Subcellular localisation of recombinant α- and γ-synuclein

www.elsevier.com/locate/ymcne Mol. Cell. Neurosci. 28 (2005) 326 – 334

Subcellular localisation of recombinant A- and ;-synuclein Christian G. Specht, Cezar M. Tigaret, Georg F. Rast, Agnes Thalhammer, York Rudhard, and Ralf Schoepfer* Laboratory for Molecular Pharmacology, Department of Pharmacology, University College London, UCL, London WC1E 6BT, UK Received 6 April 2004; revised 27 September 2004; accepted 28 September 2004 Available online 21 November 2004 A-Synuclein, a protein implicated in neurodegenerative diseases and of elusive physiological function owes its name to an observed presence in presynaptic and nuclear compartments. However, its nuclear localisation has remained controversial. We expressed synuclein–eGFP fusion proteins in organotypic rat hippocampal slice cultures and murine hippocampal primary neurons using a Sindbis virus expression system. Recombinant full-length A-synuclein accumulated in presynaptic locations, mimicking its native distribution. Expression of deletion mutant A-synuclein revealed that presynaptic targeting depended on the presence of its N-terminal and core region. This domain also causes nuclear exclusion of the Asynuclein fusion protein. In contrast, the C-terminal domain of Asynuclein directs fusion proteins into the nuclear compartment. The related protein ;-synuclein contains a similar N-terminal and core domain as A-synuclein. However, ;-synuclein lacks a C-terminal domain that causes nuclear localisation of the fusion protein, suggesting that the two synucleins might have different roles relating to the cell nucleus. D 2004 Elsevier Inc. All rights reserved.

Introduction The presence of a-synuclein in Lewy bodies (LB) in Parkinson’s disease (PD) and other synucleinopathies has attracted considerable attention (for review, see Dev et al., 2003). However, the somatic localisation of aggregated a-synuclein in LBs (Spillantini et al., 1997; Wakabayashi et al., 1997) is in contrast to an exclusively presynaptic localisation of soluble a-synuclein that has been frequently observed (e.g., Iwai et al., 1995). More recently, extensive evidence was presented for the somatodendritic as well as presynaptic localisation of a-synuclein (Andringa et al., 2003). The nuclear localisation of a-synuclein, although described initially (in torpedo californica, see Maroteaux et al., 1988), has

only been observed in few subsequent studies (e.g., Goers et al., 2003) and remains controversial. Rare familial forms of PD have been linked to point mutations or gene dosage of the human a-synuclein (SNCA) gene (Farrer et al., 2004; Kru¨ger et al., 1998; Polymeropoulos et al., 1997; Singleton et al., 2003; Zarranz et al., 2004). Engineered expression models have been used to address the pathological role of a-synuclein. Wild-type and mutant a-synuclein has been overexpressed in transgenic mice (Giasson et al., 2002; Kahle et al., 2000; Lee et al., 2002; Masliah et al., 2000; Richfield et al., 2002; van der Putten et al., 2000) and invertebrates (Feany and Bender, 2000; Lakso et al., 2003), as well as by viral expression in rodents and primates (Kirik et al., 2002, 2003; Lo Bianco et al., 2002). All these PD models reproduce, to varying degrees, behavioural and/or neuropathological phenotypes such as the loss of dopaminergic neurons and a-synuclein aggregation, but have failed to disclose the protein’s physiological function within the neuron. Also, the deletion of the Snca gene in mice did not reveal strong phenotypes related to the function of native a-synuclein (Abeliovich et al., 2000; Cabin et al., 2002; Chen et al., 2002; Robertson et al., 2004; Schluter et al., 2003; Specht and Schoepfer, 2001). In this study, we sought to address the physiological behaviour of a-synuclein by studying its distribution within the neuron, rather than its involvement in pathological events or protein aggregation. We have expressed a- and g-synuclein as fusion proteins with enhanced green fluorescent protein (eGFP) with a viral expression system, to study their subcellular distribution in hippocampal neurons. Using deletion mutant forms of a- and g-synuclein, we identified protein domains that are responsible for the observed presynaptic and nuclear localisation of the synucleins in hippocampal neurons.

Results * Corresponding author. Laboratory for Molecular Pharmacology, Department of Pharmacology, University College London, UCL, Gower Street, London WC1E 6BT, UK. Fax: +44 20 76797245. E-mail address: [email protected] (R. Schoepfer). Available online on ScienceDirect (www.sciencedirect.com). 1044-7431/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.mcn.2004.09.017

A range of full-length and deletion mutant a- and g-synuclein fusion constructs were generated with a short linking sequence to an eGFP domain at their C-terminal end (Fig. 1A). The design of the deletion variants was based on the domain structure of a-

C.G. Specht et al. / Mol. Cell. Neurosci. 28 (2005) 326–334

327

1998). Accordingly, construct aSyn 1–46 encompasses the first helical domain, whereas aSyn 1–19 and aSyn 1–67 contain one and five repeats of a conserved hexamer motif, respectively (Dev et al., 2003). In contrast, the C-terminal domain (construct aSyn 103–140) retains a random coil conformation (Chandra et al., 2003). The recombinant synuclein fusion proteins were expressed using a Sindbis virus (SV) derived system (Bredenbeek et al., 1993). Expression of synuclein fusion proteins in primary neurons

Fig. 1. Expression of synuclein–eGFP fusion proteins in murine hippocampal primary neurons. (A) Synuclein expression constructs include fulllength a-synuclein (aSyn 1–140), g-synuclein (gSyn 1–123) and a range of a- and g-synuclein deletion constructs (as indicated) fused to eGFP via the linking peptide GADLH (Gly-Ala-Asp-Leu-His). The expression of Histagged eGFP (second from top) was used as control in subsequent experiments. The domain structure of a-synuclein is indicated above, outlining the domains that assume a-helical (upon lipid binding) and random coil structures (see Results for details). (B) Detection of eGFP and synuclein domains in fusion proteins by Western blotting. The rb@GFP antibody reveals all a-synuclein-eGFP constructs expressed for 18 h in primary neurons, with limited proteolytic degradation occurring in some constructs. A minor unspecific band of 27 kDa is detected in all lanes including the uninfected control. Antibodies rb@panSyn and m@aSyn confirm the presence of the a-synuclein epitopes 11–26 and 68–102, respectively. The 55-kDa tubulin band served as loading control. (C) Proteolytic degradation of constructs containing the C-terminal domain of a-synuclein was not detected with rb@GFP after short periods of expression of only 6 h. (D) The expression of g-synuclein fusion proteins for 18 h was equally confirmed with rb@GFP and rb@panSyn antibodies.

synuclein. Construct aSyn 1–102 represents the N-terminal and core region of a-synuclein, reported to contain two natively unfolded domains that assume a-helical structure upon lipid binding, separated by a short break around position 42–44 (Bussell and Eliezer, 2003; Chandra et al., 2003; Davidson et al.,

Following the infection of murine hippocampal primary neurons with SV preparations, the presence of synuclein and eGFP domains in recombinant fusion proteins was verified by Western blotting (Figs. 1B–D). For all constructs, one main specific protein band was detected. After prolonged expression of 18 h, some a-synuclein–eGFP fusion proteins appeared to have undergone limited proteolytic degradation, as judged by the presence of minor eGFP-positive products (Fig. 1B). The degradation products were most noticeable for aSyn 103–140, aSyn 1–19/103–140 and aSyn 20–140, suggesting that the Cterminal domain of a-synuclein is particularly vulnerable to proteolysis (and accessible, despite the neighbouring eGFP domain). However, after 6 h of expression, no evidence of significant levels of degradation products was observed (Fig. 1C), confirming that this time window of expression could be used for subsequent studies. The presence of a-synuclein domains within the fusion protein sequences was confirmed with an N-terminal pan synuclein antibody. This identified all constructs with the amino acid residues 11–26 (Fig. 1B). The signal for aSyn 1–19 and aSyn 1–19/103–140 was absent or weak, probably due to the deletion of part of the epitope in these constructs. Similarly, the presence of the central domain of a-synuclein was shown with a monoclonal antibody that identified all constructs containing residues 68–102 (Fig. 1B), consistent with the recent mapping of its epitope to residues 91–99 (Perrin et al., 2003). The expression of g-synuclein fusion constructs was equally confirmed, using antibodies against the eGFP and synuclein domains (Fig. 1D). The apparent molecular masses of synuclein fusion proteins as judged by their SDS-PAGE mobility are generally close to the calculated molecular masses. In proteins containing the C-terminal domains of a- or g-synuclein, however, the apparent molecular masses exceed these by 5–10 kDa (Figs. 1B–D), in line with previous observations (Choi et al., 2002; Matagne et al., 1991). In summary, we have developed a suitable system for recombinant expression of synuclein fusion proteins in neurons. Axonal accumulation of a-synuclein–eGFP To analyse the subcellular distribution of recombinant fulllength a-synuclein in a more physiological network environment, we infected organotypic rat hippocampal slice cultures with virus encoding aSyn 1–140. Green fluorescence appeared as early as 6 h post-infection, and was seen predominantly in neurons. Fluorescent glial cells were also observed, albeit at a lower frequency. The overexpression of aSyn 1–140 for periods between 12 and 48 h did not appear to alter the overall distribution of the fusion protein within the cell significantly, with strong fluorescent signals in the soma and in dendritic arborisations of infected neurons (Fig. 2). Moreover, intense signals were detected in beaded structures,

328

C.G. Specht et al. / Mol. Cell. Neurosci. 28 (2005) 326–334

140 and full-length gSyn 1–123 for the presynaptic compartment, compared to the eGFP control ( P b 0.001, n = 26 cells, Mann– Whitney U test, two-tailed; Altman, 1999). However, the degree of presynaptic localisation was more pronounced for a-synuclein than for g-synuclein. The construct containing the helical domains of a-synuclein, aSyn 1–102, accumulated at presynaptic locations ( P b 0.001 against eGFP, n z 13) to a comparable degree as the full-length aSyn 1–140 ( P N 0.1, n z 13), suggesting that the C-terminus of a-synuclein has no special role in presynaptic targeting (Figs. 3B,C). This was confirmed by the absence of any specific presynaptic localisation in neurons expressing aSyn 103–140. Since the degree of presynaptic accumulation was highest for aSyn

Fig. 2. Subcellular localisation of a-synuclein–eGFP in organotypic rat hippocampal neurons. (A) Full-length aSyn 1–140 expressed for 22 h in a hippocampal neuron, identified by its morphology as pyramidal neuron. Bright green fluorescent signals are observed in all cellular compartments, including a beaded, axonal localisation (arrowheads). (B) Hippocampal neuron expressing aSyn 1–140, with a dense cluster of beaded structures. (C) Detail of a dendrite (1) and an axon (2) of a hippocampal neuron. Intense fluorescent signals (3) are present along the threadlike structure of the axon. Axons were distinguished from dendrites by their reduced diameter and increased length.

likely appertaining to the closest fluorescent neuron itself, since expressing cells were generally distant from each other (Fig. 2A). Occasionally, these fluorescent structures formed dense clusters in the proximity of the cell body (Fig. 2B) and, upon closer inspection, appeared to have axonal origin (Fig. 2C). In contrast, the formation of fluorescent beads along the axon was not observed in cells expressing recombinant eGFP protein alone (not shown). Presynaptic localisation of a-synuclein–eGFP To confirm the accumulation of recombinant full-length asynuclein in axonal locations, murine hippocampal primary cultures were analysed by immunostaining. The presence of aSyn 1–140, first observed as fluorescent signals 3 h postinfection, was compared to that of a presynaptic marker after 5 h of expression. Immunostaining for synapsin I revealed that it colocalised with the eGFP-positive axonal structures, indicative of presynaptic accumulation of aSyn 1–140 (Fig. 3A). We then investigated which domains of a-synuclein were responsible for its accumulation in the presynaptic compartment. The extent of presynaptic accumulation of a- and g-synuclein deletion mutants was analysed by confocal microscopy after 5 h of expression (Fig. 3B), followed by quantitative image analysis (Fig. 3C). This showed a clear preference of both, full-length aSyn 1–

Fig. 3. Presynaptic accumulation of a-synuclein-eGFP in murine hippocampal primary neurons. (A) aSyn 1–140 expressed for 5 h in primary neurons. The co-localisation of fluorescent beaded structures (eGFP, green) with the presynaptic marker synapsin I (monoclonal antibody m@syp, Cy3label, red) suggested that aSyn 1–140 accumulates at presynaptic locations (composite image). Immunostaining was confirmed with polyclonal synapsin I antibody (rb@syp, Cy5-label, blue). (B) Details of axons from neurons expressing full-length aSyn 1–140 and gSyn 1–123, an eGFP control, as well as deletion variants of a-synuclein for 5 h. Presynaptic accumulation is most pronounced for aSyn 1–140 and aSyn 1–102 fusion proteins. (C) Quantification of presynaptic accumulation of expression constructs shown in B. Presynaptic localisation is expressed as % change of the eGFP control (mean F standard deviation, n z 13). Statistical analysis confirmed the significance of these data (indicated by asterisks, see Results for details).

C.G. Specht et al. / Mol. Cell. Neurosci. 28 (2005) 326–334

329

1–102 and dramatically reduced or absent in the other deletion constructs, it is likely the positive determinants for presynaptic localisation are contained within the entire a-helical region of asynuclein. The 19 N-terminal amino acid residues (aSyn 1–19) by themselves are not sufficient to form a positive signal. Equally, aSyn 20–140 did not locate presynapically, suggesting that a localisation signal is either formed by few amino acid residues around position 19/20 or that presynaptic localisation is determined by a higher order structure. The intermediate result obtained with aSyn 1–67 ( P b 0.001 against eGFP, n z 13) would rather indicate the latter. We conclude that efficient presynaptic accumulation of asynuclein requires large portions of its N-terminal and core domain, but is independent of its C-terminus. Subcellular distribution of endogenous and untagged a-synuclein To exclude that the expression of a-synuclein as a fusion protein with eGFP would alter its subcellular distribution, we analysed the localisation of wild-type a-synuclein. Initially, immunostaining of the endogenous protein in murine hippocampal primary neurons suggested that a-synuclein is present in most cellular compartments, with an accumulation at presynaptic locations (Fig. 4A). Furthermore, we performed SV overexpression of untagged a-synuclein in primary neurons from an a-synucleindeficient (Snca / ) mouse strain (Figs. 4B,C; Specht and Schoepfer, 2001, 2004). Again, we found that the untagged protein accumulated at presynaptic locations, in line with the behaviour of a-synuclein–eGFP fusion protein. Immunostaining also revealed the presence of untagged asynuclein (endogenous or overexpressed in Snca / background) in neuronal nuclei (Figs. 4A,B, right panels), in agreement with previous reports (Goers et al., 2003). We therefore sought to study the influence of different synuclein domains on the nuclear localisation of a- or g-synuclein. The distribution of deletion variant synuclein–eGFP constructs was used to determine their role in subcellular localisation relative to eGFP. Nuclear distribution of synuclein–eGFP fusion proteins Initial experiments showed that synuclein fusion protein constructs differed in their presence within the nucleus. For example, murine hippocampal primary neurons expressing eGFP for 5 h showed a subtle accumulation of fluorescent product within the nuclear compartment as compared to the soma. In contrast, eGFP-tagged gSyn 1–123 appeared to be near absent from the nucleus (Fig. 5A). Within the nucleus, the recombinant fusion proteins are distributed unevenly, with a reduced presence in the nucleoli. As we noted a reduced nuclear signal when comparing fulllength a-synuclein–eGFP (Fig. 5A, aSyn 1–140) with untagged asynuclein (Fig. 4B, right panel), we first analysed whether the detection of eGFP-tagged aSyn 1–140 by eGFP fluorescence indeed reflects its distribution as judged by immunostaining for asynuclein. Quantitative image analysis revealed an average intensity correlation quotient of ICQ = 0.35 (n = 6; Li et al., 2004), indicating that the eGFP signal is an excellent indicator of the recombinantly expressed a-synuclein, with close to perfect correlation (ICQ = 0.5). This type of analysis could not be carried out for the entire range of deletion constructs, due to the lack of suitable antibodies against individual synuclein domains. There-

Fig. 4. Subcellular localisation of untagged a-synuclein in murine primary neurons. (A) Endogenous a-synuclein (aSyn 1–140) is present at presynaptic (central panel, arrowhead) as well as nuclear locations (right panel) in primary hippocampal neurons, as judged by immunostaining with monoclonal a-synuclein antibody (m@aSyn). (B) The localisation of overexpressed a-synuclein (aSyn 1–140, untagged; expressed for 5 h) in a-synuclein-deficient (Snca / ) neurons is consistent with the distribution of the endogenous protein, being present in presynaptic and nuclear locations. The degree of overexpression (after 5 h) was estimated by Western blotting to lie about one order of magnitude above the endogenous expression level (not shown), without an obvious effect on the subcellular distribution of a-synuclein. (C) The overexpression of asynuclein (aSyn 1–140, untagged) for 6 h in a-synuclein-deficient primary neurons (Snca / ) was analysed by Western blotting. Antibody m@aSyn detects the 19-kDa recombinant protein, as well as endogenous a-synuclein from primary neurons (Snca +/+).

fore, the subsequent quantitative analysis was designed to measure the degree of nuclear localisation of the recombinant fusion proteins relative to eGFP (Fig. 5B). Full-length aSyn 1–140 has a tendency to be excluded from the nucleus, compared to the eGFP control ( P b 0.001, n = 13 cells, Mann–Whitney U test, two-tailed; Altman, 1999; Figs. 5A,B). This appears to depend upon the presence of the helical N-terminal and core region of a-synuclein, since nuclear exclusion is not observed in aSyn 1–19, but becomes increasingly apparent in constructs containing longer sections of this region. The nuclear exclusion is most notable in constructs aSyn 1–102 and aSyn 7–102, whose normalised distribution ratios significantly exceed even those of aSyn 1–140 ( P b 0.001 each, n = 13; Fig. 5B). This suggests that these deletion constructs lack a second signal, which promotes nuclear localisation, and we tested this hypothesis in a further set of experiments. Indeed, the soma vs. nucleus distribution ratios for the constructs aSyn 103– 140 and aSyn 1–19/103–140 are both significantly smaller than that of the eGFP control ( P b 0.001, n = 13; Fig. 5B). Furthermore, aSyn 20–140 behaves similarly to full-length aSyn 1–140 ( P N 0.1, n = 13), suggesting that the N-terminal and core and the C-terminal domains counter each other’s influence on the nuclear presence.

330

C.G. Specht et al. / Mol. Cell. Neurosci. 28 (2005) 326–334

Fig. 5. Nuclear localisation of synuclein fusion proteins in murine hippocampal primary neurons. (A) Cell bodies of neurons expressing full-length a-and g-synuclein (aSyn 1–140, gSyn 1–123) and N-terminal (aSyn 1–102, gSyn 1–103) and C-terminal fusion constructs (aSyn 103– 140, gSyn 101–123) for 5 h. (B) Quantification of the nuclear distribution of synuclein fusion proteins relative to eGFP. The degree of nuclear exclusion (I soma/0.63I nucleus) b 1 for constructs with a tendency stronger than that of eGFP to accumulate within the nucleus and N1 for constructs that are excluded from the nucleus (mean F standard deviation, n = 13; statistical significance indicated by asterisks, see Results section for details).

Comparisons of a- and g-synuclein fusion proteins indicated a different behaviour with respect to nuclear localisation, with fulllength gSyn 1–123 being almost entirely excluded from the nucleus (Fig. 5A). Again, this appears to be caused by the Nterminal and core domain in gSyn 1–103 that behaves similarly to the highly conserved domain in a-synuclein (aSyn 1–102). However, nuclear exclusion of gSyn 1–123 was found to be significantly more pronounced than that of gSyn 1–103 ( P b 0.001, n = 13; Fig. 5B). This observation could be explained by the behaviour of the C-terminal domain of g-synuclein that, unlike the C-terminus of a-synuclein, does not cause nuclear localisation.

Discussion The precise subcellular distribution of a-synuclein has been the subject of considerable dispute. While a presynaptic localisation of a-synuclein has been frequently observed (e.g., Totterdell et al., 2004), the somatodendritic localisation of a-synuclein, expected for a soluble and cytosolic protein, has only recently been analysed in more detail (Andringa et al., 2003). Furthermore, the nuclear localisation of a-synuclein has been rarely described (Goers et al., 2003; Maroteaux et al., 1988) and has remained

controversial. Using a Sindbis virus expression system, we have now expressed murine synuclein–eGFP fusion proteins and deletion variants to investigate their subcellular distribution in hippocampal neurons. Previous studies have reported that the distribution of recombinant a-synuclein–GFP fusion protein mimics that of untagged asynuclein, but have focussed on the aggregation of the fusion protein in vitro (McLean et al., 2001; Outeiro and Lindquist, 2003). Instead, our findings relate to the distribution of a-synuclein within the neuron, rather than its involvement in neuropathological events. Therefore, to minimise potential cytotoxicity or protein aggregation, we used short expression periods similar to those reported in a recent study (Saha et al., 2004). The expression of asynuclein in yeast revealed that the fusion protein localised specifically to the plasma membrane (Outeiro and Lindquist, 2003). We did not observe preferential targeting of a-synuclein to the plasma membrane of neurons, perhaps due to the different nature of the expression systems used. We have, however, observed the accumulation of a-synuclein– eGFP in structures along the axon of hippocampal neurons in vitro, and identified these as presynaptic locations. This is in line with the co-localisation of a-synuclein with synaptophysin in mature rat hippocampal primary neurons (Murphy et al., 2000). The presynaptic accumulation of full-length a-synuclein was dependent upon the presence of its N-terminal and core domain (amino acid residues 1–102), and was thus absent or reduced in most other deletion constructs. Previous findings have related this domain of a-synuclein to lipid binding, upon which it is believed to assume a helical conformation (Davidson et al., 1998). Indeed, two a-helices are present within the region of amino acid residues 1–100, separated by a short break (Bussell and Eliezer, 2003; Chandra et al., 2003). In addition, we found that the eGFP-tagged synuclein deletion variants display different tendencies to locate to the cell nucleus. While we had observed that a-synuclein–eGFP closely matches the accumulation of the untagged protein (endogenous or overexpressed) at presynaptic locations, we found a reduced nuclear localisation of the fusion protein. Therefore, our subsequent study reflects influences of synuclein domains on nuclear localisation relative to eGFP. The C-terminal domain of a-synuclein caused nuclear localisation (amino acid residues 103–140), which is antagonised by its N-terminal and core domain (1–102). This is in contrast to the behaviour of the g-synuclein C-terminus that lacks the nuclear localisation observed for a-synuclein. Although no definitive role of a-synuclein in the nucleus has yet been demonstrated, the presence of aggregated a-synuclein in neuronal nuclei suggests an involvement in neuropathological events (Lin et al., 2004). Also, it has been proposed that a-synuclein could interact via its acidic C-terminus with histones in the nucleus (Goers et al., 2003). Many studies concerned with the regional expression profile of a-synuclein have focussed on dopaminergic neurons, due to their specific vulnerability in PD (Dev et al., 2003). However, there is ample evidence for the expression of a-synuclein in the hippocampal formation (Andringa et al., 2003). The authors observed presynaptic as well as somatodendritic expression in hippocampal neurons, with rostral to caudal variation. Also, a-synuclein immunoreactivity was observed in a presynaptic hippocampal pathology (Galvin et al., 1999), and the triplication of the SNCA locus in familial PD causes a severe loss of hippocampal neurons (Farrer et al., 2004). It will be interesting to investigate whether

C.G. Specht et al. / Mol. Cell. Neurosci. 28 (2005) 326–334

hippocampal pathology in vivo can be replicated by long-term expression of a-synuclein in hippocampal culture systems, such as the one used in the present study. Taken together, our findings indicate that the distribution of asynuclein–eGFP fusion protein recapitulates the presence of the native protein in presynaptic locations, determined by the Nterminal and core domain of a-synuclein. Furthermore, we have identified a special role of the C-terminal domain for the nuclear localisation of a-synuclein, that is absent in g-synuclein.

Experimental methods Sindbis virus expression system A Sindbis virus (SV) system was used for the expression of synuclein–eGFP constructs (Invitrogen; Bredenbeek et al., 1993). Murine synuclein cDNA sequences were amplified with a range of oligonucleotide primer pairs (Table 1), and cloned into plasmid pSin-EG-N1 (EMBL accession number AJ786825; http://www. ebi.ac.uk/embl) using its NcoI and BglII restriction sites. Coding sequences of a-synuclein amplified on 0.01–0.1 Ag cDNA (W41663, GenBank, NCBI; IMAGE Consortium CloneID 353366, HGMP; Lennon et al., 1996) in 50 Al, containing 20 pmol primers, 10 nmol deoxynucleotides and 1–1.2 U Taq or Pfu DNA polymerase (Promega). Cycling consisted of 25–32  [948C/ 30 s, 52–558C/30 s, 728C/30–60 s]. A four-primer PCR produced aSyn 1–19/103–140 (242-bp product), using N- and C-terminal templates. Full-length g-synuclein was amplified by RT-PCR as previously described (Specht and Schoepfer, 2001) and the resulting clone gSyn 1–123 (AJ786826, EMBL) served to generate deletion constructs. Subcloning of an annealed primer pair containing a 6 His-tag sequence generated an eGFP control (Table 1). To exclude any influence of the His-tag, its subcellular distribution was compared to that of plain eGFP and found to be indistinguishable (not shown). An untagged, full-length a-synuclein construct was also generated, in which the coding sequence of a-synuclein was followed by the sequence TAAGAATGTCATTGCACCCAATCTAGGTACCATGCATGATATCCTCGAG (a-synuclein stop codon up to and including the XhoI restriction

331

site of pSin-EG-N1, both underlined). All coding sequences were shuttled from pSin-EG-N1 into plasmid pSinRep5 (Bredenbeek et al., 1993) with XbaI and NotI. Initially, in vitro transcription yielded replicon cRNA containing fusion protein sequences under the control of a subgenomic promoter (PSG), and replicase for the amplification of the viral genome. Expression constructs based on pSinRep5 (Fig. 1A) were linearised with NotI, and the helper plasmid pDH26S with XhoI. In vitro transcription was performed for 1–2 h at 32–378C in 20 Al, containing 2–5 Ag linearised plasmid DNA, 5 mM each of ATP, UTP and CTP, 1.6 mM GTP, 0.75 mM m7G(5V)ppp(5V)G (capping reagent; Amersham Pharmacia), and 2 Al SP6 polymerase (Promega), yielding in the range of 100 Ag cRNA. Replicon cRNA was then co-transfected together with defective helper cRNA that carries the viral structural protein sequences for the packaging of replicon cRNA into SV particles. Baby hamster kidney BHK-21 cells (0.5  107 to 2  107 cells in 0.5 ml of 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4) were mixed with 30 Ag pSinRep5 cRNA (replicon) and 20 Ag pDH26S cRNA on ice. Electroporation was performed in 4 mm gap cuvettes (BTX Inc.) with 129 V/0.8–1 kV (~1 ms pulse; ECM 600; BTX Inc.). Cells were then cultured at 368C/5% CO2 in MEM alpha medium (with l-glutamine), containing 5% fetal bovine serum, 100 U/ml penicillin and 0.1 mg/ml streptomycin. SV particles were collected with the medium 22–48 h post-transfection, and frozen at 808C. For plaque assays, BHK cell monolayers were infected with SV preparations and overlain with culture medium containing 2% serum and 1% low-melting agarose (SeaPlaque GTG, FMC Bioproducts). Titers of infectious units (IU) were counted 48 h post-infection by their eGFP fluorescence and lay in the order of 105–108 per milliliter. Organotypic rat hippocampal slice culture Organotypic explants were cultured on porous membranes (according to Stoppini et al., 1991). The hippocampus was prepared from a male Sprague–Dawley rat at postnatal day P7–9 in dissection solution (35 mM glucose in GBSS) on ice and cut into slices of 300 Am, using a McIlwain tissue chopper (Mickle Laboratory Engineering). Slices were allowed to rest in dissection

Table 1 Primer pairs used for the generation of synuclein–eGFP fusion constructs Construct

Oligonucleotide primers

Size (bp)

aSyn 1–140 eGFP

AACTGCAGTTCTTCAGAAGCCTAGGGAGC/GGAAGATCTGCTCCGGCTTCAGGCTCATAGTCTTG CATGCCTCATCACCATCACCATCATGCCATGGGCGCA/ GATCTGCGCCCATGGCATGATGGTGATGGTGATGAGG AAGCCATGGATGTGTTCATGAAAGGAC/GGAAGATCTGCTCCAGCAGCAGCCACAACTCC AAGCCATGGATGTGTTCATGAAAGGAC/GGAAGATCTGCTCCTTCCTTAGTTTTGGAAC AAGCCATGGATGTGTTCATGAAAGGAC/GGAAGATCTGCTCCTCCAACATTTGTCAC AACTGCAGTTCTTCAGAAGCCTAGGGAGC/GGAAGATCTGCACCCTTGCCCATCTGGTCC AAGCCATGGGACTTTCAAAGGCCAAGG/GGAAGATCTGCTCCTTCCTTAGTTTTGGAAC AAGCCATGGGACTTTCAAAGGCCAAGG/GGAAGATCTGCTCCTCCAACATTTGTCAC AAGCCATGGGACTTTCAAAGGCCAAGG/GGAAGATCTGCACCCTTGCCCATCTGGTCC TTGCCATGGGTGAGGAGGGGTACCCACAG/GGAAGATCTGCTCCGGCTTCAGGCTCATAGTCTTG AACTGCAGTTCTTCAGAAGCCTAGGGAGC/CTCACCAGCAGCAGCCACAACTCCCTC; GCTGCTGGTGAGGAGGGGTACCCACAG/GGAAGATCTGCTCCGGCTTCAGGCTCATAGTCTTG TTGCCATGGAGAAAACCAAGCAGGGTGTG/GGAAGATCTGCTCCGGCTTCAGGCTCATAGTCTTG GCAAACACCATGGACGTCTTC/GGAAGATCTGCTCCGTCTTCTCCACTCTTGGCCTC ACTTTGACCATGGACGTCTTC/GGAAGATCTGCAGGGGGTTCCAAGTCCTCC TTGCCATGGAACCCCCTGCACAGGAC/GGAAGATCTGCTCCGTCTTCTCCACTCTTGGCCTC

491 annealed primer pair 75 157 220 377 141 204 309 137 242

aSyn aSyn aSyn aSyn aSyn aSyn aSyn aSyn aSyn

1–19 1–46 1–67 1–102 7–46 7–67 7–102 103–140 1–19/103–140

aSyn 20–140 gSyn 1–123 gSyn 1–103 gSyn 101–123

385 392 329 91

332

C.G. Specht et al. / Mol. Cell. Neurosci. 28 (2005) 326–334

solution for 30 min at 48C, then placed on TC inserts (0.4 Am, Millicell CM filter; Millipore) that had been equilibrated with 1.5-ml culture medium (35 mM glucose in 49% MEM, 24.5% EBSS, 24.5% heat inactivated horse serum, 2% B27 supplement). Slices were cultured at 368C/5% CO2. The culture medium was changed the next day and then twice a week, and supplemented with 10 AM cytosine h-arabinofuranoside after day in vitro DIV4. Organotypic slice cultures were infected in bulk at DIV7–10 with 103–104 IU, fixed after 12–48 h, and examined by confocal microscopy. Murine hippocampal primary neuron culture Neuron culture protocols were derived from Banker and Goslin (1991). Glass cover slips were coated with 3 Ag/ml poly-ornithine, 2 Ag/ml laminin in PBS (20 mM sodium phosphate, 150 mM NaCl, pH 7.5) and equilibrated with attachment medium (90% MEM with Earl’s salts and glutamine, 10% fetal bovine serum, 30 mM glucose, 1 mM pyruvate). Mouse embryos [C57BL/6J background, a-synuclein-positive (Snca +/+), bred at UCL] were obtained through caesarean section at embryonic day E16. Hippocampal tissue was prepared in dissection medium (HBSS with Mg2+, Ca2+ and glucose, containing 10 mM HEPES pH 7.2–7.5), trypsinised for 9 min at 368C in dissection medium (without divalent cations), containing 0.05% trypsin and 0.53 mM EDTA, and washed in attachment medium containing 10 mM HEPES. Cells were triturated, then cultured at a concentration of 15,000/cm2 in attachment medium at 368C/5% CO2. After 4 h, the medium was changed to maintenance medium (Neurobasal medium without glutamine, containing 2% B27 supplement, 2 mM GlutaMAX-I, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 33 mM glucose). Primary hippocampal neuron cultures (DIV10–30) were infected with ~105 IU for Western blotting. For imaging, neurons (DIV10– 22) were infected with 103–104 IU and fixed 5 h post-infection for 10–15 min at 368C with PB (0.1 M sodium phosphate, pH 7.5), containing 4% paraformaldehyde and 1% sucrose. Cultures were washed in PB followed by immunostaining (if required), and mounted (Gel Mount, Sigma G-0918). To generate a-synuclein-deficient (Snca / ) primary neurons, hippocampal or cortical cultures were prepared from C57BL/ 6JOlaHsd mice with the chromosomal deletion Del(6)Snca1Slab (Specht and Schoepfer, 2004) using the above protocol.

Immunostaining Cells were permeabilised for 30 min with 0.25% Triton X100 in blocking buffer (3% bovine serum albumin in PB) and blocked for at least 2 h. Monoclonal mouse anti synapsin I antibody (m@syp; Synaptic Systems No. 106001, cl.46.1), polyclonal rabbit anti bovine synapsin I (rb@syp; Abcam ab8/Novus NB300–104) or monoclonal anti a-synuclein (m@aSyn) were applied sequentially at dilutions of 1:500 for 1 h. Secondary antibodies (Cy3conjugated goat anti mouse and Cy5-conjugated goat anti rabbit IgG, Jackson ImmunoResearch) were applied simultaneously at 1:250 for 1 h, followed by washes in PB. Imaging Confocal microscopy was performed on a Biorad system (Radiance 2100 upright multiphoton confocal, Nikon Eclipse E1000 microscope) with a 60 oil-immersion objective (1.40 NA; Nikon Plan Apo), using Biorad Lasersharp 2000 software 5.1. For co-localisation studies (Fig. 3A), a Zeiss laser-scanning confocal microscope (LSM 510 Meta) with a 63 oil-immersion objective (1.40 NA; Zeiss Plan Apochromat) and Zeiss LSM 510 Meta software 3.2 were used (pinhole set to 1 Airy disc unit). Excitation wavelengths were 488, 543 and 633 nm and fluorescence was acquired at 500–530, 560–615 and 643–717 nm for eGFP, Cy3 and Cy5, respectively. Laser power, amplifier gain and offset were adjusted to accommodate the entire dynamic range of the signal. Presynaptic localisation Neurons with distinct axons were considered for the study of presynaptic localisation of synuclein–eGFP fusion proteins. Confocal image stacks (68  68 Am, 2.5–4 Am thick) of axonal segments with the most pronounced beaded appearance were acquired, with a lateral resolution of 0.07 Am and an optical thickness of 0.53 Am. Images were compressed on the z-axis (maximal pixel intensity algorithm, ImageJ software, available from http://rsb.info.nih.gov/ij; NIH) and pixel profiles of beaded segments (20 Am) were exported into Igor Pro 4.0. Following Fourier transformation, data waves were corrected for their means and power spectral analysis was performed. The power spectra were integrated over a spatial frequency of 0–0.74 Am 1, and considered a measure of presynaptic accumulation, expressed as % change of the eGFP control.

Western blotting Primary neurons were rinsed with PBS and collected in loading buffer containing SDS and h-mercaptoethanol at 5–18 h postinfection. Samples were subjected to SDS-PAGE (~20 Ag protein per lane, 12–15% gels) and Western blotting as previously described (Specht and Schoepfer, 2001). Polyclonal rabbit antibody against GFP (rb@GFP; Abcam ab290) was used at a dilution of 1:2500. Polyclonal rabbit anti pan synuclein antibody (rb@ panSyn; 1:500; Abcam ab6176) was raised against amino acid residues 11–26 of human a-synuclein, and crossreacts with gsynuclein. Monoclonal mouse anti a-synuclein IgG1 (m@aSyn; 1:500–1:1000; Transduction Laboratories S63320) was raised against residues 15–123 of rat a-synuclein. Monoclonal mouse anti chick a-tubulin IgG1 (m@tub; 1:10000; Sigma T9026) served as positive control. HRP-conjugated secondary antibodies (goat anti-rabbit or anti-mouse IgG; Jackson ImmunoResearch Laboratories) were used at 1:10,000.

Nuclear distribution For the study of nuclear distribution of synuclein–eGFP fusion proteins, equatorial sections of nuclei (20  20 Am) were acquired with a lateral resolution of 0.02 Am and an optical thickness of 0.51 Am. For each construct, the pixel intensity ratio I soma/I nucleus was calculated on background-corrected intensity profiles (2 Am) drawn from the nucleus and the soma (ImageJ). This value was normalised against the eGFP construct (= 0.63) and represents a measure of nuclear exclusion (I soma/0.63  I nucleus).

Acknowledgments This work was funded by the Wellcome Trust (to RS). RS is a Senior Wellcome Research Fellow. We would like to thank Steve Davies for suggestions on the manuscript and Diane Griffin for the supply of SV antibody.

C.G. Specht et al. / Mol. Cell. Neurosci. 28 (2005) 326–334

References Abeliovich, A., Schmitz, Y., Farinas, I., Choi-Lundberg, D., Ho, W.H., Castillo, P.E., Shinsky, N., Verdugo, J.M., Armanini, M., Ryan, A., et al., 2000. Mice lacking alpha-synuclein display functional deficits in the nigrostriatal dopamine system. Neuron 25, 239 – 252. Altman, D.G., 1999. Practical Statistics for Medical Research. Chapman & Hall/CRC, Boca Raton, FL. Andringa, G., Du, F., Chase, T.N., Bennett, M.C., 2003. Mapping of rat brain using the Synuclein-1 monoclonal antibody reveals somatodendritic expression of alpha-synuclein in populations of neurons homologous to those vulnerable to Lewy body formation in human synucleopathies. J. Neuropathol. Exp. Neurol. 62, 1060 – 1075. Banker, G., Goslin, K., 1991. Culturing Nerve Cells. MIT Press, Cambridge, MA. Bredenbeek, P.J., Frolov, I., Rice, C.M., Schlesinger, S., 1993. Sindbis virus expression vectors: packaging of RNA replicons by using defective helper RNAs. J. Virol. 67, 6439 – 6446. Bussell, R., Eliezer, D., 2003. A structural and functional role for 11-mer repeats in alpha-synuclein and other exchangeable lipid binding proteins. J. Mol. Biol. 329, 763 – 778. Cabin, D.E., Shimazu, K., Murphy, D., Cole, N.B., Gottschalk, W., McIlwain, K.L., Orrison, B., Chen, A., Ellis, C.E., Paylor, R., et al., 2002. Synaptic vesicle depletion correlates with attenuated synaptic responses to prolonged repetitive stimulation in mice lacking alphasynuclein. J. Neurosci. 22, 8797 – 8807. Chandra, S., Chen, X., Rizo, J., Jahn, R., Sudhof, T.C., 2003. A broken alpha-helix in folded alpha-Synuclein. J. Biol. Chem. 278, 15313 – 15318. Chen, P.E., Specht, C.G., Morris, R.G., Schoepfer, R., 2002. Spatial learning is unimpaired in mice containing a deletion of the alphasynuclein locus. Eur. J. Neurosci. 16, 154 – 158. Choi, J.Y., Sung, Y.M., Park, H.J., Hur, E.H., Lee, S.J., Hahn, C., Min, B.R., Kim, I.K., Kang, S., Rhim, H., 2002. Rapid purification and analysis of alpha-synuclein proteins: C-terminal truncation promotes the conversion of alpha-synuclein into a protease-sensitive form in Escherichia coli. Biotechnol. Appl. Biochem. 36, 33 – 40. Davidson, W.S., Jonas, A., Clayton, D.F., George, J.M., 1998. Stabilization of alpha-synuclein secondary structure upon binding to synthetic membranes. J. Biol. Chem. 273, 9443 – 9449. Dev, K.K., Hofele, K., Barbieri, S., Buchman, V.L., van der Putten, H., 2003. Part II: alpha-synuclein and its molecular pathophysiological role in neurodegenerative disease. Neuropharmacology 45, 14 – 44. Farrer, M., Kachergus, J., Forno, L., Lincoln, S., Wang, D.S., Hulihan, M., Maraganore, D., Gwinn-Hardy, K., Wszolek, Z., Dickson, D., Langston, J.W., 2004. Comparison of kindreds with parkinsonism and alpha-synuclein genomic multiplications. Ann. Neurol. 55, 174 – 179. Feany, M.B., Bender, W.W., 2000. A Drosophila model of Parkinson’s disease. Nature 404, 394 – 398. Galvin, J.E., Uryu, K., Lee, V.M., Trojanowski, J.Q., 1999. Axon pathology in Parkinson’s disease and Lewy body dementia hippocampus contains alpha-, beta-, and gamma-synuclein. Proc. Natl. Acad. Sci. U. S. A. 96, 13450 – 13455. Giasson, B.I., Duda, J.E., Quinn, S.M., Zhang, B., Trojanowski, J.Q., Lee, V.M., 2002. Neuronal alpha-synucleinopathy with severe movement disorder in mice expressing A53T human alpha-synuclein. Neuron 34, 521 – 533. Goers, J., Manning-Bog, A.B., McCormack, A.L., Millett, I.S., Doniach, S., Di Monte, D.A., Uversky, V.N., Fink, A.L., 2003. Nuclear localization of alpha-synuclein and its interaction with histones. Biochemistry 42, 8465 – 8471. Iwai, A., Masliah, E., Yoshimoto, M., Ge, N., Flanagan, L., de Silva, H.A., Kittel, A., Saitoh, T., 1995. The precursor protein of non-A beta component of Alzheimer’s disease amyloid is a presynaptic protein of the central nervous system. Neuron 14, 467 – 475. Kahle, P.J., Neumann, M., Ozmen, L., Muller, V., Jacobsen, H., Schindzielorz, A., Okochi, M., Leimer, U., van der Putten, H., Probst,

333

A., et al., 2000. Subcellular localization of wild-type and Parkinson’s disease- associated mutant alpha -synuclein in human and transgenic mouse brain. J. Neurosci. 20, 6365 – 6373. Kirik, D., Rosenblad, C., Burger, C., Lundberg, C., Johansen, T.E., Muzyczka, N., Mandel, R.J., Bjorklund, A., 2002. Parkinson-like neurodegeneration induced by targeted overexpression of alphasynuclein in the nigrostriatal system. J. Neurosci. 22, 2780 – 2791. Kirik, D., Annett, L.E., Burger, C., Muzyczka, N., Mandel, R.J., Bjorklund, A., 2003. Nigrostriatal alpha-synucleinopathy induced by viral vectormediated overexpression of human alpha-synuclein: a new primate model of Parkinson’s disease. Proc. Natl. Acad. Sci. U. S. A. 100, 2884 – 2889. Krqger, R., Kuhn, W., Muller, T., Woitalla, D., Graeber, M., Kosel, S., Przuntek, H., Epplen, J.T., Schols, L., Riess, O., 1998. Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson’s disease. Nat. Genet. 18, 106 – 108. Lakso, M., Vartiainen, S., Moilanen, A.M., Sirvio, J., Thomas, J.H., Nass, R., Blakely, R.D., Wong, G., 2003. Dopaminergic neuronal loss and motor deficits in Caenorhabditis elegans overexpressing human alphasynuclein. J. Neurochem. 86, 165 – 172. Lee, M.K., Stirling, W., Xu, Y., Xu, X., Qui, D., Mandir, A.S., Dawson, T.M., Copeland, N.G., Jenkins, N.A., Price, D.L., 2002. Human alphasynuclein-harboring familial Parkinson’s disease-linked Ala-53 Y Thr mutation causes neurodegenerative disease with alpha-synuclein aggregation in transgenic mice. Proc. Natl. Acad. Sci. U. S. A. 99, 8968 – 8973. Lennon, G., Auffray, C., Polymeropoulos, M., Soares, M.B., 1996. The I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression. Genomics 33, 151 – 152. Li, Q., Lau, A., Morris, T.J., Guo, L., Fordyce, C.B., Stanley, E.F., 2004. A syntaxin 1, Galpha(o), and N-type calcium channel complex at a presynaptic nerve terminal: analysis by quantitative immunocolocalization. J. Neurosci. 24, 4070 – 4081. Lin, W.L., DeLucia, M.W., Dickson, D.W., 2004. Alpha-synuclein immunoreactivity in neuronal nuclear inclusions and neurites in multiple system atrophy. Neurosci. Lett. 354, 99 – 102. Lo Bianco, C., Ridet, J.L., Schneider, B.L., Deglon, N., Aebischer, P., 2002. Alpha-Synucleinopathy and selective dopaminergic neuron loss in a rat lentiviral-based model of Parkinson’s disease. Proc. Natl. Acad. Sci. U. S. A. 99, 10813 – 10818. Maroteaux, L., Campanelli, J.T., Scheller, R.H., 1988. Synuclein: a neuronspecific protein localized to the nucleus and presynaptic nerve terminal. J. Neurosci. 8, 2804 – 2815. Masliah, E., Rockenstein, E., Veinbergs, I., Mallory, M., Hashimoto, M., Takeda, A., Sagara, Y., Sisk, A., Mucke, L., 2000. Dopaminergic loss and inclusion body formation in alpha-synuclein mice: implications for neurodegenerative disorders. Science 287, 1265 – 1269. Matagne, A., Joris, B., Frere, J.M., 1991. Anomalous behaviour of a protein during SDS/PAGE corrected by chemical modification of carboxylic groups. Biochem. J. 280, 553 – 556. McLean, P.J., Kawamata, H., Hyman, B.T., 2001. Alpha-synucleinenhanced green fluorescent protein fusion proteins form proteasome sensitive inclusions in primary neurons. Neuroscience 104, 901 – 912. Murphy, D.D., Rueter, S.M., Trojanowski, J.Q., Lee, V.M., 2000. Synucleins are developmentally expressed, and alpha-synuclein regulates the size of the presynaptic vesicular pool in primary hippocampal neurons. J. Neurosci. 20, 3214 – 3220. Outeiro, T.F., Lindquist, S., 2003. Yeast cells provide insight into alphasynuclein biology and pathobiology. Science 302, 1772 – 1775. Perrin, R.J., Payton, J.E., Barnett, D.H., Wraight, C.L., Woods, W.S., Ye, L., George, J.M., 2003. Epitope mapping and specificity of the antialpha-synuclein monoclonal antibody Syn-1 in mouse brain and cultured cell lines. Neurosci. Lett. 349, 133 – 135. Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R., et al., 1997. Mutation in the alpha-synuclein gene identified in families with Parkinson’s disease. Science 276, 2045 – 2047.

334

C.G. Specht et al. / Mol. Cell. Neurosci. 28 (2005) 326–334

Richfield, E.K., Thiruchelvam, M.J., Cory-Slechta, D.A., Wuertzer, C., Gainetdinov, R.R., Caron, M.G., Di Monte, D.A., Federoff, H.J., 2002. Behavioral and neurochemical effects of wild-type and mutated human alpha-synuclein in transgenic mice. Exp. Neurol. 175, 35 – 48. Robertson, D.C., Schmidt, O., Ninkina, N., Jones, P.A., Sharkey, J., Buchman, V.L., 2004. Developmental loss and resistance to MPTP toxicity of dopaminergic neurones in substantia nigra pars compacta of gamma-synuclein, alpha-synuclein and double alpha/gamma-synuclein null mutant mice. J. Neurochem. 89, 1126 – 1136. Saha, A.R., Hill, J., Utton, M.A., Asuni, A.A., Ackerley, S., Grierson, A.J., Miller, C.C., Davies, A.M., Buchman, V.L., Anderton, B.H., Hanger, D.P., 2004. Parkinson’s disease alpha-synuclein mutations exhibit defective axonal transport in cultured neurons. J. Cell Sci. 117, 1017 – 1024. Schluter, O.M., Fornai, F., Alessandri, M.G., Takamori, S., Geppert, M., Jahn, R., Sudhof, T.C., 2003. Role of alpha-synuclein in 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine-induced parkinsonism in mice. Neuroscience 118, 985 – 1002. Singleton, A.B., Farrer, M., Johnson, J., Singleton, A., Hague, S., Kachergus, J., Hulihan, M., Peuralinna, T., Dutra, A., Nussbaum, R., et al., 2003. alpha-Synuclein locus triplication causes Parkinson’s disease. Science 302, 841.

Specht, C.G., Schoepfer, R., 2001. Deletion of the alpha-synuclein locus in a subpopulation of C57BL/6J inbred mice. BMC Neurosci. 2, 11. Specht, C.G., Schoepfer, R., 2004. Deletion of multimerin-1 in alphasynuclein-deficient mice. Genomics 83, 1176 – 1178. Spillantini, M.G., Schmidt, M.L., Lee, V.M., Trojanowski, J.Q., Jakes, R., Goedert, M., 1997. Alpha-synuclein in Lewy bodies. Nature 388, 839 – 840. Stoppini, L., Buchs, P.A., Muller, D., 1991. A simple method for organotypic cultures of nervous tissue. J. Neurosci. Methods 37, 173 – 182. Totterdell, S., Hanger, D., Meredith, G.E., 2004. The ultrastructural distribution of alpha-synuclein-like protein in normal mouse brain. Brain Res. 1004, 61 – 72. van der Putten, H., Wiederhold, K.H., Probst, A., Barbieri, S., Mistl, C., Danner, S., Kauffmann, S., Hofele, K., Spooren, W.P., Ruegg, M.A., et al., 2000. Neuropathology in mice expressing human alphasynuclein. J. Neurosci. 20, 6021 – 6029. Wakabayashi, K., Matsumoto, K., Takayama, K., Yoshimoto, M., Takahashi, H., 1997. NACP, a presynaptic protein, immunoreactivity in Lewy bodies in Parkinson’s disease. Neurosci. Lett. 239, 45 – 48. Zarranz, J.J., Alegre, J., Gomez-Esteban, J.C., Lezcano, E., Ros, R., Ampuero, I., Vidal, L., Hoenicka, J., Rodriguez, O., Atares, B., et al., 2004. The new mutation, E46K, of alpha-synuclein causes Parkinson and Lewy body dementia. Ann. Neurol. 55, 164 – 173.