Studies on biofilm formation and virulence factors associated with uropathogenic Escherichia coli isolated from patient with acute pyelonephritis

G Model

ARTICLE IN PRESS

PATPHY-953; No. of Pages 7

Pathophysiology xxx (2018) xxx–xxx

Contents lists available at ScienceDirect

Pathophysiology journal homepage: www.elsevier.com/locate/pathophys

Studies on biofilm formation and virulence factors associated with uropathogenic Escherichia coli isolated from patient with acute pyelonephritis A. Vysakh, Sebastian Jose Midhun, Kuriakose Jayesh, Mathew Jyothis, M.S. Latha ∗ School of Biosciences, Mahatma Gandhi University, Priyadarshini Hills, Kottayam, Kerala, India

a r t i c l e

i n f o

Article history: Received 24 March 2018 Received in revised form 29 June 2018 Accepted 12 July 2018 Available online xxx Keywords: Escherichia coli Uropathogen Pyelonephritis Virulence factors

a b s t r a c t The current study aims to the detection of pathogenic potential and virulence factor identification of uropathogenic Escherichia coli BRL-17 isolated from patients urine. The organism was isolated from the patient with chronic pyelonephritis. The identification of organism was done by analyzing gram staining, biochemical, 16S rDNA analysis, Raman microscopy and SEM analysis. The pathogenic potential was identified by multiplex PCR analysis of virulence factor genes like sfa, hly D, pap C. The biofilm forming ability was tested by congo red agar assay and tissue culture plate assay. The result of gram staining and biochemical analysis shows the characteristics of E-coli. The 16S rDNA analysis of the clinically isolated uropathogen showed 100% similarity with uropathogenic Escherichia coli strain. Raman microscopy and SEM confirms the organism as E-coli. The Multiplex PCR study identifies virulence genes like sfa, hly D, pap C in isolated E-coli. The presence of P fimbriae coded pap C gene, S fimbriae coded sfa gene and hemolysinD coded hly D gene discloses its potential to cause urinary tract infection. Biofilm assay result enhances the organism’s role as strong biofilm former. This biofilm forming ability of Escherichia coli strain BRL-17 made the organism to escape from host immune system and helps to colonize in bladder and kidney. This also helps to enhance the resistance to antibiotics. Our study confirms the organism as multidrug resistant, highly virulent, strong biofilm forming E-coli. The strain may be used for the development of animal models of pyelonephritis for the purpose of drug discovery. © 2018 Elsevier B.V. All rights reserved.

1. Introduction Urinary tract infections (UTIs) are considered as the most common infections in humans all over the world. Majority of community-acquired urinary tract infections are caused by uropathogenic Escherichia coli (UPEC) [1,2]. UPEC associated UTI have very serious health and economic impacts on the world [3]. Most of the scientist in recent time generally accepted the hypothesis that “UPEC evolved from non-pathogenic strains”. Acquiring of new virulence factors from accessory DNA horizontal transfer located at the chromosomal or plasmid level was the reason for the transformation of non-pathogenic strain to pathogenic one [4]. Progress in molecular technology has facilitated studies on UPEC [5]. The severity of disease conditions associated with UTIs depends upon multiple UPEC virulence factors and host susceptibility. Wide range of virulence factors such as adhesins (fim, afaI, sfa, iha, tsh, papC, and papGI, -II, and -III), iron-acquisition systems (iroN, irp2,

∗ Corresponding author. E-mail address: [email protected] (M.S. Latha).

and iuc), protectins (kpsMT, ompT, and iss), and genes encoding toxins (cnf1, hlyA, set, astA, vat, usp, and cva/cvi) are involved in the pathogenicity of UPEC [6,7]. These virulence factors contribute to bacterial host colonization and invasion, biofilm formation and tissue damage. They also helps to stimulate the inflammatory response, evasion of the immune response, and ascent to the bladder and kidney [8]. The movement of UPEC from bladder to kidney leads to the pyelonephritis and kidney inflammation. Microorganisms growing in biofilm are highly resistant to antimicrobial agents and are associated with chronic and recurrent human infections [9]. The biofilm formation helps the bacterial population to escape from immune system attack. This may contributes to the pathogenesis of chronic infections such as cystitis and other pulmonary illnesses [10]. Formation of biofilm and its architecture maintenance are controlled by a quorum sensing (QS)dependent mechanism [11]. Entry of antibiotics and antimicrobial peptides to the biofilm where restricted by an effective barrier made with exopolymeric substance (EPS) [12]. Biofilm formation and QS-controlled virulence factors are another interesting factor that contributes for the development of acute and chronic infections caused by Gram-negative bacteria. These factors result

https://doi.org/10.1016/j.pathophys.2018.07.004 0928-4680/© 2018 Elsevier B.V. All rights reserved.

Please cite this article in press as: A. Vysakh, et al., Studies on biofilm formation and virulence factors associated with uropathogenic Escherichia coli isolated from patient with acute pyelonephritis, Pathophysiology (2018), https://doi.org/10.1016/j.pathophys.2018.07.004

G Model PATPHY-953; No. of Pages 7

ARTICLE IN PRESS A. Vysakh et al. / Pathophysiology xxx (2018) xxx–xxx

2

in bacterial persistence and reduced sensitivity to antimicrobials [12]. According to National Institutes of Health, more than 80% of all infections involve biofilms [13]. Biofilms are associated with many medical conditions such as dental plaque, indwelling medical devices, upper respiratory tract infections, urogenital infections and peritonitis [14]. From the above context of knowledge, the biofilm formation ability and virulence factors in an organism was responsible for the severity of the disease, which contributes by the organism. So the aim of the current study was to determine the pathogenic potential of uropathogenic Escherichia coli BRL-17 isolated from patients urine. 2. Materials and methods 2.1. Microorganism and culture collection The uropathogenic E-coli were clinically isolated from patients urine with severe urinary tract infection. The microorganism was collected from MOSC medical college, Kolenchery, Kerala, India with Institutional Ethical Committee approval (Reg. No: MOSC/IEC/167/II/ext/2016). 2.2. Biochemical analysis The biochemical analysis like IMViC, Mannitol salt agar test, Triple sugar iron agar test, Urease test, nitrate reduction test and gram staining were performed for the identification of microorganism [15]. 2.3. SEM analysis of uropathogen The characterization of the prepared surfaces was performed with a JEOL-JSM-6390 model SEM instrument. The SEM images of the bacterial cells in the slide were acquired upon drying at ambient temperature. The accelerating voltage was 10 kV for all experiments. 2.4. Raman spectroscopy and imaging of uropathogen Raman measurements of E-coli was performed using a confocal Raman spectrometer (Alpha 300, Witec, Germany) with a piezodriven controlled scanning stage, a 100× Nikon objective (N: A: ¼ 0.90) lens at room temperature, and an Ar ion laser (Melles Griot) at a wavelength of 532 nm. 2.5. Growth curve analysis The cell suspension containing 1 × 106 cells/mL of diluted (1:100 fold) E-coli was distributed to sterile 96-well polystyrene microtitre plates. The plate was incubated at 37 ◦ C. The OD of the bacterial culture at 600 nm was recorded at 1 h intervals for 24 h using an iMark Microplate plate reader (Biorad, USA). All experiments were performed in triplicate. 2.6. 16 s rDNA sequencing and virulence factor gene identification The genomic DNA was isolated using the phenol-chloroform extraction method [16]. The pathogen was identified by 16S rRNA gene sequence analysis using the universal primers, 8 F and 1492R as described previously [17]. Amplified PCR product was purified using column purification as per manufacturers guidelines and further used for the sequencing reaction. The concentration of the purified DNA was determined and was subjected to automated DNA sequencing on ABI3730xl Genetic Analyzer (Applied Biosystems, USA). Each nucleic acid sequence was edited manually to

correct falsely identified bases and trimmed to remove unreadable sequence at the 3 and 5’ ends (considering peak and quality values for each base) using the sequence analysis tools. The edited sequences (16S rDNA) were then used for similarity searches using BLAST (Basic Local Alignment Search Tool) programme in the NCBI GenBank (www.ncbi.nlm.nih.gov) DNA database for identifying the bacterial strains. For virulence factor gene identification, E-coli genes were amplified by PCR from genomic DNA using gene-specific primers. The primers for virulence factor genes like sfa, hly D, Pap C were used for the current study. Characteristics of all used primers, as well as amplicon length, are listed in Table 3. The PCR amplification was done according to manufactures procedure. Amplified PCR product was purified using column purification as per manufacturer’s guidelines and further used for the sequencing reaction. The concentration of the purified DNA was determined and was subjected to automated DNA sequencing on ABI3730xl Genetic Analyzer (Applied Biosystems, USA). The PCR products were loaded on 1.5% agarose gel. The gels were viewed on UV transilluminator and the photograph of the gel was taken using a gel documentation system (Alpha imager, USA). Commercially available (BioLit ProxiB 100bp DNA Ladder plus) ladder was used as standard molecular weight DNA. 2.7. Antibiotic sensitivity test The clinically isolated uropathogenic E-coli was sub-cultured in LB broth and incubated at 37 ◦ C in a shaker incubator. The optical density (OD) was adjusted to 0.5 McFarland (1 × 108 CFU/ml) standard. The antibiotic sensitivity test was performed according to the method prescribed by Bauer et al [18]. The test was performed in triplicates. The results were interpreted according to Clinical and Laboratory Standards Institute (CLSI) guidelines [19]. 2.8. Biofilm production assays 2.8.1. Congo red agar (CRA) method CRA method described by Freeman et al was used for the detection of biofilm formation ability of isolated uropathogen [20]. The CRA plates were inoculated with test organism (Escherichia coli strain BRL-17), a non-biofilm producing bacteria (Aeromonas caviae MTCC 7725) as negative control, and biofilm producer (Aeromonas hydrophila MTCC 1739) as positive control. The plates were incubated at 30 ◦ C for 24 h aerobically then observed for biofilm production. The experiment was done in triplicate and repeated three times. The strong biofilm producer have characteristic black coloured colonies with a dry crystalline consistency [21]. 2.8.2. Tissue culture plate (TCP) assay TCP assay was described by Christensen et al. [22]. The organism was inoculated to fresh Luria-Bertani broth containing 1% glucose (HiMedia) and incubated at 30 ◦ C for 24 h. The culture was diluted (1:100) with fresh LB medium. The 96 well flat bottom polystyrene tissue culture plates (HiMedia) was added with 200 ␮L fresh medium and 50 ␮L of bacterial culture. Sterile broth and non-biofilm producing bacteria, biofilm producing bacteria were served as controls. The plates were incubated at 30 ◦ C for 24 h. After incubation culture medium in the each well were removed by gentle tapping. Floating bacteria was removed by washing plate twice with 0.2 mL of phosphate buffer saline (pH 7.2). The biofilm formed by bacteria adherent to the wells were fixed by 2% sodium acetate and stained with 0.1% crystal violet (aqueous). Excess stain was removed by washing with deionized water. The wells were diluted with 100 ␮L of 95% ethanol and kept for drying. Optical density of stained adherent biofilm was measured by Microplate plate reader (Biorad, USA) at 570 nm wavelength. The experi-

Please cite this article in press as: A. Vysakh, et al., Studies on biofilm formation and virulence factors associated with uropathogenic Escherichia coli isolated from patient with acute pyelonephritis, Pathophysiology (2018), https://doi.org/10.1016/j.pathophys.2018.07.004

G Model PATPHY-953; No. of Pages 7

ARTICLE IN PRESS A. Vysakh et al. / Pathophysiology xxx (2018) xxx–xxx

3

Table 1 Biochemical analysis of E-coli BRL-17. Biochemical test

Result

Grams staining Indole Methyl Red Voges Proskauer Test Citrate utilization Mannitol Salt Agar Triple Sugar Iron Agar Urease Nitrate reduction

Negative Positive Positive Negative Negative Positive Positive Negative Positive

ments were performed in triplicate and repeated three times [23]. The Weak/Nonbiofilm producer have OD value <0.120; Moderate biofilm producer have OD value in between 0.12–0.24 OD, High biofilm producer have OD value >0.24 OD.

Fig. 1. SEM analysis of E-coli BRL-17.

2.9. Statistical analysis

3.2. SEM analysis of E-coli BRL-17

All the data were expressed as mean ± standard deviation (n = 3) and the results were analyzed by using GraphPad Prism© version 5.03 for Windows (GraphPad Software, San Diego, CA, USA).

The SEM analysis of E-coli BRL-17 revealed its rod-like characteristics at 2 ␮m resolution range. The result confirmed the organism as E-coli (Fig. 1).

3. Results

3.3. Raman spectrum and image analysis of E-coli BRL-17

3.1. Biochemical analysis of E-coli BRL-17

The Raman spectrum of E-coli BRL-17 shows the peak that was similar to standard Raman spectrum of pathogenic E- coli(Fig. 2C). The Raman image (Fig. 2B) of E-coli BRL-17 shows its rod-like characteristic at 9 ␮m resolution. The spectrum and image of Raman spectroscopy confirm the organism as E-coli.

The biochemical analysis of uropathogen was done by performing the following assays like IMViC, mannitol salt agar test, triple sugar iron agar test, urease test, nitrate reduction test and gram staining. The organism was a positive result on indole test, methyl red test, mannitol salt agar, triple sugar iron agar and nitrate reduction test. The organism shows the negative result on Voges Proskauer test, citrate utilization test and urease test (Table 1). The gram staining result indicates it as a gram negative organism.

3.4. Growth curve analysis of E-coli BRL-17 The growth curve analysis of E-coli BRL-17 shows high growth rate in short time span. The organism attains its stationary phase

Fig. 2. Raman spectrum and image analysis of E-coli BRL-17. A: objective lens image of E-coli BRL-17; B: Raman image of E-coli BRL-17; C: Raman spectrum of E-coli BRL-17.

Please cite this article in press as: A. Vysakh, et al., Studies on biofilm formation and virulence factors associated with uropathogenic Escherichia coli isolated from patient with acute pyelonephritis, Pathophysiology (2018), https://doi.org/10.1016/j.pathophys.2018.07.004

G Model PATPHY-953; No. of Pages 7

ARTICLE IN PRESS A. Vysakh et al. / Pathophysiology xxx (2018) xxx–xxx

4

Table 2 Antibiotic sensitivity profiling of E-coli BRL-17. Antibiotic

Inference

Antibiotic

Inference

Amoxicillin Ampicillin Ticarcillin/Clavulanic Acid Cephalaxin Cefixime Cefotaxime Nalidixic Acid Ciprofloxacin Gomefloxacin Norfloxacin Cefepime Nitrofurantoine

Resistant Resistant Resistant Resistant Resistant Resistant Resistant Resistant Resistant Resistant Resistant Resistant

Ampicillin/Sulbactum Piperacillin/Tazobactum Ceftazidimime Cefuroxime Augmentin Gentamicin Fostomycin

Sensitive Sensitive Sensitive Sensitive Sensitive Sensitive Sensitive

Fig. 3. Growth curve analysis of E-coli BRL-17.

within six hours and multiplying at a very faster rate during log phase (Fig. 3).

Table 3 Details of primers used for PCR. Primer/Gene Name

3.5. 16s rDNA sequencing Based on the 16S rDNA analysis (Fig. 5A), the clinically isolated uropathogen showed 100% similarity with Escherichia coli strain CH611 (Accession No. CP017980.1). The result of 16 s rDNA sequencing of uropathogen illustrates that the organism was Escherichia coli. The phylogenetic tree (Fig. 4) was constructed and the sequence was deposited in NCBI GenBank under accession no: MF185683 Escherichia coli strain BRL-17. 3.6. Virulence factor identification of E-coli BRL-17 Virulence factor genes like sfa, hly D, pap C were analyzed by multiplex PCR amplification using specific primers. The amplified products were visualized on 1.5% agarose gel (Fig. 5B–D). The PCR amplification of virulence factor genes from Escherichia coli strain BRL-17 shows the presence of virulent factors like hly D (Fig. 5B), pap C (Fig. 5C), sfa (Fig. 5D). 3.7. Antibiotic sensitivity testing of E-coli BRL-17 The antibiotic sensitivity testing of E-coli BRL-17 was performed by disc diffusion method. The result obtained from the experi-

Primer sequence

Product Size

papC

F R

5’GTGGCAGTATGAGTAATGACCGTTA3’ 5’ATATCCTTTCTGCAGGGATGCAATA3’

205 bp

sfa

F R

5’CTCCGGAGAACTGGGTGCATCTTAC3’ 5’CGGAGGAGTAATTACAAACCTGGCA3’

410 bp

hly D

F R

5’CTCCGGTACGTGAAAAGGAC3’ 5’GCCCTGATTACTGAAGCCTG3’

900bp

ment shows high resistance towards most of the commonly used antibiotics like Amoxicillin, Ampicillin, Ticarcillin/Clavulanic Acid, Cephalaxin, Cefixime, Cefotaxime, Nalidixic Acid, Ciprofloxacin, Gomefloxacin, Norfloxacin, Cefepime, and Nitrofurantoine. The pathogen was sensitive to Ampicillin/Sulbactum combination, Piperacillin/Tazobactum combination, Ceftazidimime, Cefuroxime, Augmentin, Gentamicin, and Fostomycin (Table 2). 3.8. Congo red agar assay for biofilm production The result of congo red agar assay of Escherichia coli strain BRL17 shows (Fig. 6C) black colonies with a dry crystalline consistency which indicated strong biofilm production. The nonbiofilm producer Aeromonas caviae was used as negative control (Fig. 6A). The

Fig. 4. Phylogenetic tree of E-coli BRL-17. The evolutionary history was inferred using the Neighbor-Joining method. Evolutionary analyses were conducted in MEGA6.

Please cite this article in press as: A. Vysakh, et al., Studies on biofilm formation and virulence factors associated with uropathogenic Escherichia coli isolated from patient with acute pyelonephritis, Pathophysiology (2018), https://doi.org/10.1016/j.pathophys.2018.07.004

G Model PATPHY-953; No. of Pages 7

ARTICLE IN PRESS A. Vysakh et al. / Pathophysiology xxx (2018) xxx–xxx

5

Fig. 5. 16 s rRNA and virulence factor identification of E-coli BRL-17. A: 16 s rRNA of E-coli BRL-17; B: hly D; C: papC; D: sfa.

Fig. 6. Congo red agar assay for biofilm production. A: Aeromonas caviae; B: Aeromonas hydrophila; C: E-coli BRL-17.

Fig. 7. a) Tissue culture plate assay for biofilm production. 7 aA: Aeromonas caviae; 7aB: Aeromonas hydrophila; 7aC: E-coli BRL-17; 7aD: Blank without microorganism. b) Biofilm forming ability of E-coli BRL-17.

strong biofilm producer Aeromonas hydrophila was used as positive control (Fig. 6B).

hydrophila was used as positive control (Fig. 7aB). The Fig. 7b shows the biofilm formation ability of uropathogen. 4. Discussion

3.9. Tissue culture plate assay for biofilm production The result of tissue culture plate assay for biofilm production of Escherichia coli strain BRL-17 shows its higher ability to form biofilm (Fig. 7aC). The nonbiofilm producer Aeromonas caviae was used as negative control (Fig. 7aA). The strong biofilm producer Aeromonas

Urinary tract infections are common bacterial infections that affect most of the people once in their lifetime. The UTI was more common in females and are associated with considerable morbidity and health care cost [24]. Escherichia coli strains that attain disease causing capability and causing disease outside the gastrointesti-

Please cite this article in press as: A. Vysakh, et al., Studies on biofilm formation and virulence factors associated with uropathogenic Escherichia coli isolated from patient with acute pyelonephritis, Pathophysiology (2018), https://doi.org/10.1016/j.pathophys.2018.07.004

G Model PATPHY-953; No. of Pages 7 6

ARTICLE IN PRESS A. Vysakh et al. / Pathophysiology xxx (2018) xxx–xxx

nal tract belong to a diverse group referred to as uropathogenic E-coli [25]. Virulence factors expressed in UPEC helps to break the inertia of the mucosal barrier [26]. The prerequisite for the establishment of infectious diseases was the ability of the bacteria to adhere host epithelial cells. Both host and E- coli virulence factors can contribute to the development of upper UTI, and less virulent strains can cause upper UTI in hosts with predisposing factors, such as immunosuppression, or urinary tract obstruction and diabetes with poor glycemic control [27]. Clinical examination of urine was the first line diagnosis of acute pyelonephritis and cystitis. The identification criteria for UTI was defined as the presence of a positive urine culture having ≥105 colony-forming units (cfu/mL) of uropathogen and pyuria (≥104 leukocytes/mL of clean voided urine) [28]. The diagnostic criteria for acute pyelonephritis were dysuria, temperature (≥38.5 ◦ C), leukocyturia (>105 mL), and no other identifiable source of infection [29]. For the current study we isolate the uropathogen from patient’s urine which shows ≥ 105 colony-forming units bacteria upon culture. The isolated organism was confirmed as E-coli via biochemical, gram staining analysis, SEM analysis, Raman spectroscopy/imaging and 16S rDNA analysis. The 16S rDNA analysis of the clinically isolated uropathogen showed 100% similarity with uropathogenic Escherichia coli strain. The sequence was deposited in NCBI GenBank under accession no: MF185683 Escherichia coli strain BRL-17. The antibiotic sensitivity testing result of isolated E-coli BRL-17 prove its character as a good multi resistant strain. The organism was resistant to most of the antibiotics. This factor increases the risk to medical practitioners for treating the disease. The multi drug resistant UPEC may lead to pyelonephritis in patients and leads to kidney inflammation and tissue damage. Faster multiplication rate contributes the disease-causing potential of uropathogen [30]. The growth curve analysis of E-coli BRL-17 shows high growth rate in short time span. This result reveals its potential to grow fast and cause chronic disease conditions. The conventional methods of bacteria identification require too much time. Now days, the identification of bacteria based on micro-Raman spectroscopy was introduced. This technique is able to investigate single bacterial cells [31,32]. The surface enhanced Raman scattering (SERS) is an emerging and promising technique to identify bacteria, but its potential has not fully explored. The several groups explored the utility of SERS for bacterial characterization, discrimination, and identification [33–36]. Our study uses Raman spectrum and imaging to confirm the organism as uropathogenic E-coli. The spectrum shows characteristic peaks of E-coli and Raman image confirm the shape of the organism as rod. The SEM analysis of Escherichia coli strain BRL-17 also shows its rod-like appearance. From the Raman and SEM analysis confirmed the organism as Ecoli. The SEM analysis also shows the presence of slime production. The slime production in Escherichia coli strain BRL-17 increase its ability to cause diseases and enhance its drug resistance capacity. The invasion and colonization of UPEC into host cells was facilitated by several virulence factors [1,37]. These virulence factors determine the degree of pathogenicity of UPEC strains [38]. The identification and characterization of virulence genes in UPEC can be useful to study the pathogenesis of UTI and to minimize the complications, including kidney failure. Adhesins (Surface virulence factors) of UPEC are among the most important virulence factors that play a central role in its pathogenicity [39]. P fimbriae is the main attachment factor, which is encoded by pap genes and particularly associated with pyelonephritis [40]. Another adhesion that acts as a virulence factor is S fimbrial adhesion, which is coded by sfa genes [41]. Hemolysin-D (hlyD) is one of the most important secretory virulence factor which is encoded by the hly gene have been reported in cases of pyelonephritis and recurring cystitis [42]. Virulence factor genes like sfa, hly D, pap C were active in Escherichia coli strain BRL-17. The presence of these genes in Escherichia coli strain

BRL-17 proves its role as a potent uropathogen. These genes help to colonize the pathogen to uroepithelial tissue and establish the infection. The virulence factors are also capable to induce major inflammatory pathways such as TLR-4 mediated NF-␬B pathway. The stimulation of TLR-4 leads to the activation of transcription factors which are responsible for the transcription of proinflammatory cytokines and chemokines. These result in the formation of chronic inflammation at the site of infection. The inflammatory condition associated with uropathogenic infection leads to tissue damage and renal scaring. The virulence factors have major role in pathophysiology of pyelonephritis. A bacterial biofilm consists of a three-dimensional structured community of aggregated cells embedded in a self-produced exopolysaccharide matrix. It has the ability to adhere to abiotic and biotic surfaces. Many chronic and persistent bacterial infections are believed to be associated with biofilm formation [43]. Biofilm forming pathogenic bacteria was thousand times more resistant to antimicrobial agents such as antibiotics, and host immune attacks [44,45]. The ability of bacterial cells to develop biofilms is not only responsible for many health problems but also causes economic losses [46]. The results of congo red agar assay and tissue culture plate assay for biofilm production shows the higher ability of Escherichia coli strain BRL-17 to form biofilm. The strong biofilm forming ability of Escherichia coli strain BRL-17 uropathogen helps to colonize in bladder and kidney. This biofilm forming ability of Escherichia coli strain BRL-17 made the organism to escape from host immune system. This also helps to enhance the resistance to antibiotics. One of the reasons behind the multi drug resistant ability of the Escherichia coli strain BRL-17 may be due to its capacity to form strong biofilm. The biofilm production capability of the Escherichia coli strain BRL-17 has play an important role in catheter associated UTI. 5. Conclusion We can conclude from our study that the organism was confirmed as multidrug resistant, highly virulent, strong biofilm forming E-coli. The organism has the capability to cause cystitis and pyelonephritis. Future studies focused on to develop an animal model of pyelonephritis using Escherichia coli strain BRL-17 for the drug discovery to treat UTI. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not for-profit sectors. Conflict of interest The authors declare that they have no conflict of interest. Informed consent Informed consent was obtained from all individual participants included in the study. Ethical approval This article does not contain any studies with human participants or animals performed by any of the authors. Acknowledgements The authors are grateful to School of Biosciences, School of Chemical Sciences, School of Environmental Sciences of Mahatma

Please cite this article in press as: A. Vysakh, et al., Studies on biofilm formation and virulence factors associated with uropathogenic Escherichia coli isolated from patient with acute pyelonephritis, Pathophysiology (2018), https://doi.org/10.1016/j.pathophys.2018.07.004

G Model PATPHY-953; No. of Pages 7

ARTICLE IN PRESS A. Vysakh et al. / Pathophysiology xxx (2018) xxx–xxx

Gandhi University for the excellent research facilities provided for the study. Financial assistance in the form of JRF, from CSIR, Government of India (09/499(0093)/2017-EMR-I), to A. Vysakh is gratefully acknowledged. References [1] K. Ejrnæs, Bacterial characteristics of importance for recurrent urinary tract infections caused by Escherichia coli, Dan. Med. Bull. 58 (2011) B4187. [2] N.S. Sheerin, Urinary tract infection, Medicine (Baltimore) 43 (2015) 435–439, http://dx.doi.org/10.1016/j.mpmed.2015.05.007. [3] W.E. Stamm, S.R. Norrby, Urinary tract infections: disease panorama and challenges, J. Infect. Dis. 183 (2001) S1–S4, http://dx.doi.org/10.1086/318850. [4] J.R. Johnson, M.A. Kuskowski, T.T. O’bryan, R. Colodner, R. Raz, Virulence genotype and phylogenetic origin in relation to antibiotic resistance profile among Escherichia coli urine sample isolates from Israeli women with acute uncomplicated cystitis, Antimicrob. Agents Chemother. 49 (2005) 26–31, http://dx.doi.org/10.1128/AAC.49.1.26-31.2005. [5] J.R. Johnson, A.L. Stell, Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise, J. Infect. Dis. 181 (2000) 261–272, http://dx.doi.org/10.1086/315217. [6] C.M. Abe, F.A. Salvador, I.N. Falsetti, M.A.M. Vieira, J. Blanco, J.E. Blanco, M. Blanco, A.M.O. MacHado, W.P. Elias, R.T. Hernandes, T.A.T. Gomes, Uropathogenic Escherichia coli (UPEC) strains may carry virulence properties of diarrhoeagenic E. coli, FEMS Immunol. Med. Microbiol. 52 (2008) 397–406, http://dx.doi.org/10.1111/j.1574-695X.2008.00388.x. [7] Y.-Y. Chiou, M.-J. Chen, N.-T. Chiu, C.-Y. Lin, C.-C. Tseng, Bacterial virulence factors are associated with occurrence of acute pyelonephritis but not renal scarring, J. Urol. 184 (2010) 2098–2102, http://dx.doi.org/10.1016/j.juro.2010. 06.135. [8] S.S. Justice, C. Hung, J.A. Theriot, D.A. Fletcher, G.G. Anderson, M.J. Footer, S.J. Hultgren, Differentiation and developmental pathways of uropathogenic Escherichia coli in urinary tract pathogenesis, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 1333–1338, http://dx.doi.org/10.1073/pnas.0308125100. [9] B. Vu, M. Chen, R.J. Crawford, E.P. Ivanova, Bacterial extracellular polysaccharides involved in biofilm formation, Molecules 14 (2009) 2535–2554, http://dx.doi.org/10.3390/molecules14072535. [10] P.Ø. Jensen, M. Givskov, T. Bjarnsholt, C. Moser, The immune system vs. Pseudomonas aeruginosa biofilms, FEMS Immunol. Med. Microbiol. 59 (2010) 292–305, http://dx.doi.org/10.1111/j.1574-695X.2010.00706.x. [11] S. Wang, S. Yu, Z. Zhang, Q. Wei, L. Yan, G. Ai, H. Liu, L.Z. Ma, Coordination of swarming motility, biosurfactant synthesis, and biofilm matrix exopolysaccharide production in pseudomonas aeruginosa, Appl. Environ. Microbiol. 80 (2014) 6724–6732, http://dx.doi.org/10.1128/AEM.01237-14. [12] S.S. Grant, D.T. Hung, Persistent bacterial infections, antibiotic tolerance, and the oxidative stress response, Virulence 4 (2013) 273–283, http://dx.doi.org/ 10.4161/viru.23987. [13] NIH, NIH Guide: Research on Microbial Biofilms (PA-03-047), Natl. Hear. Lung, Blood Institute, 2002 https://grants.nih.gov/grants/guide/pa-files/pa-03-047. html. [14] G. Reid, Biofilms in infectious disease and on medical devices, Int. J. Antimicrob. Agents 11 (1999), 223–226-9. [15] C.R. Mahon, D.C. Lehman, G. Manuselis, Textbook of Diagnostic Microbiology, Elsevier Health Sciences, 2014. [16] Michael R. G, J. Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, 2012. [17] D.J. Lane, 16S/23S rRNA sequencing, in: E. Stackebrandt, M. Goodfellow (Eds.), Nucleic Acid Techniques in Bacterial Systematics, John Wiley and Sons, Chichester, United Kingdom, 1991. [18] A.W. Bauer, W.M. Kirby, J.C. Sherris, M. Turck, Antibiotic susceptibility testing by a standardized single disk method, Am. J. Clin. Pathol. 45 (1966) 493–496. [19] CLSI, Clinical and Laboratory Standards Institute (CLSI), Performance Standards for Antimicrobial Susceptibility Testing; Twenty Second Informational Supplement, 2012. [20] D.J. Freeman, F.R. Falkiner, C.T. Keane, New method for detecting slime production by coagulase negative staphylococci, J. Clin. Pathol. 42 (1989) 872–874. [21] G. Reid, Biofilms in infectious disease and on medical devices, in: Int. J. Antimicrob. Agents, Elsevier, 1999, pp. 223–226, http://dx.doi.org/10.1016/ S0924-8579(99)00020-5. [22] G.D. Christensen, W.A. Simpson, J.J. Younger, L.M. Baddour, F.F. Barrett, D.M. Melton, E.H. Beachey, Adherence of coagulase-negative staphylococci to plastic tissue culture plates: a quantitative model for the adherence of staphylococci to medical devices, J. Clin. Microbiol. 22 (1985) 996–1006. [23] G.A. O’Toole, L.A. Pratt, P.I. Watnick, D.K. Newman, V.B. Weaver, R. Kolter, Genetic approaches to study of biofilms, Methods Enzymol. 310 (1999) 91–109.

7

[24] J. Agarwal, M. Singh, S. Srivastava, Pathogenomics of uropathogenic Escherichia coli, Indian J. Med. Microbiol. 30 (2012) 141, http://dx.doi.org/10. 4103/0255-0857.96657. [25] X. Wang, Q. Yan, X. Xia, Y. Zhang, D. Li, C. Wang, S. Chen, R. Hou, Serotypes, virulence factors, and antimicrobial susceptibilities of vaginal and fecal isolates of Escherichia coli from giant pandas, Appl. Environ. Microbiol. 79 (2013) 5146–5150, http://dx.doi.org/10.1128/AEM.01367-13. [26] J. Bien, O. Sokolova, P. Bozko, Role of uropathogenic escherichia coli virulence factors in development of urinary tract infection and kidney damage, Int. J. Nephrol. 2012 (2012) 1–15, http://dx.doi.org/10.1155/2012/681473. [27] C.-C. Tseng, J.-J. Wu, H.-L. Liu, J.-M. Sung, J.-J. Huang, Roles of host and bacterial virulence factors in the development of upper urinary tract infection caused by Escherichia coli, Am. J. Kidney Dis. 39 (2002) 744–752, http://dx. doi.org/10.1053/ajkd.2002.32992. [28] M. Tarchouna, A. Ferjani, W. Ben-Selma, J. Boukadida, Distribution of uropathogenic virulence genes in Escherichia coli isolated from patients with urinary tract infection, Int. J. Infect. Dis. 17 (2013) e450–e453, http://dx.doi. org/10.1016/j.ijid.2013.01.025. [29] W. Sakran, V. Smolkin, A. Odetalla, R. Halevy, A. Koren, Community-acquired urinary tract infection in hospitalized children, Clin. Pediatr. (Phila.) 54 (2015) 479–483, http://dx.doi.org/10.1177/0009922814555974. [30] A.L. Flores-Mireles, J.N. Walker, M. Caparon, S.J. Hultgren, Urinary tract infections: epidemiology, mechanisms of infection and treatment options, Nat. Rev. Microbiol. 13 (2015) 269–284, http://dx.doi.org/10.1038/ nrmicro3432. [31] M. Harz, P. Rösch, J. Popp, Vibrational spectroscopy-a powerful tool for the rapid identification of microbial cells at the single-cell level, Cytom. Part A 75A (2009) 104–113, http://dx.doi.org/10.1002/cyto.a.20682. [32] S. Meisel, S. Stöckel, M. Elschner, P. Rösch, J. Popp, Assessment of two isolation techniques for bacteria in milk towards their compatibility with Raman spectroscopy, Analyst 136 (2011) 4997, http://dx.doi.org/10.1039/ c1an15761b. [33] L. Zeiri, B.V. Bronk, Y. Shabtai, J. Eichler, S. Efrima, Surface-enhanced raman spectroscopy as a tool for probing specific biochemical components in bacteria, Appl. Spectrosc. 58 (2004) 33–40, http://dx.doi.org/10.1366/ 000370204322729441. [34] R.M. Jarvis, A. Brooker, R. Goodacre, Surface-enhanced Raman spectroscopy for bacterial discrimination utilizing a scanning electron microscope with a Raman spectroscopy interface, Anal. Chem. 76 (2004) 5198–5202, http://dx. doi.org/10.1021/ac049663f. [35] R.M. Jarvis, R. Goodacre, Discrimination of bacteria using surface-enhanced raman spectroscopy, Anal. Chem. 76 (2004) 40–47, http://dx.doi.org/10.1021/ ac034689c. [36] W.R. Premasiri, D.T. Moir, M.S. Klempner, N. Krieger, G. Jones, L.D. Ziegler, Characterization of the surface enhanced Raman scattering (SERS) of bacteria, J. Phys. Chem. B 109 (2005) 312–320, http://dx.doi.org/10.1021/jp040442n. [37] T. Kudinha, F. Kong, J.R. Johnson, S.D. Andrew, P. Anderson, G.L. Gilbert, Multiplex PCR-based reverse line blot assay for simultaneous detection of 22 virulence genes in uropathogenic Escherichia coli, Appl. Environ. Microbiol. 78 (2012) 1198–1202, http://dx.doi.org/10.1128/AEM.06921-11. [38] M.R. Tiba, T. Yano, D. da S. Leite, Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis, Rev. Inst. Med. Trop. Sao Paulo 50 (2008) 255–260, http://dx.doi.org/10.1590/S003646652008000500001. [39] L.E. Nicolle, Uncomplicated urinary tract infection in adults including uncomplicated pyelonephritis, Urol. Clin. North Am. 35 (2008) 1–12, http:// dx.doi.org/10.1016/j.ucl.2007.09.004. [40] S. Jadhav, A. Hussain, S. Devi, A. Kumar, S. Parveen, N. Gandham, L.H. Wieler, C. Ewers, N. Ahmed, Virulence characteristics and genetic affinities of multiple drug resistant uropathogenic Escherichia coli from a semi urban locality in India, PLoS One 6 (2011), e18063, http://dx.doi.org/10.1371/ journal.pone.0018063. [41] T. Grodzicki, J. Wojkowska-Mach, A. Chmielarczyk, D. Romaniszyn, P. Adamski, P.B. Heczko, B. Gryglewska, T. Grodzicki, Molecular characterization and drug resistance of Escherichia coli strains isolated from urine from long-term care facility residents in Cracow, Poland, Med. Sci. Monit. 19 (2013) 317–326, http://dx.doi.org/10.12659/MSM.883898. [42] A.L. Servin, Pathogenesis of Afa/Dr diffusely adhering Escherichia coli, Clin. Microbiol. Rev. 18 (2005) 264–292, http://dx.doi.org/10.1128/CMR.18.2.264292.2005. [43] J.W. Costerton, Z. Lewandowski, D.E. Caldwell, D.R. Korber, H.M. Lappin-Scott, Microbial biofilms, Annu. Rev. Microbiol. 49 (1995) 711–745, http://dx.doi. org/10.1146/annurev.mi.49.100195.003431. [44] G.G. Anderson, G.A. O’Toole, Innate and induced resistance mechanisms of bacterial biofilms, Curr. Top. Microbiol. Immunol. 322 (2008) 85–105. [45] P.S. Stewart, M.J. Franklin, Physiological heterogeneity in biofilms, Nat. Rev. Microbiol. 6 (2008) 199–210, http://dx.doi.org/10.1038/nrmicro1838. [46] J.W. Costerton, P.S. Stewart, E.P. Greenberg, Bacterial biofilms: a common cause of persistent infections, Science 284 (1999) 1318–1322.

Please cite this article in press as: A. Vysakh, et al., Studies on biofilm formation and virulence factors associated with uropathogenic Escherichia coli isolated from patient with acute pyelonephritis, Pathophysiology (2018), https://doi.org/10.1016/j.pathophys.2018.07.004