- Email: [email protected]
Sublichenin, a new subtilin-like lantibiotics of probiotic bacterium Bacillus licheniformis MCC 2512T with antibacterial activity
Microbial Pathogenesis 128 (2019) 139–146
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Sublichenin, a new subtilin-like lantibiotics of probiotic bacterium Bacillus licheniformis MCC 2512T with antibacterial activity
T
Prakash M. Halami Microbiology and Fermentation Technology Department, CSIR-Central Food Technological Research Institute, Mysore, 570 020, India
ARTICLE INFO
ABSTRACT
Keywords: Bacillus licheniformis Subtilin-like lantibiotics Succinylation Lan operon Auto-induction Anti-Bacterial activity
Probiotic bacteria with antibacterial activity is of desirable trait since they can check the growth of pathogenic bacteria besides exhibiting health benefits to host. Aim of this study was to characterize Bacillus licheniformis MCC 2512T (MCC 2512), a potential probiotic culture for its ability to produce subtilin-like antibiotics. The antimicrobial compound produced by MCC 2512 was identified and characterized using subtilin-specific cell reporter, Bacillus subtilis 168:BS2 (BS2). Induction of β-gal by the test culture suggested the ability of B. licheniformis to produce subtilin-like lantibiotic. Subsequently, DNA sequencing of major lanS-operon was carried out, wherein sequencing results showed that lan cluster of MCC 2512 resembles entianin (etn) type. Upon lan-S disruption, the bacterial culture lost antimicrobial activity as well as ability to induce β-gal with BS2 reporter. High amount of succinylated form of antibiotics produced by wild type and un-succinylated form by engineered strain of B. subtilis 15029p clearly indicates that MCC 2512 is indeed an inter-specific subtilin-like (named as sublichenin) lantibiotic producer. Partially concentrated sublichenin preparation exhibited strong antibacterial activity against food-borne pathogens and antibiotic resistant (AR) lactic acid bacteria (LAB) with a minimum inhibitory concentration in the range of 6–10 and 0.5–1.5 μg/ml, respectively. Production of lantibiotic, sublichenin by a probiotic bacterium of B. licheniformis MCC 2512T and its antibacterial activity against food associated AR LAB is a new information reported in this study.
1. Introduction Lantibiotics are ribosomally synthesized and post-translationally modified polycyclic lanthionine containing antibiotics being used for food preservation and therapeutic purposes. Because of its strong antimicrobial activity, lantibiotics can act at nanomolar concentrations and have several therapeutic applications [1,2]. Nisin produced by Lactococcus spp. is the only lantibiotic being used for food preservation commercially [3]. To date, nine natural variants of nisin, with a range of antimicrobial spectrum and being produced by different species of lactic acid bacteria (LAB) are available [4,5]. In the recent past, antimicrobial spectrum of nisin has been investigated and found to inhibit the growth of drug-resistant bacterial strains, such as methicillin-resistant Staphylococcus aureus, Streptococcus pneumoniae, enterococci and Clostridium difficile [2,3]. Antimicrobial activity of nisin has been well documented in both Gram-positive bacteria and also in case of Gramnegative disease-associated pathogens. A newly identified nisin-like lantibiotic, SalD produced by Streptococcus salivarius 5M6c was found to inhibit the growth of some of the important pathogens like Streptococcus pyogenes and S. pneumoniae, besides several Gram-positive bacteria [4]. Subtilin, a natural variant of nisin produced by spore forming soil
bacterium has been used for several genetic and molecular studies to investigate the biosynthetic mechanisms of linear pentacyclic class-I antibiotics [1,6]. With reference to the diversity of subtilin, only three natural variants are known. This includes subtilin produced by B. subtilis ATCC 6633 [6–8], entianin produced by B. subtilis DSM 15029 [9] and ericin produced by another Bacillus subtilis A1/3 strain [10]. The conservative changes between variants of subtilin includes, four amino acid positions for ericin and three amino acid positions for entianin. Due to their structural similarities in primary sequence and biosynthetic gene organization, they are grouped together as a subtilin-like lantibiotics [9,10]. Entianin and ericin exhibited antibacterial activity against several Gram-positive bacteria. Entianin, a subtilin like lantibiotic was found to be very active against several Gram-positive pathogens, such as Staphylococcus aureus and Enterococcus faecalis [9]. Like-wise, ericin A/s producing B. subtilis strain A1/3 are known to exhibit broad spectrum of inhibitory activities against fungi and phytoviruses, as well as Clavibacter michiganensis that causes bacterial canker in tomato [10]. Thus, lantibiotics of Bacillus have broad spectrum activity against different spoilage and pathogenic bacteria. Production of nisin-like lantibiotics has been discovered from different genera and species of LAB [4,5].
E-mail address: [email protected]. https://doi.org/10.1016/j.micpath.2018.12.044 Received 25 August 2018; Received in revised form 22 December 2018; Accepted 26 December 2018 Available online 27 December 2018 0882-4010/ © 2018 Elsevier Ltd. All rights reserved.
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
B15029p (ΔetnS amyE::PspaS-lanS (Specr Neor)) (Kind courtesy Prof KD Entian). Other reference standard cultures namely, B. subtilis DSM 15029, B. subtilis ATCC 6633, whole cell biosensor B. subtilis 168.BS2 (W168 amyETP SpaS: lacZ, PSpaRK-SpaRK) and B. subtilis MB1 (ΔspaS amyE::PspaS-lacZ (SpecR, CmR, Sub−) [21] a subtilin-specific reporter, were used in this study. All the Bacillus cultures were grown in TY broth under shaking (200 rpm) or agar plate (37 °C incubator) and maintained with appropriate antibiotic/s. For antibacterial activity, the indicator organism, Kocuria rhizophila ATCC 9341 grown in TY broth under shaking at 37 °C incubator. Yeast, Saccharomyces cerevisiae strain CEN.PK2 was grown at 30 °C in YPD medium (1% yeast extract and 2% each of peptone and glucose) or synthetic drop out medium (0.5% Ammonium sulfate, 0.17% yeast nitrogen base and 2% glucose) without uracil for plasmid marker selection. The bacterial cultures enlisted in Table 1 viz. food-borne pathogens were grown in BHI broth at 37 °C under shaking and drug resistant lactic acid bacteria (LAB) [16,18] grown in De Man, Rogosa and Sharpe (MRS) broth at 37 °C incubator. The stock of all the microbial cultures was maintained at −80 °C deep freezer with 20% glycerol.
However, subtilin-like lantibiotic has been identified only in Bacillus subtilis [9]. Production of interspecific subtilin-like lantibiotic is not reported in the literature. Antibiotic resistance is spreading across in all the three compartments of ecosystem viz. health, veterinary-food chain and environment. Developing countries are recognized as the hot-bed for such resistant microbiota [11]. In order to minimize the spread of drug resistant bacteria, new and novel compounds and innovative methods are urgently required. Bacteriocins, especially the lantibiotic group constitute an emerging class of natural products that have attracted considerable interest as promising alternatives to existing antibiotics [12,14]. New antimicrobials of bacterial origin possess novel modes of action, exhibiting collateral sensitivity against drug resistant organisms so that they can be specifically targeted for their applications [13,14]. Lantibiotics finds considerable potential as a consequence of their unusual structures, unique mechanisms of action and their potency against multi-drug resistant bacteria, AMR induced biofilm producing bacteria [2,13,14]. Nisin variants were reported exhibiting improved antimicrobial activity against VRE, MRSA as well as against diarrhea causing C. difficile and against some of Gram-negative bacteria [5,11]. However, limited studies are carried out in case of subtilin-like antibiotics with reference to its antimicrobial spectrum against antibiotic resistant bacteria. In food-chain, antimicrobial resistance is also increasing at an alarming rate. This is because of the fact that, nearly 70% of antibiotics used is being directed towards food-animals as a therapeutic and as a growth promoter [15]. This results in development of antibiotic resistant bacteria in food system. LAB a natural microflora of GI tract, being consumed as a probiotic are often referred as reservoir for antibiotic resistant (AR) genes and are found to exhibit antibiotic induced biofilm formation [16–18]. Most LAB are found to harbor genes associated with multidrug resistant viz. aminoglycoside resistance [15,16]. AR genes such as aac aph can be easily transferred to pathogenic bacteria hence raising the question of biosafety of the food-grade bacterial cultures [17]. There are limited studies on antibacterial substance of natural origin to control such drug resistant bacteria. This report describes the first case of subtilin-like antibiotic production by industrially important strain of B. licheniformis. Antibacterial activity of crude sublichenin preparation against food-borne pathogens and AR LAB is also reported.
2.3. Antibacterial activity and chromogenic plate assay For the detection of lantibiotic production, spot-on-lawn assay was performed [20]. Overnight grown indicator bacterium was grown freshly to an optical density at 600 nm (OD600) of 0.8 at and the inoculum of 1 ml/L was mixed when the media temperature was around 50 °C and pour-plated on LB agar plate. For auto-induction property of β-gal, a petri-plate assay was performed as described by Spiess et al. [20]. A fresh overnight culture of subtilin reporter, BS2 was inoculated to an OD600 of 0.1 and incubated at 37 °C until an OD600 of 1.0 was reached. Subsequently, 100 μl of culture was used to inoculate 100 ml cooled down LB agar medium supplemented with 4 mg of X-Gal. Thereafter, 5 μl of a fresh overnight culture of the strain of interest or test sample was spotted onto the plate. The plate was incubated overnight at 37 °C and observed for blue coloration around the spot. 2.4. β-Galactosidase induction assay An overnight grown culture of subtilin reporter strain, B6633.MB1 was inoculated to an OD600 0.1 in TY medium containing 0.3 M NaCl. The culture was grown to an OD600 at 1.0 and used for of β-gal induction by lantibiotics as described previously [20]. Thereafter, 2 ml of the culture was transferred into small test tubes containing different concentrations of lantibiotics (ranging from 3 to 12 nm for native and 50–1500 nM for succinylated). After 1 h, samples were taken and cells were harvested by centrifugation and stored at −20 °C for β-galactosidase assay. The β-galactosidase activity was measured as described previously and normalized to the cell density [22].
2. Materials and methods 2.1. Microbiological media, fine chemicals and reagents All microbiological media were from Merck (Merck KGaA, Darmstadt, Germany). Fine chemicals such as, Agarose, X-Gal (5bromo-4-chloro- 3-indolyl-beta-D-galacto-pyranoside), ONPG (ONitrophenyl β-galactoside) as well as Sodium chloride; organic solvents such as butanol, acetone, chloroform and ethanol were purchased from Sigma (Sigma-Aldrich, Taufkirchen, Germany). Oligonucleotide primers were obtained from Scientific Research and Development GmbH, Oberursel, Germany. All chemicals used were of analytical grade unless otherwise mentioned. For selection of B. subtilis transformants, antibiotics such as neomycin (15 μg/ml), chloramphenicol (5 μg/ml) and spectinomycin (100 μg/ml) were used. For selection of B. licheniformis and E. coli transformants, spectinomycin (250 μg/ml), ampicillin (100 μg/ml) was used, respectively.
2.5. DNA techniques and PCR amplification The lan operon was amplified using primer/s 15029-26F (5′-CTTA TATGAAGTTCAGCAGG G-3′) and 15029-37R(5′-GAATTGGCCAGCTCC AAGG-3′); 15029-10F(5′-AATCAGTTAG AAAGAAAGCTCC-3′) and 15029-3R (5′-CTACACCTACAGCTCCATCC-3′) primer 15029-13F ( 5′-CATTGTTGAGTTTAATCGTGAG-3′) with 15029–8R (5′-ATTCGTAT GAAGGAATCTGCC-3′) spanning regions 4649–9227; 1622–6566; and 7879–13333 respectively (as per the entianin partial sequences GenBank Accession No. HQ871873). In addition, 5 kb spanning upstream region of lan operon was amplified using primers, LanBUP( 5′-ACTTTATTCTATAATGGGAAGC-3′) and BlR01 (5′-TCATCTGCAATT TCATAATTGC-3′). PCR components comprised of 100–300 ng of genomic DNA, a 0.2 mM concentration of each deoxynucleoside triphosphate, 200 mM of each primer and 1.25 U of fusion DNA polymerase along with 3% DMSO. The samples were amplified after incubation at 94 °C (5 min), followed by 30 cycles at 94 °C (30 s), 55 °C
2.2. Bacterial, yeast cultures and their growth conditions Bacterial strain of Bacillus licheniformis MCC 2512T is a laboratory isolate obtained for its potential probiotic properties [19]. B. licheniformis Δ2512 is a lanS disrupted strain of MCC 2512. B. subtilis B15029.TSp01 (ΔetnS (SpecR, Ent−) [20] was transformed with lanS synthetic gene construct of MCC 2512 for obtaining Bacillus subtilis 140
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
Table 1 MIC of crude preparation of sublichenin produced by B. licheniformis. MCC 2512T against antibiotic resistant LAB and food-borne pathogens. Bacterial culture name
Resistant phenotype R
R
R
R
R
R
R
Source & referencea
MIC (μg/ml)
Pork intestine Beef intestine, Sheep intestine Sheep intestine Chicken meat -do-doChicken intestine Chicken sausage Chicken intestine
1.5 0.5 0.5 0.25 0.5 0.25 0.5 0.5 0.5 0.75 1.5 1.5 0.75
Pediococcus lolii MCC 2972 Enterococcus durans B20G1 Enterococcus faecalis MF3 E. faecalis MM2 E. faecalis CHL1 E. faecalis CHL3 E. faecalis CHL E. faecalis MCC 3063 E. faecalis MCC 2773 Enterococcus faecium MCC 2763 Entercoccus avium CS32+ Enterococcus cecorum 1-40a Lactobacillus plantarum MCC 2774
Gen , Apr , Str , Neo Ami , Spc , GenR, AprR, KanR GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, SpcR, KanR GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, NeoR AmiR,KanR AprR, StrR, NeoR AmiR, SpcR, KanR GenR, KanR, StrR GenR, KanR, StrR AprR, StrR, NeoR AmiR, SpcR, KanR
Food-borne pathogens
Strain No
Source
Kokuria rhizophila Listeria monocytogenes
ATCC 9431 Scott A
Staphylococcus aureus Staphylococcus aureus (MRSA) Escherichia coli Klebsiella pneumoniae
MTCC 96 ATCC 43300 ETEC ATCC® 10031™
ATCCa AK Bhunia, Purdue University, USA IMTECH Chandigarh, India ATCC ATCC ATCC
a b
Kan
R
Kan
KanR KanR KanR
Chicken sausage
0.5 2 5 7 > 08 10
Jaimee and Halami [16–18]. American Type Culture Colllection.
(30 s), and 72 °C (3–5 min) for amplification of larger (3- or 5-kb) DNA fragments, followed by 1 cycle of 72 °C (10 min) in a Thermo Cycler GeneAmp 2400 (Perkin-Elmer). The PCR product was gel eluted and purified using QIAquick PCR purification kit (Qiagen, Hilden, Germany).
of acetone. Thus the precipitate obtained referred as partially purified. Further purification was done according to a modified protocol described by Spiess et al. [20]. Lantibiotic and its succinylated form was separated on a semi-preparative reverse-phase (RP) high-performance liquid chromatography (HPLC) column (5 μm, 110 Å, 250 by 10 mm; Gemini-NX C18 liquid chromatography [LC] column [Phenomenex, CA, USA]) using eluents A (20% acetonitrile [HPLC grade], 0.1% 2,2,2trifluoroacetic acid [TFA]) and B (99.9% acetonitrile [HPLC grade], 0.1% TFA). One of the major peak was eluted with a linear gradient of 17%–45% eluent B within 40 and another at 48 min (∼80% eluent B) which was collected individually. The collected fractions were dried under vacuum and re-suspended in 5% acetonitrile for bioassay or β-gal assay as described above. Analytical Reverse-Phase High-Performance Liquid Chromatography (RP-HPLC) column (5 μm; 250 by 4.6 mm; Gemini-NX) was performed following a procedure described previously [8]. The samples were read at 214 nm and 280 nm and the β-gal active peak was used for further analysis. For mass spectrometric analysis, the vacuum dried sample was dissolved in 30% acetonitrile and 0.1% TFA. For all Mass Spectrometric analysis, a Voyager- DE STR mass spectrometer (Applied Biosystems, Darmstadt, Germany) and a MALDI linear trap quadrupole (LTQ) Orbitrap XL Mass Spectrometer (Thermo Fisher Scientific, Inc., Waltham, MA) were used. The conditions and analyses parameters were as described by Fuchs et al. [9]. Molarities were calculated using the Molar Extinction Co-efficient of subtilin (ε280 = 5750 L mol−1 cm−1; ProtParam; ExPASy). The peak areas were recorded using an Agilent 1200 series ChemStation for LC three-dimensional systems offline program and used to form equations (x = peak area; y = micrograms of lantibiotic), resulting in y = 1195.8x + 370.97 and y = 77.684x + 7.4 for 214 nm and 280 nm, respectively.
2.6. Construction of disruptive plasmid and lan S disruption Vector, pRS416 was used as a backbone plasmid for the construction of pPH1ΔlanS. Disruptive plasmid was constructed as follows. pRS416 was linearized with BamHI and transformed into Saccharomyces cerevisiae CEN.PK2 (MATa/α ura3-52/ura3-52 trp1-289/trp1-289 leu23112/leu2-3112 his3Δ1/his3Δ1 MAL2-8C/MAL2-8CSUC2/SUC2) together with the PCR products of Ph1201F(5′-GGTATCGATAAGCTTGA TATCGAATTCCTGCAGCCCGGGGTCAGTGGAA TAGCAAGTTACC-3′)/ Ph1202R(5‘-GGTCACCTCCTTTCAATACC) (upstream lanS region), Ph1203F (5′- GAATCACTTTGCTCTGACTCC-3′)/Ph1204R (5′-AGCTCC ACCGCGGTGG CGGCCGCTCTAGAACTAGTGGATCTCCGGGTCATTAG AGATATACG-3′) (down-stream lanS region), and Spec-F5′-TATTTGTC TGTTACTATATAGGTATTGAAAGGAGGTGA CCGGATCGATCTGTATA ATAAAG-3’/R(5′-TAACGCTCAGGAATGCAAGGAGTCAGAG CAAAGTG ATTCGTTTATAAGTGGGTAAACCGTG-3′) (spectinomycin resistance cassette), amplified from ECE74 [20]. Recombinant plasmid, pPH1ΔlanS linearized with Nde1 and was transformed for gap repair in Saccharomyces cerevisiae strain CEN.PK2 as described by Schiestl and Gietz [23]. Standard methodology described in the laboratory protocol was employed for the isolation of recombinant plasmids from CEN.PK2 and E. coli. Transformation of B. licheniformis was performed as described previously for B. subtilis [20] with certain modification, wherein higher concentration of spectinomycin (as described above) was used for selection.
2.8. DNA sequencing, analysis and GenBank deposition
2.7. Purification and quantification of lantibiotics
DNA sequencing was performed by Scientific Research and Development GmbH, Oberursel, Germany. Clone Manager professional suite and or NCBI online tools viz BLAST was used for analysis of DNA sequences using Bioinformatics [24]. The partial DNA sequence of the sublichenin gene cluster of B. licheniformis MCC 2512T has been deposited in GenBank under Accession number MF399478.
B. licheniformis MCC 2512T and B15029p was grown at 37 °C in medium-A for optimized production of lantibiotics as per the protocol of Spiess et al. [20] in 50 ml of the respective medium in 500-ml flasks. Culture supernatants of MCC 2512 and B15029p concentrated by 0.5 volume of butanol and the extract obtained was precipitated with 2 vol 141
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
2.9. MIC determination and statistical analysis
type amino acid residues were found. Structural gene, lanS showed 95% sequence similarity with subtilin and entianin and 94% with ericin S. Thus lanS of B. licheniformis MCC 2512T represented novel sequences and deduced amino acid showed four exchanges. The first, at 30th position being a spaS type, 2nd at 39th position eriS type and 3rd at 48th position being an etnS type and 4th being spaS/etnS type (Fig. 1). As till date, no such subtilin-like lantibiotic with unique combination of amino acid has been reported, hence it could be named as Sublichenin (subtilin-like lantibiotics produced by B. licheniformis) [1]. Thus, sublichenin represents a new subtilin-like lantibiotics, however, it is most identical to entianin. Ne terminal extension of immunity lipoprotein LanI, also represented EtnI type. Though most of amino acid exchanges were EtnI type, one of them was SpaI and another being unique. With reference to LanF, a component of ABC transporter: entire LanF of 245 aa was obtained, whose sequence exhibited high level similarity with EtnF. However, few new exchanges were also reported. LanE: Lan E of only 51 aa consisting of C-terminal end was analyzed. As expected all the exchanges were similar to EntE type. LanG: an interesting N-terminal extension as found in Etn was noticed. In case of LanR: 200 aa deduced sequence represented Etn type as expected. Likewise, with reference to LanK, 200 aa sequence was most similar to Etn type. Orf3 was amplified using 3’ end primer (15029-8R) to identify the flanking region. Deduced aa sequences of partial orf3 showed 100% homology with Etn Orf3. Flanking region of lan operon of 2512 clearly indicated that there must be an integration of lantibiotic gene cluster, recombining region need to be identified. On the other hand, upstream sequences of lan operon showed similarity only with Etn type. B. licheniformis is an industrially important strain being used for the production of several enzymes and fine chemicals. It is known for the production of some of the antibiotics that include, licheniformin, bacitracin and proticin [28]. Recently, B. licheniformis MCC 2512T has been identified as a potential probiotic because of its food-grade nature and health benefits to host [25–27]. Since subtilin-like lantibiotic production by B. licheniformis was a newly established information, DNA sequencing of all the lan operon genes including flanking region was undertaken. BLAST analysis of lan operon, revealed that several strains of B. subtilis also had the similar lan operon. These results suggested that there must be a high diversity of subtilin-like bacteriocin as found in nisin, indicating the need for further investigations. Sequence results for lanBUP along with BlR01 indicated that the sequence length of 940 bp was 100% similar to subtilin-like antibiotic producing strain of B. subtilis DSM TU (Acc No. NC016047). Since subtilin biosynthesis genes are chromosomally encoded, there must be an involvement of conjugative plasmid for mobilizing the interspecific bacteriocin production trait as observed in case of Bacillus coagulans for pediocin-like (coagulin) bacteriocin production [29].
B. licheniformis MCC 2512T was grown in medium-A, CFS was extracted with butanol followed by acetone precipitation, as described above. The dried precipitate was dissolved in Mili Q water and was used for protein estimation using Bicinchoninic acid protein assay kit (Sigma Aldrich). Minimum Inhibitory Concentration (MIC) determination was carried out against the range of AR LAB and food-borne pathogens enlisted in Table 1. For MIC determination, FBPs were cultivated overnight under shaking condition in BHI broth at 37 °C. AR LAB cultures were grown in MRS broth at 37 °C under static condition. Next day, test culture was diluted to OD600 0.001 in a fresh medium and the antibiotic with different concentrations were incorporated and the test was carried out in 96 well ELISA plate. Bacterial cultures were allowed to grow (FBPs under shaking and LAB under static condition) for 10–12 h and the OD600 was recorded using an ELISA plate reader (Thermo Scientific). MIC was calculated wherein the lowest concentration of antibiotics (μg/ml) exhibited no growth of the indicator bacteria. For all statistical analysis, one way analysis of variance (ANOVA) was used using Microsoft excel. p < 0.05 was considered statistically significant. All the data was represented as mean ± SD and represent data from a minimum of two independent experiments. 3. Results and discussion 3.1. Characterization of lanS operon Earlier studies have shown potential probiotic properties by Bacillus licheniformis MCC 2512T which was demonstrated in our laboratory [21–23]. In addition, we have demonstrated that this culture has the capacity to produce subtilin-like bacteriocin (low MW peptide) [19]. To confirm lan operon, DNA sequencing was undertaken for the presence of lanS structural gene and other accessory genes. As expected, primer set 15029–26 and 24 yielded 5.2 kb PCR product. Primer set 15029–2 and 37 gave 4.5 Kb amplicon, 15029–3 and 10 gave 5 kb and 15029–14 with 15029–3 gave 4.2 kb PCR product, covering entire lan operon. All the four individual PCR products obtained were sequenced using the corresponding primers or internal primers. Obtained sequences of MCC 2512 were aligned against 15029 using clone manager. A detailed comparison of deduced amino acid sequences obtained from lan operon of 2512 with B. subtilis ATCC 6633 and D15029 is described in supplementary Figure 01. DNA sequencing results indicated that 2512 had a very similar and unique lan operon of entianin (Etn) type. Upon BLAST search analysis it showed that the lan operon of MCC 2512 exhibited 100% homology with complete genome of Bacillus subtilis strain ge25, (CP021903.1) and Bacillus sp. YP1, (CP010014.1). Translated partial amino acid (aa) sequence of LanB (145–425 aa positon of EtnB) indicated few exchanges of around 11 amino acids similar to Etn type. LanT representing N-terminal partial sequences of 1–110 amino acid showed few exchanges than SpaB, however similar to EtnB type. Similarly, amino acid sequence of LanC comprising region 60 to 400 aa was mostly EtnC type. However, few unique and few SpaC
3.2. Construction and characterization of lan-S disruptive mutant For the deletion of lanS gene of MCC 2512, a disruptive plasmid pPHlanS was constructed and transformed into the host bacterium. The Fig. 1. Comparison of nisin with subtilin-like antibiotics as well as deduced amino acid sequences of sublichenin (LanS) produced by B. licheniformis MCC 2512T reported in this study. Amino acid residues in open box showed the similarity among nisin and subtilin-like molecules. In shaded box are the similarity of LanS (sublichenin identified in this study) with subtilin-like peptide antibiotics. Arrow indicates the N-terminal sequences of pre-peptide. Bended arrow indicates the putative position of thioether ring.
142
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
BS2 reporter and also exhibits antibacterial activity against K. rhizophila (Fig. 3). These results also helped to confirm the ability of 15029.TSp01 machinery to process biologically active form of lantibiotics of MCC 2512. Previously, entianin producing host had been successfully exploited for the heterologous production of subtilin as well as its engineered variants [8,20]. In view to provide suitable evidences that the antibacterial substance produced by MCC 2512 is a subtilin-like molecule and is identical to antibacterial molecule of B. subtilis B15029p, further characterization of antibacterial peptide was carried out. RP HPLC analysis of lantibiotic preparation of MCC 2512 showed major peaks at 36 and 48 min elution. These two fractions were collected and assayed for β-gal induction activity (Fig. 4A). However, sample obtained from B. subtilis B15029p showed only 36 min peak (Fig. 4B). Chromatogram pattern (Fig. 4) comparison of A and B showed that, B15029p was lacking 48 min peak, indicating it does not succinylate the sublichenin. This observation suggested the ability of host bacterium (B. subtilis B15029p) tolerance for greater amount of un-succinylated substance, rather than processing it into an inactive sublichenin. Quantitative RP-HPLC of 36 and 48 min peak was individually performed (Fig. 5) and the β-gal inducing peak was used for mass spectrophotometry measurements. Upon MALDI TOF analysis, the 36 min peak confirmed the lantibiotic of expected MW 3348 Da, as observed with translated aa sequences of matured sublichenin. Likewise, 48 min peak was found to have a size of 3448 Da with increase in MW of 100 Da (Fig. 5), which confirmed the succinylated form of sublichenin, also it coincided with succinylatedsubtilin (data not shown). These results correlated to succinylation studies carried out in subtilin and entianin [8,9]. Confirmation by MALDI TOF analysis in combination with analytical RP- HPLC results obtained were used for quantification of lantibiotics of MCC 2512.
Fig. 2. Characterization of lanS deletion mutant by antibacterial activity against Kocuria rhizophila ATCC 9341 (A) and auto-induction assay using BS2 reporter (B), + positive reaction, - negative reaction. 6633, B. subtilis ATCC 6633; 2512, MCC 2512 and Δ2512, lanS deleted MCC 2512.
3.4. B. licheniformis MCC 2512T produces high amount of succinylated lantibiotics Fig. 3. Antibacterial activity and auto-induction ability of B. subtilis 15029p expressing lanS of 2512. antibacterial activity was evaluated against Kocuria rhizophila ATCC 9341 (A) and auto-induction assay using BS2 reporter (B). 2512, MCC 2512; B15029, B. subtilis DSM 15029 and B15029p, Δ15029p::MCC 2512 lanS.
In order to evaluate auto-induction ability of succinylated lantibiotic produced by MCC 2512, individual active peak appeared at 36 and 48 min elution was collected, freeze dried and used for β-gal induction assay. Auto-induction assay showed that the succinylated form of lantibiotic had reduced level of β-gal induction. This induction was comparable with sublichenin, wherein 4000 Miller unit of β-gal was observed with 6 nM concentration of native molecule (Fig. 6). On the other hand, it was ∼150 times more potent than succinylated form. N-terminal tryptophan of matured subtilin-like lantibiotics is known to undergo succinylation [8,30]. To study the fate of lantibiotic produced by MCC 2512, the test culture was grown in medium-A as synthetic medium known to ensure low production of succinylation of entianin [8]. Production of non-succinylated form of sublichenin suggested that the host bacterium plays a role in succinilation. As described above, succinylation of subtilin-like lantibiotic is known to be modified by the host enzyme [8]. With reference to auto-induction and antibacterial potency, it was observed that succinilated form of lantibiotic showed remarkable difference for its auto-induction ability (100 fold less) and 10–40 fold less for antibacterial activity compared to un-succinylated counterpart [9,30]. In this study, succinylated lantibiotic was > 150 fold less effective than its native counterpart with regard to auto-induction. However, further studies are to be undertaken to unravel antibacterial spectra against a broad range of target bacteria to assess the potency of succinylated molecule. Results obtained in this study suggest that the strain of B licheniformis could be more prone for succinylation as compared to B. subtilis. As a means of general resistance mechanism for the producer bacterium, succinylation of subtilin-like lantibiotics could provide negative charge to the N-terminal of peptide with reduced interaction with lipid II. It is also reported that succinylation reduces the autoinduction capacity of lantibiotic, and hence associated with prevention of toxic
lanS deletion strain (Δ2512) was initially confirmed for its growth in medium containing spectinomycin and lack activity against K. rhizophila. The loss of antibacterial activity as well as ability to induce betagal when assayed using BS2 reporter (Fig. 2). Stable integration was confirmed by diagnostic PCR followed by growth in antibiotic selection media in subsequent generation. Antibacterial activity was quite prominent against K. rhizophila by the standard reference culture as well as WT 2512. These results suggest the requirement of intact lanS gene for antibacterial activity of 2512. Though, Δ2512 showed marginal antibacterial activity against K rhizophila, such background inhibition could be due to other antibacterial substances than the target lantibiotics, produced by the test culture. Disruption mutagenesis has been successfully employed previously for the functional analysis of lantibiotics [8,10]. 3.3. Evidence for subtilin-like lantibiotic production Subtilin-like (sublichenin) lantibiotic production was additionally confirmed upon heterologous expression of synthetic gene into B. subtilis B15029.TSp01 (Δ15029). B. subtilis Δ15029 is etnS gene disrupted strain obtained by introducing SpecR cassette. B. subtilis Δ15029 has all the lantibiotic gene cluster except its corresponding structural (etnS) gene. B. subtilis B15029p (B15029p) is a TSp01 derivative wherein etnS has been replaced with lanS of 2512 along with neomycin resistant cassette. B15029p has the ability to induce β-gal when assayed using 143
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
Fig. 4. RP-HPLC profile of native lantibiotic of B. licheniformis MCC 2512T (A) and upon heterologous expressed in B. subtilis B15029p (B). Each peak was collected and assayed for β-gal induction (a). Arrow indicates the type of peak that was used for analytical RP HPLC. (C) A1, crude CF of sample A; B1, crude CF of sample B; N1, N2 are 36 min Peak of Sample A1 and B1 respectively, S1, 48 min peak of sample A1. Five ul of sample was spotted for β-gal induction using reporter. Other numbered spots are the non β-gal inducing samples.
Fig. 5. Quantification and molecular weight estimation of sublichenin and its succinylated form. Quantitative RP-HPLC separation and MALDI TOF analysis of (a) sublichenin and its (b) succinylated form (inset).
3.5. Antibacterial spectra of B. licheniformis MCC 2512T There is a growing concern among antibiotic resistance to human pathogens that cause infectious diseases [2]. Humans consume ever more antibiotics not only through prescriptions but also through agriculture and livestock products that lead to rapid development of AMR in the food chain. Hence, there is an urgent need to increase defense against specific AMR bacteria. Since, lantibiotics are yet to be brought into use as therapeutic agents, there is a need to understand their potency against the AMR resistant bacteria [14]. In this study, an attempt has been made to evaluate the potency of crude preparation of sublichenin against FBPs and AR LAB that are known to produce biofilm upon antibiotic exposure [18]. A very potent MIC of 0.5 μg/ml against K. rhizophila was found. However, higher concentration of AMC was required in case of Gram-negative pathogens (8–10 μg/ml) and for Gram-positive pathogens such as MRSA (6–8 μg/ml). AMC was quite potent against AR LAB wherein MIC in the range of 0.5–1.5 μg/ml was reported. These results indicated that AMC of B. licheniformis MCC 2512T has a broad spectrum antibacterial activity against a wide range of bacteria. Lantibiotics have been tested and found to inhibit the growth of MRSA, bacterial plant pathogens as well as collateral sensitivity to MDR bacteria [9,10,14]. Lantibiotic group of bacteriocins can be a suitable alternative to conventional antibiotics because of their broad spectrum activity against MDR pathogens [3]. Antibacterial
Fig. 6. Induction response of subtilin reporter B6633.MB1 upon addition of sublichenin peptide of MCC 2512. β-gal activity was measured after 60 min of induction. Error bars represent two SD of two separate cultures measured in duplicate. Control, no lantibiotic was added.
effect of lantibiotics [8]. B. licheniformis which is an industrially relevant culture, indicating that succinylation mechanism must be very effective since large amount of succinylated lantibiotic was detected. 144
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
activity of sublichenin, a subtilin-like antibiotics against drug resistant LAB is reported for the first time in this study. 4. Conclusion
[2]
This study reports the interspecific production of subtilin-like lantibiotics by the industrially important probiotic strain of B. licheniformis MCC 2512T. Heterologously expressed lantibiotic (sublichenin) was produced without succinylation indicating the importance of host bacterium. The new exchanges found in the aa sequence of lantibiotic produced by MCC 2512 could be associated with potential antibacterial activity. Sublichenin biosynthesis operon is very similar to entianin operon suggesting high diversity of this class of lantibiotics in nature. Ability of crude preparation of sublichenin to inhibit the growth of AR bacteria provides a means in combating their spread and application in food system. Newly discovered sublichenin producing culture can be used in functional food preparation since the bacterium is of food-grade and possesses probiotic as well as starter culture properties. In addition, B. licheniformis MCC 2512T can be used for in situ production of sublichenin that can curtail the development of resistance besides combating intestinal infection.
[3] [4] [5]
[6] [7] [8]
[9]
Conflicts of interest
[10]
The author declares no competing interests. Ethical approval
[11]
This article does not contain any studies with human participants or animals performed by the author.
[12] [13]
Funding
[14]
This work was supported by CSIR-DAAD exchange of academic (No. 50015739) and DBT Govt. of India New Delhi (BT/PR16706/NER/95/ 259/2015). Acknowledgements
[15]
Author thankfully acknowledges the kind permission granted by Prof. Dr. K-D Entian to carry out this study in his laboratory at the Institute of Molecular Biosciences, University of Frankfurt/M, Germany. Also sincere gratitude to Prof Entian and his team for granting full access to research facility for analysis and generously providing bacterial cultures indicated in this study. This work was carried out under CSIR-DAAD exchange of academics-2015 program. Part of study was supported with funding from Department of Biotechnology, Govt. of India New Delhi (BT/PR16706/NER/95/259/2015). Author also acknowledges Akash Bal for performing the part of antibacterial sensitivity assays and Dr SVN Vijayendra for critically reading the manuscript text.
[16]
[17]
[18] [19]
[20]
Appendix A. Supplementary data
[21]
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.micpath.2018.12.044.
[22]
References
[23]
[1] P.G. Arnison, M.J. Bibb, G. Bierbaum, A.A. Bowers, T.S. Bugni, G. Bulaj, J.A. Camarero, D.J. Campopiano, G.L. Challis, J. Clardy, P.D. Cotter, D.J. Craik, M. Dawson, E. Dittmann, S. Donadio, P.C. Dorrestein, K.-D. Entian, M.A. Fischbach, J.S. Garavelli, U. Göransson, C.W. Gruber, D.H. Haft, T.K. Hemscheidt, C. Hertweck, C. Hill, A.R. Horswill, M. Jaspars, W.L. Kelly, J.P. Klinman, O.P. Kuipers, A.J. Link, W. Liu, M.A. Marahiel, D.A. Mitchell, G.N. Moll, B.S. Moore, R. Müller, S.K. Nair, I.F. Nes, G.E. Norris, B.M. Olivera, H. Onaka, M.L. Patchett, J. Piel, M.J. Reaney, S. Rebuffat, R.P. Ross, H.G. Sahl, E.W. Schmidt, M.E. Selsted, K. Severinov, B. Shen,
[24]
[25] [26]
145
K. Sivonen, L. Smith, T. Stein, R.D. Süssmuth, J.R. Tagg, G.L. Tang, A.W. Truman, J.C. Vederas, C.T. Walsh, J.D. Walton, S.C. Wenzel, J.M. Willey, W.A. van der Donk, Ribosomally synthesized and post-translationally modified peptide natural products: overview and recommendations for a universal nomenclature, Nat. Prod. Rep. 30 (2013) 108–160, https://doi.org/10.1039/c2np20085f. M. Montalba´n-Lo´pez, L. Zhou, As Buivydas, A.J. van Heel, O.P. Kuipers, Increasing the success rate of lantibiotic drug discovery by synthetic biology, Expert Opin. Drug Discov. 7 (2012) 695–709, https://doi.org/10.1517/17460441.2012.693476. P.D. Cotter, R.P. Ross, C. Hill, Bacteriocins — a viable alternative to antibiotics, Nat. Rev. Microbiol. 11 (2013) 95–105. J.M. Shin, J.W. Gwak, P. Kamarajan, J.C. Fenno, A.H. Rickard, Y.L. Kapila, Biomedical application of nisin, J. Appl. Microbiol. 120 (6) (2016) 1449–1465, https://doi.org/10.1111/jam.13033. P.M. O'Connor, E.F. O'Shea, C.M. Guinane, O. O'Sullivan, P.D. Cotter, R.P. Ross, C. Hill, Nisin H is a new nisin variant produced by the gut-derived strain Streptococcus hyointestinalis DPC 6484, Appl. Environ. Microbiol. 81 (2015) 3953–3960, https://doi.org/10.1128/AEM.00212-15. S. Banerjee, J.N. Hansen, Structure and expression of a gene encoding the precursor of subtilin, a small protein antibiotic, J. Biol. Chem. 263 (1988) 9508–9514. K.-D. Entian, W.M. de Vos, Genetics of subtilin and nisin biosynthesis: biosynthesis of lantibiotics, Antonie Leeuwenhoek 69 (1996) 109–117, https://doi.org/10. 1007/BF00399416. S.M. Bochmann, T. Spieß, P. Kötter, K.D. Entian, Synthesis and succinylation of subtilin-like lantibiotics are strongly influenced by glucose and transition state regulator AbrB, Appl. Environ. Microbiol. 81 (2) (2015) 614–622, https://doi.org/ 10.1128/AEM.02579-14. S.W. Fuchs, T.W. Jaskolla, S. Bochmann, P. Kötter, T. Wichelhaus, M. Karas, et al., Entianin, a novel subtilin-like lantibiotic from Bacillus subtilis subsp. spizizenii DSM 15029T with high antimicrobial activity, Appl. Environ. Microbiol. 77 (5) (2011) 1698–1707, https://doi.org/10.1128/AEM.01962-10. T. Stein, S. Borchert, B. Conrad, J. Feesche, B. Hofemeister, J. Hofemeister, K.D. Entian, Two different lantibiotic-like peptides originate from the ericin gene cluster of Bacillus subtilis A1/3, J. Bacteriol. 184 (2002) 1703–1711, https://doi. org/10.1128/JB.184.6.1703-1711.2002. J.A. Ayukekbong, M. Ntemgwa, A.N. Atabe, The threat of antimicrobial resistance in developing countries: causes and control strategies, Antimicrob. Resist. Infect. Contr. 6 (2017) 47, https://doi.org/10.1186/s13756-017-0208-x. Des Field, P.D. Cotter, C. Hill, R.P. Ross, Bioengineering lantibiotics for therapeutic success, Front. Microbiol. 6 (2015) 1363, https://doi.org/10.3389/fmicb.2015. 01363. H. Mathur, Des Field, M.C. Rea, P.D. Cotter, C. Hill, R.P. Ross, Fighting biofilms with lantibiotics and other groups of bacteriocins, Biofilms and Microbiomes 4 (2018) 9, https://doi.org/10.1038/s41522-018-0053-6 2018. V. Lazar, A. Martins, R. Spohn, L. Daruka, G. Grezal, G. Fekete, M. Szamel, P.K. Jangir, B. Kintses, B. Csorgő, A. Nyerges, A. Gyorkei, A. Kincses, A. Der, F.R. Walter, M.A. Deli, E. Urban, Z. Hegedűs, G. Olajos, O. Mehi, B. Balint, I. Nagy, T.A. Martinek, B. Papp, C. Pal, Antibiotic-resistant bacteria show widespread collateral sensitivity to antimicrobial peptides, Nature Microbiol 3 (2018) 718–731, https://doi.org/10.1038/s41564-018-0164-0. G. Jaimee, P.M. Halami, Emerging resistance to aminoglycosides in lactic acid bacteria of food origin—an impending menace, Appl. Microbiol. Biotechnol. 100 (3) (2016) 1137–1151, https://doi.org/10.1007/s00253-015-7184-y. G. Jaimee, P.M. Halami, High level aminoglycoside resistance in Enterococcus, Pediococcus and Lactobacillus species from farm animals and commercial meat products, Ann. Microbiol. 66 (2016) 101–110, https://doi.org/10.1007/s13213015-1086-1. G. Jaimee, P.M. Halami, Conjugal transfer of aac-aph from native species and mechanism of regulation and cross resistance in Enterococcus faecalis MCC 3063 by real time-PCR, Microb. Pathog. 110 (2017) 546–553, https://doi.org/10.1016/j. micpath.2017.07.049. G. Jaimee, P.M. Halami, Presence of extracellular DNA and protein in biofilm formation by gentamicin resistant Lactobacillus plantarum, Indian J. Med. Res. (2018) (accepted). P. Shobharani, R.J. Padmaja, P.M. Halami, Diversity in the antibacterial potential of probiotic cultures Bacillus licheniformis MCC2514 and Bacillus licheniformis MCC2512, Res. Microbiol. 166 (6) (2015) 546–554, https://doi.org/10.1016/j. resmic.2015.06.003. T. Spieß, S.M. Korn, P. Kötter, K.D. Entian, Auto-induction specificities of the lantibiotics subtilin and nisin, Appl. Environ. Microbiol. 81 (22) (2015) 7914–7923, https://doi.org/10.1128/AEM.02392-15. M. Burkard, K.-D. Entian, T. Stein, Development and application of a microtiter plate-based auto-induction bioassay for detection of the lantibiotic subtilin, J. Microbiol. Methods 70 (2007) 179–185, https://doi.org/10.1016/j.mimet.2007.04. 015. J. H Miller, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1972. R.H. Schiestl, R.D. Gietz, High efficiency transformation of intact yeast cells using single stranded nucleic acids as a Carrier, Curr. Genet. 16 (1989) 339–346. S.F. Altschul, T.L. Madden, A.A. Schäffer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman, Gapped BLAST and PSIBLAST: a new generation of protein database search programs, Nucleic Acids Res. 25 (1997) 3389–3402, https://doi.org/10. 1093/nar/25.17.3389. P. Shobharani, P.M. Halami, In-vitro evaluation on cholesterol reducing ability of probiotic Bacillus spp, Ann. Microbiol. 66 (2016) 643–651, https://doi.org/10. 1007/s13213-015-1146-6. P. Shobharani, M. Prakash, P.M. Halami, Probiotic Bacillus spp. in soy-curd:
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami nutritional, rheological, sensory, and antioxidant properties, J. Food Sci. 80 (10) (2015) M2247–M2256, https://doi.org/10.1111/1750-3841.13004. [27] P. Shobharani, P.M. Halami, Cellular fatty acid profile and H+-ATPase activity to assess acid tolerance of Bacillus sp. for potential probiotic functional attributes, Appl. Microbiol. Biotechnol. 98 (21) (2014) 9045–9058, https://doi.org/10.1007/ s00253-014-5981-3. [28] M.W. Rey, P. Ramaiya, B.A. Nelson, S.D. Brody-Karpin, E.J. Zaretsky, M. Tang, A.L. de Leon, H. Xiang, V. Gusti, I.G. Clausen, P.B. Olsen, M.D. Rasmussen, J.T. Andersen, P.L. Jørgensen, T.S. Larsen, A. Sorokin, A. Bolotin, A. Lapidus, N. Galleron, S.D. Ehrlich, R.M. Berka, Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus
species, Genome Biol. 5 (2004) R77, https://doi.org/10.1186/gb-2004-5-10-r77. [29] C. Le Marrec, B. Hyronimus, P. Bressollier, B. Verneuil, M.C. Urdaci, Biochemical and genetic characterization of coagulin, a new antilisterial bacteriocin in the pediocin family of bacteriocins, produced by Bacillus coagulans I4, Appl. Environ. Microbiol. 66 (12) (2000) 5213–5220, https://doi.org/10.1128/AEM.66.12.52135220.2000. [30] W.C. Chan, B.W. Bycroft, M.L. Leyland, L.Y. Lian, G.C. Roberts, A novel posttranslational modification of the peptide antibiotic subtilin: isolation and characterization of a natural variant from Bacillus subtilis A.T.C.C. 6633, Biochem. J. 291 (Part 1) (1993) 23–27, https://doi.org/10.1042/bj2910023.
146
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Sublichenin, a new subtilin-like lantibiotics of probiotic bacterium Bacillus licheniformis MCC 2512T with antibacterial activity
T
Prakash M. Halami Microbiology and Fermentation Technology Department, CSIR-Central Food Technological Research Institute, Mysore, 570 020, India
ARTICLE INFO
ABSTRACT
Keywords: Bacillus licheniformis Subtilin-like lantibiotics Succinylation Lan operon Auto-induction Anti-Bacterial activity
Probiotic bacteria with antibacterial activity is of desirable trait since they can check the growth of pathogenic bacteria besides exhibiting health benefits to host. Aim of this study was to characterize Bacillus licheniformis MCC 2512T (MCC 2512), a potential probiotic culture for its ability to produce subtilin-like antibiotics. The antimicrobial compound produced by MCC 2512 was identified and characterized using subtilin-specific cell reporter, Bacillus subtilis 168:BS2 (BS2). Induction of β-gal by the test culture suggested the ability of B. licheniformis to produce subtilin-like lantibiotic. Subsequently, DNA sequencing of major lanS-operon was carried out, wherein sequencing results showed that lan cluster of MCC 2512 resembles entianin (etn) type. Upon lan-S disruption, the bacterial culture lost antimicrobial activity as well as ability to induce β-gal with BS2 reporter. High amount of succinylated form of antibiotics produced by wild type and un-succinylated form by engineered strain of B. subtilis 15029p clearly indicates that MCC 2512 is indeed an inter-specific subtilin-like (named as sublichenin) lantibiotic producer. Partially concentrated sublichenin preparation exhibited strong antibacterial activity against food-borne pathogens and antibiotic resistant (AR) lactic acid bacteria (LAB) with a minimum inhibitory concentration in the range of 6–10 and 0.5–1.5 μg/ml, respectively. Production of lantibiotic, sublichenin by a probiotic bacterium of B. licheniformis MCC 2512T and its antibacterial activity against food associated AR LAB is a new information reported in this study.
1. Introduction Lantibiotics are ribosomally synthesized and post-translationally modified polycyclic lanthionine containing antibiotics being used for food preservation and therapeutic purposes. Because of its strong antimicrobial activity, lantibiotics can act at nanomolar concentrations and have several therapeutic applications [1,2]. Nisin produced by Lactococcus spp. is the only lantibiotic being used for food preservation commercially [3]. To date, nine natural variants of nisin, with a range of antimicrobial spectrum and being produced by different species of lactic acid bacteria (LAB) are available [4,5]. In the recent past, antimicrobial spectrum of nisin has been investigated and found to inhibit the growth of drug-resistant bacterial strains, such as methicillin-resistant Staphylococcus aureus, Streptococcus pneumoniae, enterococci and Clostridium difficile [2,3]. Antimicrobial activity of nisin has been well documented in both Gram-positive bacteria and also in case of Gramnegative disease-associated pathogens. A newly identified nisin-like lantibiotic, SalD produced by Streptococcus salivarius 5M6c was found to inhibit the growth of some of the important pathogens like Streptococcus pyogenes and S. pneumoniae, besides several Gram-positive bacteria [4]. Subtilin, a natural variant of nisin produced by spore forming soil
bacterium has been used for several genetic and molecular studies to investigate the biosynthetic mechanisms of linear pentacyclic class-I antibiotics [1,6]. With reference to the diversity of subtilin, only three natural variants are known. This includes subtilin produced by B. subtilis ATCC 6633 [6–8], entianin produced by B. subtilis DSM 15029 [9] and ericin produced by another Bacillus subtilis A1/3 strain [10]. The conservative changes between variants of subtilin includes, four amino acid positions for ericin and three amino acid positions for entianin. Due to their structural similarities in primary sequence and biosynthetic gene organization, they are grouped together as a subtilin-like lantibiotics [9,10]. Entianin and ericin exhibited antibacterial activity against several Gram-positive bacteria. Entianin, a subtilin like lantibiotic was found to be very active against several Gram-positive pathogens, such as Staphylococcus aureus and Enterococcus faecalis [9]. Like-wise, ericin A/s producing B. subtilis strain A1/3 are known to exhibit broad spectrum of inhibitory activities against fungi and phytoviruses, as well as Clavibacter michiganensis that causes bacterial canker in tomato [10]. Thus, lantibiotics of Bacillus have broad spectrum activity against different spoilage and pathogenic bacteria. Production of nisin-like lantibiotics has been discovered from different genera and species of LAB [4,5].
E-mail address: [email protected]. https://doi.org/10.1016/j.micpath.2018.12.044 Received 25 August 2018; Received in revised form 22 December 2018; Accepted 26 December 2018 Available online 27 December 2018 0882-4010/ © 2018 Elsevier Ltd. All rights reserved.
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
B15029p (ΔetnS amyE::PspaS-lanS (Specr Neor)) (Kind courtesy Prof KD Entian). Other reference standard cultures namely, B. subtilis DSM 15029, B. subtilis ATCC 6633, whole cell biosensor B. subtilis 168.BS2 (W168 amyETP SpaS: lacZ, PSpaRK-SpaRK) and B. subtilis MB1 (ΔspaS amyE::PspaS-lacZ (SpecR, CmR, Sub−) [21] a subtilin-specific reporter, were used in this study. All the Bacillus cultures were grown in TY broth under shaking (200 rpm) or agar plate (37 °C incubator) and maintained with appropriate antibiotic/s. For antibacterial activity, the indicator organism, Kocuria rhizophila ATCC 9341 grown in TY broth under shaking at 37 °C incubator. Yeast, Saccharomyces cerevisiae strain CEN.PK2 was grown at 30 °C in YPD medium (1% yeast extract and 2% each of peptone and glucose) or synthetic drop out medium (0.5% Ammonium sulfate, 0.17% yeast nitrogen base and 2% glucose) without uracil for plasmid marker selection. The bacterial cultures enlisted in Table 1 viz. food-borne pathogens were grown in BHI broth at 37 °C under shaking and drug resistant lactic acid bacteria (LAB) [16,18] grown in De Man, Rogosa and Sharpe (MRS) broth at 37 °C incubator. The stock of all the microbial cultures was maintained at −80 °C deep freezer with 20% glycerol.
However, subtilin-like lantibiotic has been identified only in Bacillus subtilis [9]. Production of interspecific subtilin-like lantibiotic is not reported in the literature. Antibiotic resistance is spreading across in all the three compartments of ecosystem viz. health, veterinary-food chain and environment. Developing countries are recognized as the hot-bed for such resistant microbiota [11]. In order to minimize the spread of drug resistant bacteria, new and novel compounds and innovative methods are urgently required. Bacteriocins, especially the lantibiotic group constitute an emerging class of natural products that have attracted considerable interest as promising alternatives to existing antibiotics [12,14]. New antimicrobials of bacterial origin possess novel modes of action, exhibiting collateral sensitivity against drug resistant organisms so that they can be specifically targeted for their applications [13,14]. Lantibiotics finds considerable potential as a consequence of their unusual structures, unique mechanisms of action and their potency against multi-drug resistant bacteria, AMR induced biofilm producing bacteria [2,13,14]. Nisin variants were reported exhibiting improved antimicrobial activity against VRE, MRSA as well as against diarrhea causing C. difficile and against some of Gram-negative bacteria [5,11]. However, limited studies are carried out in case of subtilin-like antibiotics with reference to its antimicrobial spectrum against antibiotic resistant bacteria. In food-chain, antimicrobial resistance is also increasing at an alarming rate. This is because of the fact that, nearly 70% of antibiotics used is being directed towards food-animals as a therapeutic and as a growth promoter [15]. This results in development of antibiotic resistant bacteria in food system. LAB a natural microflora of GI tract, being consumed as a probiotic are often referred as reservoir for antibiotic resistant (AR) genes and are found to exhibit antibiotic induced biofilm formation [16–18]. Most LAB are found to harbor genes associated with multidrug resistant viz. aminoglycoside resistance [15,16]. AR genes such as aac aph can be easily transferred to pathogenic bacteria hence raising the question of biosafety of the food-grade bacterial cultures [17]. There are limited studies on antibacterial substance of natural origin to control such drug resistant bacteria. This report describes the first case of subtilin-like antibiotic production by industrially important strain of B. licheniformis. Antibacterial activity of crude sublichenin preparation against food-borne pathogens and AR LAB is also reported.
2.3. Antibacterial activity and chromogenic plate assay For the detection of lantibiotic production, spot-on-lawn assay was performed [20]. Overnight grown indicator bacterium was grown freshly to an optical density at 600 nm (OD600) of 0.8 at and the inoculum of 1 ml/L was mixed when the media temperature was around 50 °C and pour-plated on LB agar plate. For auto-induction property of β-gal, a petri-plate assay was performed as described by Spiess et al. [20]. A fresh overnight culture of subtilin reporter, BS2 was inoculated to an OD600 of 0.1 and incubated at 37 °C until an OD600 of 1.0 was reached. Subsequently, 100 μl of culture was used to inoculate 100 ml cooled down LB agar medium supplemented with 4 mg of X-Gal. Thereafter, 5 μl of a fresh overnight culture of the strain of interest or test sample was spotted onto the plate. The plate was incubated overnight at 37 °C and observed for blue coloration around the spot. 2.4. β-Galactosidase induction assay An overnight grown culture of subtilin reporter strain, B6633.MB1 was inoculated to an OD600 0.1 in TY medium containing 0.3 M NaCl. The culture was grown to an OD600 at 1.0 and used for of β-gal induction by lantibiotics as described previously [20]. Thereafter, 2 ml of the culture was transferred into small test tubes containing different concentrations of lantibiotics (ranging from 3 to 12 nm for native and 50–1500 nM for succinylated). After 1 h, samples were taken and cells were harvested by centrifugation and stored at −20 °C for β-galactosidase assay. The β-galactosidase activity was measured as described previously and normalized to the cell density [22].
2. Materials and methods 2.1. Microbiological media, fine chemicals and reagents All microbiological media were from Merck (Merck KGaA, Darmstadt, Germany). Fine chemicals such as, Agarose, X-Gal (5bromo-4-chloro- 3-indolyl-beta-D-galacto-pyranoside), ONPG (ONitrophenyl β-galactoside) as well as Sodium chloride; organic solvents such as butanol, acetone, chloroform and ethanol were purchased from Sigma (Sigma-Aldrich, Taufkirchen, Germany). Oligonucleotide primers were obtained from Scientific Research and Development GmbH, Oberursel, Germany. All chemicals used were of analytical grade unless otherwise mentioned. For selection of B. subtilis transformants, antibiotics such as neomycin (15 μg/ml), chloramphenicol (5 μg/ml) and spectinomycin (100 μg/ml) were used. For selection of B. licheniformis and E. coli transformants, spectinomycin (250 μg/ml), ampicillin (100 μg/ml) was used, respectively.
2.5. DNA techniques and PCR amplification The lan operon was amplified using primer/s 15029-26F (5′-CTTA TATGAAGTTCAGCAGG G-3′) and 15029-37R(5′-GAATTGGCCAGCTCC AAGG-3′); 15029-10F(5′-AATCAGTTAG AAAGAAAGCTCC-3′) and 15029-3R (5′-CTACACCTACAGCTCCATCC-3′) primer 15029-13F ( 5′-CATTGTTGAGTTTAATCGTGAG-3′) with 15029–8R (5′-ATTCGTAT GAAGGAATCTGCC-3′) spanning regions 4649–9227; 1622–6566; and 7879–13333 respectively (as per the entianin partial sequences GenBank Accession No. HQ871873). In addition, 5 kb spanning upstream region of lan operon was amplified using primers, LanBUP( 5′-ACTTTATTCTATAATGGGAAGC-3′) and BlR01 (5′-TCATCTGCAATT TCATAATTGC-3′). PCR components comprised of 100–300 ng of genomic DNA, a 0.2 mM concentration of each deoxynucleoside triphosphate, 200 mM of each primer and 1.25 U of fusion DNA polymerase along with 3% DMSO. The samples were amplified after incubation at 94 °C (5 min), followed by 30 cycles at 94 °C (30 s), 55 °C
2.2. Bacterial, yeast cultures and their growth conditions Bacterial strain of Bacillus licheniformis MCC 2512T is a laboratory isolate obtained for its potential probiotic properties [19]. B. licheniformis Δ2512 is a lanS disrupted strain of MCC 2512. B. subtilis B15029.TSp01 (ΔetnS (SpecR, Ent−) [20] was transformed with lanS synthetic gene construct of MCC 2512 for obtaining Bacillus subtilis 140
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
Table 1 MIC of crude preparation of sublichenin produced by B. licheniformis. MCC 2512T against antibiotic resistant LAB and food-borne pathogens. Bacterial culture name
Resistant phenotype R
R
R
R
R
R
R
Source & referencea
MIC (μg/ml)
Pork intestine Beef intestine, Sheep intestine Sheep intestine Chicken meat -do-doChicken intestine Chicken sausage Chicken intestine
1.5 0.5 0.5 0.25 0.5 0.25 0.5 0.5 0.5 0.75 1.5 1.5 0.75
Pediococcus lolii MCC 2972 Enterococcus durans B20G1 Enterococcus faecalis MF3 E. faecalis MM2 E. faecalis CHL1 E. faecalis CHL3 E. faecalis CHL E. faecalis MCC 3063 E. faecalis MCC 2773 Enterococcus faecium MCC 2763 Entercoccus avium CS32+ Enterococcus cecorum 1-40a Lactobacillus plantarum MCC 2774
Gen , Apr , Str , Neo Ami , Spc , GenR, AprR, KanR GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, SpcR, KanR GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, NeoR AmiR, SpcR, GenR, AprR, StrR, NeoR AmiR,KanR AprR, StrR, NeoR AmiR, SpcR, KanR GenR, KanR, StrR GenR, KanR, StrR AprR, StrR, NeoR AmiR, SpcR, KanR
Food-borne pathogens
Strain No
Source
Kokuria rhizophila Listeria monocytogenes
ATCC 9431 Scott A
Staphylococcus aureus Staphylococcus aureus (MRSA) Escherichia coli Klebsiella pneumoniae
MTCC 96 ATCC 43300 ETEC ATCC® 10031™
ATCCa AK Bhunia, Purdue University, USA IMTECH Chandigarh, India ATCC ATCC ATCC
a b
Kan
R
Kan
KanR KanR KanR
Chicken sausage
0.5 2 5 7 > 08 10
Jaimee and Halami [16–18]. American Type Culture Colllection.
(30 s), and 72 °C (3–5 min) for amplification of larger (3- or 5-kb) DNA fragments, followed by 1 cycle of 72 °C (10 min) in a Thermo Cycler GeneAmp 2400 (Perkin-Elmer). The PCR product was gel eluted and purified using QIAquick PCR purification kit (Qiagen, Hilden, Germany).
of acetone. Thus the precipitate obtained referred as partially purified. Further purification was done according to a modified protocol described by Spiess et al. [20]. Lantibiotic and its succinylated form was separated on a semi-preparative reverse-phase (RP) high-performance liquid chromatography (HPLC) column (5 μm, 110 Å, 250 by 10 mm; Gemini-NX C18 liquid chromatography [LC] column [Phenomenex, CA, USA]) using eluents A (20% acetonitrile [HPLC grade], 0.1% 2,2,2trifluoroacetic acid [TFA]) and B (99.9% acetonitrile [HPLC grade], 0.1% TFA). One of the major peak was eluted with a linear gradient of 17%–45% eluent B within 40 and another at 48 min (∼80% eluent B) which was collected individually. The collected fractions were dried under vacuum and re-suspended in 5% acetonitrile for bioassay or β-gal assay as described above. Analytical Reverse-Phase High-Performance Liquid Chromatography (RP-HPLC) column (5 μm; 250 by 4.6 mm; Gemini-NX) was performed following a procedure described previously [8]. The samples were read at 214 nm and 280 nm and the β-gal active peak was used for further analysis. For mass spectrometric analysis, the vacuum dried sample was dissolved in 30% acetonitrile and 0.1% TFA. For all Mass Spectrometric analysis, a Voyager- DE STR mass spectrometer (Applied Biosystems, Darmstadt, Germany) and a MALDI linear trap quadrupole (LTQ) Orbitrap XL Mass Spectrometer (Thermo Fisher Scientific, Inc., Waltham, MA) were used. The conditions and analyses parameters were as described by Fuchs et al. [9]. Molarities were calculated using the Molar Extinction Co-efficient of subtilin (ε280 = 5750 L mol−1 cm−1; ProtParam; ExPASy). The peak areas were recorded using an Agilent 1200 series ChemStation for LC three-dimensional systems offline program and used to form equations (x = peak area; y = micrograms of lantibiotic), resulting in y = 1195.8x + 370.97 and y = 77.684x + 7.4 for 214 nm and 280 nm, respectively.
2.6. Construction of disruptive plasmid and lan S disruption Vector, pRS416 was used as a backbone plasmid for the construction of pPH1ΔlanS. Disruptive plasmid was constructed as follows. pRS416 was linearized with BamHI and transformed into Saccharomyces cerevisiae CEN.PK2 (MATa/α ura3-52/ura3-52 trp1-289/trp1-289 leu23112/leu2-3112 his3Δ1/his3Δ1 MAL2-8C/MAL2-8CSUC2/SUC2) together with the PCR products of Ph1201F(5′-GGTATCGATAAGCTTGA TATCGAATTCCTGCAGCCCGGGGTCAGTGGAA TAGCAAGTTACC-3′)/ Ph1202R(5‘-GGTCACCTCCTTTCAATACC) (upstream lanS region), Ph1203F (5′- GAATCACTTTGCTCTGACTCC-3′)/Ph1204R (5′-AGCTCC ACCGCGGTGG CGGCCGCTCTAGAACTAGTGGATCTCCGGGTCATTAG AGATATACG-3′) (down-stream lanS region), and Spec-F5′-TATTTGTC TGTTACTATATAGGTATTGAAAGGAGGTGA CCGGATCGATCTGTATA ATAAAG-3’/R(5′-TAACGCTCAGGAATGCAAGGAGTCAGAG CAAAGTG ATTCGTTTATAAGTGGGTAAACCGTG-3′) (spectinomycin resistance cassette), amplified from ECE74 [20]. Recombinant plasmid, pPH1ΔlanS linearized with Nde1 and was transformed for gap repair in Saccharomyces cerevisiae strain CEN.PK2 as described by Schiestl and Gietz [23]. Standard methodology described in the laboratory protocol was employed for the isolation of recombinant plasmids from CEN.PK2 and E. coli. Transformation of B. licheniformis was performed as described previously for B. subtilis [20] with certain modification, wherein higher concentration of spectinomycin (as described above) was used for selection.
2.8. DNA sequencing, analysis and GenBank deposition
2.7. Purification and quantification of lantibiotics
DNA sequencing was performed by Scientific Research and Development GmbH, Oberursel, Germany. Clone Manager professional suite and or NCBI online tools viz BLAST was used for analysis of DNA sequences using Bioinformatics [24]. The partial DNA sequence of the sublichenin gene cluster of B. licheniformis MCC 2512T has been deposited in GenBank under Accession number MF399478.
B. licheniformis MCC 2512T and B15029p was grown at 37 °C in medium-A for optimized production of lantibiotics as per the protocol of Spiess et al. [20] in 50 ml of the respective medium in 500-ml flasks. Culture supernatants of MCC 2512 and B15029p concentrated by 0.5 volume of butanol and the extract obtained was precipitated with 2 vol 141
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
2.9. MIC determination and statistical analysis
type amino acid residues were found. Structural gene, lanS showed 95% sequence similarity with subtilin and entianin and 94% with ericin S. Thus lanS of B. licheniformis MCC 2512T represented novel sequences and deduced amino acid showed four exchanges. The first, at 30th position being a spaS type, 2nd at 39th position eriS type and 3rd at 48th position being an etnS type and 4th being spaS/etnS type (Fig. 1). As till date, no such subtilin-like lantibiotic with unique combination of amino acid has been reported, hence it could be named as Sublichenin (subtilin-like lantibiotics produced by B. licheniformis) [1]. Thus, sublichenin represents a new subtilin-like lantibiotics, however, it is most identical to entianin. Ne terminal extension of immunity lipoprotein LanI, also represented EtnI type. Though most of amino acid exchanges were EtnI type, one of them was SpaI and another being unique. With reference to LanF, a component of ABC transporter: entire LanF of 245 aa was obtained, whose sequence exhibited high level similarity with EtnF. However, few new exchanges were also reported. LanE: Lan E of only 51 aa consisting of C-terminal end was analyzed. As expected all the exchanges were similar to EntE type. LanG: an interesting N-terminal extension as found in Etn was noticed. In case of LanR: 200 aa deduced sequence represented Etn type as expected. Likewise, with reference to LanK, 200 aa sequence was most similar to Etn type. Orf3 was amplified using 3’ end primer (15029-8R) to identify the flanking region. Deduced aa sequences of partial orf3 showed 100% homology with Etn Orf3. Flanking region of lan operon of 2512 clearly indicated that there must be an integration of lantibiotic gene cluster, recombining region need to be identified. On the other hand, upstream sequences of lan operon showed similarity only with Etn type. B. licheniformis is an industrially important strain being used for the production of several enzymes and fine chemicals. It is known for the production of some of the antibiotics that include, licheniformin, bacitracin and proticin [28]. Recently, B. licheniformis MCC 2512T has been identified as a potential probiotic because of its food-grade nature and health benefits to host [25–27]. Since subtilin-like lantibiotic production by B. licheniformis was a newly established information, DNA sequencing of all the lan operon genes including flanking region was undertaken. BLAST analysis of lan operon, revealed that several strains of B. subtilis also had the similar lan operon. These results suggested that there must be a high diversity of subtilin-like bacteriocin as found in nisin, indicating the need for further investigations. Sequence results for lanBUP along with BlR01 indicated that the sequence length of 940 bp was 100% similar to subtilin-like antibiotic producing strain of B. subtilis DSM TU (Acc No. NC016047). Since subtilin biosynthesis genes are chromosomally encoded, there must be an involvement of conjugative plasmid for mobilizing the interspecific bacteriocin production trait as observed in case of Bacillus coagulans for pediocin-like (coagulin) bacteriocin production [29].
B. licheniformis MCC 2512T was grown in medium-A, CFS was extracted with butanol followed by acetone precipitation, as described above. The dried precipitate was dissolved in Mili Q water and was used for protein estimation using Bicinchoninic acid protein assay kit (Sigma Aldrich). Minimum Inhibitory Concentration (MIC) determination was carried out against the range of AR LAB and food-borne pathogens enlisted in Table 1. For MIC determination, FBPs were cultivated overnight under shaking condition in BHI broth at 37 °C. AR LAB cultures were grown in MRS broth at 37 °C under static condition. Next day, test culture was diluted to OD600 0.001 in a fresh medium and the antibiotic with different concentrations were incorporated and the test was carried out in 96 well ELISA plate. Bacterial cultures were allowed to grow (FBPs under shaking and LAB under static condition) for 10–12 h and the OD600 was recorded using an ELISA plate reader (Thermo Scientific). MIC was calculated wherein the lowest concentration of antibiotics (μg/ml) exhibited no growth of the indicator bacteria. For all statistical analysis, one way analysis of variance (ANOVA) was used using Microsoft excel. p < 0.05 was considered statistically significant. All the data was represented as mean ± SD and represent data from a minimum of two independent experiments. 3. Results and discussion 3.1. Characterization of lanS operon Earlier studies have shown potential probiotic properties by Bacillus licheniformis MCC 2512T which was demonstrated in our laboratory [21–23]. In addition, we have demonstrated that this culture has the capacity to produce subtilin-like bacteriocin (low MW peptide) [19]. To confirm lan operon, DNA sequencing was undertaken for the presence of lanS structural gene and other accessory genes. As expected, primer set 15029–26 and 24 yielded 5.2 kb PCR product. Primer set 15029–2 and 37 gave 4.5 Kb amplicon, 15029–3 and 10 gave 5 kb and 15029–14 with 15029–3 gave 4.2 kb PCR product, covering entire lan operon. All the four individual PCR products obtained were sequenced using the corresponding primers or internal primers. Obtained sequences of MCC 2512 were aligned against 15029 using clone manager. A detailed comparison of deduced amino acid sequences obtained from lan operon of 2512 with B. subtilis ATCC 6633 and D15029 is described in supplementary Figure 01. DNA sequencing results indicated that 2512 had a very similar and unique lan operon of entianin (Etn) type. Upon BLAST search analysis it showed that the lan operon of MCC 2512 exhibited 100% homology with complete genome of Bacillus subtilis strain ge25, (CP021903.1) and Bacillus sp. YP1, (CP010014.1). Translated partial amino acid (aa) sequence of LanB (145–425 aa positon of EtnB) indicated few exchanges of around 11 amino acids similar to Etn type. LanT representing N-terminal partial sequences of 1–110 amino acid showed few exchanges than SpaB, however similar to EtnB type. Similarly, amino acid sequence of LanC comprising region 60 to 400 aa was mostly EtnC type. However, few unique and few SpaC
3.2. Construction and characterization of lan-S disruptive mutant For the deletion of lanS gene of MCC 2512, a disruptive plasmid pPHlanS was constructed and transformed into the host bacterium. The Fig. 1. Comparison of nisin with subtilin-like antibiotics as well as deduced amino acid sequences of sublichenin (LanS) produced by B. licheniformis MCC 2512T reported in this study. Amino acid residues in open box showed the similarity among nisin and subtilin-like molecules. In shaded box are the similarity of LanS (sublichenin identified in this study) with subtilin-like peptide antibiotics. Arrow indicates the N-terminal sequences of pre-peptide. Bended arrow indicates the putative position of thioether ring.
142
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
BS2 reporter and also exhibits antibacterial activity against K. rhizophila (Fig. 3). These results also helped to confirm the ability of 15029.TSp01 machinery to process biologically active form of lantibiotics of MCC 2512. Previously, entianin producing host had been successfully exploited for the heterologous production of subtilin as well as its engineered variants [8,20]. In view to provide suitable evidences that the antibacterial substance produced by MCC 2512 is a subtilin-like molecule and is identical to antibacterial molecule of B. subtilis B15029p, further characterization of antibacterial peptide was carried out. RP HPLC analysis of lantibiotic preparation of MCC 2512 showed major peaks at 36 and 48 min elution. These two fractions were collected and assayed for β-gal induction activity (Fig. 4A). However, sample obtained from B. subtilis B15029p showed only 36 min peak (Fig. 4B). Chromatogram pattern (Fig. 4) comparison of A and B showed that, B15029p was lacking 48 min peak, indicating it does not succinylate the sublichenin. This observation suggested the ability of host bacterium (B. subtilis B15029p) tolerance for greater amount of un-succinylated substance, rather than processing it into an inactive sublichenin. Quantitative RP-HPLC of 36 and 48 min peak was individually performed (Fig. 5) and the β-gal inducing peak was used for mass spectrophotometry measurements. Upon MALDI TOF analysis, the 36 min peak confirmed the lantibiotic of expected MW 3348 Da, as observed with translated aa sequences of matured sublichenin. Likewise, 48 min peak was found to have a size of 3448 Da with increase in MW of 100 Da (Fig. 5), which confirmed the succinylated form of sublichenin, also it coincided with succinylatedsubtilin (data not shown). These results correlated to succinylation studies carried out in subtilin and entianin [8,9]. Confirmation by MALDI TOF analysis in combination with analytical RP- HPLC results obtained were used for quantification of lantibiotics of MCC 2512.
Fig. 2. Characterization of lanS deletion mutant by antibacterial activity against Kocuria rhizophila ATCC 9341 (A) and auto-induction assay using BS2 reporter (B), + positive reaction, - negative reaction. 6633, B. subtilis ATCC 6633; 2512, MCC 2512 and Δ2512, lanS deleted MCC 2512.
3.4. B. licheniformis MCC 2512T produces high amount of succinylated lantibiotics Fig. 3. Antibacterial activity and auto-induction ability of B. subtilis 15029p expressing lanS of 2512. antibacterial activity was evaluated against Kocuria rhizophila ATCC 9341 (A) and auto-induction assay using BS2 reporter (B). 2512, MCC 2512; B15029, B. subtilis DSM 15029 and B15029p, Δ15029p::MCC 2512 lanS.
In order to evaluate auto-induction ability of succinylated lantibiotic produced by MCC 2512, individual active peak appeared at 36 and 48 min elution was collected, freeze dried and used for β-gal induction assay. Auto-induction assay showed that the succinylated form of lantibiotic had reduced level of β-gal induction. This induction was comparable with sublichenin, wherein 4000 Miller unit of β-gal was observed with 6 nM concentration of native molecule (Fig. 6). On the other hand, it was ∼150 times more potent than succinylated form. N-terminal tryptophan of matured subtilin-like lantibiotics is known to undergo succinylation [8,30]. To study the fate of lantibiotic produced by MCC 2512, the test culture was grown in medium-A as synthetic medium known to ensure low production of succinylation of entianin [8]. Production of non-succinylated form of sublichenin suggested that the host bacterium plays a role in succinilation. As described above, succinylation of subtilin-like lantibiotic is known to be modified by the host enzyme [8]. With reference to auto-induction and antibacterial potency, it was observed that succinilated form of lantibiotic showed remarkable difference for its auto-induction ability (100 fold less) and 10–40 fold less for antibacterial activity compared to un-succinylated counterpart [9,30]. In this study, succinylated lantibiotic was > 150 fold less effective than its native counterpart with regard to auto-induction. However, further studies are to be undertaken to unravel antibacterial spectra against a broad range of target bacteria to assess the potency of succinylated molecule. Results obtained in this study suggest that the strain of B licheniformis could be more prone for succinylation as compared to B. subtilis. As a means of general resistance mechanism for the producer bacterium, succinylation of subtilin-like lantibiotics could provide negative charge to the N-terminal of peptide with reduced interaction with lipid II. It is also reported that succinylation reduces the autoinduction capacity of lantibiotic, and hence associated with prevention of toxic
lanS deletion strain (Δ2512) was initially confirmed for its growth in medium containing spectinomycin and lack activity against K. rhizophila. The loss of antibacterial activity as well as ability to induce betagal when assayed using BS2 reporter (Fig. 2). Stable integration was confirmed by diagnostic PCR followed by growth in antibiotic selection media in subsequent generation. Antibacterial activity was quite prominent against K. rhizophila by the standard reference culture as well as WT 2512. These results suggest the requirement of intact lanS gene for antibacterial activity of 2512. Though, Δ2512 showed marginal antibacterial activity against K rhizophila, such background inhibition could be due to other antibacterial substances than the target lantibiotics, produced by the test culture. Disruption mutagenesis has been successfully employed previously for the functional analysis of lantibiotics [8,10]. 3.3. Evidence for subtilin-like lantibiotic production Subtilin-like (sublichenin) lantibiotic production was additionally confirmed upon heterologous expression of synthetic gene into B. subtilis B15029.TSp01 (Δ15029). B. subtilis Δ15029 is etnS gene disrupted strain obtained by introducing SpecR cassette. B. subtilis Δ15029 has all the lantibiotic gene cluster except its corresponding structural (etnS) gene. B. subtilis B15029p (B15029p) is a TSp01 derivative wherein etnS has been replaced with lanS of 2512 along with neomycin resistant cassette. B15029p has the ability to induce β-gal when assayed using 143
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
Fig. 4. RP-HPLC profile of native lantibiotic of B. licheniformis MCC 2512T (A) and upon heterologous expressed in B. subtilis B15029p (B). Each peak was collected and assayed for β-gal induction (a). Arrow indicates the type of peak that was used for analytical RP HPLC. (C) A1, crude CF of sample A; B1, crude CF of sample B; N1, N2 are 36 min Peak of Sample A1 and B1 respectively, S1, 48 min peak of sample A1. Five ul of sample was spotted for β-gal induction using reporter. Other numbered spots are the non β-gal inducing samples.
Fig. 5. Quantification and molecular weight estimation of sublichenin and its succinylated form. Quantitative RP-HPLC separation and MALDI TOF analysis of (a) sublichenin and its (b) succinylated form (inset).
3.5. Antibacterial spectra of B. licheniformis MCC 2512T There is a growing concern among antibiotic resistance to human pathogens that cause infectious diseases [2]. Humans consume ever more antibiotics not only through prescriptions but also through agriculture and livestock products that lead to rapid development of AMR in the food chain. Hence, there is an urgent need to increase defense against specific AMR bacteria. Since, lantibiotics are yet to be brought into use as therapeutic agents, there is a need to understand their potency against the AMR resistant bacteria [14]. In this study, an attempt has been made to evaluate the potency of crude preparation of sublichenin against FBPs and AR LAB that are known to produce biofilm upon antibiotic exposure [18]. A very potent MIC of 0.5 μg/ml against K. rhizophila was found. However, higher concentration of AMC was required in case of Gram-negative pathogens (8–10 μg/ml) and for Gram-positive pathogens such as MRSA (6–8 μg/ml). AMC was quite potent against AR LAB wherein MIC in the range of 0.5–1.5 μg/ml was reported. These results indicated that AMC of B. licheniformis MCC 2512T has a broad spectrum antibacterial activity against a wide range of bacteria. Lantibiotics have been tested and found to inhibit the growth of MRSA, bacterial plant pathogens as well as collateral sensitivity to MDR bacteria [9,10,14]. Lantibiotic group of bacteriocins can be a suitable alternative to conventional antibiotics because of their broad spectrum activity against MDR pathogens [3]. Antibacterial
Fig. 6. Induction response of subtilin reporter B6633.MB1 upon addition of sublichenin peptide of MCC 2512. β-gal activity was measured after 60 min of induction. Error bars represent two SD of two separate cultures measured in duplicate. Control, no lantibiotic was added.
effect of lantibiotics [8]. B. licheniformis which is an industrially relevant culture, indicating that succinylation mechanism must be very effective since large amount of succinylated lantibiotic was detected. 144
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami
activity of sublichenin, a subtilin-like antibiotics against drug resistant LAB is reported for the first time in this study. 4. Conclusion
[2]
This study reports the interspecific production of subtilin-like lantibiotics by the industrially important probiotic strain of B. licheniformis MCC 2512T. Heterologously expressed lantibiotic (sublichenin) was produced without succinylation indicating the importance of host bacterium. The new exchanges found in the aa sequence of lantibiotic produced by MCC 2512 could be associated with potential antibacterial activity. Sublichenin biosynthesis operon is very similar to entianin operon suggesting high diversity of this class of lantibiotics in nature. Ability of crude preparation of sublichenin to inhibit the growth of AR bacteria provides a means in combating their spread and application in food system. Newly discovered sublichenin producing culture can be used in functional food preparation since the bacterium is of food-grade and possesses probiotic as well as starter culture properties. In addition, B. licheniformis MCC 2512T can be used for in situ production of sublichenin that can curtail the development of resistance besides combating intestinal infection.
[3] [4] [5]
[6] [7] [8]
[9]
Conflicts of interest
[10]
The author declares no competing interests. Ethical approval
[11]
This article does not contain any studies with human participants or animals performed by the author.
[12] [13]
Funding
[14]
This work was supported by CSIR-DAAD exchange of academic (No. 50015739) and DBT Govt. of India New Delhi (BT/PR16706/NER/95/ 259/2015). Acknowledgements
[15]
Author thankfully acknowledges the kind permission granted by Prof. Dr. K-D Entian to carry out this study in his laboratory at the Institute of Molecular Biosciences, University of Frankfurt/M, Germany. Also sincere gratitude to Prof Entian and his team for granting full access to research facility for analysis and generously providing bacterial cultures indicated in this study. This work was carried out under CSIR-DAAD exchange of academics-2015 program. Part of study was supported with funding from Department of Biotechnology, Govt. of India New Delhi (BT/PR16706/NER/95/259/2015). Author also acknowledges Akash Bal for performing the part of antibacterial sensitivity assays and Dr SVN Vijayendra for critically reading the manuscript text.
[16]
[17]
[18] [19]
[20]
Appendix A. Supplementary data
[21]
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.micpath.2018.12.044.
[22]
References
[23]
[1] P.G. Arnison, M.J. Bibb, G. Bierbaum, A.A. Bowers, T.S. Bugni, G. Bulaj, J.A. Camarero, D.J. Campopiano, G.L. Challis, J. Clardy, P.D. Cotter, D.J. Craik, M. Dawson, E. Dittmann, S. Donadio, P.C. Dorrestein, K.-D. Entian, M.A. Fischbach, J.S. Garavelli, U. Göransson, C.W. Gruber, D.H. Haft, T.K. Hemscheidt, C. Hertweck, C. Hill, A.R. Horswill, M. Jaspars, W.L. Kelly, J.P. Klinman, O.P. Kuipers, A.J. Link, W. Liu, M.A. Marahiel, D.A. Mitchell, G.N. Moll, B.S. Moore, R. Müller, S.K. Nair, I.F. Nes, G.E. Norris, B.M. Olivera, H. Onaka, M.L. Patchett, J. Piel, M.J. Reaney, S. Rebuffat, R.P. Ross, H.G. Sahl, E.W. Schmidt, M.E. Selsted, K. Severinov, B. Shen,
[24]
[25] [26]
145
K. Sivonen, L. Smith, T. Stein, R.D. Süssmuth, J.R. Tagg, G.L. Tang, A.W. Truman, J.C. Vederas, C.T. Walsh, J.D. Walton, S.C. Wenzel, J.M. Willey, W.A. van der Donk, Ribosomally synthesized and post-translationally modified peptide natural products: overview and recommendations for a universal nomenclature, Nat. Prod. Rep. 30 (2013) 108–160, https://doi.org/10.1039/c2np20085f. M. Montalba´n-Lo´pez, L. Zhou, As Buivydas, A.J. van Heel, O.P. Kuipers, Increasing the success rate of lantibiotic drug discovery by synthetic biology, Expert Opin. Drug Discov. 7 (2012) 695–709, https://doi.org/10.1517/17460441.2012.693476. P.D. Cotter, R.P. Ross, C. Hill, Bacteriocins — a viable alternative to antibiotics, Nat. Rev. Microbiol. 11 (2013) 95–105. J.M. Shin, J.W. Gwak, P. Kamarajan, J.C. Fenno, A.H. Rickard, Y.L. Kapila, Biomedical application of nisin, J. Appl. Microbiol. 120 (6) (2016) 1449–1465, https://doi.org/10.1111/jam.13033. P.M. O'Connor, E.F. O'Shea, C.M. Guinane, O. O'Sullivan, P.D. Cotter, R.P. Ross, C. Hill, Nisin H is a new nisin variant produced by the gut-derived strain Streptococcus hyointestinalis DPC 6484, Appl. Environ. Microbiol. 81 (2015) 3953–3960, https://doi.org/10.1128/AEM.00212-15. S. Banerjee, J.N. Hansen, Structure and expression of a gene encoding the precursor of subtilin, a small protein antibiotic, J. Biol. Chem. 263 (1988) 9508–9514. K.-D. Entian, W.M. de Vos, Genetics of subtilin and nisin biosynthesis: biosynthesis of lantibiotics, Antonie Leeuwenhoek 69 (1996) 109–117, https://doi.org/10. 1007/BF00399416. S.M. Bochmann, T. Spieß, P. Kötter, K.D. Entian, Synthesis and succinylation of subtilin-like lantibiotics are strongly influenced by glucose and transition state regulator AbrB, Appl. Environ. Microbiol. 81 (2) (2015) 614–622, https://doi.org/ 10.1128/AEM.02579-14. S.W. Fuchs, T.W. Jaskolla, S. Bochmann, P. Kötter, T. Wichelhaus, M. Karas, et al., Entianin, a novel subtilin-like lantibiotic from Bacillus subtilis subsp. spizizenii DSM 15029T with high antimicrobial activity, Appl. Environ. Microbiol. 77 (5) (2011) 1698–1707, https://doi.org/10.1128/AEM.01962-10. T. Stein, S. Borchert, B. Conrad, J. Feesche, B. Hofemeister, J. Hofemeister, K.D. Entian, Two different lantibiotic-like peptides originate from the ericin gene cluster of Bacillus subtilis A1/3, J. Bacteriol. 184 (2002) 1703–1711, https://doi. org/10.1128/JB.184.6.1703-1711.2002. J.A. Ayukekbong, M. Ntemgwa, A.N. Atabe, The threat of antimicrobial resistance in developing countries: causes and control strategies, Antimicrob. Resist. Infect. Contr. 6 (2017) 47, https://doi.org/10.1186/s13756-017-0208-x. Des Field, P.D. Cotter, C. Hill, R.P. Ross, Bioengineering lantibiotics for therapeutic success, Front. Microbiol. 6 (2015) 1363, https://doi.org/10.3389/fmicb.2015. 01363. H. Mathur, Des Field, M.C. Rea, P.D. Cotter, C. Hill, R.P. Ross, Fighting biofilms with lantibiotics and other groups of bacteriocins, Biofilms and Microbiomes 4 (2018) 9, https://doi.org/10.1038/s41522-018-0053-6 2018. V. Lazar, A. Martins, R. Spohn, L. Daruka, G. Grezal, G. Fekete, M. Szamel, P.K. Jangir, B. Kintses, B. Csorgő, A. Nyerges, A. Gyorkei, A. Kincses, A. Der, F.R. Walter, M.A. Deli, E. Urban, Z. Hegedűs, G. Olajos, O. Mehi, B. Balint, I. Nagy, T.A. Martinek, B. Papp, C. Pal, Antibiotic-resistant bacteria show widespread collateral sensitivity to antimicrobial peptides, Nature Microbiol 3 (2018) 718–731, https://doi.org/10.1038/s41564-018-0164-0. G. Jaimee, P.M. Halami, Emerging resistance to aminoglycosides in lactic acid bacteria of food origin—an impending menace, Appl. Microbiol. Biotechnol. 100 (3) (2016) 1137–1151, https://doi.org/10.1007/s00253-015-7184-y. G. Jaimee, P.M. Halami, High level aminoglycoside resistance in Enterococcus, Pediococcus and Lactobacillus species from farm animals and commercial meat products, Ann. Microbiol. 66 (2016) 101–110, https://doi.org/10.1007/s13213015-1086-1. G. Jaimee, P.M. Halami, Conjugal transfer of aac-aph from native species and mechanism of regulation and cross resistance in Enterococcus faecalis MCC 3063 by real time-PCR, Microb. Pathog. 110 (2017) 546–553, https://doi.org/10.1016/j. micpath.2017.07.049. G. Jaimee, P.M. Halami, Presence of extracellular DNA and protein in biofilm formation by gentamicin resistant Lactobacillus plantarum, Indian J. Med. Res. (2018) (accepted). P. Shobharani, R.J. Padmaja, P.M. Halami, Diversity in the antibacterial potential of probiotic cultures Bacillus licheniformis MCC2514 and Bacillus licheniformis MCC2512, Res. Microbiol. 166 (6) (2015) 546–554, https://doi.org/10.1016/j. resmic.2015.06.003. T. Spieß, S.M. Korn, P. Kötter, K.D. Entian, Auto-induction specificities of the lantibiotics subtilin and nisin, Appl. Environ. Microbiol. 81 (22) (2015) 7914–7923, https://doi.org/10.1128/AEM.02392-15. M. Burkard, K.-D. Entian, T. Stein, Development and application of a microtiter plate-based auto-induction bioassay for detection of the lantibiotic subtilin, J. Microbiol. Methods 70 (2007) 179–185, https://doi.org/10.1016/j.mimet.2007.04. 015. J. H Miller, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1972. R.H. Schiestl, R.D. Gietz, High efficiency transformation of intact yeast cells using single stranded nucleic acids as a Carrier, Curr. Genet. 16 (1989) 339–346. S.F. Altschul, T.L. Madden, A.A. Schäffer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman, Gapped BLAST and PSIBLAST: a new generation of protein database search programs, Nucleic Acids Res. 25 (1997) 3389–3402, https://doi.org/10. 1093/nar/25.17.3389. P. Shobharani, P.M. Halami, In-vitro evaluation on cholesterol reducing ability of probiotic Bacillus spp, Ann. Microbiol. 66 (2016) 643–651, https://doi.org/10. 1007/s13213-015-1146-6. P. Shobharani, M. Prakash, P.M. Halami, Probiotic Bacillus spp. in soy-curd:
Microbial Pathogenesis 128 (2019) 139–146
P.M. Halami nutritional, rheological, sensory, and antioxidant properties, J. Food Sci. 80 (10) (2015) M2247–M2256, https://doi.org/10.1111/1750-3841.13004. [27] P. Shobharani, P.M. Halami, Cellular fatty acid profile and H+-ATPase activity to assess acid tolerance of Bacillus sp. for potential probiotic functional attributes, Appl. Microbiol. Biotechnol. 98 (21) (2014) 9045–9058, https://doi.org/10.1007/ s00253-014-5981-3. [28] M.W. Rey, P. Ramaiya, B.A. Nelson, S.D. Brody-Karpin, E.J. Zaretsky, M. Tang, A.L. de Leon, H. Xiang, V. Gusti, I.G. Clausen, P.B. Olsen, M.D. Rasmussen, J.T. Andersen, P.L. Jørgensen, T.S. Larsen, A. Sorokin, A. Bolotin, A. Lapidus, N. Galleron, S.D. Ehrlich, R.M. Berka, Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus
species, Genome Biol. 5 (2004) R77, https://doi.org/10.1186/gb-2004-5-10-r77. [29] C. Le Marrec, B. Hyronimus, P. Bressollier, B. Verneuil, M.C. Urdaci, Biochemical and genetic characterization of coagulin, a new antilisterial bacteriocin in the pediocin family of bacteriocins, produced by Bacillus coagulans I4, Appl. Environ. Microbiol. 66 (12) (2000) 5213–5220, https://doi.org/10.1128/AEM.66.12.52135220.2000. [30] W.C. Chan, B.W. Bycroft, M.L. Leyland, L.Y. Lian, G.C. Roberts, A novel posttranslational modification of the peptide antibiotic subtilin: isolation and characterization of a natural variant from Bacillus subtilis A.T.C.C. 6633, Biochem. J. 291 (Part 1) (1993) 23–27, https://doi.org/10.1042/bj2910023.
146