- Email: [email protected]
Study on biocontrol of postharvest decay of table grapes caused by Penicillium rubens and the possible resistance mechanisms by Yarrowia lipolytica
Accepted Manuscript Study on biocontrol of postharvest decay of table grapes caused by Penicillium rubens and the possible resistance mechanisms by Yarrowia lipolytica Meiyan Wang, Lina Zhao, Xiaoyun Zhang, Solairaj Dhanasekaran, Mandour H. Abdelhai, Qiya Yang, Zhenhui Jiang, Hongyin Zhang PII: DOI: Reference:
S1049-9644(18)30616-9 https://doi.org/10.1016/j.biocontrol.2018.11.004 YBCON 3884
To appear in:
Biological Control
Received Date: Revised Date: Accepted Date:
29 August 2018 24 October 2018 11 November 2018
Please cite this article as: Wang, M., Zhao, L., Zhang, X., Dhanasekaran, S., Abdelhai, M.H., Yang, Q., Jiang, Z., Zhang, H., Study on biocontrol of postharvest decay of table grapes caused by Penicillium rubens and the possible resistance mechanisms by Yarrowia lipolytica, Biological Control (2018), doi: https://doi.org/10.1016/j.biocontrol. 2018.11.004
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Study on biocontrol of postharvest decay of table grapes caused by Penicillium rubens and the possible resistance mechanisms by Yarrowia lipolytica
Meiyan Wang1, Lina Zhao1, Xiaoyun Zhang1, Solairaj Dhanasekaran1, Mandour H. Abdelhai1, Qiya Yang1, Zhenhui Jiang1, Hongyin Zhang1*
1
School of Food and Biological Engineering, Jiangsu University, Zhenjiang 212013,
Jiangsu, People’s Republic of China
*Corresponding author: Hongyin Zhang Email address: [email protected] Tel.: +86-511-88790211; Fax: +86-511-88780201
1
Abstract Table grapes are one of the most common fruits throughout the world. Decay of grapes caused by pathogenic fungal infections results in tremendous economic losses. The aim of this study was to evaluate the effect of Yarrowia lipolytica on the control of postharvest decay of grapes caused by Penicillium rubens and the possible mechanisms involved. The results showed that Y. lipolytica provided significant inhibition of the postharvest decay of grapes by P. rubens compared with the control. When the concentration of Y. lipolytica was 1 × 109 cells/mL, decay incidence and decay diameter of grapes were 12.45% and 6.19 mm, respectively. Y. lipolytica reduced spore germination and germ tube length of P. rubens. Moreover, the results also showed that the activities of defense-related enzymes, including polyphenoloxidase (PPO), peroxidase (POD), catalase (CAT), phenylalanine ammonialyase (PAL), ascorbate peroxidase (APX) and β-1,3 glucanase (GLU),were significantly enhanced in grapes treated with Y. lipolytica. Similarly, the expression levels of these genes were also increased in grape fruits treated with Y. lipolytica. The results suggested that the possible resistance mechanism of Y. lipolytica was to enhance the defense-related enzymes and genes, ultimately reduce postharvest decay caused by P. rubens in grapes. Altogether, the research work confirmed that Y. lipolytica has potential biocontrol efficacy and could be used as a biocontrol agent to prevent the postharvest decay of grape fruits. Keywords: Table grapes; Yarrowia lipolytica; Penicillium rubens; Biocontrol; Enzyme activity; Gene expression 2
1. Introduction Table grapes (Vitis vinifera L.) are one of the most important fruits worldwide. However, table grapes are vulnerable to pathogen infections during the postharvest storage, which results in rapid deterioration of fruits (HashemAbeer et al., 2013). Pathogenic fungi such as Botrytis cinerea, Penicillium spp. and Aspergillus spp. are causing potential postharvest losses in table grapes (Romanazzi et al., 2012). It is reviewed that Aspergillus and Penicillium species can produce ochratoxin A (OTA), which is a mycotoxin classified as carcinogenic and causes harm to human health, especially the nephridium and hepatic (Lasram et al., 2012). Therefore, control of fungal infections in grapes is essential. The control of pathogen infections during postharvest practices are primarily based on synthetic chemical fungicides (Duarte-Sierra et al., 2016). However, the use of synthetic chemicals is becoming increasingly limited due to growing public pressure resulting from their toxicological risks to human health and environmental pollution, as well as the increasing development fungicide-resistant pathogenic strains (Mcgrath and Thind, 2012). Therefore, researchers are looking for alternative method to control postharvest diseases of fruits. Biological control, using antagonist microorganisms (BCAs-biological control agents) such as yeast and bacteria, has become a promising alternative method to control postharvest diseases of fruits and vegetables. Among these antagonists, yeasts do not produce toxic secondary metabolites (Yao and Tian, 2005). Therefore, yeasts have great potential as a biocontrol agent for postharvest decay of fruits. It was 3
reported that antagonistic yeasts, such as Metschnikowia fructicola (Karabulut et al., 2007), Candida oleophila (Droby et al., 2002a), Aureobasidium pullulans (Mari et al., 2012) and Sporidiobolus pararoseus (Li et al., 2017), have showed great potential in controlling the postharvest decay of fruits. In grape fruits, Debaryomyces hansenii has reported to control green mold caused by Penicillium digitatum (Droby et al., 1989). Antagonistic yeast Saccharomyces cerevisiae could control gray mold caused by B. cinerea in table grapes (Nallya et al., 2012). Although several antagonistic yeasts were reported to have significant effect on postharvest decay of grapes, the effectiveness of biocontrol also needs to be further improved. Y. lipolytica was isolated from the surface of grapes leaves picked in unsprayed orchards by our laboratory. Previous study from our research group indicated that Y. lipolytica could significantly inhibited P. expansum and B. cinerea decay of apples (Zhang et al., 2017). However, there is little information about biocontrol of postharvest diseases of grape by Y. lipolytica. Moreover, P. rubens was also isolated from grapes by our laboratory, and the strain can produce OTA (Zhang et al., 2016b). Therefore, in this study, the effect of Y. lipolytica on the biocontrol of postharvest decay of grapes caused by P. rubens and the possible resistance mechanisms involved were investigated. It has been reported that antagonistic yeasts can induce defense-related enzymes and increase the defense-related enzyme activity which enhances the disease resistance in fruits (Lu et al., 2013). Defense-related enzyme activity, such as peroxidase (POD), catalase (CAT) and phenylalanine ammonialyase (PAL) in peaches has been reported (Xu et al., 2013a). However, there are few reports about the effect of Y. lipolytica on the expression levels of 4
defense-related genes, especially in grapes. Therefore, the aims of this study were to investigate: (1) the biocontrol efficacy of Y. lipolytica in controlling postharvest decay caused by P. rubens in grapes and the effect of Y. lipolytica on OTA content produced by P. rubens in grapes; (2) the effectiveness of Y. lipolytica against pathogens in vitro; (3) the effect of Y. lipolytica on defense-related enzymes activities (polyphenoloxidase (PPO), CAT, POD, PAL, β-1,3 glucanase (GLU）and ascorbate peroxidase (APX) and the expression levels of these genes. 2. Materials and methods 2.1. Fruits Table grapes (Vitis vinifera L.) were harvested at commercial maturity from an orchard in Zhenjiang, Jiangsu province, and randomly selected for uniformity of size, color and ripeness, and without visible injury or infection. Selected grapes were surface disinfected using 0.2% (v/v) sodium hypochlorite for 2 min, washed with tap water, and allowed to air dry at room temperature. 2.2. Yeast and culture media Y. lipolytica was isolated by our research team from the surfaces of grape leaves picked in unsprayed orchards, Zhenjiang, China, and then stored at 4°C on nutrient yeast dextrose agar (NYDA) medium (8 g of nutrient broth, 5 g of yeast extract, 10 g of dextrose, 20 g of agar in 1 L of distilled water) (Yang et al., 2017). The yeast strain was preserved in the China General Microbiological Culture Collection Center (CGMCC), No.8492. The yeast was grown in 250-mL Erlenmeyer flasks containing 50 mL of 5
nutrient yeast dextrose broth (NYDB: 8 g/L nutrient broth, 5 g/L yeast extract, 10 g/L dextrose). Flasks were incubated on a rotary shaker at 180 rpm at 28°C for 36 h. After incubation, cells were centrifuged at 7500 × g for 10 min and washed twice with sterile distilled water in order to remove the growth medium. The cell pellets were resuspended in sterile distilled water and adjusted to the required concentration by a hemocytometer (XB-K-250, Jianling Medical Device Co., Danyang, China). 2.3. Pathogen and culture media P. rubens was isolated from grapes infected with diseases and inoculated on potato dextrose agar (PDA) medium (200 mL of extract from boiled potatoes, 20 g dextrose, 20 g agar in 1 L of distilled water) (Zhang et al., 2016b). The pathogen strain was preserved in the China General Microbiological Culture Collection Center (CGMCC), No.3.15509. PDA plates were incubated at 25°C. Spore suspensions of the pathogen were prepared by removing the spores from a 6 day old incubated culture of P. rubens with inoculation loop and then suspended them in sterile distilled water. Spore concentration was adjusted to 1 × 105 spores/mL using a hemocytometer. 2.4. The determination method of effect of different concentrations of Y. lipolytica on postharvest decay of table grapes caused by P. rubens A uniform wound (3 mm deep × 3 mm diameter) was made on each grape by using a sterile nail in the equatorial region. A 10 μL of aqueous Y. lipolytica suspension that were adjusted to concentrations of 1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL with sterile water using a hemocytometer was pipetted into each wound respectively. Equal volume of sterile water was inoculated into the wound and used as 6
the control. After incubation of 2 h, 10 μL of P. rubens suspension (1 × 105 spores/mL) was pipetted into the wound. Then, the fruits were air dried and stored in enclosed plastic trays at 20°C, relative humidity (RH) 95% (Droby et al., 2002b). The decay incidence and decay diameter of grapes were measured after 6 days. Each treatment included three replicates and every treatment needed thirty six grapes. The experiment was conducted twice. 2.5. Determination of OTA content produced by P. rubens in grapes treated with Y. lipolytica The grapes were wounded as described in 2.4. 10 μL of Y. lipolytica suspension at the final concentration of 1 × 108 cells/mL was inoculated into each wound, 10 μL of sterile water was used as the control. After incubation of 2 h, 10 μL of P. rubens suspension (1 × 105 spores/mL) was inoculated into each wound. OTA content was assayed according to the method described by (Bejaoui et al., 2010) with some modifications. Tissues were collected after 8, 11, 14 and 17 days, respectively, and then crushed into juice for further experiment. Equal volume of dichloromethane was mixed up with the grape juice in 1-L triangle flask, which was placed in rotary shaker at 120 rpm, 25°C for 24 h. Then, the mixture was statically stratified to obtain the liquid. The liquid was evaporated at 40°C and dissolved in methanol (chromatography grade) and performed High-Pressure Liquid Chromatography with a Fluorescence Detector (HPLC-FLD) analysis. The whole experiment was conducted twice. 2.6. Determination of the spore germination rate and germ tube length of P. rubens treated with Y. lipolytica 7
Spore germination rate and germ tube length of P. rubens treated with Y. lipolytica in vitro were measured according to the method described by (Zhao et al., 2018). 1 mL of Y. lipolytica suspension at different concentrations (1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL) and 1 mL of sterile distilled water (as the control) were added into 100-mL Erlenmeyer flasks containing 20 mL potato dextrose broth (PDB; PDA without agar) medium. Then equal volume of P. rubens suspension whose final concentration was 1 × 105 spores/mL were added into each PDB flask. These flasks were incubated on a rotary shaker at 75 rpm, 25°C for 12 h. Above 100 spores of P. rubens were observed randomly using a hemocytometer to determine the germination rate and germ tube length. Every treatment carried out three replicates. The whole experiment was conducted twice. 2.7. The assay of defense-related enzyme activities in grapes Grapes were wounded as described above. And the wound was treated with 10 μL of Y. lipolytica suspension (1 × 108 cells/mL), or equal volume of sterile water as the control. After drying, all grapes were stored in enclosed plastic trays at 20°C, 95% RH. The tissues around the wound were collected with a sterilized scalpel from six grapes after 0 (1 h after treatment), 1, 2, 3, 4, 5 and 6 days of treatment. Each treatment had three replicates. The whole experiment was conducted twice. 2 g of the fresh tissues was ground with 10 mL of cold (4°C) phosphate buffer (50 mmol/L, pH 7.8) containing 1.33 mmol/L ethylenediaminetetraacetic acid (EDTA) and 1% polyvinyl pyrrolidone (PVPP), was used to measure polyphenoloxidase (PPO), peroxidase (POD), phenylalanine ammonialyase (PAL), catalase (CAT) activities. 8
Acetate buffer (50 mmol/L, pH 5.0) containing 0.2% cumulene polysaccharide was used to measure β-1,3 glucanase (GLU) activity. Potassium phosphate buffer pH 7.9 containing 2 mmol/L ascorbic acid (AsA), 5 mmol/L EDTA and 3 g PVPP were used to measure APX activity. The homogenates were centrifuged at 12000 × g for 10 min with a high-speed freezing centrifuge. Then the supernatants were collected and used to evaluate the activities of different enzymes. PPO activity was determined by previously described method (Mohammadi and Kazemi, 2002) with some modifications. 0.2 mL of crude enzyme extract was reacted with 2.8 mL of catechol which was preheated at 30°C for 10 min. The concentration of catechol was 0.1 mol/L, which was dissolved by phosphate buffer (50 mmol/L, pH 6.4). The absorbance was estimated every one minute in a period of 3 min. The absorbance was increased by 0.01 as an enzyme unit for one minute in A378. POD activity was determined according to the method described by (Xu et al., 2013b) with some modifications. 0.2 mL of crude enzyme extract was mixed with 2.2 mL of guaiac which was preheated at 30°C for 10 min. 0.3 g of guaiac was added into phosphate buffer (50 mmol/L, pH 6.4). Finally, 0.6 mL of preheated H2O2 (30°C for 10 min) was added at last to initiate reaction. POD activity was calculated as described above. PAL activity was evaluated described by (Meng et al., 2008; Shao et al., 2013) with some modifications. 1 mL of crude enzyme extract was added into 3 mL of borate buffer as test group, while 1 mL of sterile water was added into 3 mL of borate buffer as the control. The absorbance values of the control and test groups were recorded. Then, 9
the mixture was heated at 37°C for 1 h and the absorbance values were noted again. The enzyme activity was calculated by subtracting the two absorbance values. An enzyme unit was defined as the change of A290 in 0.01 absorbance per minute. CAT activity was determined according to the method described by (Xu and Du, 2012) with some modifications. Zymolyte (2.8 mL of H2O2) was mixed with 0.2 mL of crude extract for 10 s. The absorbance was measured at every one minute interval for 3 min in A240. The enzyme activity was calculated as described above. APX activity was analyzed according to the method described by (Nakano and Asada, 1987). 20 μL of crude enzyme extract was blended with 3 mL of reaction buffer (50 mmol/L, pH 6.4 potassium phosphate buffer, 0.5 mmol/L, pH 7.0 AsA, 0.1 mol/L EDTA and 0.1 mmol/L mM H2O2). One unit was defined as the change of A290 of 0.01 per minute. GLU activity was analyzed using the method described by (Cao and Jiang, 2006). 250 μL of acetic acid buffer (50 mmol/L, pH 5.0) containing 0.2% laminarin was mixed with 250 μL of crude enzyme extract for 1 h at 37°C. Then, 0.5 mL of 3,5-dinitrosalicylic acid (DNS) was added into the mixture for 10 min in boiling water. After cooling, the absorbance was measured at 500nm. The amount of enzyme used for the hydrolysis of laminarin into 1 mg of glucose was determined as an enzyme unit in 1 h. The units of PPO, POD, CAT, PAL, APX and GLU activities were expressed as U per gram fresh tissue weight (U/g FW). 2.8. Analysis of the expression levels of defense-related genes in grapes Grapes and wound were treated as described in 2.7. Grape tissue samples were 10
collected after 0 (1 h after treatment), 1, 2, 3, 4, 5 and 6 days of treatment, respectively. 2 g of grape tissues was frozen immediately by liquid nitrogen and stored at -80°C for further RNA extraction. RNA was extracted according to the operation instructions of Spin Column Plant Total RNA Purification Kit (Sangon Biotech, Shanghai, China) with some modifications. 2 g of frozen grape tissues was ground into powder with liquid nitrogen in cold mortar. 450 μL of Buffer Rlysis-PG and powder were added into 1.5 mL RNase-free centrifuge tube and kept it at room temperature for 5 min. The mixture was centrifuged at 4°C, 12000 × g for 3 min. Supernatant was collected in a new 1.5 mL RNase-free centrifuge tube. To the supernatant, half the volume of absolute ethanol was added and vortexed to make them homogeneous. Then the adsorption column was put into the collection tube, all liquid was pipetted into the adsorption column and kept it at room temperature for 1min. After centrifugation, the remaining liquid in the collection tube was discarded. 500 μL of GT solution was added into the adsorption column and was static at room temperature for 1min. The mixture was centrifuged at 10,000 × g for 1 min at room temperature, the remaining liquid in the collection tube was discarded again. 500 μL of NT solution was added by repeating the step of GT solution. Then, the adsorption column was opened at room temperature for 5 min in order to evaporate the residual ethanol. 30 μL of Diethyl pyrocarbonate (DEPC)-treated ddH2O was added in the middle of the adsorption column, which was put into another 1.5 mL RNase-free centrifuge tube. RNA was collected by centrifuging at 4°C, 12000 × g for 2 min. 1% agarose gel was used to examine RNA contamination. Spectrophotometer (Thermo Scientific, CA, USA) was used to check the purity and 11
quantity of RNA at wavelengths of 260, and 280 nm. The concentration and integrity of RNA were evaluated using RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The RNA was kept at -80°C for further use.1000 ng of total RNA was used to synthesize cDNA with PrimeScript RT reagent kit with gDNA Eraser (Takara-Dalian, China). The cDNA was kept at -20°C. Specific primers were designed with the Primer premier 5.0 software (PREMIER Biosoft International, Palo Alto, CA, USA) and are listed in Table 1. RT-qPCR was operated at Biorad CFX96 Real Time PCR System (Applied Biosystems, USA). The program was set: initial denaturation at 95°C for 30 s, denaturation at 95℃ for 5 s, annealing at 60℃ for 10 s, primer extension at 72°C for 20 s, 40 cycles from the second step to the forth step. Amplification products were verified the specificity of the amplification at the end of the PCR reaction. Melting curve analyses were performed immediately. The melting cycle was 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s. The expression level was normalized as level of grape Actin, relative expression levels were calculated by the method of 2 −ΔΔC T (Livak and Schmittgen, 2001). RT-qPCR was analyzed according to three biological replicates. 2.9. Statistical analysis All statistical analyses were performed with statistical program SPSS/PC version17.0. In this study, data were analyzed with one-way analysis of variance (ANOVA) and a Student’s t-test. Mean separations performed with Tukey's test. The mean values and the standard error of the mean were calculated from the data obtained from two independent experiments. P < 0.05 means that differences are significant. All 12
treatments were designed randomly. 3. Results 3.1. Effect of Y. lipolytica at different concentrations on postharvest decay of table grapes caused by P. rubens Fig. 1 showed the effect of different concentrations of Y. lipolytica on the decay incidence and decay diameter caused by P. rubens in grape. Fig. 1A showed that Y. lipolytica significantly inhibited the decay incidence of grapes in a concentration dependent manner, compared with the control, and the higher the concentrations of Y. lipolytica, the lower the decay incidence. The decay incidence of grape wound treatment with Y. lipolytica at 1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL were 54.15%, 49.95%, 45.82%, 25.03% and 12.45%, respectively, which were significantly lower than that of the control (79.15%). With regard to decay diameter, Y. lipolytica showed similar trend to the decay incidence, the increase in the concentration of Y. lipolytica showed significantly reduced in decay diameter of the grape wound. When the concentration of Y. lipolytica was 1 × 109 cells/mL, the decay diameter of grape wound was 6.19 mm, while the decay diameter of the control was 13.91 mm (Fig. 1B). Though the highest inhibition efficacy was observed at 1 × 109 cells/mL of Y. lipolytica, 1 × 108 cells/mL has been used for further experiments due to high cost and inconsistent with reality in the application. 3.2. Effect of Y. lipolytica on OTA content produced by P. rubens in grapes As shown in Fig. 2, the content of OTA produced by P. rubens in grapes was increased with response to increase in number of days in the control group. Whereas the 13
grapes treated with Y. lipolytica showed significantly decreased the content of OTA production by P. rubens. After 17 days of treatment, the OTA contents of grapes treatment with Y. lipolytica was 0.32 ng/grape only, while OTA content of the control was 74.61 ng/grape. Compared with 8, 11 and 14 days of treatment, the OTA content of grapes treated with Y. lipolytica was significantly decreased at the seventeenth day of treatment. 3.3. Effect of different concentrations of Y. lipolytica on the spore germination rate and germ tube length of P. rubens treatment with Y. lipolytica As shown in Fig. 3, Y. lipolytica significantly decreased spore germination rate and germ tube length of P. rubens in vitro, and the higher the concentration of Y. lipolytica, the lower spore germination rate and the shorter germ tube length. Fig. 3A showed that the spore germination rate of P. rubens treatment with Y. lipolytica at different concentrations were lower than that of the control. When the concentration of Y. lipolytica was 1 × 109 cells/mL, the spore germination rate of P. rubens was 7.22%, while the spore germination rate of P. rubens was 83.39% for the control. Fig. 3B showed that at 1 × 109 cells/mL concentration of Y. lipolytica, the germ tube length of P. rubens was reduced drastically, which was only 1.25 μm. In brief, spore germination rate and germ tube length of P. rubens was significantly inhibited by Y. lipolytica. 3.4. Effect of Y. lipolytica on defense-related enzyme (PPO, POD, CAT, PAL, APX and GLU) activities in the wound of grapes As indicated in Fig. 4A, the trend of PPO activity in grapes treatment with Y. 14
lipolytica was increased from 0 to 2 days and then decreased to the lowest value at the third day and afterwards increased gradually until the 6 days, which was similar to the trend of the control. The results indicated that the PPO activity of grapes treatment with Y. lipolytica was generally higher than the control and was up to peak at the second day, which was 1.52-fold higher than the control. The trend of POD activity in the control and Y. lipolytica treated grapes was coherent. Both the control and treated grapes showed POD activities were up to peak at the first day (Fig. 4B). As shown in Fig. 4C, the CAT activity of grapes treated with Y. lipolytica was about 8.33-fold higher than the control at the third day. As for Fig. 4D, the value of PAL activity of grapes treated with Y. lipolytica was up to the maximum and was 1.38-fold higher than the control at the first day. APX activity both in the control and Y. lipolytica treated grapes was increased during the incubation for 3 days and then decreased from 3 to 5 days and then increased until 6 days. The APX activity of grapes treated with Y. lipolytica was generally higher than the control. The activity of APX reached the highest values at the third day (Fig. 4E). As shown in Fig. 4F, the change of GLU activity in grapes treated with Y. lipolytica was similar to that of the control. And the GLU activity of grapes treatment with Y. lipolytica was at 1.25 times of the control at the second day. The activities of all these defense-related enzymes in grapes treatment with Y. lipolytica were generally higher than that of the control during the whole storage period. 3.5. Effect of Y. lipolytica on the relative expression levels of defense-related (PPO, POD, CAT, PAL, APX and GLU) in grapes 15
As shown in Fig. 5A, the expression levels of PPO in grapes treatment with Y. lipolytica were up-regulated except for the forth day and fifth day, and were significantly up-regulated at the first day and was at 3.88 times of the control. Fig. 5B showed that the expression levels of POD in grapes treatment with Y. lipolytica were up-regulated except for the first day, and the expression levels of POD were up to peak and were at 1.76 times of the control at the third day. The expression levels of CAT in grapes treatment with Y. lipolytica were overall up-regulated compared with the control. The expression levels of CAT in grapes were 2.18-fold higher and 1.88-fold higher than the control at the third day and the second day, respectively (Fig. 5C). And the expression levels of PAL in grapes treatment with Y. lipolytica were up to peak at the first day, and was at 3.17 times of the control (Fig. 5D). As shown in Fig. 5E, the expression levels of APX in grapes treatment with Y. lipolytica were significantly increased at the first day and the second day, and were down-regulated compared with the control at the zero day and the fifth day. And the expression levels of APX reached the maximum at the second day. Except for the first day and the forth day, the expression levels of GLU were up-regulated compared with the control. The expression levels of GLU treatment with Y. lipolytica was at 1.85 times of the control and reached the maximum at the second day (Fig. 5F). Generally, the expression levels of PPO, POD, CAT, PAL, APX and GLU in table grapes treated with Y. lipolytica was higher than the control during the whole storage period. 4. Discussion A previous study showed that Y. lipolytica had an available biocontrol against P. 16
expansum, B. cinerea on apples (Zhang et al., 2017). And Y. lipolytica can effectively suppress postharvest decay caused by T. Rugulosus in grapes (Yang et al., 2017). However, the biocontrol efficacy of Y. lipolytica on postharvest decay of grapes caused by P. rubens is not reported yet. This study demonstrated that Y. lipolytica had a significant biocontrol on the postharvest decay caused by P. rubens in grapes. The results showed that Y. lipolytica can reduce decay incidence and decay diameter of grapes caused by P. rubens, and the higher the concentration of Y. lipolytica, the lower the decay incidence of grape wound and the shorter the decay diameter of grape wound, and the result is in accordance with (Yan et al., 2018), who reported that the efficacy of antagonistic yeasts on inhibiting postharvest diseases caused by pathogens on fruits was depend on the concentration of the yeast. The data revealed that OTA content produced by P. rubens can be decreased by the application of Y. lipolytica. Similarly, Saccharomyces cerevisiae significantly reduced OTA content produced by Aspergillus niger and Aspergillus ochraceus without impair in the quality of coffee (Velmourougane et al., 2011). Therefore, Y. lipolytica might be developed as an antifungal biopesticide for postharvest decay management in grapes. To further understand the mechanisms of Y. lipolytica controlling the postharvest decay of grapes, the effect of Y. lipolytica on spore germination rate and germ tube length of P. rubens in vitro was investigated further. The results suggested that Y. lipolytica significantly inhibited spore germination rate and germ tube length of P. rubens in PDB media. Similarly, results have been reported that spore germination rate of B. cinerea in PDB media was significantly inhibited by Rhodotorula glutinis (Zhang et al., 2007). 17
It was reported that antagonistic yeasts could induce and enhance defense-related enzyme activities or produce lignin and phytoalexin (Guo et al., 2015). PPO, POD, CAT, PAL, APX and GLU are very important defense-related enzyme in fruits, and these enzymes activities are related with disease resistance in plants (Qin et al., 2015; Zhang et al., 2016a). Moreover, the levels of these enzymes activities were related to the levels of gene expression. PPO and PAL play important roles in the defense mechanism of host plants and involve in phenolic metabolism in plants, which can oxide phenol into toxicant quinone (Maffei et al., 2006). PAL is key enzyme in the pathway of synthesizing phenylpropane in fruits and vegetables, which often is used as a biochemical indicator of disease resistance (Navarre et al., 2013). PAL also could contribute to synthesis of lignin, so PAL is used as a kind of important defense-related enzymes that contribute to the production of lignin. POD, CAT and APX, which belong to antioxidases, play an important role in defense response of plants. These three enzymes all can scavenge reactive oxygen species (ROS) in order to protect cells and tissue from damages caused by free radicals, such as O2- and H2O2, O2- is converted to H2O2 by the action of superoxide (SOD), whereas H2O2 is destroyed predominantly by POD, CAT and APX (Gill and Tuteja, 2010). POD can synthesize lignin and phytoalexin, making cell wall reinforce (Ge et al., 2015). All of these enzymes are considered as key enzymes in host defense reactions and protect host from pathogen infections. GLU, as one of the pathogenesis related proteins (Romero et al., 2006), can hydrolyzed the cell wall components of fungi, such as β-1,3 glucan. In the process of glucan hydrolysis, some small molecule could induce host disease 18
resistance (Mauch et al., 1988). In this study, Y. lipolytica could induce PPO, POD, CAT, PAL, APX and GLU activities of grapes and enhanced those enzyme activities of grapes. Furthermore, the results showed that the expression levels of PPO and POD of grapes treatment with Y. lipolytica were up-regulated during the period of storage. Intensities of up-regulated gene expression are higher, the enzyme activities are stronger (Lin et al., 2011). The change of the expression levels of PAL and GLU coincided with PAL and GLU enzyme activities. The expression levels of PAL could elucidate the trend of enzyme activity, and the expression levels of GLU enhanced the GLU activity as elicitors (Landi et al., 2014). CAT was involved in inducing resistance responses in tomato fruit by regulating ROS production and increasing expression of up-regulated gene (Fan et al., 2016). Results showed that the expression levels of CAT in grapes in Y. lipolytica treatment group were significantly higher than that of the control during the whole storage period. The expression of APX was related to decrease in the H2O2 content and elucidate the expression of up-regulated gene involved in ascorbic acid synthetic metabolism to induce resistance responses in peach (Wang et al., 2014). Therefore, the levels of defense-related gene expression and its corresponding enzyme activity are closely related, and they play a very important role in enhancing the resistance of the fruits. In conclusion, Y. lipolytica has great potential as a biocontrol agent for postharvest decay of grape fruits caused by P. rubens. Y. lipolytica competed with P. rubens for space and nutrition, further inhibited spore germination and growth of pathogens. Activities of defense-related enzyme (PPO, POD, CAT, PAL, APX and 19
GLU) treatment with Y. lipolytica are enhanced and improved the disease resistance of grape fruits. And Y. lipolytica can also induce the expression levels of defense-related genes in grapes and improved the resistance of fruits. The mechanisms of the effect of Y. lipolytica on postharvest decay of grape fruits caused by P. rubens need further research, particularly at the molecular level. Acknowledgements This research was supported by the National Natural Science Foundation of China (31701971), the China Postdoctoral Science Foundation (2018M630532) and 333 High-Level Personnel Training Project of Jiangsu Province (BRA2017442). Conflict of interest The authors declare that there are no conflicts of interest. Reference Bejaoui, H., Mathieu, F., Taillandier, P., A, 2010. Biodegradation of Ochratoxin A by Aspergillus Section Nigri Species Isolated from French Grapes: a Potential Means of Ochratoxin A Decontamination in Grape Juices and Musts. FEMS Microbiol. Lett. 255, 203-208. Cao, J., Jiang, W., 2006. Induction of Resistance in Yali Pear (Pyrus bretschneideri Rehd.) Fruit against Postharvest Diseases by Acibenzolar- S -methyl Sprays on Trees during Fruit Growth. Sci Hortic-Amsterdam 110, 181-186. Droby, S., Chalutz, E., Wilson, C.L., Wisniewski, M., 1989. Characterization of the Biocontrol Activity of Debaryomyces hansenii in the Control of Penicillium digitatum on Grapefruit. Revue Canadienne De Microbiologie 35, 794-800. Droby, S., Vinokur, V., Weiss, B., Cohen, L., Daus, A., Goldschmidt, E.E., Porat, R., 2002a. Induction of Resistance to Penicillium digitatum in Grapefruit by the Yeast Biocontrol Agent Candida oleophila. Phytopathology 92, 393-399. Droby, S., Vinokur, V., Weiss, B., Cohen, L., Daus, A., Goldschmidt, E.E., Porat, R., 2002b. Induction of Rresistance to Penicillium digitatum in Grapefruit by the Yeast Biocontrol Agent Candida oleophila. Phytopathology 92, 393-399. Duarte-Sierra, A., Aispuro-Hernandez, E., Vargas-Arispuro, I., Islas-Osuna, M.A., Gonzalez-Aguilar, G.A., Martinez-Tellez, M.A., 2016. Quality and PR Gene Expression of Table Grapes Treated with Ozone and Sulfur Dioxide to Control Fungal Decay. J Sci Food Agr. 96, 2018-2024. Fan, L., Shi, J., Zuo, J., Gao, L., Lv, J., Wang, Q., 2016. Methyl Jasmonate Delays 20
Postharvest Ripening and Senescence in the Non-climacteric Eggplant (Solanum melongena L.) Fruit. Postharvest Biol. Technol. 120, 76-83. Ge, Y., Deng, H., Bi, Y., Li, C., Liu, Y., Dong, B., 2015. Postharvest ASM Dipping and DPI Pre-treatment Regulated Reactive Oxygen Species Metabolism in Muskmelon (Cucumis melo L.) Fruit. Postharvest Biol. Technol. 99, 160-167. Gill, S.S., Tuteja, N., 2010. Reactive Oxygen Species and Antioxidant Machinery in Abiotic Stress Tolerance in Crop Plants. Plant Physiol Bioch 48, 909-930. Guo, M., Feng, J., Zhang, P., Jia, L., Chen, K., 2015. Postharvest Treatment with Trans-2-hexenal Induced Resistance against Botrytis cinerea in Tomato Fruit. Australas Plant Path 44, 121-128. HashemAbeer, Abd-Allah, E.F., Al-Obeed, R.S., Mridha, M.A.U., Al-Huqail, A., 2013. Non-chemical Strategies to Control Postharvest Losses and Extend the Shelf Life of Table Grape Fruits. Biol Agric Hortic 29, 82-90. Karabulut, O.A., Smilanick, J.L., Gabler, F.M., Mansour, M., Droby, S., 2007. Near-Harvest Applications of Metschnikowia fructicola, Ethanol, and Sodium Bicarbonate to Control Postharvest Diseases of Grape in Central California. Plant Dis. 87, 1384-1389. Landi, L., Feliziani, E., Romanazzi, G., 2014. Expression of Defense Genes in Strawberry Fruits Treated with Different Resistance Inducers. J Agric Food Chem 62, 3047-3056. Lasram, S., Oueslati, S., Mliki, A., Ghorbel, A., Silar, P., Chebil, S., 2012. Ochratoxin A and Ochratoxigenic Black Aspergillus Species in Tunisian Grapes Cultivated in Different Geographic Areas. Food Control 25, 75-80. Li, Q., Li, C., Li, P., Zhang, H., Zhang, X., Zheng, X., Yang, Q., Apaliya, M.T., Serwah, B.N.A., Sun, Y., 2017. The Biocontrol Effect of Sporidiobolus pararoseus Y16 against Postharvest Diseases in Table Grapes Caused by Aspergillus niger and the Possible Mechanisms Involved. Biol. Control 113, 18-25. Lin, J., Gong, D., Zhu, S., Zhang, L., Zhang, L., 2011. Expression of PPO and POD genes and Contents of Polyphenolic Compounds in Harvested Mango Fruits in Relation to Benzothiadiazole-induced defense against anthracnose. Sci Hortic-Amsterdam 130, 85-89. Livak, K.J., Schmittgen, T.D., 2001. Analysis of Relative Gene Expression Data Using Real-time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408. Lu, L., Ye, C., Guo, S., Sheng, K., Shao, L., Zhou, T., Yu, T., Zheng, X., 2013. Preharvest Application of Antagonistic Yeast Rhodosporidium paludigenum Induced Resistance against Postharvest Diseases in Mandarin Orange. Biol. Control 67, 130-136. Maffei, A., Nataraj, K., Nelson, S.B., Turrigiano, G.G., 2006. Potentiation of Cortical Inhibition by Visual Deprivation. Nature 443, 81-84. Mari, M., Martini, C., Spadoni, A., Rouissi, W., Bertolini, P., 2012. Biocontrol of Apple Postharvest Decay by Aureobasidium pullulans. Postharvest Biol. Technol. 73, 56-62. 21
Mauch, F., Mauchmani, B., Boller, T., 1988. Antifungal Hydrolases in Pea Tissue : II. Inhibition of Fungal Growth by Combinations of Chitinase and beta-1,3-Glucanase. Plant Physiol. 88, 936-942. Mcgrath, M.T., Thind, T.S., 2012. Challenge of Fungicide Resistance and Anti-resistance Strategies in Managing Vegetable Diseases in the USA. Fungicide Resistance in Crop Protection Risk & Management. Meng, X., Li, B., Jia, L., Tian, S., 2008. Physiological Responses and Quality Attributes of Table Grape Fruit to Chitosan Preharvest Spray and Postharvest Coating during Storage. Food Chem. 106, 501-508. Mohammadi, M., Kazemi, H., 2002. Changes in Peroxidase and Polyphenol Oxidase Activities in Susceptible and Resistant Wheat Heads Inoculated with Fusarium graminearum and Induced Resistance. Plant Sci 162, 491-498. Nakano, Y., Asada, K., 1987. Purification of Ascorbate Peroxidase in Spinach Chloroplasts; Its Inactivation in Ascorbate-Depleted Medium and Reactivation by Monodehydroascorbate Radical. Plant Cell Physiol. 131-140. Nallya, M.C., Maturano, Y.P., Muñoz, C.J., Combina, M., Toro, M.E., Figueroa, L.I.C.D., Vazquez, F., 2012. Biocontrol of Botrytis cinerea in Table Grapes by Non-pathogenic Indigenous Saccharomyces cerevisiae Yeasts Isolated from Viticultural Environments in Argentina. Postharvest Biol. Technol. 64, 40-48. Navarre, D.A., Payyavula, R.S., Shakya, R., Knowles, N.R., Pillai, S.S., 2013. Changes in Potato Phenylpropanoid Metabolism during Tuber Development. Plant Physiol Bioch 65, 89-101. Qin, X., Xiao, H., Xue, C., Yu, Z., Yang, R., Cai, Z., Si, L., 2015. Biocontrol of Gray Mold in Grapes with the Yeast Hanseniaspora uvarum alone and in Combination with Salicylic Acid or Sodium Bicarbonate. Postharvest Biol. Technol. 100, 160-167. Romanazzi, G., Lichter, A., Gabler, F.M., Smilanick, J.L., 2012. Recent Advances on the Use of Natural and Safe Alternatives to Conventional Methods to Control Postharvest Gray Mold of Table Grapes. Postharvest Biol. Technol. 63, 141-147. Romero, I., Sanchez-Ballesta, M.T., Maldonado, R., Escribano, M.I., Merodio, C., 2006. Expression of Class I Chitinase and β-1,3-glucanase Genes and Postharvest Fungal Decay Control of Table Grapes by High CO2 Pretreatment. Postharvest Biol. Technol. 41, 9-15. Shao, X., Wang, H., Xu, F., Cheng, S., 2013. Effects and Possible Mechanisms of Tea Tree Oil Vapor Treatment on the Main Disease in Postharvest Strawberry Fruit. Postharvest Biol. Technol. 77, 94-101. Velmourougane, K., Bhat, R., Gopinandhan, T.N., Panneerselvam, P., 2011. Management of Aspergillus ochraceus and Ochratoxin-A Contamination in Coffee during on-farm Processing through Commercial Yeast Inoculation. Biol. Control 57, 215-221. Wang, K., Shao, X., Gong, Y., Xu, F., Wang, H., 2014. Effects of Postharvest Hot Air Treatment on Gene Expression Associated with Ascorbic Acid Metabolism in Peach Fruit. Plant Mol Biol Rep 32, 881-887. 22
Xu, B., Zhang, H., Chen, K., Xu, Q., Yao, Y., Gao, H., 2013a. Biocontrol of Postharvest Rhizopus Decay of Peaches with Pichia caribbica. Curr. Microbiol. 67, 255-261. Xu, B., Zhang, H., Chen, K., Xu, Q., Yao, Y., Gao, H., 2013b. Biocontrol of Postharvest Rhizopus Decay of Peaches with Pichia caribbica. Curr. Microbiol. 67, 255-261. Xu, L., Du, Y., 2012. Effects of Yeast Antagonist in Combination with UV-C treatment on Postharvest Diseases of Pear Fruit. Biol. Control 57, 451-461. Yan, Y., Zhang, X., Zheng, X., Apaliya, M.T., Yang, Q., Zhao, L., Gu, X., Zhang, H., 2018. Control of Postharvest Blue Mold Decay in Pears by Meyerozyma guilliermondii and It’s Effects on the Protein Expression Profile of Pears. Postharvest Biol. Technol. 136, 124-131. Yang, Q., Wang, H., Zhang, H., Zhang, X., Apaliya, M.T., Zheng, X., Mahunu, G.K., 2017. Effect of Yarrowia lipolytica on Postharvest Decay of Grapes Caused by Talaromyces rugulosus and the Protein Expression Profile of T. rugulosus. Postharvest Biol. Technol. 126, 15-22. Yao, H.J., Tian, S.P., 2005. Effects of a Biocontrol Agent and Methyl Jasmonate on Postharvest Diseases of Peach Fruit and the Possible Mechanisms Involved. J. Appl. Microbiol 98, 941–950. Zhang, H., Chen, L., Sun, Y., Zhao, L., Zheng, X., Yang, Q., Zhang, X., 2017. Investigating Proteome and Transcriptome Defense Response of Apples Induced by Yarrowia lipolytica. Molecular plant-microbe interactions: Mol Plant Microbe In 30, 301. Zhang, H., Wang, L., Dong, Y., Jiang, S., Cao, J., Meng, R., 2007. Postharvest Biological Control of Gray Mold Decay of Strawberry with Rhodotorula glutinis. Biol. Control 40, 287-292. Zhang, Q., Yong, D., Zhang, Y., Shi, X., Li, B., Li, G., Liang, W., Wang, C., 2016a. Streptomyces Rochei A-1 Induces Resistance and Defense-related Responses against Botryosphaeria dothidea in Apple Fruit during Storage. Postharvest Biol. Technol. 115, 30-37. Zhang, X., Li, Y., Wang, H., Gu, X., Zheng, X., Wang, Y., Diao, J., Peng, Y., Zhang, H., 2016b. Screening and Identification of Novel Ochratoxin A-Producing Fungi from Grapes. Toxins (Basel) 8, 333. Zhao, L., Sun, Y., Yang, D., Li, J., Gu, X., Zhang, X., Zhang, H., 2018. Effects of Sporidiobolus pararoseus Y16 on Postharvest Blue Mold Decay and the Defense Response of Apples. J Food Quality 2018, 1-9.
23
Figure Captions Fig. 1 Effect of different concentrations of Y. lipolytica on controlling postharvest decay caused by P. rubens of table grapes. Decay incidence (a) and decay diameter (b) were measured after 6 days incubation at 20°C, RH 95%. CK: the control, the letters of A, B, C, D and E represent the concentrations of Y. lipolytica at 1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL respectively. Each value is the mean of three replicates of thirty six grapes. Bars represent the standard error of the mean. Data in columns with the different letters are significantly different according to Tukey's test at P < 0.05.
Fig. 2 Effect of Y. lipolytica on OTA content produced by P. rubens in table grapes. Each value is the mean of three replicates of thirty six grapes. Bars represent standard errors. CK: the control. Y: grapes treatment with Y. lipolytica. Data in columns with the different letters are significantly different according to Tukey's test at P < 0.05.
Fig. 3 Effect of different concentration of Y. lipolytica on spore germination rate (a) and germ tube length (b) of P. rubens in vitro. CK: the control, the letters of A, B, C, D and E represent the concentrations of Y. lipolytica at 1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL respectively. Bars represent standard errors. Data in columns with different letters are statistically different according to Tukey's test at P < 0.05.
Fig. 4 Effect of Y. lipolytica on defense-related enzyme activities in the wound of table grapes. (a), (b), (c), (d), (e) and (f) represent polyphenoloxidase (PPO), peroxidase 24
(POD), catalase (CAT), phenylalanine ammonialyase (PAL), ascorbate peroxidase (APX) and β-1,3 glucanase (GLU) respectively. CK: the control. Y: grapes treatment with Y. lipolytica. Each value is the mean of three replicates of six grapes. Bars represent standard errors.
Fig. 5 Relative expression levels of (a) polyphenoloxidase (PPO), (b) peroxidase (POD), (c) catalase (CAT), (d) phenylalanine ammonialyase (PAL), (e) ascorbate peroxidase (APX) and (f) β-1,3 glucanase (GLU) in table grapes treatment with Y. lipolytica. CK: grapes treatment with sterile distilled water as the control. Y: grapes treatment with Y. lipolytica. Each value is the mean of three replicates of six grapes. Bars represent standard errors.
25
Fig. 1
Decay incidence (%)
(a) 90 80 70 60 50 40 30 20 10 0
a
b b
b c
c
CK
A
B C Treatments
D
E
(b)
Decay diameter (mm)
16 14 12
a ab
10
bc
8
c d
6 e
4 2 0 CK
A
B C Treatments
D
E
26
Fig. 2
80
CK
OTA content (ng/grape)
70
Y a
60
a
50 40 30 b
20 10
c
c
b
a
a
0 8
11 Time (d)
14
17
27
Fig. 3 (a)
Spore germinaton rate (%)
100 90 80 70 60 50 40 30 20 10 0
a
b
c cd
CK
A
B
C Treatments
d
d
D
E
(b) 14 Germ tube length (um)
12
a
10 8 6 4
b
2
b
bc cd
0
CK
A
B
C Treatments
D
d
E
28
CK
6
a
Y
a b b c
c
c
b
c c
b c
c
c
0
1
2 3 4 5 Treatment time(d)
b b
3
b b
2
c
b
b
b b
1
c
0
1
2 3 4 5 Treatment time(d)
3.5 PAL activity (U/g FW）
CAT activity (U/g FW)
a
Y a
0.4
a b
0.3
b
a
c
b
c
0.1
b
a
b
a
b
0
1
2 3 4 5 Treatment time(d）
6
a
CK
3
Y b
2.5
b
2
1.5
b
a
b
1 0
b
c c
0.5
6
b
b c
c
0
(e)
APX activity(U/g FW)
b
b
4
CK
0.5
11 10 9 8 7 6 5 4 3 2 1
a
(d)
0.6
0
Y
5
0
6
(c)
0.2
CK
a
1
2 3 4 5 Treatment time(d)
6
(f) CK
b
a
Y
a
a
a
c c
c
d
0
b
b
d
1
c
2 3 4 5 Treatment time(d)
CK
0.6
d
GLUactivity (U/g FW)
40 35 30 25 20 15 10 5 0
(b)
POD activity (U/g FW)
PPO activity (U/g FW)
Fig. 4 (a)
a
a
0.4
a
0.3 0.2 0.1
b b
b b
b
0 6
a
Y
0.5
0
1
b b
b
b
2 3 4 5 Treatment time(d)
29
6
Fig. 5 (a)
(b)
Relative expression of PPO
Y
Relative expression of POD
CK
4.5 4 3.5 3 2.5 2 1.5 1 0.5 0
a
b b
0
1
b c
c
2 3 4 Time (d)
5
b
1.8
CK
a
Y
1.5 1.2
b
b
b
0.9
b
b
5
6
0.6 c
0.3 0
6
0
(c)
1
2
3 4 Time (d)
(d)
3.5
CK
3
4 3.5 3 2.5 2 1.5 1 0.5 0
Y
a a
2.5 2
b
1.5 c
1
c
c
c
0.5 0 0
1
2 3 4 Time (d)
5
6
CK
Y
CK
Relative expression of PAL
Relative expression of CAT
(e) Y
a
b b
b
b
0
1
2
c
c
3 4 Time (d)
5
6
(f)
3 a
2.5 2 b
1.5 1
0.5
b
b
b
b c
0
0
1
2 3 4 Time (d)
5
6
Relative expression of GLU
Relative expression of APX
3.5
2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
CK
Y
a
b
b b
b c
0
1
c
2 3 4 Time (d) 30
5
6
Table 1 Primer design of defense-related genes in grapes Gene Name
Accession number
PPO
NM_001281116.1
APX
XM_010655137.1
GLU
XM002274792.2
CAT
KP271927.1
PAL
KU162977.1
POD
MVKN7XNT014
ACTIN
XM_002277287.3
Primer
Primer Sequence (5’ → 3’)
Tm (OC)
qRT-PPO-F
5'GTCCCCGTAGCCAGAAACC 3'
59.5
qRT-PPO-R
5'AGCAGCACCATACAGCCCT 3'
62.4
qRT-APX-F
5'TTCAAAAAATCCAACGGTCG 3'
52.4
qRT-APX-R
5'TTCTGGTACTCCTCGCTCACA 3'
58.9
qRT-GLU-F
5'GGGGTTATTTGGATCCCATCATGT3'
54.5
qRT-GLU-R
5'CAGAAGCGGCGACTTATTGTCT3'
57.5
qRT-CAT-F
5'ATGTGCTGATTTCCTTCGTACC 3'
55.1
qRT-CAT-R
5'GTCAACAACTCTCCAATACTCCTG 3’
56.7
qRT-PAL-F
5’ AACCGAATCAAGGAGTGC 3’
54.1
qRT-PAL-R
5’ ACTGAGACAATCCAGAAGAG 3’
53.9
qRT-POD-F
5’ AGTTGGCTGGAGTTGTTGCT3’
57.2
qRT-POD-R
5’ GTGATCGCATCCTTTGGTGG3’
56.8
ACTIN-F
5' TTCAATAAGGAGAAGATGGTGGA3'
53.8
ACTIN-R
5' TTGGTGAGGTAGTCTGTGAGGTC3'
54.8
Product Length (bp) 171
170
213
251
151
189
232
31
Author Statement Hongyin Zhang conceived and designed the experiments. Meiyan Wang performed the experiments and wrote the manuscript. Manuscript was mainly modified by Lina Zhao and Xiaoyun Zhang. Solairaj Dhanasekaran and Mandour H Abdelhai provided amendments. Qiya Yang and Zhenhui Jiang contributed to regents, material and data analysis.
32
Highlights Y. lipolytica significantly controlled decay caused by P. rubens of grapes Y. lipolytica significantly reduced OTA content produced by P. rubens of grapes Spore germination and germ tube length of P. rubens were inhibited by Y. lipolytica PPO, POD, PAL, APX, GLU and CAT activities of grapes were induced by Y. lipolytica The expression levels of defense-related genes were up-regulated by Y. lipolytica
33
S1049-9644(18)30616-9 https://doi.org/10.1016/j.biocontrol.2018.11.004 YBCON 3884
To appear in:
Biological Control
Received Date: Revised Date: Accepted Date:
29 August 2018 24 October 2018 11 November 2018
Please cite this article as: Wang, M., Zhao, L., Zhang, X., Dhanasekaran, S., Abdelhai, M.H., Yang, Q., Jiang, Z., Zhang, H., Study on biocontrol of postharvest decay of table grapes caused by Penicillium rubens and the possible resistance mechanisms by Yarrowia lipolytica, Biological Control (2018), doi: https://doi.org/10.1016/j.biocontrol. 2018.11.004
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Study on biocontrol of postharvest decay of table grapes caused by Penicillium rubens and the possible resistance mechanisms by Yarrowia lipolytica
Meiyan Wang1, Lina Zhao1, Xiaoyun Zhang1, Solairaj Dhanasekaran1, Mandour H. Abdelhai1, Qiya Yang1, Zhenhui Jiang1, Hongyin Zhang1*
1
School of Food and Biological Engineering, Jiangsu University, Zhenjiang 212013,
Jiangsu, People’s Republic of China
*Corresponding author: Hongyin Zhang Email address: [email protected] Tel.: +86-511-88790211; Fax: +86-511-88780201
1
Abstract Table grapes are one of the most common fruits throughout the world. Decay of grapes caused by pathogenic fungal infections results in tremendous economic losses. The aim of this study was to evaluate the effect of Yarrowia lipolytica on the control of postharvest decay of grapes caused by Penicillium rubens and the possible mechanisms involved. The results showed that Y. lipolytica provided significant inhibition of the postharvest decay of grapes by P. rubens compared with the control. When the concentration of Y. lipolytica was 1 × 109 cells/mL, decay incidence and decay diameter of grapes were 12.45% and 6.19 mm, respectively. Y. lipolytica reduced spore germination and germ tube length of P. rubens. Moreover, the results also showed that the activities of defense-related enzymes, including polyphenoloxidase (PPO), peroxidase (POD), catalase (CAT), phenylalanine ammonialyase (PAL), ascorbate peroxidase (APX) and β-1,3 glucanase (GLU),were significantly enhanced in grapes treated with Y. lipolytica. Similarly, the expression levels of these genes were also increased in grape fruits treated with Y. lipolytica. The results suggested that the possible resistance mechanism of Y. lipolytica was to enhance the defense-related enzymes and genes, ultimately reduce postharvest decay caused by P. rubens in grapes. Altogether, the research work confirmed that Y. lipolytica has potential biocontrol efficacy and could be used as a biocontrol agent to prevent the postharvest decay of grape fruits. Keywords: Table grapes; Yarrowia lipolytica; Penicillium rubens; Biocontrol; Enzyme activity; Gene expression 2
1. Introduction Table grapes (Vitis vinifera L.) are one of the most important fruits worldwide. However, table grapes are vulnerable to pathogen infections during the postharvest storage, which results in rapid deterioration of fruits (HashemAbeer et al., 2013). Pathogenic fungi such as Botrytis cinerea, Penicillium spp. and Aspergillus spp. are causing potential postharvest losses in table grapes (Romanazzi et al., 2012). It is reviewed that Aspergillus and Penicillium species can produce ochratoxin A (OTA), which is a mycotoxin classified as carcinogenic and causes harm to human health, especially the nephridium and hepatic (Lasram et al., 2012). Therefore, control of fungal infections in grapes is essential. The control of pathogen infections during postharvest practices are primarily based on synthetic chemical fungicides (Duarte-Sierra et al., 2016). However, the use of synthetic chemicals is becoming increasingly limited due to growing public pressure resulting from their toxicological risks to human health and environmental pollution, as well as the increasing development fungicide-resistant pathogenic strains (Mcgrath and Thind, 2012). Therefore, researchers are looking for alternative method to control postharvest diseases of fruits. Biological control, using antagonist microorganisms (BCAs-biological control agents) such as yeast and bacteria, has become a promising alternative method to control postharvest diseases of fruits and vegetables. Among these antagonists, yeasts do not produce toxic secondary metabolites (Yao and Tian, 2005). Therefore, yeasts have great potential as a biocontrol agent for postharvest decay of fruits. It was 3
reported that antagonistic yeasts, such as Metschnikowia fructicola (Karabulut et al., 2007), Candida oleophila (Droby et al., 2002a), Aureobasidium pullulans (Mari et al., 2012) and Sporidiobolus pararoseus (Li et al., 2017), have showed great potential in controlling the postharvest decay of fruits. In grape fruits, Debaryomyces hansenii has reported to control green mold caused by Penicillium digitatum (Droby et al., 1989). Antagonistic yeast Saccharomyces cerevisiae could control gray mold caused by B. cinerea in table grapes (Nallya et al., 2012). Although several antagonistic yeasts were reported to have significant effect on postharvest decay of grapes, the effectiveness of biocontrol also needs to be further improved. Y. lipolytica was isolated from the surface of grapes leaves picked in unsprayed orchards by our laboratory. Previous study from our research group indicated that Y. lipolytica could significantly inhibited P. expansum and B. cinerea decay of apples (Zhang et al., 2017). However, there is little information about biocontrol of postharvest diseases of grape by Y. lipolytica. Moreover, P. rubens was also isolated from grapes by our laboratory, and the strain can produce OTA (Zhang et al., 2016b). Therefore, in this study, the effect of Y. lipolytica on the biocontrol of postharvest decay of grapes caused by P. rubens and the possible resistance mechanisms involved were investigated. It has been reported that antagonistic yeasts can induce defense-related enzymes and increase the defense-related enzyme activity which enhances the disease resistance in fruits (Lu et al., 2013). Defense-related enzyme activity, such as peroxidase (POD), catalase (CAT) and phenylalanine ammonialyase (PAL) in peaches has been reported (Xu et al., 2013a). However, there are few reports about the effect of Y. lipolytica on the expression levels of 4
defense-related genes, especially in grapes. Therefore, the aims of this study were to investigate: (1) the biocontrol efficacy of Y. lipolytica in controlling postharvest decay caused by P. rubens in grapes and the effect of Y. lipolytica on OTA content produced by P. rubens in grapes; (2) the effectiveness of Y. lipolytica against pathogens in vitro; (3) the effect of Y. lipolytica on defense-related enzymes activities (polyphenoloxidase (PPO), CAT, POD, PAL, β-1,3 glucanase (GLU）and ascorbate peroxidase (APX) and the expression levels of these genes. 2. Materials and methods 2.1. Fruits Table grapes (Vitis vinifera L.) were harvested at commercial maturity from an orchard in Zhenjiang, Jiangsu province, and randomly selected for uniformity of size, color and ripeness, and without visible injury or infection. Selected grapes were surface disinfected using 0.2% (v/v) sodium hypochlorite for 2 min, washed with tap water, and allowed to air dry at room temperature. 2.2. Yeast and culture media Y. lipolytica was isolated by our research team from the surfaces of grape leaves picked in unsprayed orchards, Zhenjiang, China, and then stored at 4°C on nutrient yeast dextrose agar (NYDA) medium (8 g of nutrient broth, 5 g of yeast extract, 10 g of dextrose, 20 g of agar in 1 L of distilled water) (Yang et al., 2017). The yeast strain was preserved in the China General Microbiological Culture Collection Center (CGMCC), No.8492. The yeast was grown in 250-mL Erlenmeyer flasks containing 50 mL of 5
nutrient yeast dextrose broth (NYDB: 8 g/L nutrient broth, 5 g/L yeast extract, 10 g/L dextrose). Flasks were incubated on a rotary shaker at 180 rpm at 28°C for 36 h. After incubation, cells were centrifuged at 7500 × g for 10 min and washed twice with sterile distilled water in order to remove the growth medium. The cell pellets were resuspended in sterile distilled water and adjusted to the required concentration by a hemocytometer (XB-K-250, Jianling Medical Device Co., Danyang, China). 2.3. Pathogen and culture media P. rubens was isolated from grapes infected with diseases and inoculated on potato dextrose agar (PDA) medium (200 mL of extract from boiled potatoes, 20 g dextrose, 20 g agar in 1 L of distilled water) (Zhang et al., 2016b). The pathogen strain was preserved in the China General Microbiological Culture Collection Center (CGMCC), No.3.15509. PDA plates were incubated at 25°C. Spore suspensions of the pathogen were prepared by removing the spores from a 6 day old incubated culture of P. rubens with inoculation loop and then suspended them in sterile distilled water. Spore concentration was adjusted to 1 × 105 spores/mL using a hemocytometer. 2.4. The determination method of effect of different concentrations of Y. lipolytica on postharvest decay of table grapes caused by P. rubens A uniform wound (3 mm deep × 3 mm diameter) was made on each grape by using a sterile nail in the equatorial region. A 10 μL of aqueous Y. lipolytica suspension that were adjusted to concentrations of 1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL with sterile water using a hemocytometer was pipetted into each wound respectively. Equal volume of sterile water was inoculated into the wound and used as 6
the control. After incubation of 2 h, 10 μL of P. rubens suspension (1 × 105 spores/mL) was pipetted into the wound. Then, the fruits were air dried and stored in enclosed plastic trays at 20°C, relative humidity (RH) 95% (Droby et al., 2002b). The decay incidence and decay diameter of grapes were measured after 6 days. Each treatment included three replicates and every treatment needed thirty six grapes. The experiment was conducted twice. 2.5. Determination of OTA content produced by P. rubens in grapes treated with Y. lipolytica The grapes were wounded as described in 2.4. 10 μL of Y. lipolytica suspension at the final concentration of 1 × 108 cells/mL was inoculated into each wound, 10 μL of sterile water was used as the control. After incubation of 2 h, 10 μL of P. rubens suspension (1 × 105 spores/mL) was inoculated into each wound. OTA content was assayed according to the method described by (Bejaoui et al., 2010) with some modifications. Tissues were collected after 8, 11, 14 and 17 days, respectively, and then crushed into juice for further experiment. Equal volume of dichloromethane was mixed up with the grape juice in 1-L triangle flask, which was placed in rotary shaker at 120 rpm, 25°C for 24 h. Then, the mixture was statically stratified to obtain the liquid. The liquid was evaporated at 40°C and dissolved in methanol (chromatography grade) and performed High-Pressure Liquid Chromatography with a Fluorescence Detector (HPLC-FLD) analysis. The whole experiment was conducted twice. 2.6. Determination of the spore germination rate and germ tube length of P. rubens treated with Y. lipolytica 7
Spore germination rate and germ tube length of P. rubens treated with Y. lipolytica in vitro were measured according to the method described by (Zhao et al., 2018). 1 mL of Y. lipolytica suspension at different concentrations (1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL) and 1 mL of sterile distilled water (as the control) were added into 100-mL Erlenmeyer flasks containing 20 mL potato dextrose broth (PDB; PDA without agar) medium. Then equal volume of P. rubens suspension whose final concentration was 1 × 105 spores/mL were added into each PDB flask. These flasks were incubated on a rotary shaker at 75 rpm, 25°C for 12 h. Above 100 spores of P. rubens were observed randomly using a hemocytometer to determine the germination rate and germ tube length. Every treatment carried out three replicates. The whole experiment was conducted twice. 2.7. The assay of defense-related enzyme activities in grapes Grapes were wounded as described above. And the wound was treated with 10 μL of Y. lipolytica suspension (1 × 108 cells/mL), or equal volume of sterile water as the control. After drying, all grapes were stored in enclosed plastic trays at 20°C, 95% RH. The tissues around the wound were collected with a sterilized scalpel from six grapes after 0 (1 h after treatment), 1, 2, 3, 4, 5 and 6 days of treatment. Each treatment had three replicates. The whole experiment was conducted twice. 2 g of the fresh tissues was ground with 10 mL of cold (4°C) phosphate buffer (50 mmol/L, pH 7.8) containing 1.33 mmol/L ethylenediaminetetraacetic acid (EDTA) and 1% polyvinyl pyrrolidone (PVPP), was used to measure polyphenoloxidase (PPO), peroxidase (POD), phenylalanine ammonialyase (PAL), catalase (CAT) activities. 8
Acetate buffer (50 mmol/L, pH 5.0) containing 0.2% cumulene polysaccharide was used to measure β-1,3 glucanase (GLU) activity. Potassium phosphate buffer pH 7.9 containing 2 mmol/L ascorbic acid (AsA), 5 mmol/L EDTA and 3 g PVPP were used to measure APX activity. The homogenates were centrifuged at 12000 × g for 10 min with a high-speed freezing centrifuge. Then the supernatants were collected and used to evaluate the activities of different enzymes. PPO activity was determined by previously described method (Mohammadi and Kazemi, 2002) with some modifications. 0.2 mL of crude enzyme extract was reacted with 2.8 mL of catechol which was preheated at 30°C for 10 min. The concentration of catechol was 0.1 mol/L, which was dissolved by phosphate buffer (50 mmol/L, pH 6.4). The absorbance was estimated every one minute in a period of 3 min. The absorbance was increased by 0.01 as an enzyme unit for one minute in A378. POD activity was determined according to the method described by (Xu et al., 2013b) with some modifications. 0.2 mL of crude enzyme extract was mixed with 2.2 mL of guaiac which was preheated at 30°C for 10 min. 0.3 g of guaiac was added into phosphate buffer (50 mmol/L, pH 6.4). Finally, 0.6 mL of preheated H2O2 (30°C for 10 min) was added at last to initiate reaction. POD activity was calculated as described above. PAL activity was evaluated described by (Meng et al., 2008; Shao et al., 2013) with some modifications. 1 mL of crude enzyme extract was added into 3 mL of borate buffer as test group, while 1 mL of sterile water was added into 3 mL of borate buffer as the control. The absorbance values of the control and test groups were recorded. Then, 9
the mixture was heated at 37°C for 1 h and the absorbance values were noted again. The enzyme activity was calculated by subtracting the two absorbance values. An enzyme unit was defined as the change of A290 in 0.01 absorbance per minute. CAT activity was determined according to the method described by (Xu and Du, 2012) with some modifications. Zymolyte (2.8 mL of H2O2) was mixed with 0.2 mL of crude extract for 10 s. The absorbance was measured at every one minute interval for 3 min in A240. The enzyme activity was calculated as described above. APX activity was analyzed according to the method described by (Nakano and Asada, 1987). 20 μL of crude enzyme extract was blended with 3 mL of reaction buffer (50 mmol/L, pH 6.4 potassium phosphate buffer, 0.5 mmol/L, pH 7.0 AsA, 0.1 mol/L EDTA and 0.1 mmol/L mM H2O2). One unit was defined as the change of A290 of 0.01 per minute. GLU activity was analyzed using the method described by (Cao and Jiang, 2006). 250 μL of acetic acid buffer (50 mmol/L, pH 5.0) containing 0.2% laminarin was mixed with 250 μL of crude enzyme extract for 1 h at 37°C. Then, 0.5 mL of 3,5-dinitrosalicylic acid (DNS) was added into the mixture for 10 min in boiling water. After cooling, the absorbance was measured at 500nm. The amount of enzyme used for the hydrolysis of laminarin into 1 mg of glucose was determined as an enzyme unit in 1 h. The units of PPO, POD, CAT, PAL, APX and GLU activities were expressed as U per gram fresh tissue weight (U/g FW). 2.8. Analysis of the expression levels of defense-related genes in grapes Grapes and wound were treated as described in 2.7. Grape tissue samples were 10
collected after 0 (1 h after treatment), 1, 2, 3, 4, 5 and 6 days of treatment, respectively. 2 g of grape tissues was frozen immediately by liquid nitrogen and stored at -80°C for further RNA extraction. RNA was extracted according to the operation instructions of Spin Column Plant Total RNA Purification Kit (Sangon Biotech, Shanghai, China) with some modifications. 2 g of frozen grape tissues was ground into powder with liquid nitrogen in cold mortar. 450 μL of Buffer Rlysis-PG and powder were added into 1.5 mL RNase-free centrifuge tube and kept it at room temperature for 5 min. The mixture was centrifuged at 4°C, 12000 × g for 3 min. Supernatant was collected in a new 1.5 mL RNase-free centrifuge tube. To the supernatant, half the volume of absolute ethanol was added and vortexed to make them homogeneous. Then the adsorption column was put into the collection tube, all liquid was pipetted into the adsorption column and kept it at room temperature for 1min. After centrifugation, the remaining liquid in the collection tube was discarded. 500 μL of GT solution was added into the adsorption column and was static at room temperature for 1min. The mixture was centrifuged at 10,000 × g for 1 min at room temperature, the remaining liquid in the collection tube was discarded again. 500 μL of NT solution was added by repeating the step of GT solution. Then, the adsorption column was opened at room temperature for 5 min in order to evaporate the residual ethanol. 30 μL of Diethyl pyrocarbonate (DEPC)-treated ddH2O was added in the middle of the adsorption column, which was put into another 1.5 mL RNase-free centrifuge tube. RNA was collected by centrifuging at 4°C, 12000 × g for 2 min. 1% agarose gel was used to examine RNA contamination. Spectrophotometer (Thermo Scientific, CA, USA) was used to check the purity and 11
quantity of RNA at wavelengths of 260, and 280 nm. The concentration and integrity of RNA were evaluated using RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The RNA was kept at -80°C for further use.1000 ng of total RNA was used to synthesize cDNA with PrimeScript RT reagent kit with gDNA Eraser (Takara-Dalian, China). The cDNA was kept at -20°C. Specific primers were designed with the Primer premier 5.0 software (PREMIER Biosoft International, Palo Alto, CA, USA) and are listed in Table 1. RT-qPCR was operated at Biorad CFX96 Real Time PCR System (Applied Biosystems, USA). The program was set: initial denaturation at 95°C for 30 s, denaturation at 95℃ for 5 s, annealing at 60℃ for 10 s, primer extension at 72°C for 20 s, 40 cycles from the second step to the forth step. Amplification products were verified the specificity of the amplification at the end of the PCR reaction. Melting curve analyses were performed immediately. The melting cycle was 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s. The expression level was normalized as level of grape Actin, relative expression levels were calculated by the method of 2 −ΔΔC T (Livak and Schmittgen, 2001). RT-qPCR was analyzed according to three biological replicates. 2.9. Statistical analysis All statistical analyses were performed with statistical program SPSS/PC version17.0. In this study, data were analyzed with one-way analysis of variance (ANOVA) and a Student’s t-test. Mean separations performed with Tukey's test. The mean values and the standard error of the mean were calculated from the data obtained from two independent experiments. P < 0.05 means that differences are significant. All 12
treatments were designed randomly. 3. Results 3.1. Effect of Y. lipolytica at different concentrations on postharvest decay of table grapes caused by P. rubens Fig. 1 showed the effect of different concentrations of Y. lipolytica on the decay incidence and decay diameter caused by P. rubens in grape. Fig. 1A showed that Y. lipolytica significantly inhibited the decay incidence of grapes in a concentration dependent manner, compared with the control, and the higher the concentrations of Y. lipolytica, the lower the decay incidence. The decay incidence of grape wound treatment with Y. lipolytica at 1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL were 54.15%, 49.95%, 45.82%, 25.03% and 12.45%, respectively, which were significantly lower than that of the control (79.15%). With regard to decay diameter, Y. lipolytica showed similar trend to the decay incidence, the increase in the concentration of Y. lipolytica showed significantly reduced in decay diameter of the grape wound. When the concentration of Y. lipolytica was 1 × 109 cells/mL, the decay diameter of grape wound was 6.19 mm, while the decay diameter of the control was 13.91 mm (Fig. 1B). Though the highest inhibition efficacy was observed at 1 × 109 cells/mL of Y. lipolytica, 1 × 108 cells/mL has been used for further experiments due to high cost and inconsistent with reality in the application. 3.2. Effect of Y. lipolytica on OTA content produced by P. rubens in grapes As shown in Fig. 2, the content of OTA produced by P. rubens in grapes was increased with response to increase in number of days in the control group. Whereas the 13
grapes treated with Y. lipolytica showed significantly decreased the content of OTA production by P. rubens. After 17 days of treatment, the OTA contents of grapes treatment with Y. lipolytica was 0.32 ng/grape only, while OTA content of the control was 74.61 ng/grape. Compared with 8, 11 and 14 days of treatment, the OTA content of grapes treated with Y. lipolytica was significantly decreased at the seventeenth day of treatment. 3.3. Effect of different concentrations of Y. lipolytica on the spore germination rate and germ tube length of P. rubens treatment with Y. lipolytica As shown in Fig. 3, Y. lipolytica significantly decreased spore germination rate and germ tube length of P. rubens in vitro, and the higher the concentration of Y. lipolytica, the lower spore germination rate and the shorter germ tube length. Fig. 3A showed that the spore germination rate of P. rubens treatment with Y. lipolytica at different concentrations were lower than that of the control. When the concentration of Y. lipolytica was 1 × 109 cells/mL, the spore germination rate of P. rubens was 7.22%, while the spore germination rate of P. rubens was 83.39% for the control. Fig. 3B showed that at 1 × 109 cells/mL concentration of Y. lipolytica, the germ tube length of P. rubens was reduced drastically, which was only 1.25 μm. In brief, spore germination rate and germ tube length of P. rubens was significantly inhibited by Y. lipolytica. 3.4. Effect of Y. lipolytica on defense-related enzyme (PPO, POD, CAT, PAL, APX and GLU) activities in the wound of grapes As indicated in Fig. 4A, the trend of PPO activity in grapes treatment with Y. 14
lipolytica was increased from 0 to 2 days and then decreased to the lowest value at the third day and afterwards increased gradually until the 6 days, which was similar to the trend of the control. The results indicated that the PPO activity of grapes treatment with Y. lipolytica was generally higher than the control and was up to peak at the second day, which was 1.52-fold higher than the control. The trend of POD activity in the control and Y. lipolytica treated grapes was coherent. Both the control and treated grapes showed POD activities were up to peak at the first day (Fig. 4B). As shown in Fig. 4C, the CAT activity of grapes treated with Y. lipolytica was about 8.33-fold higher than the control at the third day. As for Fig. 4D, the value of PAL activity of grapes treated with Y. lipolytica was up to the maximum and was 1.38-fold higher than the control at the first day. APX activity both in the control and Y. lipolytica treated grapes was increased during the incubation for 3 days and then decreased from 3 to 5 days and then increased until 6 days. The APX activity of grapes treated with Y. lipolytica was generally higher than the control. The activity of APX reached the highest values at the third day (Fig. 4E). As shown in Fig. 4F, the change of GLU activity in grapes treated with Y. lipolytica was similar to that of the control. And the GLU activity of grapes treatment with Y. lipolytica was at 1.25 times of the control at the second day. The activities of all these defense-related enzymes in grapes treatment with Y. lipolytica were generally higher than that of the control during the whole storage period. 3.5. Effect of Y. lipolytica on the relative expression levels of defense-related (PPO, POD, CAT, PAL, APX and GLU) in grapes 15
As shown in Fig. 5A, the expression levels of PPO in grapes treatment with Y. lipolytica were up-regulated except for the forth day and fifth day, and were significantly up-regulated at the first day and was at 3.88 times of the control. Fig. 5B showed that the expression levels of POD in grapes treatment with Y. lipolytica were up-regulated except for the first day, and the expression levels of POD were up to peak and were at 1.76 times of the control at the third day. The expression levels of CAT in grapes treatment with Y. lipolytica were overall up-regulated compared with the control. The expression levels of CAT in grapes were 2.18-fold higher and 1.88-fold higher than the control at the third day and the second day, respectively (Fig. 5C). And the expression levels of PAL in grapes treatment with Y. lipolytica were up to peak at the first day, and was at 3.17 times of the control (Fig. 5D). As shown in Fig. 5E, the expression levels of APX in grapes treatment with Y. lipolytica were significantly increased at the first day and the second day, and were down-regulated compared with the control at the zero day and the fifth day. And the expression levels of APX reached the maximum at the second day. Except for the first day and the forth day, the expression levels of GLU were up-regulated compared with the control. The expression levels of GLU treatment with Y. lipolytica was at 1.85 times of the control and reached the maximum at the second day (Fig. 5F). Generally, the expression levels of PPO, POD, CAT, PAL, APX and GLU in table grapes treated with Y. lipolytica was higher than the control during the whole storage period. 4. Discussion A previous study showed that Y. lipolytica had an available biocontrol against P. 16
expansum, B. cinerea on apples (Zhang et al., 2017). And Y. lipolytica can effectively suppress postharvest decay caused by T. Rugulosus in grapes (Yang et al., 2017). However, the biocontrol efficacy of Y. lipolytica on postharvest decay of grapes caused by P. rubens is not reported yet. This study demonstrated that Y. lipolytica had a significant biocontrol on the postharvest decay caused by P. rubens in grapes. The results showed that Y. lipolytica can reduce decay incidence and decay diameter of grapes caused by P. rubens, and the higher the concentration of Y. lipolytica, the lower the decay incidence of grape wound and the shorter the decay diameter of grape wound, and the result is in accordance with (Yan et al., 2018), who reported that the efficacy of antagonistic yeasts on inhibiting postharvest diseases caused by pathogens on fruits was depend on the concentration of the yeast. The data revealed that OTA content produced by P. rubens can be decreased by the application of Y. lipolytica. Similarly, Saccharomyces cerevisiae significantly reduced OTA content produced by Aspergillus niger and Aspergillus ochraceus without impair in the quality of coffee (Velmourougane et al., 2011). Therefore, Y. lipolytica might be developed as an antifungal biopesticide for postharvest decay management in grapes. To further understand the mechanisms of Y. lipolytica controlling the postharvest decay of grapes, the effect of Y. lipolytica on spore germination rate and germ tube length of P. rubens in vitro was investigated further. The results suggested that Y. lipolytica significantly inhibited spore germination rate and germ tube length of P. rubens in PDB media. Similarly, results have been reported that spore germination rate of B. cinerea in PDB media was significantly inhibited by Rhodotorula glutinis (Zhang et al., 2007). 17
It was reported that antagonistic yeasts could induce and enhance defense-related enzyme activities or produce lignin and phytoalexin (Guo et al., 2015). PPO, POD, CAT, PAL, APX and GLU are very important defense-related enzyme in fruits, and these enzymes activities are related with disease resistance in plants (Qin et al., 2015; Zhang et al., 2016a). Moreover, the levels of these enzymes activities were related to the levels of gene expression. PPO and PAL play important roles in the defense mechanism of host plants and involve in phenolic metabolism in plants, which can oxide phenol into toxicant quinone (Maffei et al., 2006). PAL is key enzyme in the pathway of synthesizing phenylpropane in fruits and vegetables, which often is used as a biochemical indicator of disease resistance (Navarre et al., 2013). PAL also could contribute to synthesis of lignin, so PAL is used as a kind of important defense-related enzymes that contribute to the production of lignin. POD, CAT and APX, which belong to antioxidases, play an important role in defense response of plants. These three enzymes all can scavenge reactive oxygen species (ROS) in order to protect cells and tissue from damages caused by free radicals, such as O2- and H2O2, O2- is converted to H2O2 by the action of superoxide (SOD), whereas H2O2 is destroyed predominantly by POD, CAT and APX (Gill and Tuteja, 2010). POD can synthesize lignin and phytoalexin, making cell wall reinforce (Ge et al., 2015). All of these enzymes are considered as key enzymes in host defense reactions and protect host from pathogen infections. GLU, as one of the pathogenesis related proteins (Romero et al., 2006), can hydrolyzed the cell wall components of fungi, such as β-1,3 glucan. In the process of glucan hydrolysis, some small molecule could induce host disease 18
resistance (Mauch et al., 1988). In this study, Y. lipolytica could induce PPO, POD, CAT, PAL, APX and GLU activities of grapes and enhanced those enzyme activities of grapes. Furthermore, the results showed that the expression levels of PPO and POD of grapes treatment with Y. lipolytica were up-regulated during the period of storage. Intensities of up-regulated gene expression are higher, the enzyme activities are stronger (Lin et al., 2011). The change of the expression levels of PAL and GLU coincided with PAL and GLU enzyme activities. The expression levels of PAL could elucidate the trend of enzyme activity, and the expression levels of GLU enhanced the GLU activity as elicitors (Landi et al., 2014). CAT was involved in inducing resistance responses in tomato fruit by regulating ROS production and increasing expression of up-regulated gene (Fan et al., 2016). Results showed that the expression levels of CAT in grapes in Y. lipolytica treatment group were significantly higher than that of the control during the whole storage period. The expression of APX was related to decrease in the H2O2 content and elucidate the expression of up-regulated gene involved in ascorbic acid synthetic metabolism to induce resistance responses in peach (Wang et al., 2014). Therefore, the levels of defense-related gene expression and its corresponding enzyme activity are closely related, and they play a very important role in enhancing the resistance of the fruits. In conclusion, Y. lipolytica has great potential as a biocontrol agent for postharvest decay of grape fruits caused by P. rubens. Y. lipolytica competed with P. rubens for space and nutrition, further inhibited spore germination and growth of pathogens. Activities of defense-related enzyme (PPO, POD, CAT, PAL, APX and 19
GLU) treatment with Y. lipolytica are enhanced and improved the disease resistance of grape fruits. And Y. lipolytica can also induce the expression levels of defense-related genes in grapes and improved the resistance of fruits. The mechanisms of the effect of Y. lipolytica on postharvest decay of grape fruits caused by P. rubens need further research, particularly at the molecular level. Acknowledgements This research was supported by the National Natural Science Foundation of China (31701971), the China Postdoctoral Science Foundation (2018M630532) and 333 High-Level Personnel Training Project of Jiangsu Province (BRA2017442). Conflict of interest The authors declare that there are no conflicts of interest. Reference Bejaoui, H., Mathieu, F., Taillandier, P., A, 2010. Biodegradation of Ochratoxin A by Aspergillus Section Nigri Species Isolated from French Grapes: a Potential Means of Ochratoxin A Decontamination in Grape Juices and Musts. FEMS Microbiol. Lett. 255, 203-208. Cao, J., Jiang, W., 2006. Induction of Resistance in Yali Pear (Pyrus bretschneideri Rehd.) Fruit against Postharvest Diseases by Acibenzolar- S -methyl Sprays on Trees during Fruit Growth. Sci Hortic-Amsterdam 110, 181-186. Droby, S., Chalutz, E., Wilson, C.L., Wisniewski, M., 1989. Characterization of the Biocontrol Activity of Debaryomyces hansenii in the Control of Penicillium digitatum on Grapefruit. Revue Canadienne De Microbiologie 35, 794-800. Droby, S., Vinokur, V., Weiss, B., Cohen, L., Daus, A., Goldschmidt, E.E., Porat, R., 2002a. Induction of Resistance to Penicillium digitatum in Grapefruit by the Yeast Biocontrol Agent Candida oleophila. Phytopathology 92, 393-399. Droby, S., Vinokur, V., Weiss, B., Cohen, L., Daus, A., Goldschmidt, E.E., Porat, R., 2002b. Induction of Rresistance to Penicillium digitatum in Grapefruit by the Yeast Biocontrol Agent Candida oleophila. Phytopathology 92, 393-399. Duarte-Sierra, A., Aispuro-Hernandez, E., Vargas-Arispuro, I., Islas-Osuna, M.A., Gonzalez-Aguilar, G.A., Martinez-Tellez, M.A., 2016. Quality and PR Gene Expression of Table Grapes Treated with Ozone and Sulfur Dioxide to Control Fungal Decay. J Sci Food Agr. 96, 2018-2024. Fan, L., Shi, J., Zuo, J., Gao, L., Lv, J., Wang, Q., 2016. Methyl Jasmonate Delays 20
Postharvest Ripening and Senescence in the Non-climacteric Eggplant (Solanum melongena L.) Fruit. Postharvest Biol. Technol. 120, 76-83. Ge, Y., Deng, H., Bi, Y., Li, C., Liu, Y., Dong, B., 2015. Postharvest ASM Dipping and DPI Pre-treatment Regulated Reactive Oxygen Species Metabolism in Muskmelon (Cucumis melo L.) Fruit. Postharvest Biol. Technol. 99, 160-167. Gill, S.S., Tuteja, N., 2010. Reactive Oxygen Species and Antioxidant Machinery in Abiotic Stress Tolerance in Crop Plants. Plant Physiol Bioch 48, 909-930. Guo, M., Feng, J., Zhang, P., Jia, L., Chen, K., 2015. Postharvest Treatment with Trans-2-hexenal Induced Resistance against Botrytis cinerea in Tomato Fruit. Australas Plant Path 44, 121-128. HashemAbeer, Abd-Allah, E.F., Al-Obeed, R.S., Mridha, M.A.U., Al-Huqail, A., 2013. Non-chemical Strategies to Control Postharvest Losses and Extend the Shelf Life of Table Grape Fruits. Biol Agric Hortic 29, 82-90. Karabulut, O.A., Smilanick, J.L., Gabler, F.M., Mansour, M., Droby, S., 2007. Near-Harvest Applications of Metschnikowia fructicola, Ethanol, and Sodium Bicarbonate to Control Postharvest Diseases of Grape in Central California. Plant Dis. 87, 1384-1389. Landi, L., Feliziani, E., Romanazzi, G., 2014. Expression of Defense Genes in Strawberry Fruits Treated with Different Resistance Inducers. J Agric Food Chem 62, 3047-3056. Lasram, S., Oueslati, S., Mliki, A., Ghorbel, A., Silar, P., Chebil, S., 2012. Ochratoxin A and Ochratoxigenic Black Aspergillus Species in Tunisian Grapes Cultivated in Different Geographic Areas. Food Control 25, 75-80. Li, Q., Li, C., Li, P., Zhang, H., Zhang, X., Zheng, X., Yang, Q., Apaliya, M.T., Serwah, B.N.A., Sun, Y., 2017. The Biocontrol Effect of Sporidiobolus pararoseus Y16 against Postharvest Diseases in Table Grapes Caused by Aspergillus niger and the Possible Mechanisms Involved. Biol. Control 113, 18-25. Lin, J., Gong, D., Zhu, S., Zhang, L., Zhang, L., 2011. Expression of PPO and POD genes and Contents of Polyphenolic Compounds in Harvested Mango Fruits in Relation to Benzothiadiazole-induced defense against anthracnose. Sci Hortic-Amsterdam 130, 85-89. Livak, K.J., Schmittgen, T.D., 2001. Analysis of Relative Gene Expression Data Using Real-time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408. Lu, L., Ye, C., Guo, S., Sheng, K., Shao, L., Zhou, T., Yu, T., Zheng, X., 2013. Preharvest Application of Antagonistic Yeast Rhodosporidium paludigenum Induced Resistance against Postharvest Diseases in Mandarin Orange. Biol. Control 67, 130-136. Maffei, A., Nataraj, K., Nelson, S.B., Turrigiano, G.G., 2006. Potentiation of Cortical Inhibition by Visual Deprivation. Nature 443, 81-84. Mari, M., Martini, C., Spadoni, A., Rouissi, W., Bertolini, P., 2012. Biocontrol of Apple Postharvest Decay by Aureobasidium pullulans. Postharvest Biol. Technol. 73, 56-62. 21
Mauch, F., Mauchmani, B., Boller, T., 1988. Antifungal Hydrolases in Pea Tissue : II. Inhibition of Fungal Growth by Combinations of Chitinase and beta-1,3-Glucanase. Plant Physiol. 88, 936-942. Mcgrath, M.T., Thind, T.S., 2012. Challenge of Fungicide Resistance and Anti-resistance Strategies in Managing Vegetable Diseases in the USA. Fungicide Resistance in Crop Protection Risk & Management. Meng, X., Li, B., Jia, L., Tian, S., 2008. Physiological Responses and Quality Attributes of Table Grape Fruit to Chitosan Preharvest Spray and Postharvest Coating during Storage. Food Chem. 106, 501-508. Mohammadi, M., Kazemi, H., 2002. Changes in Peroxidase and Polyphenol Oxidase Activities in Susceptible and Resistant Wheat Heads Inoculated with Fusarium graminearum and Induced Resistance. Plant Sci 162, 491-498. Nakano, Y., Asada, K., 1987. Purification of Ascorbate Peroxidase in Spinach Chloroplasts; Its Inactivation in Ascorbate-Depleted Medium and Reactivation by Monodehydroascorbate Radical. Plant Cell Physiol. 131-140. Nallya, M.C., Maturano, Y.P., Muñoz, C.J., Combina, M., Toro, M.E., Figueroa, L.I.C.D., Vazquez, F., 2012. Biocontrol of Botrytis cinerea in Table Grapes by Non-pathogenic Indigenous Saccharomyces cerevisiae Yeasts Isolated from Viticultural Environments in Argentina. Postharvest Biol. Technol. 64, 40-48. Navarre, D.A., Payyavula, R.S., Shakya, R., Knowles, N.R., Pillai, S.S., 2013. Changes in Potato Phenylpropanoid Metabolism during Tuber Development. Plant Physiol Bioch 65, 89-101. Qin, X., Xiao, H., Xue, C., Yu, Z., Yang, R., Cai, Z., Si, L., 2015. Biocontrol of Gray Mold in Grapes with the Yeast Hanseniaspora uvarum alone and in Combination with Salicylic Acid or Sodium Bicarbonate. Postharvest Biol. Technol. 100, 160-167. Romanazzi, G., Lichter, A., Gabler, F.M., Smilanick, J.L., 2012. Recent Advances on the Use of Natural and Safe Alternatives to Conventional Methods to Control Postharvest Gray Mold of Table Grapes. Postharvest Biol. Technol. 63, 141-147. Romero, I., Sanchez-Ballesta, M.T., Maldonado, R., Escribano, M.I., Merodio, C., 2006. Expression of Class I Chitinase and β-1,3-glucanase Genes and Postharvest Fungal Decay Control of Table Grapes by High CO2 Pretreatment. Postharvest Biol. Technol. 41, 9-15. Shao, X., Wang, H., Xu, F., Cheng, S., 2013. Effects and Possible Mechanisms of Tea Tree Oil Vapor Treatment on the Main Disease in Postharvest Strawberry Fruit. Postharvest Biol. Technol. 77, 94-101. Velmourougane, K., Bhat, R., Gopinandhan, T.N., Panneerselvam, P., 2011. Management of Aspergillus ochraceus and Ochratoxin-A Contamination in Coffee during on-farm Processing through Commercial Yeast Inoculation. Biol. Control 57, 215-221. Wang, K., Shao, X., Gong, Y., Xu, F., Wang, H., 2014. Effects of Postharvest Hot Air Treatment on Gene Expression Associated with Ascorbic Acid Metabolism in Peach Fruit. Plant Mol Biol Rep 32, 881-887. 22
Xu, B., Zhang, H., Chen, K., Xu, Q., Yao, Y., Gao, H., 2013a. Biocontrol of Postharvest Rhizopus Decay of Peaches with Pichia caribbica. Curr. Microbiol. 67, 255-261. Xu, B., Zhang, H., Chen, K., Xu, Q., Yao, Y., Gao, H., 2013b. Biocontrol of Postharvest Rhizopus Decay of Peaches with Pichia caribbica. Curr. Microbiol. 67, 255-261. Xu, L., Du, Y., 2012. Effects of Yeast Antagonist in Combination with UV-C treatment on Postharvest Diseases of Pear Fruit. Biol. Control 57, 451-461. Yan, Y., Zhang, X., Zheng, X., Apaliya, M.T., Yang, Q., Zhao, L., Gu, X., Zhang, H., 2018. Control of Postharvest Blue Mold Decay in Pears by Meyerozyma guilliermondii and It’s Effects on the Protein Expression Profile of Pears. Postharvest Biol. Technol. 136, 124-131. Yang, Q., Wang, H., Zhang, H., Zhang, X., Apaliya, M.T., Zheng, X., Mahunu, G.K., 2017. Effect of Yarrowia lipolytica on Postharvest Decay of Grapes Caused by Talaromyces rugulosus and the Protein Expression Profile of T. rugulosus. Postharvest Biol. Technol. 126, 15-22. Yao, H.J., Tian, S.P., 2005. Effects of a Biocontrol Agent and Methyl Jasmonate on Postharvest Diseases of Peach Fruit and the Possible Mechanisms Involved. J. Appl. Microbiol 98, 941–950. Zhang, H., Chen, L., Sun, Y., Zhao, L., Zheng, X., Yang, Q., Zhang, X., 2017. Investigating Proteome and Transcriptome Defense Response of Apples Induced by Yarrowia lipolytica. Molecular plant-microbe interactions: Mol Plant Microbe In 30, 301. Zhang, H., Wang, L., Dong, Y., Jiang, S., Cao, J., Meng, R., 2007. Postharvest Biological Control of Gray Mold Decay of Strawberry with Rhodotorula glutinis. Biol. Control 40, 287-292. Zhang, Q., Yong, D., Zhang, Y., Shi, X., Li, B., Li, G., Liang, W., Wang, C., 2016a. Streptomyces Rochei A-1 Induces Resistance and Defense-related Responses against Botryosphaeria dothidea in Apple Fruit during Storage. Postharvest Biol. Technol. 115, 30-37. Zhang, X., Li, Y., Wang, H., Gu, X., Zheng, X., Wang, Y., Diao, J., Peng, Y., Zhang, H., 2016b. Screening and Identification of Novel Ochratoxin A-Producing Fungi from Grapes. Toxins (Basel) 8, 333. Zhao, L., Sun, Y., Yang, D., Li, J., Gu, X., Zhang, X., Zhang, H., 2018. Effects of Sporidiobolus pararoseus Y16 on Postharvest Blue Mold Decay and the Defense Response of Apples. J Food Quality 2018, 1-9.
23
Figure Captions Fig. 1 Effect of different concentrations of Y. lipolytica on controlling postharvest decay caused by P. rubens of table grapes. Decay incidence (a) and decay diameter (b) were measured after 6 days incubation at 20°C, RH 95%. CK: the control, the letters of A, B, C, D and E represent the concentrations of Y. lipolytica at 1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL respectively. Each value is the mean of three replicates of thirty six grapes. Bars represent the standard error of the mean. Data in columns with the different letters are significantly different according to Tukey's test at P < 0.05.
Fig. 2 Effect of Y. lipolytica on OTA content produced by P. rubens in table grapes. Each value is the mean of three replicates of thirty six grapes. Bars represent standard errors. CK: the control. Y: grapes treatment with Y. lipolytica. Data in columns with the different letters are significantly different according to Tukey's test at P < 0.05.
Fig. 3 Effect of different concentration of Y. lipolytica on spore germination rate (a) and germ tube length (b) of P. rubens in vitro. CK: the control, the letters of A, B, C, D and E represent the concentrations of Y. lipolytica at 1 × 105, 1 × 106, 1 × 107, 1 × 108 and 1 × 109 cells/mL respectively. Bars represent standard errors. Data in columns with different letters are statistically different according to Tukey's test at P < 0.05.
Fig. 4 Effect of Y. lipolytica on defense-related enzyme activities in the wound of table grapes. (a), (b), (c), (d), (e) and (f) represent polyphenoloxidase (PPO), peroxidase 24
(POD), catalase (CAT), phenylalanine ammonialyase (PAL), ascorbate peroxidase (APX) and β-1,3 glucanase (GLU) respectively. CK: the control. Y: grapes treatment with Y. lipolytica. Each value is the mean of three replicates of six grapes. Bars represent standard errors.
Fig. 5 Relative expression levels of (a) polyphenoloxidase (PPO), (b) peroxidase (POD), (c) catalase (CAT), (d) phenylalanine ammonialyase (PAL), (e) ascorbate peroxidase (APX) and (f) β-1,3 glucanase (GLU) in table grapes treatment with Y. lipolytica. CK: grapes treatment with sterile distilled water as the control. Y: grapes treatment with Y. lipolytica. Each value is the mean of three replicates of six grapes. Bars represent standard errors.
25
Fig. 1
Decay incidence (%)
(a) 90 80 70 60 50 40 30 20 10 0
a
b b
b c
c
CK
A
B C Treatments
D
E
(b)
Decay diameter (mm)
16 14 12
a ab
10
bc
8
c d
6 e
4 2 0 CK
A
B C Treatments
D
E
26
Fig. 2
80
CK
OTA content (ng/grape)
70
Y a
60
a
50 40 30 b
20 10
c
c
b
a
a
0 8
11 Time (d)
14
17
27
Fig. 3 (a)
Spore germinaton rate (%)
100 90 80 70 60 50 40 30 20 10 0
a
b
c cd
CK
A
B
C Treatments
d
d
D
E
(b) 14 Germ tube length (um)
12
a
10 8 6 4
b
2
b
bc cd
0
CK
A
B
C Treatments
D
d
E
28
CK
6
a
Y
a b b c
c
c
b
c c
b c
c
c
0
1
2 3 4 5 Treatment time(d)
b b
3
b b
2
c
b
b
b b
1
c
0
1
2 3 4 5 Treatment time(d)
3.5 PAL activity (U/g FW）
CAT activity (U/g FW)
a
Y a
0.4
a b
0.3
b
a
c
b
c
0.1
b
a
b
a
b
0
1
2 3 4 5 Treatment time(d）
6
a
CK
3
Y b
2.5
b
2
1.5
b
a
b
1 0
b
c c
0.5
6
b
b c
c
0
(e)
APX activity(U/g FW)
b
b
4
CK
0.5
11 10 9 8 7 6 5 4 3 2 1
a
(d)
0.6
0
Y
5
0
6
(c)
0.2
CK
a
1
2 3 4 5 Treatment time(d)
6
(f) CK
b
a
Y
a
a
a
c c
c
d
0
b
b
d
1
c
2 3 4 5 Treatment time(d)
CK
0.6
d
GLUactivity (U/g FW)
40 35 30 25 20 15 10 5 0
(b)
POD activity (U/g FW)
PPO activity (U/g FW)
Fig. 4 (a)
a
a
0.4
a
0.3 0.2 0.1
b b
b b
b
0 6
a
Y
0.5
0
1
b b
b
b
2 3 4 5 Treatment time(d)
29
6
Fig. 5 (a)
(b)
Relative expression of PPO
Y
Relative expression of POD
CK
4.5 4 3.5 3 2.5 2 1.5 1 0.5 0
a
b b
0
1
b c
c
2 3 4 Time (d)
5
b
1.8
CK
a
Y
1.5 1.2
b
b
b
0.9
b
b
5
6
0.6 c
0.3 0
6
0
(c)
1
2
3 4 Time (d)
(d)
3.5
CK
3
4 3.5 3 2.5 2 1.5 1 0.5 0
Y
a a
2.5 2
b
1.5 c
1
c
c
c
0.5 0 0
1
2 3 4 Time (d)
5
6
CK
Y
CK
Relative expression of PAL
Relative expression of CAT
(e) Y
a
b b
b
b
0
1
2
c
c
3 4 Time (d)
5
6
(f)
3 a
2.5 2 b
1.5 1
0.5
b
b
b
b c
0
0
1
2 3 4 Time (d)
5
6
Relative expression of GLU
Relative expression of APX
3.5
2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
CK
Y
a
b
b b
b c
0
1
c
2 3 4 Time (d) 30
5
6
Table 1 Primer design of defense-related genes in grapes Gene Name
Accession number
PPO
NM_001281116.1
APX
XM_010655137.1
GLU
XM002274792.2
CAT
KP271927.1
PAL
KU162977.1
POD
MVKN7XNT014
ACTIN
XM_002277287.3
Primer
Primer Sequence (5’ → 3’)
Tm (OC)
qRT-PPO-F
5'GTCCCCGTAGCCAGAAACC 3'
59.5
qRT-PPO-R
5'AGCAGCACCATACAGCCCT 3'
62.4
qRT-APX-F
5'TTCAAAAAATCCAACGGTCG 3'
52.4
qRT-APX-R
5'TTCTGGTACTCCTCGCTCACA 3'
58.9
qRT-GLU-F
5'GGGGTTATTTGGATCCCATCATGT3'
54.5
qRT-GLU-R
5'CAGAAGCGGCGACTTATTGTCT3'
57.5
qRT-CAT-F
5'ATGTGCTGATTTCCTTCGTACC 3'
55.1
qRT-CAT-R
5'GTCAACAACTCTCCAATACTCCTG 3’
56.7
qRT-PAL-F
5’ AACCGAATCAAGGAGTGC 3’
54.1
qRT-PAL-R
5’ ACTGAGACAATCCAGAAGAG 3’
53.9
qRT-POD-F
5’ AGTTGGCTGGAGTTGTTGCT3’
57.2
qRT-POD-R
5’ GTGATCGCATCCTTTGGTGG3’
56.8
ACTIN-F
5' TTCAATAAGGAGAAGATGGTGGA3'
53.8
ACTIN-R
5' TTGGTGAGGTAGTCTGTGAGGTC3'
54.8
Product Length (bp) 171
170
213
251
151
189
232
31
Author Statement Hongyin Zhang conceived and designed the experiments. Meiyan Wang performed the experiments and wrote the manuscript. Manuscript was mainly modified by Lina Zhao and Xiaoyun Zhang. Solairaj Dhanasekaran and Mandour H Abdelhai provided amendments. Qiya Yang and Zhenhui Jiang contributed to regents, material and data analysis.
32
Highlights Y. lipolytica significantly controlled decay caused by P. rubens of grapes Y. lipolytica significantly reduced OTA content produced by P. rubens of grapes Spore germination and germ tube length of P. rubens were inhibited by Y. lipolytica PPO, POD, PAL, APX, GLU and CAT activities of grapes were induced by Y. lipolytica The expression levels of defense-related genes were up-regulated by Y. lipolytica
33