.: Antibacterial peptides from pig intestine: isolation of a mammalian cecropin. Proc. Natl. Acad. Sci. USA, 86 (1989) 9159-9162. Taniai, K., Kato, K., Hiroehika, H. and Yamakawa, M.: Isolation and nucleotide sequense of cecropin B cDNA clones from the silkworm, Bombyx mori. Biochim. Biophys. Acta 1132 (1992) 203-206. Thanos, D. and Maniatis, T.: NF-•B: a lesson in family values. Cell 80 (1995) 529-532.