Studies on biosurfactant from Oceanobacillus sp. BRI 10 isolated from Antarctic sea water

Desalination 318 (2013) 64–71

Contents lists available at SciVerse ScienceDirect

Desalination journal homepage: www.elsevier.com/locate/desal

Studies on biosurfactant from Oceanobacillus sp. BRI 10 isolated from Antarctic sea water Vipra Vijay Jadhav a, Amit Yadav c, Yogesh S. Shouche c, Shama Aphale b, Alpana Moghe b, Sruthy Pillai a, Aditi Arora a, Rama Kaustubh Bhadekar a,⁎ a b c

Department of Microbial Biotechnology, Rajiv Gandhi Institute of I.T. and Biotechnology, Bharati Vidyapeeth Deemed University, Katraj, Pune, 411046, Maharashtra, India Department of Molecular Biology, Rajiv Gandhi Institute of I.T. and Biotechnology, Bharati Vidyapeeth Deemed University, Katraj, Pune, 411046, Maharashtra, India Molecular Biology Unit, National Centre for Cell Science, Ganeshkhind, Pune 411007, Maharashtra, India

H I G H L I G H T S • • • • •

Probably first report on glycolipoprotein biosurfactant producing Oceanobacillus sp. 100% stability of biosurfactant at 70 °C, pH8.0 Significant emulsification activity against different hydrocarbons Crude oil biodegradation (up to 90%) in presence of biosurfactant Antimicrobial activity against E. coli and no cytotoxicity on normal cell line

a r t i c l e

i n f o

Article history: Received 2 November 2012 Received in revised form 14 March 2013 Accepted 16 March 2013 Available online 17 April 2013 Keywords: Antimicrobial activity Bioremediation Cytotoxicity Glycolipoprotein Optimization Stability

a b s t r a c t The search for new biosurfactant producing strains from uncommon or extreme microbial habitats has become increasingly important due to their biotechnological and environmental significance. In view of this, fourteen bacterial strains were isolated from eight different sea water samples obtained from various locations of Antarctica. All of them were screened for biosurfactant production and only the isolate BRI 10 was found to be positive in all the tests. It was identified as Oceanobacillus sp. BRI 10 based on 16S rRNA sequencing and phylogenetic analysis. The production of biosurfactant was found to be maximum (E24 = 55%) in the medium containing glucose (3%) and ammonium chloride (0.48%) at 30 °C, pH 8.0 at the end of 48 h. The biosurfactant was stable at higher temperature and at alkaline pH. TLC and FTIR analysis revealed that biosurfactant is a glycolipoprotein. It exhibited antimicrobial activity against Escherichia coli and no cytotoxicity against normal cell line. It is found to emulsify lubricant oil, crude oil, diesel and kerosene in the order kerosene > lubricant oil > diesel > crude oil. The emulsification activity (D610) of biosurfactant was 0.64 as compared to 0.31 with SDS. Crude oil biodegradation experiments resulted in 56 and 90% degradation on 9th and 27th day respectively. These results suggested its applicability against diverse hydrocarbon pollution. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Microbial compounds which exhibit pronounced surface activity are classified as biosurfactants. They decrease surface tension at the air– water interface and between immiscible liquids, or at the solid–liquid interface [1,2]. Chemically they belong to various categories viz. glycolipids, lipopeptides, polysaccharide–protein complexes, phospholipids, fatty acids and neutral lipids [3]. Excellent detergency, emulsification, foaming and dispersing traits, wetting, penetrating, thickening, microbial growth enhancement, metal sequestering and resource recovering (oil)

⁎ Corresponding author. Tel.: +91 20 24365713; fax: +91 20 24379013. E-mail address: [email protected] (R.K. Bhadekar). 0011-9164/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.desal.2013.03.017

are important characteristics of biosurfactants which make them suitable to replace some of the most versatile process chemicals. Therefore, they have wide applications in cosmetics, oil recovery, bioremediation, etc. Biosurfactants are also known as suitable alternatives to synthetic medicines and antimicrobial agents and may be used as safe and effective therapeutic agents [4,5]. Their medical use is beneficial owing to their structural diversity [6], low toxicity and biocompatibility [7]. The optimization of biosurfactant production is of prime importance considering their ecological acceptance, biodegradability and extensive applications. This would help to reduce the production cost so as to increase their economic competency in comparison to synthetic biosurfactants. Microorganisms (bacteria, fungi and molds) producing biosurfactants belong to various genera [8]. Oceanobacilli are also known for their potential to produce various enzymes, antibiotics and exopolysaccharides

V.V. Jadhav et al. / Desalination 318 (2013) 64–71

[9,10]. However, very few reports are available in literature on biosurfactants from Oceanobacilli, e.g. Oceanobacillus sp. (KBDL6) from Lonar soda lake [11], thermotolerant O. picturae from hot springs of Thailand [12] and Oceanobacillus sp. from Qinghai oilfield [13]. An article was published in 2010 [14] on screening of biosurfactant producing Antarctic bacteria. The isolates producing biosurfactants were found to be Rhodococcus spp. Psychrobacter, Micrococcus and Acinetobacter sp. Therefore, to the best of our knowledge, this is the first report on biosurfactant producing Oceanobacillus sp. isolated from Antarctic sea water. The published data indicate that the most commonly isolated biosurfactants are glycolipids and lipopeptides e.g. rhamnolipids produced by Pseudomonas aeruginosa [15], sophorolipids from Candida species [16], surfactin and iturin produced by Bacillus subtilis strains [17] etc. On the contrary, very few reports on biosurfactants of glycolipoprotein nature are available [18,19]. Our TLC and FTIR analysis revealed glycolipoprotein nature of biosurfactant produced by Oceanobacillus sp. BRI 10. The present study was also aimed at its production, optimization and stability studies. The potential of biosurfactant with respect to antimicrobial activity, cytotoxicity and oil degradation was also examined. 2. Materials and methods 2.1. Chemicals All the media components and chemicals were purchased from Hi-Media and Merck (Mumbai, India) and were of analytical grade (AG). 2.2. Screening for biosurfactant production Antarctic seawater samples were collected during the Antarctic summer of 2007–2008 from different locations (Table 1). Isolation of microorganisms was carried out as described previously [20]. All the isolates were screened for biosurfactant production by examining them for i) hemolytic activity [21], ii) oil displacement test [22], iii) microtitre plate assay [23] and iv) drop-collapse test [24]. 2.3. Identification of an isolate Identification of the bacterial isolate BRI 10 (an isolate showing positive results in all the screening tests) was performed by sequencing 16S rDNA. The genomic DNA was isolated as described previously [25]. The PCR assay was performed using Applied Biosystems, model 9800 (Foster, California, USA) with 50 ng of DNA extract in a total volume of 25 μl. The PCR master mixture contained 2.5 μl of 10× PCR reaction buffer (with 1.5 M MgCl2), 2.5 μl of 2 mM dNTPs, 1.25 μl of 10 pm μl−1 of each oligonucleotide primers 8F (5′ AGAGTTTGATCCTGGCTCAG 3′) and 1391R (5′ GACGGGCGGTGTGTRCA 3′) [26–29], 0.2 μl of 5 U μl−1 Taq DNA polymerase and 15.76 μl of glass-distilled PCR water. Initially denaturation accomplished at 94 °C for 3 min. Thirty-two cycles of amplification consisted of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for 1.30 min. A final extension phase at 72 °C for 10 min was performed. The PCR product was purified by PEG–NaCl method [28]. Briefly, the sample

65

was mixed with 0.6 times volume of PEG–NaCl, [20% PEG (MW 6000) and 2.5 M NaCl] and incubated for 20 min at 37 °C. The precipitate was collected by centrifugation at 3800 rev min −1 for 20 min. The pellet was washed with 70% ethanol, air dried and dissolved in 15 μl sterile distilled water. The sample was sequenced using a 96-well Applied Biosystems sequencing plate as per the manufacturer's instructions. The thermocycling for the sequencing reactions began with an initial denaturation at 94 °C for 2 min, followed by 25 cycles of PCR consisting of denaturation at 94 °C for 10 s, annealing at 50 °C for 10 s, and extension at 60 °C for 4 min using primers 704F (5′GTAGCGGTGAAATGCGTAGA3′) [26–29] and 907R (5′ CCGTCAATTCMTTTGAGTTT 3′) [26,27]. The samples were purified using standard protocols described by the manufacturer (Applied Biosystems, Foster City, USA). To this, 10 μl of Hi-Di formamide was added and vortexed briefly. The DNA was denatured by incubating at 95 °C for 3 min, kept on ice for 5–10 min and was sequenced in a 3730 DNA analyzer (Applied Biosystems, Foster City, USA) following the manufacturer's instructions. The sequences of bacterial 16S rRNA were analyzed using Sequence Scanner (Applied Biosystems) software. The 16S rRNA sequence contigs were generated using Chromas Pro and then analyzed using online databases viz. NCBI-BLAST to find the closest match of the contiguous sequence. Phylogenetic analysis was carried out using MEGA software package version 5.0 [30].

2.4. Media optimization BRI 10 was grown in Marine Salt Medium (MSM) at 30 °C for 24 h. This was used as an inoculum at the 5% (v/v) level for further experiments. BRI 10 was grown in basal salt medium (BSM) supplemented with various carbon and nitrogen sources for production of biosurfactant. [BSM, composition (g l −1): K2HPO4 (0.87), MgSO4·7H2O (0.6), NaCl (0.1), KCl (0.2), Tris (hydroxymethyl) aminomethane (6.5), yeast extract (0.05); mineral salt solution (1 ml). The mineral salt solution contained the following ingredients (g l −1): ZnSO4·7H2O (2.32), MnSO4·4H2O (1.78), CuSO4·5H2O (1.0), Na2MoO4·2H2O (0.39), CoCl2·6H2O (0.42), EDTA (1.0), KI (0.66)]. The pH of medium was adjusted to 7.0 ± 0.2. The isolate was cultivated for 48 h at 30 °C with shaking at 120 rpm. For optimization purpose, all the experiments were performed in 250 ml flasks containing 50 ml medium by varying one parameter at a time keeping other parameters constant. Initially the carbon source was optimized by supplementing the medium individually with glucose, hexadecane, olive oil and glycerol at the concentration of 2% (w/v). Further the nitrogen source was varied individually at the concentration equivalent to 0.12%. The concentrations of optimized carbon and nitrogen sources were varied individually to select the one yielding maximum biosurfactant. Following media optimization, effect of pH (5.0 to 9.0), temperatures (15 °C to 37 °C) and fermentation period (24 to 96 h) on biosurfactant production were examined. Biosurfactant production was measured by calculating an emulsification index (E24) as described below.

2.5. Measurement of emulsification activity (E24)

Table 1 Sea water samples used for isolation of Antarctic bacteria. Sample no.

Latitude

Longitude

pH

Temperature (°C)

13 15 16 20 32 L-5 L-7 24-A 27-3

S 59°40′24.6″ S 56°32′03.6″ S 55°25′19.1″ S 41°40′03.3″ S 70°45′30.9″ S 69°24′29.7″ S 69°24′34.1″ S 69°25′37.4″

E 68°33′23.7″ E 63°05′57.9″ E 60°02′17.5″ E 42°15′53.1″ E 11°40′52.0″ E 76°11′57.2″ E 76°11′38.0″ E 76°06′42.6″

7.8 7.5 7.7 7.5 7.3 8.5 7.8 8.9

−0.7 −0.7 3.9 13.5 6.2 −2.1 −1.8 −2.7

The emulsifying activity of biosurfactant was determined by an emulsification index (E24). It was evaluated by adding 2 ml of kerosene and 2 ml of the cell-free broth in test tube, vortexed at high speed for 2 min and allowed to stand for 24 h. The percentage of emulsification index was calculated by using the following equation [31].

E24 ¼

height of emulsion x 100 : total height of the mixture

66

V.V. Jadhav et al. / Desalination 318 (2013) 64–71

2.6. Stability studies In order to examine the effect of temperature on emulsification activity of biosurfactant, about 2 ml of the culture supernatant was heated at temperature ranging from (30–110 °C) for 15 min, cooled to room temperature and E24 was determined. The effect of pH was studied by varying the pH of cell free broth from 2.0 to 12.0 and measuring the emulsification activity. 2.7. Extraction of biosurfactant BRI 10 was cultivated under optimized conditions. The cell free broth was collected and acidified to pH 2.0 with HCl. The biosurfactant was extracted twice using equal volumes of chloroform:methanol (2:1) solution in a separatory funnel. The bottom layer was extracted and collected. The solvent was removed from the biosurfactant by rotary evaporation (Vacuum Rotary Evaporator: Kemi Science, Germany) at a temperature below 40 °C. The dried extract (biosurfactant) was used for further studies.

MTCC (Microbial Type Culture Collection), Chandigarh, India. An overnight culture (grown at 37 °C ± 1.0) of bacteria in Mueller–Hinton broth was standardized to an opacity equivalent to 0.5 on the McFarland scale (10 8 CFU ml−1). Briefly, the standardized suspensions of the microorganisms were mixed with 18 ml of Mueller–Hinton agar at 45 °C. Wells were made with sterile cork borer. The biosurfactant was used in the concentration range of 400–2000 μg to examine its antimicrobial activity. The plates were incubated at 37 °C for 24 h for bacterial cultures and at 28 °C for 36 h for fungi. At the end of the incubation time, the diameters of inhibition zones were measured in millimeters using a ruler. The experiments were carried out in triplicates. 2.10. Cell lines and culture conditions The African green monkey kidney (Vero) cell lines were procured from the National Cell Culture Collection (NCCS). The medium used was Dulbecco's modified Eagle's medium (DMEM; GIBCO, USA). All cells were supplemented with 10% fetal bovine serum, 100 U/ml of penicillin–streptomycin and incubated at 37 °C with 5% CO2.

2.8. Characterization of biosurfactant 2.8.1. Emulsification activity Biosurfactant (1.0 mg ml−1) was dissolved in phosphate buffered saline (PBS) buffer (pH 7.0). Hydrocarbons like lubricant oil, crude oil, diesel and kerosene were tested for emulsification activity. Two milligram per ml of the hydrocarbons were added individually to this solution, shaken well for 20 min and the mixture was allowed to stand for 20 min. The optical density (OD) of the emulsified mixture was measured at 610 nm and the results were expressed as D610 [32]. Similar experiments were carried out with sodium dodecyl sulfate (SDS) as a control keeping all other conditions constant. 2.8.2. Thin layer chromatography The components of biosurfactant were separated on silica gel (Si 60F254, 0.25 mm, Merck). The following solvent systems were used: ethyl acetate:isopropanol:water:pyridine (26:14:7:2 v/v/v/v) for carbohydrates chloroform:methanol: 0.25% KCl (5:4:1 v/v/v) for lipids butanol:acetic acid:water (4: 1: 5 v/v/v) for amino acids. Spots were detected by spraying with orcinol in H2SO4, Na2CO3 in potassium permanganate and ninhydrin in ethanol for detection of carbohydrates, lipids and amino acids respectively. 2.8.3. Fourier transform infrared spectroscopy Fourier transform infrared spectroscopy (FTIR) is most useful for identifying the types of chemical bonds (functional groups), present in an unknown mixture. Therefore, 1 mg of biosurfactant was ground with 100 mg of potassium bromide and pressed with 7500 kg for 30 s to obtain translucent pellets. Infrared absorption spectra were recorded on a Shimadzu FTIR system 8400 spectrometer, in the 4000–400 cm−1 spectral region with a spectral resolution and wave number accuracy of 4 and 0.01 cm−1, respectively. All measurements consisted of 500 scans, and a potassium bromide pellet was used as background reference. 2.9. Antimicrobial activity Eight test microorganisms were used in this study. Out of eight, seven were procured from NCIM (National Collection of Industrial Microorganisms), NCL, Pune, India. They were Escherichia coli (NCIM 2065), B. subtilis (NCIM 2920), Staphylococcus aureus (NCIM 2079), P. aeruginosa (NCIM 2200), Proteus vulgaris (NCIM 2813), Streptococcus faecalis (NCIM 5025) and Candida albicans (NCIM 3471). One test microorganism viz. Streptococcus mutans (MTCC 890) was obtained from

2.10.1. Cytotoxicity assay Aliquots (200 μl) containing 2.0 × 10 4 cells/well of cell line suspensions of Vero were seeded into the wells of 96-well plates. After 24 h of incubation, 20 μl of biosurfactant was added to the final concentrations of 20 to 4000 μg/ml and incubated for further 48 h. The cytotoxicity test was conducted by MTT [3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide] assay [33], which detected the formazan dye at 595 nm using a microplate spectrophotometer (Biorad Model 680). Each treatment of biosurfactant was assayed in triplicate. Untreated cells were used as blank. 2.11. Crude oil biodegradation Crude oil biodegradation experiments were carried out in 250 ml Erlenmeyer flasks containing 50 ml of BSM and 1% crude oil. Sterilized BSM was inoculated with 2 ml of 10 8 CFU/ml of BRI 10. The flasks were incubated at 30 °C on a rotary shaker. The experiments were conducted in three different sets as follows: Set 1, BSM + crude oil + bacterial cells Set 2, BSM + crude oil + bacterial cells + biosurfactant (25 mg) Set 3, BSM + crude oil (control). The samples were drawn on 9th and 27th day for estimation of crude oil degradation by gravimetric analysis. The residual crude oil was extracted in a preweighed beaker with hexane in a separating funnel. Extraction was repeated twice to ensure complete extraction. After extraction, hexane was evaporated in a hot air oven at 68–70 °C, the beaker was cooled down and weighed. Cell-free control was incubated under similar conditions. The % degradation was calculated as follows [34]:

% degradation ¼ amount of crude oil degraded =amount of crude oil added in the media  100:

2.12. Statistical analysis The analyses were performed in triplicates. The mean values and standard deviation (mean ± SD) were calculated and tested. Statistical analysis of variance (ANOVA) was performed on all values and tested for p b 0.05 for significance.

V.V. Jadhav et al. / Desalination 318 (2013) 64–71

3. Results and discussion 3.1. Organism Fourteen different isolates were obtained from eight different samples of Antarctic sea water (Table 1). All of them were (1) Gram-negative rods, (2) showed neutral pH optimum for growth, (3) tolerated salt concentration up to 15% and (4) grew well at 15 °C and tolerated lower temperatures up to 4 °C. None of them could grow at 45 °C, indicating that they were psychrotrophs. Also, growth up to 15% salt concentration confirmed their halotolerant character. All the isolates were grown and maintained on MSM [20]. The isolates were screened for biosurfactant production using three different tests. Only the isolate BRI 10 showed zone of β-hemolysis (Fig. 1). The oil displacement test was carried out with paraffin oil and maximum displacement of 7.06 cm2 was observed for BRI 10. For remaining isolates it was in the range of 0.79–5.72 cm2 (Table 2). The oil displacement test is an indirect measurement of surface activity of a surfactant sample tested against oil; a larger diameter represents a higher surface activity of the testing solution [35]. Researchers have reported area of displacement in the range of 1–3 cm2 with various hydrocarbons [36]. In comparison to this, our results were found to be promising. In microtitre plate assay, four isolates (including BRI 10) out of 14 showed maximum optical distortion in the grid (Table 2). Drop collapse test was positive for all the cultures. Based on the results of screening tests, BRI 10 was used for further studies. 3.2. Identification of strain The isolate BRI 10 was identified using 16S rRNA sequencing. The sequence (1239 bp) was deposited in EMBL + GenBank under the accession number JQ269650. The analysis clearly demonstrated that BRI 10 belonged to Bacilli and is a member of the genus Oceanobacillus. It exhibited maximum similarity with the 16S rRNA sequence of Oceanobacillus iheyensis HTE831 (NR 028001) (98% sequence similarity) (Fig. 2). Phylogenetic analysis of BRI 10 is shown in Fig. 2. It shows the closest matches to BRI 10 associated bacterial sequences from BLAST analysis. 3.3. Media optimization Four different carbon sources were examined for their effectiveness on biosurfactant production (Fig. 3A). Among them, glucose was the best carbon source with the emulsification activity of 35%. Studies by various researchers have also shown that addition of glucose in the medium increased the biosurfactant production [37–41]. Among the five nitrogen sources tested, ammonium chloride was found to the most

Fig. 1. Zone of β-hemolysis by BRI 10.

67

Table 2 Oil displacement activity and microtitre plate assay of culture supernatant from BRI isolates. Isolates

Oil displacement test (area in cm2)

Microtitre plate assay

BRI BRI BRI BRI BRI BRI BRI BRI BRI BRI BRI BRI BRI BRI

5.72 − − − 7.06 0.79 3.14 0.79 − 1.54 1.77 − 1.77 −

+ + + ++ ++ + + ++ ++ + + + + +

2 6 7 8 10 11 12 13 16 17 25 28 29 31

± 0.04

± ± ± ±

0.02 0.04 0.04 0.03

± 0.03 ± 0.03 ± 0.04

+ = moderate concave surface. ++ = concave surface. − = negative test. The mean values and standard deviation (mean ± SD) were calculated and tested for p b 0.05.

suitable nitrogen source for biosurfactant production (Fig. 3B). Aparna et al. (2012) and Turkovskaya et al. (2001) have also reported glucose and ammonium chloride as the most suitable carbon and nitrogen sources respectively for maximum biosurfactant production from bacterial sources [37,40]. Further we examined the effect of concentrations of glucose on emulsification activity by using different glucose concentrations (1–5%) in the fermentation media at 0.12% of ammonium chloride. Biosurfactant production initially increased with increasing carbon concentration (Fig. 3C), and maximum activity of 50% was recorded at 3% glucose concentration. Maximum biosurfactant production with glucose concentration in the range of 1–6% has been reported earlier by various researchers [37–39,41]. Following this, ammonium chloride (0.12–0.6%) was added to the fermentation media containing 3% glucose. Maximum emulsification activity of 52% was obtained at 0.48% concentration of ammonium chloride (Fig. 3D). Later, effects of pH, temperature and incubation time were evaluated. As depicted in Fig. 4A, maximum emulsification activity of 54% was obtained at pH 8.0. However, very low emulsification activity was obtained at pH 5.0 and 9.0. Similar results with pH 8.0 as optimum were observed by Ilori et al. (2005) in case of biosurfactant production from Aeromonas spp [42] and by Thavasi et al. (2008) in case of Bacillus megaterium [43]. The effect of temperature on biosurfactant production is illustrated in Fig. 4B. The production increased when the temperature was increased up to 30 °C and then decreased sharply above 30 °C. Plethora of papers on biosurfactants from marine microorganisms report 30 °C as optimum temperature for biosurfactant production [44,45]. BRI 10 was cultivated in optimized media at pH 8.0 and 30 °C for different time intervals to evaluate the effect of incubation period

Fig. 2. Phylogenetic analysis based on of 16S rRNA sequences of isolate BRI 10 and related Oceanobacillus species. GenBank accession numbers are listed with species names.

68

V.V. Jadhav et al. / Desalination 318 (2013) 64–71

Fig. 3. [A] Effect of carbon source on biosurfactant production, [B] effect of nitrogen source on biosurfactant production, [C] effect of carbon concentration on biosurfactant production and [D] effect of nitrogen concentration on biosurfactant production.

(Fig. 4C). Maximum biosurfactant production (55%) was obtained at the end of 48 h. Further increase in incubation period resulted in decrease in biosurfactant production which may be due to exhaustion of nutrients and metabolic changes in the medium. 55% emulsification activity was considered as 100% activity for stability studies.

3.4. Stability studies The stability of biosurfactant was tested over a wide range of temperatures (Fig. 5A). 100% activity was observed up to 70 °C, while almost 69% activity was retained at 110 °C. Thus, it maintains its surface properties in the range of temperatures between 30 and 110 °C. This is a significant characteristic indicating its usefulness in food, pharmaceutical and cosmetic industries where heating to achieve sterility is of prime importance [46]. Fig. 5B shows the effect of pH on the biosurfactant stability. 100% stability was obtained at pH 8.0 and 55% activity was observed at pH 10.0. This may be due to a better stability of fatty acids–surfactant micelles in the presence of NaOH and the precipitation of secondary metabolites at higher pH values. The alkaline pH for biosurfactant production and stability suggests its potential applicability in detergent industry. The effect of pH and temperature on emulsification activity of biosurfactants has been reported from different microorganisms [36,46].

3.5. Characterization of biosurfactant BRI 10 was cultivated in BSM and biosurfactant was extracted. The solid yield was 1.0 g l−1. Lower yields of biosurfactants in the range of 0.3–0.6 g l−1 have been reported earlier [47,48]. Biosurfactant from BRI 10 showed emulsification activity with different hydrocarbons in the order of kerosene > lubricant oil > diesel > crude oil (Table 3). D610 of biosurfactant and SDS with kerosene were 0.64 and 0.31 respectively. We observed almost two fold emulsification activity with biosurfactant against different hydrocarbons as compared to that of control. Thus, our results demonstrate the possibility of substituting chemical surfactants by biosurfactant from BRI 10 for bioremediation of oil polluted areas. Results of TLC experiments revealed that the biosurfactant is a mixture of carbohydrate, lipid and amino acids. The FTIR analysis of the biosurfactant (Fig. 6) exhibited strong and broad band covered a wide range of 2800–3500 cm−1 (for the OH stretch). In the middle of the spectrum, a prominent and stake shaped band was located near 1700 cm−1 (for the C_O ester bond). C\H stretching bands of CH2 and CH3 groups were observed in the region 2850–2960 cm−1. CH2 and CH3 bends were confirmed at (~1465 and 1375 cm−1). Wave numbers 3356 and 3373 cm−1 inferred the presence of N\H/C\H bonds of protein. This was confirmed with wave number 1552 cm−1 indicating NH bend in protein. This data confirmed the glycolipoprotein nature of the biosurfactant. Such type of biosurfactant has been found from marine endosymbiotic fungi Aspergillus ustus (MSF3) [19] while glycolipopeptide biosurfactants have been identified from Corynebacterium species [18,49].

V.V. Jadhav et al. / Desalination 318 (2013) 64–71

69

Fig. 5. [A] Effect of temperature on biosurfactant stability and [B] effect of pH on biosurfactant stability.

however, at lower concentrations up to 500 μg/ml [53,54]. This nontoxic effect of biosurfactant from BRI 10 suggests that it can be safe for use in pharmaceutical and cosmetic industry.

3.8. Crude oil biodegradation

Fig. 4. [A] Effect of pH on biosurfactant production, [B] Effect of temperature on biosurfactant production and [C] Effect of incubation period on biosurfactant production.

3.6. Antimicrobial activity The biosurfactant from BRI 10 was used to examine its antimicrobial activity against eight different test microorganisms. The strong activity was observed only against E. coli (18–20 mm zone diameter). The antimicrobial activity increased with increasing concentration of biosurfactant (Fig. 7). According to earlier research, Gram-positive bacteria are more sensitive to biosurfactants than Gram negative bacteria [50]. However, we have observed inhibition of Gram negative bacterium (E. coli). Interestingly, we came across only one report on glycolipoprotein type of biosurfactant possessing antimicrobial activity [19]. Other papers with data in support of our observations (inhibition of Gram negative bacteria) are published on lipopeptide and glycolipid biosurfactants [51,52]. 3.7. Cytotoxicity assay The biosurfactant from BRI 10 did not exhibit cytotoxicity against Vero cells at very high concentrations up to 4000 μg/ml (data not shown). Similar results have been reported by earlier researchers,

Three different sets were used to study crude oil biodegradation. The results were recorded on 9th and 27th day for each set. The percent degradation was 22 and 63 in the first set of experiment (BSM + crude oil + bacterial cells). On the other hand, it was around 56% and 90% in the second set of experiment (BSM + crude oil + bacterial cells + biosurfactant (25 mg)). Degradation was not observed in the control (third) set of experiment (BSM + crude oil). Similar results of crude oil degradation in the range of 40% to 76% have been reported in the literature using bacterial cells [55,56]. Percent biodegradation increased significantly with addition of biosurfactant as observed in second set of experiment. Our findings are analogous to the previous reports [55,57] indicating that biosurfactant acts as an efficient enhancer for hydrocarbon biodegradation. It may be due to i) increase in the surface area of hydrophobic water-insoluble substrates and ii) increase in the bioavailability of hydrophobic compounds [58,59]. Table 3 Emulsification of hydrocarbons by biosurfactant isolated from BRI 10 and its comparison with control (SDS). Emulsification activity (D610)

Kerosene Diesel Crude oil Lubricant oil

Biosurfactant

SDS

0.64 0.57 0.43 0.60

0.31 0.25 0.19 0.21

± ± ± ±

0.03 0.01 0.02 0.02

± ± ± ±

0.02 0.01 0.02 0.02

The mean values and standard deviation (mean ± SD) were calculated and tested for p b 0.05.

70

V.V. Jadhav et al. / Desalination 318 (2013) 64–71

Fig. 6. Fourier transform infrared spectrum of the biosurfactant produced by Oceanobacillus sp. BRI 10.

Thus, it can be concluded that biosurfactant from BRI 10 has considerable potential for bioremediation of oil polluted areas. 4. Conclusion The biosurfactant producing Oceanobacillus sp. BRI 10 was isolated from Antarctic sea water and identified. Biosurfactant may be produced from this organism using non-hydrocarbon substrates such as glucose and ammonium chloride which are easily available and would not require extensive purification. The functional characterization of extracted biosurfactant revealed its glycolipoprotein nature which is very rarely documented earlier. The highlights of present work such as i) remarkable stability at high temperature and pH, ii) antimicrobial activity and iii) non-cytotoxicity on normal cell line indicated its potential for application in food, pharmaceutical and cosmetic industry. Its applicability for bioremediation purpose was evident from its activity to degrade crude oil as well as to emulsify other hydrocarbons.

Fig. 7. Antimicrobial activity of biosurfactant from BRI 10 against E. coli. A. 400 μg. B. 800 μg. C. 1200 μg. D. 1600 μg. E. 2000 μg.

Acknowledgments This work is supported by the Department of Biotechnology, New Delhi, Govt. of India. We are thankful to Director, National Centre for Antarctic and Ocean Research, Goa. Shri Bhupesh Sharma and Shri Narendra Pal of Shriram Institute of Industrial Research are acknowledged for their help in collecting sea water samples during the expedition.

References [1] J.D. Desai, I.M. Banat, Microbial production of surfactants and their commercial potential, Microbiol. Mol. Biol. Rev. 61 (1997) 47–64. [2] N.G.K. Karanth, P.G. Deo, N.K. Veenanadig, Microbial production of biosurfactant and their importance, Curr. Sci. India 77 (1999) 116–126. [3] M. Nitschke, G.M. Pastore, Biossurfactantes: propriedades e aplicações, Quim. Nova 25 (2002) 772–776. [4] R.M. Maier, Biosurfactants: evolution and diversity, Adv. Appl. Microbiol. 52 (2003) 101–121. [5] A. Singh, J.D. Van Hamme, O.P. Ward, Surfactants in microbiology and biotechnology: Part 2. Application aspects, Biotechnol. Adv. 25 (2007) 99–121. [6] N.D. Camilios, J.A. Meira, J.M. De Araújo, D.A. Mitchell, N. Krieger, Optimization of the production of rhamnolipids by Pseudomonas aeruginosa UFPEDA 614 in solid-state culture, Appl. Microbiol. Biotechnol. 81 (2008) 441–448. [7] O. Pornsunthorntawee, S. Maksung, O. Huayyai, R. Rujiravanit, S. Chavadej, Biosurfactant production by Pseudomonas aeruginosa SP4 using sequencing batch reactors: effects of oil loading rate and cycle time, Bioresour. Technol. 100 (2009) 812–818. [8] S.K. Satpute, I.M. Banat, P.K. Dhakephalkar, A.G. Banpurkar, B.A. Chopade, Biosurfactants, bioemulsifiers and exopolysaccharides from marine microorganisms, Biotechnol. Adv. 28 (2010) 436–450. [9] R. Margesin, F. Schinner, Potential of halotolerant and halophilic microorganisms for biotechnology, Extremophiles 5 (2001) 73–83. [10] J. Lu, Y. Nogi, H. Takami, Oceanobacillus iheyensis gen. nov., sp. nov., a deep sea extremely halotolerant and alkaliphilic species isolated from a depth of 1050 m on the Iheya Ridge, FEMS Microbiol. Lett. 205 (2001) 291–297. [11] K.B. Deshmukh, A.P. Pathak, M.S. Karuppayil, Bacterial diversity of Lonar soda lake of India, Indian J. Microbiol. 51 (2011) 107–111. [12] A. Pakpitcharoen, K. Potivejkul, P. Kanjanavas, S. Areekit, K. Chansiri, Biodiversity of thermotolerant Bacillus sp. producing biosurfactants, biocatalysts, and antimicrobial agents, ScienceAsia 34 (2008) 424–431. [13] J. Wang, L. Yu, L.-X. Huang, Study on enhancing oil recovery by indigenous microorganisms in a hypersalinity reservoir, Pet. Sci. Technol. 29 (2011) 1504–1511. [14] R. Malavenda, C. Rizzo, A. Lo Giudice, L. Michaud, M. De Domenico, V. Bruni, Screening for biosurfactant production by Antarctic Marine bacteria, Conference Proceeding, Proceeding of: 41° Congresso della Società Italiana di Biologia Marina, 2010.

V.V. Jadhav et al. / Desalination 318 (2013) 64–71 [15] M. Nitschke, S.G. Costa, J. Contiero, Rhamnolipid surfactants: an update on the general aspects of these remarkable biomolecules, Biotechnol. Prog. 21 (2005) 1593–1600. [16] A. Daverey, K. Pakshirajan, Production, characterization and properties of sophorolipids from the yeast Candida bombicola using a low-cost fermentative medium, Appl. Biochem. Biotechnol. 158 (2009) 663–674. [17] F. Ahimou, P. Jacques, M. Deleu, Surfactin and iturin A effects on Bacillus subtilis surface hydrophobicity, Enzyme Microb. Technol. 27 (2000) 749–754. [18] R. Thavasi, S. Jayalakshmi, T. Balasubramanian, I.M. Banat, Biosurfactant production by Corynebacterium kutscheri from waste motor lubricant oil and peanut oil cake, Lett. Appl. Microbiol. 45 (2007) 686–691. [19] G.S. Kiran, T.A. Hema, R. Gandhimathi, J. Selvin, T.A. Thomas, T. Rajeetha Ravji, K. Natarajaseenivasan, Optimization and production of a biosurfactant from the sponge-associated marine fungus Aspergillus ustus MSF3, Colloids Surf. B 73 (2009) 250–256. [20] V.V. Jadhav, M.M. Jamle, P.D. Pawar, M.N. Devare, R.K. Bhadekar, Fatty acid profiles of PUFA producing Antarctic bacteria: correlation with RAPD analysis, Ann. Microbiol. 60 (2010) 693–699. [21] P.G. Carrillo, C. Mardaraz, S.I. Pitta-Alvarez, A.M. Giulietti, Isolation and selection biosurfactant-producing bacteria, World J. Microbiol. Biotechnol. 12 (1996) 82–84. [22] M. Morikawa, H. Daido, T. Takao, S. Murata, Y. Shimonishi, T. Imanaka, A new lipopeptide biosurfactant produced by Arthrobacter sp. strain MIS 38, J. Bacteriol. 175 (1993) 6459–6466. [23] D. Vaux, M. Cottingham, Method and apparatus for measuring surface configuration, Patent No. WO 2007/039729 A1, 2001. [24] N.H. Youssef, K.E. Dunacn, D.P. Nagle, K.N. Savage, R.M. Knapp, M.J. McInerney, Comparison of methods to detect biosurfactant production by diverse microorganism, J. Microbiol. Methods 56 (2004) 339–347. [25] F.M. Ausubel, R. Brent, R.E. Kingston, D.D. More, J.G. Seidman, J.A. Smith, K. Struhl, Current Protocols in Molecular Biology, Supplement 27, J. Wiley and Sons, New York, 1987, p. 2.4.1. [26] R. Amann, J. Stromley, R. Devereux, R. Key, D.A. Stahl, Molecular and microscopic identification of sulfate-reducing bacteria in multispecies biofilms, Appl. Environ. Microbiol. 58 (1992) 614–623. [27] E. Ben-Dov, O.H. Shapiro, N. Siboni, A. Kushmaro, Advantage of using inosine at the 3′ termini of 16S rRNA gene universal primers for the study of microbial diversity, Appl. Environ. Microbiol. 72 (2006) 6902–6906. [28] L. Hauben, L. Vauterin, J. Swings, E.R.B. Moore, Comparison of 16S ribosomal DNA sequences of all Xanthomonas species, Int. J. Syst. Bacteriol. 47 (1997) 328–335. [29] V.J. Pidiyar, A. Kaznowski, N. Badri Narayan, M.S. Patole, Y.S. Shouche, Aeromonas culicicola sp. nov., from the midgut of Culex quinquefasciatus, Int. J. Syst. Evol. Microbiol. 52 (2002) 1723–1728. [30] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance and maximum parsimony methods, Mol. Biol. Evol. 28 (2011) 731–732. [31] D.G. Cooper, B.G. Goldenberg, Surface-active agents from two Bacillus species, Appl. Environ. Microbiol. 53 (1987) 224–229. [32] E. Rosenberg, A. Zuckerberg, C. Rubinovitz, D.L. Gutnick, Emulsifier of Arthrobacter RAG-I: isolation and emulsifying properties, Appl. Environ. Microbiol. 37 (1979) 402–408. [33] S. Flis, A. Gnyszka, I. Misiewicz-Krzemińska, J. Splawiński, Decytabine enhances cytotoxicity induced by oxaliplatin and 5-fluorouracil in the colorectal cancer cell line Colo-205, Cancer Cell Int. 27 (2009) 1–10. [34] J.K. Oloke, B.R. Glick, Production of bioemulsifier by an unusual isolate of salmon/red melanin containing Rhodotorula glutinis, Afr. J. Biotechnol. 4 (2005) 164–171. [35] L.R. Rodrigues, J.A. Teixeira, H.C. Van der Mei, R. Oliveira, Physiochemical and functional characterization of a biosurfactant produced by Lactococcus lactis 53, Colloids Surf. B 49 (2006) 79–86. [36] S. Maneerat, K. Phetrong, Isolation of biosurfactant-producing marine bacteria and characteristics of selected biosurfactant, Songklanakarin J. Sci. Technol. 29 (2007) 781–791. [37] A. Aparna, G. Srinikethan, S. Hegde, Isolation, screening and production of biosurfactant by Bacillus clausii 5B, Res. Biotechnol. 3 (2012) 49–56. [38] D. Ghribi, S. Ellouze-Chaabouni, Enhancement of Bacillus subtilis lipopeptide biosurfactants production through optimization of medium composition and adequate control of aeration, Biotechnol. Res. Int. 2011 (2011) 1–6.

71

[39] I. Mnif, S. Chaabouni-Ellouze, D. Ghribi, Optimization of the nutritional parameters for enhanced production of B. subtilis SPB1 biosurfactant in submerged culture using response surface methodology, Biotechnol. Res. Int. 2012 (2012) 1–8. [40] O.V. Turkovskaya, T.V. Dmitrieva, A.Yu. Muratova, A biosurfactant-producing Pseudomonas aeruginosa strain, Appl. Biochem. Microbiol. 37 (2001) 71–75. [41] X. Wen-Jie, L. Zhi-bin, D. Han-Ping, L. Yu, C. Qing-Feng Cui, B. Yong-Qiang, Synthesis, characterization, and oil recovery application of biosurfactant produced by indigenous Pseudomonas aeruginosa WJ-1 using waste vegetable oils, Appl. Biochem. Biotechnol. 166 (2012) 1148–1166. [42] M.O. Ilori, C.J. Amobi, A.C. Odocha, Factors affecting biosurfactant production by oil degrading Aeromonas spp. isolated from a tropical environment, Chemosphere 61 (2005) 985–992. [43] R. Thavasi, S. Jayalakshmi, T. Balasubramanian, I.M. Banat, Production and characterization of a glycolipid biosurfactant from Bacillus megaterium using economically cheaper sources, World J. Microbiol. Biotechnol. 24 (2008) 917–925. [44] A. Khopade, R. Biao, X. Liu, K. Mahadik, L. Zhang, C. Kokare, Production and characterization of biosurfactant from marine Streptomyces species B3, J. Colloid Interface Sci. 367 (2012) 311–318. [45] A. Khopade, R. Biao, X. Liu, K. Mahadik, L. Zhang, C. Kokare, Production and stability studies of the biosurfactant isolated from marine Nocardiopsis sp. B4, Desalination 285 (2012) 198–204. [46] M. Abouseoud, R. Maachi, A. Amrane, S. Boudergua, A. Nabi, Evaluation of different carbon and nitrogen sources in production of biosurfactant by Pseudomonas fluorescens, Desalination 223 (2008) 143–151. [47] K.B. Cheng, Z. Jian, Z. Wang, Emulsification properties of bacterial biosurfactants native to the Yellow River Delta on hexadecane and diesel oil, Biotechnology 7 (2008) 360–370. [48] P. Suwansukho, V. Rukachisirikul, F. Kawai, A. H-Kittikun, Production and applications of biosurfactant from Bacillus subtilis MUV4, Songklanakarin J. Sci. Technol. 30 (2008) 87–93. [49] J. Akit, D.J. Cooper, K.I. Mannien, J.K. Zajic, Investigation of potential biosurfactant production among phytopathogenic Corynebacteria and related soil microbes, Curr. Microbiol. 6 (1981) 145–150. [50] G.J. Elving, H.C. Van Der Mei, H.J. Busscher, E.C. Amerogen, R. Van Weissenbruch, F.W. Albers, Antimicrobial activity of synthetic salivary peptides against voice prosthetic microorganisms, Laryngoscope 110 (2000) 321–324. [51] X. Cao, Z. Liao, C. Wang, W. Yang, M. Lu, Evaluation of a lipopeptide biosurfactant from Bacillus natto TK-1 as a potential source of anti- adhesive, antimicrobial and antitumour activities, Braz. J. Microbiol. 40 (2009) 373–379. [52] J. Arutchelvi, M. Doble, Characterization of glycolipid biosurfactant from Pseudomonas aeruginosa CPCL isolated from petroleum-contaminated soil, Lett. Appl. Microbiol. 51 (2010) 75–82. [53] B. Thanomsub, W. Pumeechockchai, A. Limtrakul, P. Arunrattiyakorn, W. Petchleelaha, T. Nitoda, H. Kanzaki, Chemical structures and biological activities of rhamnolipids produced by Pseudomonas aeruginosa B189 isolated from milk factory waste, Bioresour. Technol. 98 (2007) 1149–1153. [54] S. Phonnok, W. Uthaisang Tanechpongtamb, B. Thanomsub Wongsatayanon, Anticancer and apoptosis-inducing activities of microbial metabolites, Electron. J. Biotechnol. 13 (2010) 1–12. [55] P. Darvishi, S. Ayatollahi, D. Mowlaa, A. Niazi, Biosurfactant production under extreme environmental conditions by an efficient microbial consortium, ERCPPI-2, Colloids Surf. B 84 (2011) 292–300. [56] M. Sathishkumar, A.R. Binupriya, S. Baik, S. Yun, Biodegradation of crude oil by individual bacterial strains and a mixed bacterial consortium isolated from hydrocarbon contaminated areas, Clean 36 (2008) 92–96. [57] R. Thavasi, S. Jayalakshmi, I. Banat, Application of biosurfactant produced from peanut oil cake by Lactobacillus delbrueckii in biodegradation of crude oil, Bioresour. Technol. 102 (2011) 3366–3372. [58] A. Perfumo, I. Rancich, I.M. Banat, Possibilities and challenges for biosurfactants use in petroleum industry, in: R. Sen (Ed.), Biosurfactants: Advances in Experimental Medicine and Biology, vol. 672, Springer, Berlin, 2010, pp. 135–157. [59] A. Perfumo, T.J.P. Smyth, R. Marchant, I.M. Banat, Production and roles of biosurfactants and bioemulsifiers in accessing hydrophobic substrates, in: K.N. Timmis (Ed.), Handbook of Hydrocarbon and Lipid Microbiology, Springer-Verlag, Berlin, Heidelberg, 2010, pp. 1501–1512.