Study on the molecular mechanism of antinociception induced by ghrelin in acute pain in mice

Peptides 83 (2016) 1–7

Contents lists available at ScienceDirect

Peptides journal homepage: www.elsevier.com/locate/peptides

Study on the molecular mechanism of antinociception induced by ghrelin in acute pain in mice Fu-Yan Liu a,1 , Min-min Zhang a,1 , Ping Zeng a , Wen-wen Liu a , Jing-lei Wang a , Bei Yang a , Qun Dai b , Jie Wei a,∗ a b

Department of Physiology, Medical College of Nanchang University, Bayi Road 461, Nanchang, Jiangxi, 330006, China Medical Experimental Teaching Department, Nanchang University, Nanchang 330031, China

a r t i c l e

i n f o

Article history: Received 16 November 2015 Received in revised form 24 July 2016 Accepted 25 July 2016 Available online 26 July 2016 Keywords: Ghrelin GHS-R1␣ Opioid receptors Antinociception Transcriptional expression Protein expression

a b s t r a c t Ghrelin has been identified as the endogenous ligand for the GHS-R1␣ (growth hormone secretagogue receptor 1 alpha). Our previous experiments have indicated that ghrelin (i.c.v.) induces antinociceptive effects in acute pain in mice, and the effects were mediated through the central opioid receptors and GHS-R1␣. However, which opioid receptor (OR) mediates the antinociceptive effects and the molecular mechanisms are also needed to be further explored. In the present study, the antinociceptive effects of ghrelin (i.c.v.) could be fully antagonized by ␦-opioid receptor antagonist NTI. Furthermore, the mRNA and protein levels of ␦-opioid peptide PENK and ␦-opioid receptor OPRD were increased after i.c.v injection of ghrelin. Thus, it showed that the antinociception of ghrelin was correlated with the GHS-R1␣ and ␦-opioid receptors. To explore which receptor was firstly activated by ghrelin, GHS-R1␣ antagonist [DLys3 ]-GHRP-6 was co-injection (i.c.v.) with deltorphin II (selective ␦-opioid receptor agonist). Finally, the antinociception induced by deltorphin II wasn’t blocked by the co-injection (i.c.v.) of [D-Lys3 ]-GHRP-6, indicating that the GHS-R1␣ isn’t on the backward position of ␦-opioid receptor. The results suggested that i.c.v. injection of ghrelin initially activated the GHS-R1␣, which in turn increased the release of endogenous PENK to activation of OPRD to produce antinociception. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Ghrelin, an acylated 28-amino-acid peptide, has been identified as the endogenous peptide ligand which binds to GH secretagogue receptor (GHS-R) [11]. Ghrelin has gained increasing attention as a brain-gut hormone since it was discovered from endocrine cells of the stomach in rats in 1999 [12,10]. GHS-R includes two forms: GHS-R1␣ and GHS-R1␤ [19]. Almost all the documented activities of ghrelin have been discovered to bind to GHS-R1␣ whose selective antagonist is [D-Lys3 ]-GHRP-6 [10,3,17]. Ghrelin and its receptor GHS-R1␣ express in many other organs, such as ovaries and testis [2,18], liver, lung [7], kidney, etc. [26]. Ghrelin is characterized with

Abbreviations: GHS-R1␣, growth hormone secretagogue receptor 1 alpha; ␤FNA, ␤-funaltrexamine; NTI, naltrindole; nor-BNI, nor-binaltorphimine; POMC, proopiomelanocortin; OPRM, ␮-opioid receptor; PENK, proenkephalin; OPRD, ␦-opioid receptor; PDYN, prodynorphin; OPRK, ␬-opioid receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. ∗ Corresponding author. E-mail address: [email protected] (J. Wei). 1 Joint first authors. http://dx.doi.org/10.1016/j.peptides.2016.07.006 0196-9781/© 2016 Elsevier Inc. All rights reserved.

the presence of an n-octanoylation on the position of Ser3 [3]. The special structure is important for ghrelin’s physiological activities and help ghrelin to cross the blood-brain barrier (BBB) [21,1]. Ghrelin displays several physiological functions through GHSR1␣, such as promoting food intake [28] and GH, prolactin (PRL), ACTH secretion [20,21], regulating of cardiovascular roles, etc. [14]. Furthermore, The mRNAs or proteins of GHS-R1␣ and ghrelin have been shown to express in central nervous system such as the midbrain, the medulla oblongata, the sensorimotor area of the cortex and the hypothalamus, where is the regions relating to pain transmission [5,25,31]. Therefore, researchers have been interested in the role and mechanisms of ghrelin in the modulation of pain perception. Ghrelin has been reported to suppress the inflammatory pain through the central opioid receptors and other receptors [22,23]. Other studies have showed that ghrelin prevents mechanical hyperalgesia and cachexia induced by cisplatin [6], attenuates chronic neuropathic pain [8,13,30], and reduces diabetic neuropathy, etc. [24]. In our previous experiments, i.c.v. injection of ghrelin (1 nmol) can evoked antinociceptive effects, which are mediated through

2

F.-Y. Liu et al. / Peptides 83 (2016) 1–7

the central opioid system and GHS-R1␣ in acute pain in mice [27]. In addition, our further study has revealed that ghrelin (i.c.v.) can attenuate the antionciception of morphine which is administrated at the peripheral leval [29]. However, less attention has been given to investigate which opioid receptor (OR) mediates the antinociceptive effects of ghrelin. It is still unclear which receptor activated firstly and which receptor activated secondly by ghrelin. Moreover, the molecular mechanisms of antinociception induced by ghrelin (i.c.v.) are not known. So, in the present study, various opioid receptor antagonists will be used to explore which opioid receptors are involved in the antinociceptive effects of ghrelin (i.c.v.). It will be investigated which receptor was activated by ghrelin firstly in this test. Moreover, the methods of quantitative Real-Time PCR (qRT-PCR) and Western blot will be used to investigate the molecule mechanisms of antinociceptive effects after i.c.v. injection of ghrelin in mice. The present study examined effects of the opioid receptor antagonists, naloxone (general), beta-funaltrexamine (mu), naltrindole (delta) and nor-binaltorphamine (kappa) upon the antinociceptive effects of ghrelin.

Table 1 Sequences and the sizes of forward (F) and reverse (R) primers of target genes for quantitative real-time PCR. Gene

Sequences

Ghrelin(F) Ghrelin(R) GHSR(F) GHSR(R) POMC(F) POMC(R) Oprm(F) Oprm(R) PENK(F) PENK(R) Oprd(F) Oprd(R) PDYN(F) PDYN(R) Oprk1(F) Oprk1(R) GAPDH(F) GAPDH(R)

GAATCCAAGAAGCCACCAGC ACAGCTTGATGCCAACATCG GAGATCGCGCAGATCAGTCA GAAGTTTGAACACGGCCACC AGATTCAAGAGGGAGCTGGA CTTCTCGGAGGTCATGAAGC ATCCTCTCTTCTGCCATTGGT TGAAGGCGAAGATGAAGACA AACAGGATGAGAGCCACTTGC CTTCATCGGAGGGCAGAGACT AACCTCTCGGACGCCTTTC CGATGCCAAACATGACGAGC CGGAACTCCTCTTGGGGTAT TTTGGCAACGGAAAAGAATC CCGATACACGAAGATGAAGAC GTGCCTCCAAGGACTATCGC AGGAGCGAGACCCCACTAACAT GTGATGGCATGGACTGTGGT

Size (bp) 142 127 159 148 474 172 154 342 313

2. Materials and methods 2.1. Animals Male Kunming mice, weighing 18–22 g was provided by the Laboratory Animal Center of Medical College of Nanchang University. The experiments were all approved by the Ethics Committee of Animal Experiments at Nanchang University. Mice were housed under standard laboratory conditions in a 12/12 h light-dark cycles with standard water and food ad libitum. The mice must adapt to this surroundings for at least 3 days before the study. All tests were undertaken during the light (09:00-16:00). The mice were used only once. All efforts were taken to minimize the suffering and number of mice which were used in the following experiments. 2.2. Peptides and compounds Ghrelin, [D-Lys3 ]-GHRP-6 and deltorphin II were purchased from Phoenis Pharmaceuticals, Inc. Naloxone hydrochloride dihydrate was purchased from Fluka, ␤-funaltrexamine hydrochloride (␤-FNA), nor-binaltorphimine dihydrochloride (nor-BNI) and naltrindole hydrochloride (NTI) were purchased from Sigma. ␤-FNA, nor-BNI and NTI are the antagonists of opioid receptors. All drugs were freshly dissolved in physiological saline solution. 2.3. Drugs injection procedure The approach of intracerebroventricular (i.c.v.) administration was operated as described by Haley and McCormick [9]. Mice received 3 ␮l i.c.v. injection of drugs using the 25 ␮l microsyringe. The constant rate of injection was 10 ␮l/min. After behavioral testing, the right injection site was confirmed by injection of methylene blue dye. 2.4. Tail withdrawal test According to our previous similar experiments [27], the antinociceptive effects of the drugs were measured using the tail withdrawal test. The behavioral tester was uninformed of the specific drug conditions at testing. The tail of mouse was immerged in water set at 48.5 ± 0.5 ◦ C. The time before the mice withdraw the tail from the water was set as the tail withdrawal latency (TWL). The latency of mouse was measured through putting its tail into the water and measuring the response time. Those mice were selected whose baseline latency was 3–5 s for following study. A cut-off

latency time was set at 15 s to minimize tail damage. The measurements of post-drug latency were executed at 5, 10, 20, 30, 40, 50 and 60 min. After testing, the proper injection site was confirmed by injection of methylene blue dye. Only the results with right i.c.v. injection sites in mice were used in the study. Data are expressed as the maximum percentage effect (MPE) calculated as: MPE (%) = 100 × [(post-drug response−baseline response)/(cut-off response−baseline response)]. The original data were calculated to area under the curve (AUC) over the period 0–60 min. The data were showed as mean value ± SEM of every group of 8–12 mice. 2.5. Tissue preparation In our study, the best antinociceptive effect of ghrelin (1nmol) emerged around 10 min after i.c.v. injection. The antinociception of ghrelin (1nmol) after i.c.v. injection was within 20 min. So, the points-in-time of 5, 10 and 20 minafter i.c.v. administration of drugs were selected for next research. As a control, 3 ␮l physiological saline was conducted into the intracerebroventricular sites in mice. After administration of drugs, the mice were decapitated at the exact point-in-time. The right site of injection was confirmed by microstructure measurement. Then the brain samples which were injected ghrelin or physiological saline were rapidly transferred and stored at −80 ◦ C for further researches. 2.6. Total RNA isolation and quantitative real-time PCR (qRT-PCR) The total RNA was extracted from the brain samples with Trizol Reagent (TaKaRa, China), and the RNA sample were reversetranscribed in a 20 ␮l reaction mixture (TaKaRa, China). The primers used are listed in Table 1. The mRNA levels of these genes were evaluated by qRT-PCR with an internal control of GAPDH. QRT-PCR was performed in a 20 ␮l reaction volume using the 7500 Fast Real-Time PCR System. Negative controls consisted of samples with distilled water which replaced cDNA template. The thermalcycling criteriafor qRT-PCR were: 95 ◦ C for 30s, followed closely by 40cycles at 95 ◦ Cfor 5s, 60 ◦ C for 34 s and 1cycles at 95 ◦ C for 15 s, 60 ◦ Cfor 1 min, end up with 95 ◦ C for 15 s. The purity of PCR products were confirmed by the analysis of melting curve and agarose gel electrophoresis results. The raw Ct (threshold cycle) was selected to quantitative analysis using the 2−Ct method [15]. Each reaction was conducted in triplicate and reduplicated at least three times, respectively.

F.-Y. Liu et al. / Peptides 83 (2016) 1–7

3

2.7. Western blotting The proteins of brain tissue were extracted by using RIPA lysis buffer (Vazyme,E112-01/02) accompanied with PMSF. After being denatured by boiling, equal amount of 50 ␮g protein samples were loaded on the 12% SDS-PAGE for electrophoresis, and then electrotransferred to the Pure Nitrocellulose Blotting Membranes (Millipore, USA). The membranes were blocked with 5% non-fat milk in TBST for 2 h at room temperature and incubated with primary antibodies overnight at 4 ◦ C by different dilutions in TBS: anti-beta-actin (1:1000, ZSGB-BIO, TA-09); anti-Delta Opioid Receptor (1:1000, abcam, ab63536); anti-Enkephalin (1:500, Biorbyt, orb6690); anti- Ghrelin Receptor (1:1000, abcam, ab95250). After having been washed with TBST, the membranes were incubated for 2 h at room temperature with their respective horseradish peroxidase(HRP)-conjugated secondary antibodies. Finally, target proteins were detected via Chemiluminescencewith Super Signal West Pico Chemiluminescent Substrate (Thermo, Lot#PH203837). The band density was obtained with the Quantity One software and reported as a percentage of control density, normalized by beta-actin expression. 2.8. Statistical analysis The last data were expressed as means ± S.E.M. Significant differences between two groups were analyzed using a one-way analysis of variance (ANOVA) followed by the Bonferroni F test. In all statistical groups, P < 0.05 was considered as the statistical significance. 3. Results 3.1. Effects of various opioid receptor antagonists ˇ-FNA, NTI and nor-BNI on the antinociceptive effects induced by ghrelin In our previous experiments, the antinociceptive effects of ghrelin were mediated through GHS-R1␣ and the central opioid receptors in tail withdrawal test [27]. As we know, there are three classes of opioid receptor (ORs), such as ␮-, ␦ − and ␬-ORs which mediate analgesia with distinct pharmacological profiles. In order to further explore which OR mediates the antinociceptive effects evoked by ghrelin (i.c.v. 1nmol), ␤-FNA (an antagonist of ␮-OR), NTI (an antagonist of ␦-OR) and nor-BNI (a high selective antagonist of ␬-OR) were used. As shown in Fig. 1 and 2A, the area under the curve (AUC) of the co-injection (i.c.v.) of NTI (100 nmol) and ghrelin (1 nmol) was 180.5 ± 190.9, (vs. 1 nmol ghrelin, P < 0.001) during 0–60 min. At the same time, the AUC of 1 nmol ghrelin was 1674.8 ±302.5. The AUC of the co-injection (i.c.v.) of ␤-FNA (100 nmol) and ghrelin (1 nmol) was 1401.1 ± 282.4, (vs. 1 nmol ghrelin, P > 0.05) during 0–60 min. And The AUC of the co-injection (i.c.v.) of nor-BNI (100 nmol) and ghrelin (1 nmol) was 1490.6 ± 255.3, (vs. 1 nmol ghrelin, P > 0.05) during 0–60 min. This results indicated that only NTI abolished the antinociceptive effects induced by ghrelin (i.c.v. 1 nmol), while the antinociceptive effects were not significantly modified by ␤-FNA or nor-BNI. At the same time, i.c.v. injection of naloxone (100 nmol), ␤-FNA (100 nmol), NTI (100 nmol) and norBNI (100 nmol) didn’t induce antinociceptive effects compared to saline (Fig. 1B). So, the antinociceptive effects evoked by ghrelin was mediated through␦opioid receptor. 3.2. The expressions of GHS-R and ghrelin mRNA after i.c.v. administration of ghrelin In order to examine the expression levels of GHS-R mRNAs and ghrelin mRNAs in the antinociceptive effects of ghrelin, the method of qRT-PCR was used (Fig. 3). As shown in Fig. 3, the expression

Fig. 1. The effects of i.c.v. injection of naloxone, ␤-FNA, NTI, nor-BNI on i.c.v. ghrelin evoked antinociception in the tail withdrawal test in mice (A). The effects of opioid receptor antagonists (i.c.v.) alone in the test (B). The data at each time point represent as the maximum percentage effect, MPE% ± S.E.M. for n = 8-12/group. **P < 0.01, ***P < 0.001, statistically significant differences comparing the antinociception of ghrelin and various ORs antagonists groups to individual ghrelin-treated group at appropriate time.

levels of GHS-R mRNAs and ghrelin mRNAs were normalized with the expression level of GAPDH which is the housekeeping gene. In the qRT-PCR experiments, the method of 2−Ct was used to analyze the relative changes of gene expression. Compared to the control group (physiological saline group, normalized to 1), the expression levels of GHS-R mRNA were 1.27 ± 0.35, 1.25 ± 0.36 and 0.99 ± 0.25 after i.c.v. injection of ghrelin at 5, 10 and 20 min, respectively. At the same time, the expression levels of ghrelin mRNA were 1.25 ± 0.24, 1.12 ± 0.27 and 1.03 ± 0.19 after i.c.v. injection of ghrelin at 5, 10 and 20 min, respectively (Fig. 3). There were no significant difference between the control group and the experimental group of ghrelin at 5, 10 and 20 min with statistical analysis. These results suggested that the expression levels of GHS-R and ghrelin mRNA were not altered after the i.c.v. administration of ghrelin in mice. 3.3. The expressions of endogenous opioid peptides and opioid receptors mRNA after i.c.v. administration of ghrelin In our previous study, the antinociceptive effects evoked by ghrelin were mediated through opioid receptors [27]. So in the

4

F.-Y. Liu et al. / Peptides 83 (2016) 1–7

3.4. The protein expressions of PENK and OPRD after i.c.v. injection of ghrelin using western blot analysis

Fig. 2. The effects of various ORs antagonists on ghrelin produced antinociception, expressed as AUC after i.c.v. injection in the tail withdrawal test in mice. All data at each concentration are presented as AUC ± S.E.M which is the area under the curve during 0–60 min (n = 8-12). **P < 0.01, ***P < 0.001, statistically significant differences comparing the antinociception of ghrelin and various ORs antagonists groups to individual ghrelin-treated group.

study, the mRNA expression levels of various endogenous opioid peptides and their opioid receptors need to be analyzed with the qRT-PCR technology. It was revealed that the mRNA expression levels of OPRD (␦-opioid receptor) and the endogenous ligand of PENK (endogenous ligand for ␦-opioid receptor) in ghrelin treated group were dramatically increased compared with the control group. The values of PENK mRNA expressions at the time points of 5, 10 and 20 min after i.c.v. injection of ghrelin were 2.21 ± 0.18, 1.85 ± 0.43 and 1.92 ± 0.4, respectively (Fig. 4C). Moreover, the values of OPRD mRNA expression at the time points of 5, 10 and 20 min after i.c.v. injcetion of ghrelin were 0.93 ± 0.02, 1.12 ± 0.22 and 1.85 ± 0.43, respectively (Fig. 4D). While the mRNA expression levels of POMC (endogenous ligand for ␮-OR, Fig. 4A), PDYN (endogenous ligand for ␬-OP, Fig. 4E), OPRM (␮-OP, Fig. 4B) and OPRK (␬-OR, Fig. 4F) were not affected by i.c.v. injection of ghrelin compared with the control group. These results revealed that PENK and OPRD were involved in the antinociceptive effects evoked by ghrelin.

Furthermore, to further investigate whether the increasing of PENK and OPRD transcripts evoked by injection of ghrelin was associated with an elevation of PENK and OPRD protein expressions, western blot analyses were used. As shown in Fig. 5, after treatment with ghrelin (i.c.v.), PENK and OPRD protein expressions were markedly increased compared with the control group. The protein expression levels of PENK at 5, 10 and 20 min after i.c.v. injection of ghrelin were 2.06 ± 0.13, 2.15 ± 0.44, 2.98 ± 0.19, respectively (Fig. 5B). At the same time, the protein expression levels of OPRD at 5, 10 and 20 min were 1.41 ± 0.12, 1.54 ± 0.28, 2.1 ± 0.33, respectively (Fig. 5C). Furthermore, we evaluated whether the protein expressions of GHS-R were increased in the study. As shown in Fig. 5A, no significant changes were observed between the control group and ghrelin treated group. These results suggested that PENK and OPRD protein expressions were up-regulated in the antinociceptive effects induced by gherlin (i.c.v.) 3.5. [D-Lys3 ]-GHRP-6 did not alter the antinociception of deltorphin II which is a selective ı-opioid receptor agonist In our previous work and this work, it showed that GHS-R1␣ and ␦-opioid receptor connect in series in the mechanisms of antinociceptive effects induced by ghrelin. But it is still unclear which receptor activated firstly and which receptor activated secondly by ghrelin. To explore this question, [D-Lys3 ]-GHRP-6 was co-injection (i.c.v.) with deltorphin II in the research. Deltorphin II is a selective ␦-opioid receptor agonist and has antinociceptive effects in rats [4,16]. The MPE% of deltorphin II (1 nmol, i.c.v.) was 68.1 ± 14.21 at 10 min (P < 0.001 versus saline group). Compared to the saline group, [D-Lys3 ]-GHRP-6 (i.c.v. 100 nmol) didn’t evidently produce antinociception at appropriate time (Fig. 6). The MPE% of the co-injection (i.c.v.) of [D-Lys3 ]-GHRP-6 (100 nmol) and deltorphin II (1 nmol) was 73.06 ± 12.08, (vs. 1 nmol deltorphin II, P > 0.05). So, the antinociception induced by 1 nmol deltorphin II wasn’t blocked by the co-injection of [D-Lys3 ]-GHRP-6 (100 nmol) (Fig. 6). As we know, deltorphin II can bind to ␦-opioid receptor to induce antinociceptive effects [4,16]. In this study, it indicated that the GHS-R1␣ isn’t on the backward position of ␦-opioid receptor. So, the GHS-R1␣ is at advanced position and the ␦-opioid receptor is at backward position in the antinociception of ghrelin. These

Fig. 3. The expression levels of GHS-R and ghrelin mRNAs after i.c.v. administration of ghrelin in mice. Histogram showed the relative expression levels of the GHS-R (A) and ghrelin mRNA (B), respectively using relative qRT-PCR. Data were shown as means ± S.E.M. *p < 0.05, **p < 0.01 compared with control group which injected with physiological saline.

F.-Y. Liu et al. / Peptides 83 (2016) 1–7

5

Fig. 4. The mRNAs expression levels of the endogenous opioid peptides and opioid receptors after i.c.v. administration of ghrelin in mice. Histogram showed the relative mRNA expression levels of POMC, OPRM, PENK, OPRD, PDYN, OPRK, respectively using relative qRT-PCR. Data were shown as means ± S.E.M. *p < 0.05, ***p < 0.001 compared with control group which injected with physiological saline.

results suggested that ghrelin (i.c.v.) initially activated the GHSR1␣, which subsequently activated ␦-opioid receptor to produce antinociception (Fig. 7).

4. Discussion Ghrelin, an endogenous ligand of the GHSR, was initially discovered from endocrine cells of the gastric mucosa in rats in 1999 [10–12]. Ghrelin influences many physiological functions, including its roles in the pain [22–24]. In our previous experiments, the antinociceptive effects of ghrelin are mediated through GHS-R1␣ and the central opioid system [27]. However, the molecular mechanism of antinociception induced by ghrelin (i.c.v.) is unclear. So, in this study, our results demonstrated that i.c.v. injection of ghrelin initially activated the GHS-R1␣, which subsequently increased the

protein expression of PENK and OPRD, and then PENK combined to OPRD and induced antinociception. Initially, in order to explore which opioid receptor (OR) mediated the antinociceptive effects evoked by ghrelin, ␤-FNA (an antagonist of ␮-OR), NTI (an antagonist of ␦-OR) and nor-BNI (an antagonist of ␬-OR) were used in the tail withdrawal test in mice. Our results showed that only NTI evidently abolished the antinociceptive effects of ghrelin, while the antinociceptive effects were not abolished by ␤-FNA or nor-BNI in the tail withdrawal test. These effects revealed that the antinociceptive effects of ghrelin were mediated through ␦-opioid receptor. Our previous results revealed that ghrelin’s antinociception is mediated through GHS-R1␣and opioid receptors [27]. So, in the present study, the mRNA and protein expression levels of related proteins were explored using the qRT-PCR and western blot. Our results revealed that the GHS-R expressions at the levels of tran-

6

F.-Y. Liu et al. / Peptides 83 (2016) 1–7

Fig. 5. The protein expression levels of GHS-R, PENK and OPRD were observed using western blot between ghrelin treated group and control group in mice. Histogram showed the relative protein expression levels of GHS-R (A), PENK (B) and OPRD (C), respectively, normalized with ␤-actin expression (internal control). All experiments were performed in triplicate and repeated three times. Data were shown as means ± S.E.M. *p < 0.05, ***p < 0.001 compared with control group which injected with physiological saline.

scription and translation were not altered between the ghrelin treated group and the control group. Additionally, the expression levels of ghrelin mRNAs were not altered in the test, too. These results suggested that the expression levels of GHS-R and ghrelin mRNA were not altered after the i.c.v. administration of ghrelin in mice. Combining the present results and our previous results [27], we concluded that the molecular mechanisms of antinociception of ghrelin maybe activate the GHS-R1␣ instead of altering the expression levels of ghrelin and GHS-R1␣. Furthermore, the results of transcription revealed that the mRNA expression levels of the PENK (the endogenous ligand of ␦-opioid receptor) and the OPRD (␦-opioid receptor) increased significantly compared with the control group. At the same time, the mRNA expression levels of the OPRM (␮-opioid receptor), the POMC (the endogenous ligand of ␮opioid receptor), the OPRK (␬-opioid receptor) and the PDYN (the endogenous ligand of ␬-opioid receptor) were not altered compared with the control group. Next, the present results revealed that the protein expression levels of the OPRD and PENK increased significantly compared with the control group, too. These results showed that the antinociceptive effects evoked by ghrelin were via

the release of endogenous PENK, and the increase expression levels of OPRD, to produce antinociception through the activation of OPRD. Combining the present results and our previous results [27], we concluded that GHS-R1␣ and ␦-OR connect in series in the mechanisms of antinociceptive effects induced by ghrelin. To investigate which receptor was activated by ghrelin firstly in this test, GHS-R1␣ antagonist [D-Lys3 ]-GHRP-6 was co-administration (i.c.v.) with deltorphin II in the research. Deltorphin II is a selective ␦-opioid receptor agonist and has antinociceptive effects in rats [4,16]. Antinociception induced by deltorphin II wasn’t blocked by the coinjection (i.c.v.) of [D-Lys3 ]-GHRP-6. These results suggested that i.c.v. injection of ghrelin initially activated the GHS-R1␣, which subsequently activated ␦-opioid receptor to produce antinociception. In conclusion, the present behavioral study indicated that the antinociceptive effects of ghrelin were evidently abolished by ␦opioid receptor antagonist NTI. Moreover, the present study on the molecular levels also displayed that the antinociceptive effects of ghrelin were related to increase the expressions of endogenous ␦opioid peptide PENK and ␦-opioid receptor OPRD. All these results

F.-Y. Liu et al. / Peptides 83 (2016) 1–7

Fig. 6. The effects of [D-Lys3 ]-GHRP-6 (i.c.v.) on deltorphin II (i.c.v.) induced antinocicption in the tail withdrawal test in mice. The data at each time point represent as the maximum percentage effect, MPE% ± S.E.M. for n = 8-12/group. *P < 0.05, ***P < 0.001, statistically significant differences comparing the antinociception of deltorphin II and [D-Lys3 ]-GHRP-6 to individual deltorphin II −treated group on appropriate time. (Del II, deltorphin II; D, [D-Lys3 ]-GHRP-6).

Fig. 7. I.c.v. injection of ghrelin initially activated the GHS-R1␣, which subsequently increased the protein expression of PENK and OPRD, and then PENK combined to OPRD and induced antinociception.

suggested that i.c.v. injection of ghrelin initially activated the GHSR1␣, which secondly increased the release of endogenous PENK to activation of OPRD to produce antinociception. These results contributed to understand the mechanisms of ghrelin in acute pain. Moreover, further investigation is required to explain the mechanisms of ghrelin in pain. Acknowledgements This work was supported by the grant from National Natural Science Foundation of China (No. 21302085), by the grant from the Natural Science Foundation of Jiangxi Province (No. 20151BAB205023), the grant from the Educational Department of Jiangxi Province (No. GJJ14160), the grant from Jiangxi Post-graduate Innovation Project (YC2014-S089) and the grant from Nanchang University Post-graduate Innovation Project (CX2015153). References [1] W.A. Banks, M. Tschöp, S.M. Robinson, M.L. Heiman, Extent and direction of ghrelin transport across the blood-brain barrier is determined by its unique primary structure, J. Pharmacol. Exp. Ther. 302 (2) (2002) 822–827. [2] V. Chandra, H. Ram, A.K. Sharma, Expression profile of ghrelin and ghrelin receptor in cyclic goat ovary, Indian J. Anim. Sci. 82 (2012) 984–987. [3] E. Dehlin, J. Liu, S.H. Yun, E. Fox, S. Snyder, C. Gineste, et al., Regulation of ghrelin structure and membrane binding by phosphorylation, Peptides 29 (2008) 904–911. [4] V. Erspamer, P. Melchiorri, G. Falconieri-Erspamer, L. Negri, R. Corsi, C. Severini, et al., Deltorphins: a family of naturally occurring peptides with high affinity and selectivity for delta opioid binding sites, Proc. Natl. Acad. Sci. U. S. A. 86 (13) (1989) 5188–5192.

7

[5] F. Ferrini, C. Salio, L. Lossi, A. Merighi, Ghrelin in central neurons, Curr. Neuropharmacol. 7 (2009) 37–49. [6] J.M. Garcia, J.P. Cata, P.M. Dougherty, R.G. Smith, Ghrelin prevents cisplatin induced mechanical hyperalgesia and cachexia, Endocrinology 149 (2008) 455–460. [7] S. Ghelardoni, V. Carnicelli, S. Frascarelli, S. Ronca-Testoni, R. Zucchi, Ghrelin tissue distribution: comparison between gene and protein expression, J. Endocrinol. Invest. 29 (2006) 115–121. [8] E. Guneli, M. Gumustekin, M. Ates, Possible involvement of ghrelin on pain threshold in obesity, Med. Hypotheses 74 (2010) 452–454. [9] T.J. Haley, W. McCormick, Pharmacological effects produced by intracerebral injections of drugs in the conscious mouse, Br. J. Pharmacol 12 (1957) 12–15. [10] M. Kojima, H. Hosoda, Y. Date, M. Nakazato, K. Kangawa, Ghrelin is a growth-hormone-releasing acylated peptide from stomach, Nature 402 (6762) (1999) 656–660. [11] M. Kojima, H. Hosoda, K. Kangawa, Purification and distribution of ghrelin: the natural endogenous ligand for the growth hormone secretagogue receptor, Horm. Res. 56 (2001) 93–97. [12] M. Kojima, K. Kangawa, Ghrelin: structure and function, Physiol. Rev. 85 (2005) 495–522. [13] I. Kyoraku, K. Shiomi, K. Kangawa, M. Nakazato, Ghrelin reverses experimental diabetic neuropathy in mice, Biochem. Biophys. Res. Commun. 389 (2009) 405–408. [14] C. Ledderose, S. Kreth, Beiras-Fernandez A. Ghrelin, a novel peptide hormone in the regulation of energy balance and cardiovascular function, Recent Pat. Endocr. Metab. Immune Drug Discov. 5 (2011) 1–6. [15] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-Time quantitative PCR and the 2−CT method, Methods 25 (2001) 402–408. [16] J. Mika, R. Przewłocki, B. Przewłocka, The role of delta-opioid receptor subtypes in neuropathic pain, Eur. J. Pharmacol. 415 (1) (2001) 31–37. [17] G. Muccioli, A. Baragli, R. Granata, M. Papotti, E. Ghigo, Heterogeneity of ghrelin/growth hormone secretagogue receptors. Toward the understanding of the molecular identity of novel ghrelin/GHS receptors, Neuroendocrinology 86 (3) (2007) 147–164. [18] G. Muccioli, T. Lorenzi, M. Lorenzi, C. Ghe, E. Arnoletti, G.M. Raso, et al., Beyond the metabolic role of ghrelin: a new player in the regulation of reproductive function, Peptides 32 (2011) 2514–2521. [19] G. Muccioli, M. Papotti, V. Locatelli, E. Ghigo, R. Deghenghi, Binding of 125I-labeled ghrelin to membranes from human hypothalamus and pituitary gland, J. Endocrinol. Invest. 24 (3) (2001) RC7–RC9. [20] R. Nass, L.S. Farhy, J. Liu, C.E. Prudom, M.L. Johnson, P. Veldhuis, et al., Evidence for acyl-ghrelin modulation of growth hormone release in the fed state, J. Clin. Endocrinol. Metab. 93 (2008) 1988–1994. [21] T. Sato, Y. Nakamura, Y. Shiimura, H. Ohgusu, K. Kangawa, M. Kojima, Structure, regulation and function of ghrelin, J. Biochem. 151 (2012) 119–128. [22] V. Sibilla, N. Lattuada, D. Rapetti, F. Paqani, D. Vincenza, L. Bulqarelli, et al., Ghrelin inhibits imflammatory pain in rats: involvement of the opioid system, Neuropharmacology 51 (2006) 497–505. [23] V. Sibilia, F. Pagani, E. Mrak, E. Dieci, G. Tulipano, F. Ferrucci, Pharmacological characterization of the ghrelin receptor mediating its inhibitory action on inflammatory pain in rats, Amino Acids 43 (2012) 1751–1759. [24] W. Tsuchimochi, I. Kyoraku, H. Yamaguchi, K. Toshinai, K. Shiomi, K. Kangawa, M. Nakazato, Ghrelin prevents the development of experimental diabetic neuropathy in rodents, Eur. J. Pharmacol. 702 (1–3) (2013) 187–193. [25] A.M. Vergnano, F. Ferrini, C. Salio, L. Lossi, M. Baratta, A. Merighi, The gastrointestinal hormone ghrelin modulates inhibitory neurotransmission in deep laminae of mouse spinal cord dorsal horn, Endocrinology 149 (2008) 2306–2312. [26] G. Venables, B. Hunne, R. Bron, H.J. Cho, J.A. Brock, J.B. Furness, Ghrelin receptors are expressed by distal tubules of the mouse kidney, Cell Tissue Res. 346 (2011) 135–139. [27] J. Wei, X. Zhi, X.L. Wang, P. Zeng, T. Zou, B. Yang, et al., In vivo characterization of the effects of ghrelin on the modulation of acute pain at the supraspinal level in mice, Peptides 43 (2013) 76–82. [28] A.M. Wren, C.J. Small, H.L. Word, K.G. Murphy, C.L. Dakin, S. Taheri, et al., The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretions, Endocrinology 141 (2000) 4325–4328. [29] P. Zeng, J.X. Chen, B. Yang, X. Zhi, F.X. Guo, M.L. Sun, J.L. Wang, J. Wei, Attenuation of systemic morphine-induced analgesia by centraladministration of ghrelin and related peptides in mice, Peptides 50 (2013) 42–49. [30] C.H. Zhou, X. Li, Y.Z. Zhu, H. Huang, J. Li, L. Liu, et al., Ghrelin alleviates neuropathic pain through GHSR-1␣-mediated suppression of the p38 MAPK/NF-␬B pathway in a rat chronic constriction injury model, Reg. Anesth. Pain Med. 39 (2) (2014) 137–148. [31] J.M. Zigman, J.E. Jones, C.E. Lee, C.B. Saper, J.K. Elmquist, Expression of ghrelin receptor mRNA in the rat and mouse brain, J. Comp. Neurol. 548 (2006) 528–548.