- Email: [email protected]
Structures of primer-template hybrids in arbitrarily primed polymerase chain reaction
Genetic Analysis: Biomolecular Engineering 15 (1999) 5 – 8
Structures of primer-template hybrids in arbitrarily primed polymerase chain reaction Keita Kawakami a,b,c, Jun Yasuda a, Takamasa Kayama b, Katsuhiko Doi c, Takao Sekiyaa a,* a
Oncogene Di6ision, National Cancer Center Research Institute, 5 -1 -1 Tsukiji, Chuo-ku, Tokyo, 104 -0045, Japan b Department of Surgical Neurology, Yamagata Uni6ersity, 2 -2 -2 Iida-nishi, Yamagata-shi, 990 -2331, Japan c Department of Physiology, Yamagata Uni6ersity, 2 -2 -2 Iida-nishi, Yamagata-shi, 990 -2331, Japan Received 8 December 1997; received in revised form 8 June 1998; accepted 28 June 1998
Abstract Nucleotide sequence analysis of arbitrarily primed PCR products from two known regions of human genome revealed that at least six contiguous bases at the 3%-end of a primer of 20 bases were perfectly matched in the primer-template hybrids. © 1999 Elsevier Science B.V. All rights reserved. Keywords: AP-PCR; DNA fingerprinting; Primer-template hybrid
1. Introduction Arbitrarily primed polymerase chain reaction (APPCR) is a technique used to amplify multiple and usually anonymous DNA sequences from complex genomes using a single primer [1,2]. At lower stringency, allowing for mismatches, the primer anneals to genomic DNA at many positions. One significant characteristic of the AP-PCR technique is amplification of DNA fragments from these arbitrarily primed sites on the genome. Although detailed features of primer annealing in AP-PCR remain to be clarified, the patterns of DNA fingerprinting are significantly reproducible from both qualitative and quantitative aspects. This reproducibility could be due to rather specific annealing of primers to template DNAs. For efficient amplification by PCR, arbitrary primers were suggested to be perfectly matched to the templates with six to eight bases at their 3%-end [3 – 5]. Thus, elucidation of features of primer-template hybrids in AP-PCR would provide some important information for the use of AP-PCR * Corresponding author. Tel.: + 81 3 35422511, ext. 4800; fax: +81 3 55659535; e-mail: [email protected]
fingerprinting in molecular genetic studies. In the APPCR products from human genomic DNA using an arbitrary primer MCG1 (5% AACCCTCACCCTAACCCCAA 3%) [6] we found two DNA fragments Q0 and M with known nucleotide sequences, giving actual examples of structures of four primer-template hybrids.
2. Materials and methods Essential procedures for AP-PCR were previously described [6,7]. AP-PCR was performed in 15 ml of a mixture containing 20 ng of genomic DNA of normal human lymphocytes and 1 mM of the MCG1 primer using a Thermocycler 9600 (Perkin-Elmer/Cetus). The reaction started with a denaturing step (at 94°C for 5 min), proceeding for the first five cycles under conditions of low stringency (94°C for 30 s, 50°C for 1 min and 72°C for 1.5 min), then for the following 25 cycles under conditions of high stringency (94°C for 15 s, 60°C for 15 s, and 72°C for 1 min), and finally to an extension step (72°C for 5 min). PCR products were subjected to electrophoresis in a 5.5% denaturing polyacrylamide gel with 7 M urea and dried gels were
1050-3862/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII S1050-3862(98)00013-8
6
K. Kawakami et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 5–8
exposed to XAR-5 films or BioMax films (Kodak). Cloning of DNA fragments in gel bands was performed as described using the TA cloning vector (Invitrogen) [7]. Nucleotide sequences of the AP-PCR products from several independent clones were determined and the homology search was carried out using the BLAST program on the World Wide Web (http:// www.ncbi.nlm.nih.gov/) [8].
3. Results AP-PCR fingerprint with the MCG1 primer consisted of more than 20 major bands (Fig. 1). The BLAST homology search revealed that DNA fragments in three of the nine clones from band Q carried essentially the same nucleotide sequence as that of part of a known gene, NSCL-1 /HEN1 [9,10], located on chromosome 1q21. The fragment named Q0 of 405 bp in all three clones showed a 4-bp deletion in the ATTT repetitive sequences of the NSCL-1 gene reported in the database (Genbank Accession number: M96739). By analysis of DNA from human individuals by PCR using a specific
Fig. 1. AP-PCR fingerprinting using the MCG1 primer and its variants, M-8C and M-8C11T. The sizes of the DNA are indicated at the left side of the panel. The name of bands in the MCG1 fingerprint are indicated at the right side of each panel. Products from two independent PCR were analyzed side by side.
primer set for this repetitive sequence, the deletion of one repeating unit in fragment Q0 turned out to be polymorphic (data not shown). In addition, one-base (T) insertion was found in fragment Q0 at position 2045 of the reported NSCL-1 sequence. The nucleotide sequence of the fragment named Q1 (404 bp) in the remaining six clones was not homologous to any others in the BLAST search. The DNA fragment of 525 bp corresponding to band M in MCG1 fingerprinting (Fig. 1) was also found to carry a nucleotide sequence almost identical to that of the DNA fragment cE98F6 located on chromosome 22q13 (EMBL database, Accession No. Z82183). On the basis of nucleotide sequences of the two regions of the genomic DNA, the template DNAs and the MCG1 primer in the hybrids giving fragments G0 and M are aligned (shown in Fig. 2A and D, respectively) to obtain a maximum number of base pairs at the 3%-end of the primer. In the remaining 5%-part of the hybrids, possible looping-out structures with the maximum number of base pairs are also proposed. At all four annealing sites, six to 11 bases at the 3%-end of the primer were perfectly matched to the template sequences (Fig. 2A and D). The features were consistent with those observed in previous studies [5,11]. Of the 20 bases of the MCG1 primer, 17 and 16 could correctly pair with the upper and the lower NSCL-1 sequences, respectively, in the proposed looping-out structure (Fig. 2A). Similarly in the MCG1 primer-template hybrid producing fragment M, 16 and 12 of 20 bases of the primer could pair with the upper and the lower cE98F6 sequences, respectively (Fig. 2D). These possible structures looping-out either in primer or in template were often expected in PCR-mediated technology although there was no direct evidence for the presence of these structure in the hybrid during AP-PCR. To get some information on the structure of primer-template hybrids, the nucleotide sequence of the primer MCG1 was slightly modified on the basis of the nucleotide sequence of the NSCL-1 gene. The modified primer M-8C contained a C residue instead of T at the eighth position from the 3%-end. The modification did not change the contiguous base pairs at the 3%-end of the original primer in the hybrids producing fragment Q0 (Fig. 2B). With M-8C the hybrid at the upper site gained an additional base pair while that at the lower strand had the same base pairs. The primer M-8C was further modified to M-8C11T by changing the C residue at the 11th base to T. Possible structures of the primer-template hybrids are shown in Fig. 2C. AP-PCR products with variant primers gave fingerprinting patterns distinct from that obtained with the original MCG1 primer (Fig. 1). The signal of the band corresponding to Q in the MCG1 fingerprint was very weak in the M-8C fingerprint (Fig. 1, left), while that in the fingerprint obtained with M-8C11T was clearly ob-
K. Kawakami et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 5–8
7
Fig. 2. Possible structures of hybrids between arbitrary primers and template sequences. Hybrids with MCG1 (A and D), M-8C (B), and M-8C11T (C) arbitrary primers are indicated. The looped-out bases are indicated by lowercase and the sites in the opposite strands are indicated by dashed lines. The changed nucleotides in modified primers and newly formed base pairs are indicated in bold letters.
served although its intensity was less than that of band Q in the MCG1 fingerprint (Fig. 1, right). Amplification of the Q0 fragment by AP-PCR was confirmed by Southern hybridization with the corresponding probe after transfer of DNA fragments in fingerprints from dried gels to a nylon membrane (data not shown). The results revealed that the modified primers produced essentially the same amount of the Q0 fragment as that obtained with MCG1. The production of fragment Q1 was greatly reduced with the modified primers, suggesting that the decreased Q band signal in the fingerprints could be due to reduced synthesis of the major fragment Q1. Similarly the Southern hybridization revealed no production of fragment M from the cE98F6 sequence with the modified primers. The results of the primers modified on the basis of the template nucleotide sequence of the NSCL-1 gene indicated that slight
changes of structures of the primer-template hybrids in the regions outside of the contiguous base pairs at the 3% ends of the primers did not influence the production of fragment Q0.
4. Conclusion We report four examples of possible structures of primer-template hybrids in AP-PCR deduced from known nucleotide sequences on human genomic DNA. Our results suggested that the presence of two arbitrarily priming hybrids containing at least six contiguous base pairs at the 3%-end of the primer at an appropriate distance was important for semiquantitative and reproducible amplification of DNA fragments from template DNA by AP-PCR.
K. Kawakami et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 5–8
8
Acknowledgements We thank Drs Masayuki Nogichi and Yoichi Anami for providing the fragment M clones. This study was supported in part by grants-in-aid from the Ministry of Health and Welfare of Japan for the Second Term Comprehensive 10-Year Strategy for Cancer Control, by a grant for research on aging and health from the Ministry of Health and Welfare, and by a grant from the Ministry of Education of Japan.
References [1] Welsh J, McClelland M. Nucleic Acids Res 1990;18:7213 – 7218. [2] Williams JG, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. Nucleic Acids Res 1990;18:6531–6535.
[3] Caetano-Anolles G. PCR Methods Appl 1993;3:85 – 94. [4] McClelland M, Mathieu-Daude F, Welsh J. Trends Genet 1995;11:242 – 246. [5] Linskens MH, Feng J, Andrews WH, Enlow BE, Saati SM, Tonkin LA, Funk WD, Villeponteau B. Nucleic Acids Res 1995;23:3244 – 3251. [6] Peinado MA, Malkhosyan S, Velazquez A, Perucho M. Proc Natl Acad Sci USA 1992;89:10065 – 10069. [7] Yasuda J, Navarro JM, Malkhosyan S, Velazquez A, Arribas R, Sekiya T, Perucho M. Genomics 1996;34:1 – 8. [8] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. J Mol Biol 1990;215:403 – 410. [9] Lipkowitz S, Gobel V, Varterasian ML, Nakahara K, Tchorz K, Kirsch IR. J Biol Chem 1992;267:21065– 21071. [10] Brown L, Espinosa Rd, Le Beau MM, Siciliano MJ, Baer R, Linskens MH, Feng J, Andrews WH, Enlow BE, Saati SM, Tonkin LA, Funk WD, Villeponteau B. Proc Natl Acad Sci USA 1992;89:8492 – 8496. [11] Caetano-Anolles G, Bassam BJ, Gresshoff PM. Mol Gen Genet 1992;235:157 – 165.
. .
Structures of primer-template hybrids in arbitrarily primed polymerase chain reaction Keita Kawakami a,b,c, Jun Yasuda a, Takamasa Kayama b, Katsuhiko Doi c, Takao Sekiyaa a,* a
Oncogene Di6ision, National Cancer Center Research Institute, 5 -1 -1 Tsukiji, Chuo-ku, Tokyo, 104 -0045, Japan b Department of Surgical Neurology, Yamagata Uni6ersity, 2 -2 -2 Iida-nishi, Yamagata-shi, 990 -2331, Japan c Department of Physiology, Yamagata Uni6ersity, 2 -2 -2 Iida-nishi, Yamagata-shi, 990 -2331, Japan Received 8 December 1997; received in revised form 8 June 1998; accepted 28 June 1998
Abstract Nucleotide sequence analysis of arbitrarily primed PCR products from two known regions of human genome revealed that at least six contiguous bases at the 3%-end of a primer of 20 bases were perfectly matched in the primer-template hybrids. © 1999 Elsevier Science B.V. All rights reserved. Keywords: AP-PCR; DNA fingerprinting; Primer-template hybrid
1. Introduction Arbitrarily primed polymerase chain reaction (APPCR) is a technique used to amplify multiple and usually anonymous DNA sequences from complex genomes using a single primer [1,2]. At lower stringency, allowing for mismatches, the primer anneals to genomic DNA at many positions. One significant characteristic of the AP-PCR technique is amplification of DNA fragments from these arbitrarily primed sites on the genome. Although detailed features of primer annealing in AP-PCR remain to be clarified, the patterns of DNA fingerprinting are significantly reproducible from both qualitative and quantitative aspects. This reproducibility could be due to rather specific annealing of primers to template DNAs. For efficient amplification by PCR, arbitrary primers were suggested to be perfectly matched to the templates with six to eight bases at their 3%-end [3 – 5]. Thus, elucidation of features of primer-template hybrids in AP-PCR would provide some important information for the use of AP-PCR * Corresponding author. Tel.: + 81 3 35422511, ext. 4800; fax: +81 3 55659535; e-mail: [email protected]
fingerprinting in molecular genetic studies. In the APPCR products from human genomic DNA using an arbitrary primer MCG1 (5% AACCCTCACCCTAACCCCAA 3%) [6] we found two DNA fragments Q0 and M with known nucleotide sequences, giving actual examples of structures of four primer-template hybrids.
2. Materials and methods Essential procedures for AP-PCR were previously described [6,7]. AP-PCR was performed in 15 ml of a mixture containing 20 ng of genomic DNA of normal human lymphocytes and 1 mM of the MCG1 primer using a Thermocycler 9600 (Perkin-Elmer/Cetus). The reaction started with a denaturing step (at 94°C for 5 min), proceeding for the first five cycles under conditions of low stringency (94°C for 30 s, 50°C for 1 min and 72°C for 1.5 min), then for the following 25 cycles under conditions of high stringency (94°C for 15 s, 60°C for 15 s, and 72°C for 1 min), and finally to an extension step (72°C for 5 min). PCR products were subjected to electrophoresis in a 5.5% denaturing polyacrylamide gel with 7 M urea and dried gels were
1050-3862/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII S1050-3862(98)00013-8
6
K. Kawakami et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 5–8
exposed to XAR-5 films or BioMax films (Kodak). Cloning of DNA fragments in gel bands was performed as described using the TA cloning vector (Invitrogen) [7]. Nucleotide sequences of the AP-PCR products from several independent clones were determined and the homology search was carried out using the BLAST program on the World Wide Web (http:// www.ncbi.nlm.nih.gov/) [8].
3. Results AP-PCR fingerprint with the MCG1 primer consisted of more than 20 major bands (Fig. 1). The BLAST homology search revealed that DNA fragments in three of the nine clones from band Q carried essentially the same nucleotide sequence as that of part of a known gene, NSCL-1 /HEN1 [9,10], located on chromosome 1q21. The fragment named Q0 of 405 bp in all three clones showed a 4-bp deletion in the ATTT repetitive sequences of the NSCL-1 gene reported in the database (Genbank Accession number: M96739). By analysis of DNA from human individuals by PCR using a specific
Fig. 1. AP-PCR fingerprinting using the MCG1 primer and its variants, M-8C and M-8C11T. The sizes of the DNA are indicated at the left side of the panel. The name of bands in the MCG1 fingerprint are indicated at the right side of each panel. Products from two independent PCR were analyzed side by side.
primer set for this repetitive sequence, the deletion of one repeating unit in fragment Q0 turned out to be polymorphic (data not shown). In addition, one-base (T) insertion was found in fragment Q0 at position 2045 of the reported NSCL-1 sequence. The nucleotide sequence of the fragment named Q1 (404 bp) in the remaining six clones was not homologous to any others in the BLAST search. The DNA fragment of 525 bp corresponding to band M in MCG1 fingerprinting (Fig. 1) was also found to carry a nucleotide sequence almost identical to that of the DNA fragment cE98F6 located on chromosome 22q13 (EMBL database, Accession No. Z82183). On the basis of nucleotide sequences of the two regions of the genomic DNA, the template DNAs and the MCG1 primer in the hybrids giving fragments G0 and M are aligned (shown in Fig. 2A and D, respectively) to obtain a maximum number of base pairs at the 3%-end of the primer. In the remaining 5%-part of the hybrids, possible looping-out structures with the maximum number of base pairs are also proposed. At all four annealing sites, six to 11 bases at the 3%-end of the primer were perfectly matched to the template sequences (Fig. 2A and D). The features were consistent with those observed in previous studies [5,11]. Of the 20 bases of the MCG1 primer, 17 and 16 could correctly pair with the upper and the lower NSCL-1 sequences, respectively, in the proposed looping-out structure (Fig. 2A). Similarly in the MCG1 primer-template hybrid producing fragment M, 16 and 12 of 20 bases of the primer could pair with the upper and the lower cE98F6 sequences, respectively (Fig. 2D). These possible structures looping-out either in primer or in template were often expected in PCR-mediated technology although there was no direct evidence for the presence of these structure in the hybrid during AP-PCR. To get some information on the structure of primer-template hybrids, the nucleotide sequence of the primer MCG1 was slightly modified on the basis of the nucleotide sequence of the NSCL-1 gene. The modified primer M-8C contained a C residue instead of T at the eighth position from the 3%-end. The modification did not change the contiguous base pairs at the 3%-end of the original primer in the hybrids producing fragment Q0 (Fig. 2B). With M-8C the hybrid at the upper site gained an additional base pair while that at the lower strand had the same base pairs. The primer M-8C was further modified to M-8C11T by changing the C residue at the 11th base to T. Possible structures of the primer-template hybrids are shown in Fig. 2C. AP-PCR products with variant primers gave fingerprinting patterns distinct from that obtained with the original MCG1 primer (Fig. 1). The signal of the band corresponding to Q in the MCG1 fingerprint was very weak in the M-8C fingerprint (Fig. 1, left), while that in the fingerprint obtained with M-8C11T was clearly ob-
K. Kawakami et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 5–8
7
Fig. 2. Possible structures of hybrids between arbitrary primers and template sequences. Hybrids with MCG1 (A and D), M-8C (B), and M-8C11T (C) arbitrary primers are indicated. The looped-out bases are indicated by lowercase and the sites in the opposite strands are indicated by dashed lines. The changed nucleotides in modified primers and newly formed base pairs are indicated in bold letters.
served although its intensity was less than that of band Q in the MCG1 fingerprint (Fig. 1, right). Amplification of the Q0 fragment by AP-PCR was confirmed by Southern hybridization with the corresponding probe after transfer of DNA fragments in fingerprints from dried gels to a nylon membrane (data not shown). The results revealed that the modified primers produced essentially the same amount of the Q0 fragment as that obtained with MCG1. The production of fragment Q1 was greatly reduced with the modified primers, suggesting that the decreased Q band signal in the fingerprints could be due to reduced synthesis of the major fragment Q1. Similarly the Southern hybridization revealed no production of fragment M from the cE98F6 sequence with the modified primers. The results of the primers modified on the basis of the template nucleotide sequence of the NSCL-1 gene indicated that slight
changes of structures of the primer-template hybrids in the regions outside of the contiguous base pairs at the 3% ends of the primers did not influence the production of fragment Q0.
4. Conclusion We report four examples of possible structures of primer-template hybrids in AP-PCR deduced from known nucleotide sequences on human genomic DNA. Our results suggested that the presence of two arbitrarily priming hybrids containing at least six contiguous base pairs at the 3%-end of the primer at an appropriate distance was important for semiquantitative and reproducible amplification of DNA fragments from template DNA by AP-PCR.
K. Kawakami et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 5–8
8
Acknowledgements We thank Drs Masayuki Nogichi and Yoichi Anami for providing the fragment M clones. This study was supported in part by grants-in-aid from the Ministry of Health and Welfare of Japan for the Second Term Comprehensive 10-Year Strategy for Cancer Control, by a grant for research on aging and health from the Ministry of Health and Welfare, and by a grant from the Ministry of Education of Japan.
References [1] Welsh J, McClelland M. Nucleic Acids Res 1990;18:7213 – 7218. [2] Williams JG, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. Nucleic Acids Res 1990;18:6531–6535.
[3] Caetano-Anolles G. PCR Methods Appl 1993;3:85 – 94. [4] McClelland M, Mathieu-Daude F, Welsh J. Trends Genet 1995;11:242 – 246. [5] Linskens MH, Feng J, Andrews WH, Enlow BE, Saati SM, Tonkin LA, Funk WD, Villeponteau B. Nucleic Acids Res 1995;23:3244 – 3251. [6] Peinado MA, Malkhosyan S, Velazquez A, Perucho M. Proc Natl Acad Sci USA 1992;89:10065 – 10069. [7] Yasuda J, Navarro JM, Malkhosyan S, Velazquez A, Arribas R, Sekiya T, Perucho M. Genomics 1996;34:1 – 8. [8] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. J Mol Biol 1990;215:403 – 410. [9] Lipkowitz S, Gobel V, Varterasian ML, Nakahara K, Tchorz K, Kirsch IR. J Biol Chem 1992;267:21065– 21071. [10] Brown L, Espinosa Rd, Le Beau MM, Siciliano MJ, Baer R, Linskens MH, Feng J, Andrews WH, Enlow BE, Saati SM, Tonkin LA, Funk WD, Villeponteau B. Proc Natl Acad Sci USA 1992;89:8492 – 8496. [11] Caetano-Anolles G, Bassam BJ, Gresshoff PM. Mol Gen Genet 1992;235:157 – 165.
. .