Substantial CCT activity is required for cell cycle progression and cytoskeletal organization in mammalian cells

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / y e x c r

Research Article

Substantial CCT activity is required for cell cycle progression and cytoskeletal organization in mammalian cells Julie Grantham a,b,⁎, Karen I. Brackley a,b , Keith R. Willison a a

Cancer Research UK Centre for Cell and Molecular Biology, Chester Beatty Laboratories, The Institute of Cancer Research, 237 Fulham Road, London SW3 6JB, UK b Department of Cell and Molecular Biology, Göteborgs Universitet, Medicinaregatan 9C, 405 30 Göteborg, Sweden

ARTICLE INFORMATION

ABS T R AC T

Article Chronology:

The chaperonin CCT hexadecamer is required for the folding of non-native actins and

Received 24 November 2005

tubulins in eukaryotic cells. Among the consequences of greatly reducing CCT holocomplex

Revised version received

levels in human cell lines by siRNA targeting are growth arrest and changes in cell

15 March 2006

morphology and motility. Less extensive reduction of CCT activity via microinjection of an

Accepted 22 March 2006

inhibitory anti-CCTε subunit monoclonal antibody, which alters the rates of substrate

Available online 15 April 2006

processing by CCT in vitro, causes a delay in cell cycle progression through G1/S phase in synchronized Swiss 3T3 cells. The degree of growth arrest strongly correlates with the

Keywords:

extent of CCT depletion, indicating that full CCT activity is required for normal cell growth

Chaperonin

and division. Depletion of CCT does not affect actin polypeptide synthesis but causes a

Actin

reduction in levels of native actin and perturbation of actin-based cell motility in BE cells.

Tubulin

There are no large-scale effects on cytoplasmic protein synthesis or a general heat shock

Protein folding

response during periods of low CCT activity. © 2006 Elsevier Inc. All rights reserved.

Introduction CCT is a double ring-shaped, hexadecameric chaperonin composed of eight subunit species. Each CCT subunit is the product of an individual gene [1] and occupies a fixed position within the chaperonin rings [2]. The equatorial ATPase domain and intermediate linker domains of the eight CCT subunits share sequence homology with each other and other chaperonins, while the apical domains are divergent from each other [3]. All eight apical domains contain a putative substrate-binding region that forms a patch facing inside the chaperonin cavity, consistent with sequence-specific subunit: substrate interactions occurring during folding reactions [4]. Structural studies using cryoelectron single particle micros-

copy have allowed the visualization of actin and tubulinbound CCT complexes, interactions which are both subunitspecific and geometry-dependent. Actin binds to CCT in two modes via either the CCTδ and CCTε subunits or the CCTδ and CCTβ subunits [5]. The binding of tubulin to CCT also occurs in two orientations, however, this interaction appears to be more complex than that of actin, with tubulin interacting with five CCT subunits in each binding conformation [6]. We found previously that the major folding substrates of the cytosolic chaperonin CCT in mammalian cells in vivo are actin and tubulin [7]. Increasing numbers of other proteins have been shown to interact with CCT, but it is not clear if all these proteins are genuine, obligate folding substrates [8,9] or if some depend on binding to CCT for regulatory functions,

⁎ Corresponding author. Department of Cell and Molecular Biology, Göteborgs Universitet, Medicinaregatan 9C, 405 30 Göteborg, Sweden. Fax: +46 31 7733801. E-mail address: [email protected] ( J. Grantham). 0014-4827/$ – see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2006.03.028

2310

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

such as ternary complex formation in the case of VHL tumor suppressor [10] or regulation of Gβγ activity in the case of phosducin-like protein which binds CCT in the native state [11]. The expression of CCT subunits is controlled at the mRNA level, and the levels of CCT subunit synthesis have been shown to be similar to that of tubulin during the cell cycle [12]. This study also demonstrated an increase in tubulin binding to CCT during early S phase, while the actin synthesis and CCTbinding remained almost unchanged during the cell cycle. In yeast, it is not possible to over-express substantially actin or βtubulin without causing cell lethality [13], and genetic screens have isolated chaperones which can suppress toxic levels of βtubulin by binding unfolded monomers [14,15]. A possible explanation for these observations may be that, since both of these two cytoskeletal proteins require interactions with CCT to reach their native state, stringent co-regulation of their CCT interactions may have evolved which does not permit significant changes in the relative transit rates of substrates to be achieved by experimental manipulation, that is, the folding system has become hard-wired. We have used two independent approaches to study CCT activity in relation to cell cycle progression in mammalian cells; we lowered the absolute levels of CCT holocomplex in vivo using siRNA technology, and we also altered CCT activity using a monoclonal antibody which alters the rates of CCT:substrate interactions without resulting in a block in the production of natively folding substrates. When levels of CCT are dramatically reduced by siRNA targeting of its subunits, a complete arrest of cell division is observed but with overall protein synthesis being unaffected. When the monoclonal antibody εAD1 is injected into Swiss 3T3 cells, entry into S phase of the cell cycle is delayed by several hours. We describe the further consequences of down-regulation of CCT function and the effect of this on cell cycle progression and the actin- and tubulin-based cytoskeleton.

Materials and methods In vitro translation In vitro translations of human β-actin, α-tubulin and cyclin E were carried out by priming TNT™ rabbit reticulocyte lysate (Promega) with full-length cDNA in Bluescript SKII+ [16]. For Cdh1, the full-length S. cerevisiae sequence in pET11b was used. Translations were primed with 1 μg DNA/50 μl and carried out at 30°C in the presence of 40 μCi L-[35S] methionine/50 μl (in vitro cell labeling grade, Amersham). Time course samples (2 μl) were taken and stored on ice prior to loading on native polyacrylamide gels. Native PAGE was carried out according to [2].

Microinjection of living cells Swiss 3T3 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf serum (FCS) at 37°C, 10% CO2. For microtubule regrowth assays, nocodazole was added to give a final concentration of 2.5 μM and the cells incubated for 1 h then the cells were washed once in fresh medium and incubated at 37°C, 10% CO2 to allow for recovery to occur.

BrdU incorporation was carried out on contact-inhibited cells which had been plated at 1 × 105 cells/45 mm diameter dish in DMEM containing 5% FCS for 6–8 days to induce a G0 arrest. Following a 24-h incubation in serum-free medium containing insulin–transferrin–sodium selenite (ITS) liquid media supplement (Sigma), cells were microinjected with εAD1 mAb or control rat IgG in PBS. After a further 1h incubation in serum-free medium, cell cycle re-entry was induced by replacing media with 20% FCS/DMEM and BrdU (Amersham) added to a final dilution of 1 in 500.

Immunofluorescence staining Cells were washed briefly in PBS and fixed with 4% paraformaldehyde for 10 min. Following 2 washes in PBS, cells were permeabilized in PBS containing 0.2% Triton X-100, washed as before and blocked with 3% BSA in PBS. For staining with antiBrdU antibodies, DNA was digested by incubating cells with 1 mg/ml DNaseI for 1 h at 37°C in the presence of protease inhibitors. Primary antibodies were diluted accordingly with PBS containing 3% BSA and incubated for 1 h at room temperature. Cells were washed 3 times with PBS, and the cells incubated for a further hour in the appropriately diluted secondary antibody. For double labeling, antibody incubations were carried out consecutively and cells visualized using a Biorad MRC1024 confocal microscope at room temperature using LaserSharp 2000 acquisition software.

Immunoprecipitation Swiss 3T3 cells were plated at 5 × 105/T75 flask and a G0 arrest induced as previously described. Cell cycle re-entry was induced by replacing media with 20% FCS/DMEM. After 13 h, cells were labeled with 330 μCi L-[35S] methionine for 1 h. A post-nuclear supernatant was prepared and applied to a 5.2 ml 10–40% continuous sucrose gradient and spun at 85,000 × g for 18 h at 4°C in a Beckman Ultracentrifuge using a SW55 rotor. Gradients were fractionated into 500 μl aliquots and the CCT 16-mer (approximately 20S) fraction used for immunoprecipitation as described by [17].

IEF-PAGE IEF-PAGE was carried out according to O'Farrell (1975) [18]. For immunoprecipitation samples, 50 μl IEF loading buffer was added to the dried beads and 30 μl loaded per rod gel. For postnuclear supernatants, an equal volume of IEF sample buffer was added and 20 μl loaded onto a 4–8 pH gradient first dimension rod gel (Hoeffer). Isoelectric focusing was carried out at 500 V for 2 to 2.5 h then proteins were resolved on a 9% polyacrylamide SDS gel. L-[35S]-methionine-labeled proteins were visualized by autoradiography and quantitated using a Molecular Dynamics Storm Phosphorimager and Image Quant software.

siRNA silencing siRNA silencing of CCTζ-1 was carried out as described by Kunisawa and Shastri [19] using oligofectamine to transfect HeLa and BE cell lines. The siRNA duplex targeting

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

AAAGACGGCAAUGUGCUGCUU with 3′dTdT overhangs, annealed and deprotected, was obtained from Dharmacon Research. New CCT target sequences: the four siRNA duplexes designed in this study (Dharmacon Research) targeting the CCTβ and CCTδ sequences are: – – – –

β1 AAUGGUUCCGAUGAAGUUAAA. β3 AACAAAGGUUGCAGAAAUAGA. δ1 AAGUAAUGUCCUUCUCAUACA. δ2 AAGGUUGCUGAUGCUAUUAGA.

The control, non-targeting siRNA (UAGCGACUAAACACAUCAA) with 3′UU overhangs was obtained from Dharmacon Research.

DNaseI binding assays BE cells were treated with siRNA targeting CCTζ-1 for either 24 or 72 h then labeled with 100 μCi L-[35S] methionine/T25 flask for 30 min. Post-nuclear supernatants were prepared as described by Llorca et al. [17], and 30 μl was added to 20 μl 50% DNaseI-conjugated AFFI-gel. DNaseI binding assays were performed in triplicate essentially as described by MacLaughlin et al. [11] and recovered actin analyzed on a Molecular Dynamics Storm Phosphorimager using Image Quant software.

Flow cytometry BE cells treated with siRNA for 48 h were fixed in 70% ethanol, stained with propidium iodide and analyzed using a FACSCalibur flow cytometer (Beckton Dickenson) and CellQuest software.

Antibodies Rat mAbs to CCT subunits were: anti-CCTβ clone PK/54/21b/ 2b/3g, anti-CCTε (εAD1, [17]), anti-CCTζ-1 clone PK/35/63, antiCCTδ (8 g, [5]), anti-CCTη (η81a, [6]) and anti-β/-COP (23C, [20]); rabbit polyclonal to CCTγ [21]. Commercial antibodies used were: rabbit anti-CCTζ-1 sc13897, anti-Cdk2 sc163 (Santa Cruz) and anti-myosin IIA (Sigma). Mouse anti-actin clone AC15, anti-α-tubulin clone B-512, anti-β-tubulin clone TUB2.1, anti-γ-tubulin clone GTU-88 (Sigma), anti-Hsp90 SPA-846 (Stressgen), anti-Plk1 clone 35–206 (Abcam) and anti-BrdUFITC (Roche).

Results CCT activity is essential for cell cycle progression It has been demonstrated that the reduction in CCTζ-1 by siRNA in HeLa cells affects the levels of other CCT subunits in addition to the target subunit [19]. CCTζ-1 is the somatically expressed isoform of the pair of human CCTζ genes; CCTζ-2 is only expressed in testis [22]. We used the siRNA approach to reduce the levels of CCT in both HeLa cells and in the human colon carcinoma cell line BE [23]. In addition, we have developed four new siRNA probes which target the CCTβ

2311

and CCTδ subunits (β1, β3 and δ1, δ2 respectively) as controls for specificity which were absent from the previous study [19]. Fig. 1A shows the consequences upon cell division of treating human BE cells with these five anti-CCT subunit siRNA probes. Remarkably, they all have profound effects on cell division and are already inhibiting cell proliferation only 24 h post-application. A non-targeting siRNA duplex was used to confirm the specificity of the effects of the siRNA probes targeting CCT subunits and was shown to have no effect on cell growth. Following transfection of the CCTζ-1 siRNA probe, Western blotting of whole BE and HeLa cell lysates indicated that the steady-state levels of all CCT subunits tested were reduced (CCTγ and CCTη levels shown in Fig. 1B), and the same result is observed in BE cells in the case of our novel β1, β3 and δ1, δ2 probes (CCTδ levels shown in Fig. 1B). Loading controls included measurement of steady-state Hsp90 and β-actin levels which remain unchanged. A slight reduction in α-tubulin levels is seen in the CCT-depleted samples. The reduction in CCT levels is more pronounced in BE cells than HeLa cells when comparing Western blots. This is a reflection of transfection efficiency levels which are greater than 90% in BE cells, as demonstrated by the transfection of BE cells with an FITC-conjugated siRNA duplex (Fig. 1B). Therefore, BE cells were chosen as the focus for further studies. Following mock transfection, the control BE cells clearly undergo cell division and occupy the entire surface of the Petri dish by day 4 after transfection (Fig. 1E) while the CCTζ-1 knockdown cells are growth-arrested (Figs. 1F–H), confirming the cell counting assay (Fig. 1A). Immunofluorescence detection of CCTζ-1 protein shows substantial reduction in signal in siRNA-treated cells (Fig. 1G) compared to controls (Fig. 1D). FACS analysis of control and CCTζ-1 knockdown BE cells on day 2 following transfection, stained with propidium iodide to analyze DNA content, indicated that the knockdown of CCTζ-1 does not induce apoptosis (no sub-G1 peak observed), although a slight shift towards a G1 arrest was observed (Fig. 1J). Western blotting of duplicate cell samples shows that CCTζ-1 protein is very depleted on day 2 when the FACS analysis was performed (Fig. 1I). It is important to note that, while there will be some non-transfected cells present in the ζ-1 knockdown samples, these will be very few due to the high transfection efficiency of our system (greater than 90%). Therefore, by performing the FACS analysis on day 2 post-transfection, the maximum number of non-transfected cells would be in the order of 20% present as, unlike the transfected cells, these cells would continue to multiply. Therefore, we believe the FACS profile obtained from day 2 post-transfection reflects the cell cycle profile of the CCTdepleted cells. It has recently been shown that CCT is required for the biogenesis of Polo-like kinase 1 (Plk1) that is required for mitotic progression [24]. Here, we show that, when CCT is depleted in BE cells, the levels of Plk1 are reduced (Fig. 1K). This may indicate that Plk1 is a substrate of CCT or may be an indirect consequence of the observed cell cycle arrest since levels of cyclin B, which does not interact with CCT, were also reduced in the siRNA-treated cells (data not shown). Analysis of the 20S CCT oligomer containing fractions from sucrose gradient fractionation on day 1 post-transfection with siRNA

2312

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

CCTζ-1 shows a small Plk1 signal cofractionating with the CCT oligomer (Fig. 1K). In order to confirm that the CCT-depleted cells undergo a delay in cell cycle progression without checkpoint activation, the actin-depolymerizing drug latrunculin was used to induce a mitotic arrest. BE cells transfected either with the non-targeting control duplex or the CCTζ-1 duplex were

found not arrested in mitosis, consistent with the FACS data presented here. Following the addition of latrunculin for 24 h, approximately 75% of the control cells had become blocked in mitosis compared to only 39% of CCT-depleted cells (Table 1). This indicates that the CCT-depleted cells have arrested without checkpoint activation, and this result supports our FACS data presented here. Moreover, the cells

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

Table 1 – Latrunculin treatment of BE cells following siRNA transfection Transfection Control ζ-1 knockdown Control/latrunculin treatment ζ-1 knockdown/latrunculin treatment

Percent cells in mitosis 4.3 ± 2.5 4.3 ± 2.1 74 ± 6.5 39 ± 5.7

BE cells were transfected with either non-targeting control siRNA duplex or duplex targeting CCTζ-1. On day 2 post-transfection, the medium was replaced with either fresh medium alone or fresh medium containing 0.5 μM latrunculin. After a further 24 h, cells were fixed and permeabilized and stained with Texas-red-conjugated phalloidin, FITC-conjugated anti-tubulin monoclonal antibody and DAPI. The number of cells in mitosis was calculated as percentage of total cells, and the cells in 6 fields of view were counted for each transfection.

which do proceed to a mitotic arrest will include the low number of cells which are not transfected in our system (approximately 20%).

Reduction in CCT levels affects levels of tubulin but not actin synthesis in vivo We determined the extent to which reduction of CCT levels affects protein synthesis. This was achieved by metabolically labeling cells with [35S] methionine at 24 and 72 h posttransfection followed by IEF-PAGE analysis of post-nuclear supernatants to correspond to the day 1 and day 3 samples previously analyzed. The mock-transfection- and siRNAtreated samples on day 1 are shown in Figs. 2A and B and on day 3 in Figs. 2D and E. Quantitation was performed using a Storm Phosphorimager, and differences in total protein loading between gels adjusted using Hsp90 as a standard as there were no changes in Hsp90 levels as detected by immunoblotting in previous experiments where total protein levels had been standardized by densitometric analysis or cell counting. Individual spots were identified by immunoblotting (not shown), and the levels of individual proteins in the siRNA sample calculated as a percentage of that in the control (Figs.

2313

2C and F). The reduction in non-siRNA-targeted CCT subunits, measured by metabolic labeling, is consistent with the Western blot measurements of steady-state levels. The levels of actin synthesis are unchanged on the first day of transfection and fall only slightly on day 3 following transfection, again consistent with no changes in the total levels of actin being detected by Western blotting (see Fig. 1B). In contrast, the levels of α, β and γ tubulin are significantly reduced on day 1 and continue to be so on day 3.

Biochemical analysis of CCT assembly status in CCTζ-1-depleted BE cells Analysis of cell lysates by sucrose gradient fractionation following CCTζ-1 siRNA transfection indicated that low levels of intact 20S chaperonin holocomplex remained (Fig. 3; boxes in main panels). When levels of CCTζ-1 are reduced, all the remaining CCTζ-1 is associated with the 20S complex (Fig. 3B—Western blot over-exposed), although in normal cells there are detectable levels of ‘free’ CCTζ-1 protein (Fig. 3A—Western blot under-exposed). The overall levels of the non-siRNA-targeted CCT subunits are always diminished in these experiments, but even so an increase in the remaining levels of the non-targeted CCT subunits is observed fractionating at the top of the gradient, presumably existing as free monomers or micro-complexes (Fig. 3B shows CCTβ, CCTδ and CCTη analysis). This indicates that the remaining CCT subunits are in excess with respect to the number of 20S holo-CCT complexes when the level of one subunit is greatly reduced. How the system of CCT subunit synthesis and assembly responds to artificially changing the ratios of the subunits will be interesting to investigate in the future. Finally, in this entire series of experiments, the levels of Hsp90 and Hsp70 were always constant, and we have not found that reducing CCT complex levels induces a heat shock response.

Microinjection of εAD1 mAb into Swiss 3T3 cells Since reduction in CCT levels by siRNA produced a dramatic affect on cell division, in order to study further the dependency

Fig. 1 – Reduction in CCT levels by siRNA results in growth arrest but not apoptosis. (A) Analysis of mock- (C) and siRNA-transfected human BE cells targeting CCTζ-1, CCTβ (via 2 independent probes; β1 and β3) and CCTδ (via 2 independent probes; δ1 and δ2). A non-targeting siRNA probe (c siRNA) was used as an additional control. Cell counting was performed in triplicate. (B) Western blots of BE and HeLa cell lysates on days 1, 2 and 4 post-siRNA CCTζ-1 transfection having equivalent total protein loadings (based on densitometric analysis of Coomassie Blue stained samples) were probed with antibodies to CCTγ, CCTδ, CCTη, actin, tubulin and Hsp90. The volumes of lysate loaded per well from left to right were 10, 11.9, 7, 8.6, 9.7, 16, 7.2, 9.9 5.7, 13, 5.3 and 10.5 μl. Blots probed for Hsp90, CCTη and actin are shown at two different exposure times as indicated. BE cells targeted for CCTβ and CCTδ on day 2 are also shown, the volumes of lysate loaded per well from left to right were 1.1, 2.5, 2.3, 3.8 and 1.5 μl. BE cells transfected with a functional siRNA probe conjugated to FITC and stained with TRITC-phalloidin are also shown to demonstrate the high transfection efficiency of these cells. (C–H) Human BE cells were analyzed by immunofluorescence using an anti-CCTζ-1 polyclonal antibody followed by an FITC-conjugated secondary antibody and Texas-red-conjugated phalloidin to stain F-actin. Cells following a mock transfection (siRNA buffer and Oligofectamine) (C–E) and following siRNA transfection (F–H) are shown at 24, 48 and 96 h post-transfection (days 1, 2 and 4). The white bar (G) corresponds to 50 μm. (I, J) A duplicate BE cell CCTζ-1 siRNA transfection was probed with an anti-CCTζ-1 monoclonal antibody (PK/35/63) and anti-Hsp90 to show depletion of CCTζ-1 protein over 3 days, and cells were also harvested on day 2 posttransfection, stained with propidium iodide and analyzed by flow cytometry (J). Equivalent protein loading of whole BE lysates (mock and CCTζ-1 siRNA) 4 days post-transfection and the 20S CCT oligomer containing fractions from sucrose gradients from day 1 post-transfection were probed with an antibody to PLK-1 (K).

2314

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

Fig. 2 – siRNA targeting of CCTζ-1 affects the synthesis rates of other CCT subunits and tubulins but not overall protein synthesis. Mock-transfected control and CCTζ-1 siRNA-targeted BE cells were metabolically labeled for 30 min 24 and 72 h post-transfection (on days 1 and 3) and post-nuclear supernatants analyzed by IEF-PAGE. The control profile of 35 S-labeled polypeptides on day 1 (A) is remarkably similar to the siRNA profile (B), the positions of CCT subunits α, β, γ, ε, θ and ζ are indicated, and the absence of CCTζ-1 in B is indicated by an arrow. The control profile (D) and corresponding siRNA profile on day 3 (E) are also similar. The exposure times of these autoradiograms are not identical in order to highlight particular protein spots. Quantitation was performed using a Molecular Dynamics Storm Phosphorimager and Image Quant software. Counts were adjusted for differences in label incorporation and gel loading using Hsp90 as a standard, and values of individual protein spots in the siRNA samples expressed as a percentage of the corresponding control spots counts on day 1 (C) and day 3 (F).

on CCT during cell growth, antibody microinjection studies were performed using the monoclonal antibody εAD1 which recognizes a 15 amino acid oligo-peptide derived from the CCTε apical domain mapping to the tip of the helical protrusion of this subunit [17]. Initially, we performed microtubule and microfilament recovery (regrowth) experiments because CCT has been shown to influence the rate but not the final level of actin polymerization in vitro with differing levels of CCT subunits remaining associated with actin filaments [25] and to confirm that antibody was well tolerated in vivo. Swiss 3T3 cells were treated with nocodazole to depolymerize microtubules, and upon the washing out of nocodazole, the cells are able to reform their microtubules from existing α/β tubulin dimer pools (Figs. 4A and B), and the presence of microinjected εAD1 antibody did not result in a discernable block in this process (Figs. 4C–E), although any subtle differences in the numbers

and lengths of microtubules would be extremely difficult to quantitate by immunofluorescence. Similar results were obtained for the regrowth of microfilaments following treatment with cytochalasin (data not shown), indicating that any requirement/involvement for CCT during actin polymerization in vivo is not substantially affected by the εAD1 antibody. However, the tolerance of the εAD1 mAb by the Swiss 3T3 cells shows that this antibody does not have dramatic and nonspecific toxic effects on the cells and indicates the suitability of this antibody for probing the functions of CCT. In order to determine if the presence of the εAD1 mAb binding to CCT had any effect on cell cycle progression, Swiss 3T3 cells were grown until contact inhibition occurred and then serum-starved to induce a G0 arrest and injected with either the εAD1 mAb or a purified rat IgG as a control. Following the addition of serum to induce re-entry into the cell cycle, progression from G1 into S phase was monitored. This

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

2315

Fig. 3 – Depletion of CCTζ-1 reduces CCT holocomplex levels and increases monomeric forms of non-targeted CCT subunits. Post-nuclear supernatants of control (A) and siRNA CCTζ-1-targeted BE cells 24 h post-transfection (B) were fractionated on linear 10–40% sucrose gradients and analyzed on silver-stained SDS-PAGE; the top of the gradient is to the right hand side. The CCT subunit bands are indicated by boxing and holo-CCT complex sediments at 20S in this system. Exposures of corresponding Western blots probed with antibodies to CCT subunits β, δ, ζ-1 and η are displayed below. Note the substantial CCTβ, δ and η signals which co-migrate with the peak of the monomeric proteins in the siRNA-treated sample.

was achieved using immunofluorescence to detect BrdU incorporation into nuclei which occurs when cells enter S phase of the cell cycle and are replicating their DNA [26]. The timeframe in which BrdU is incorporated into non-injected cells was established (Figs. 4F–I). Strong levels of BrdU staining indicate progression into S phase, while faint staining results from low levels of BrdU being incorporated into chromosomes during routine DNA repair. At 21 h post-serum addition, the majority of non-injected cells show strong nuclear staining for BrdU, indicating that the cells have entered S phase and are replicating their DNA. The majority of cells injected with the control rat IgG also show strong BrdU staining, confirming that the process of microinjection and presence of a non-specific antibody do not affect cell cycle progression. However, the majority of cells that had been microinjected with the εAD1 mAb showed little staining for BrdU, consistent with the cells failing to progress from G1 into S phase (Figs. 4J and K). In order to determine whether the presence of εAD1 mAb induces a complete block in cell division or a delay in cell cycle progression, injected cells were analyzed at 25 and 30 h postserum addition. At these time points, the number of injected cells showing strong nuclear staining of BrdU had increased, indicating that the presence of the εAD1 mAb resulted in a delay in cell cycle progression rather than a complete block (Fig. 4L). However, the half-life of a microinjected IgG molecule is of the order of 24 h (Hugh Paterson, The Institute of Cancer Research, personal communication), and therefore the inhibitory effect will decay as the antibody decays. This is also the reason that it was not possible to follow microinjected cells through multiple cell cycles as the cell cycle in Swiss 3T3 cells is approximately 20 h. The results of individual microinjection experiments are summarized in Table 2. Monospecificity of the εAD1 mAb was confirmed by probing a Western blot of total Swiss 3T3 lysate. An over-exposed blot is shown to demonstrate the lack of cross-reactivity of this antibody with other proteins (Fig. 4M).

The observed delay in entering S phase may be due to either a direct effect on the rate of native tubulin production or due to effects on other proteins that may require interactions with CCT. In order to determine how many other proteins are interacting with CCT, Swiss 3T3 cells were harvested in mid-G1 following a 1-h incubation in the presence of [35S] methionine, and the CCT complex isolated by sucrose gradient fractionation of a post-nuclear supernatant. CCT was immunoprecipitated with the εAD1 mAb under non-denaturing conditions and the immunoprecipitate resolved by IEF-PAGE and visualized by autoradiography (Fig. 4N). The major co-precipitating proteins are actin and tubulin as indicated. However, there are several other co-precipitating proteins present at much lower levels. It is therefore possible that, in addition to the major CCT substrates, actin and tubulin being affected by the presence of the antibody, other less abundant CCT binding proteins may also be affected.

In vitro translation of CCT substrates in the presence of εAD1 mAb We wished to determine exactly how the εAD1 antibody influenced CCT activity. The interactions between CCT and its folding substrates can be monitored by the in vitro transcription/translation of cDNA clones encoding folding substrates in a rabbit reticulocyte lysate system. Substrate binding to the endogenous CCT and native substrate protein yields were being assessed in a native PAGE-based assay, by calculating counts associated with CCT and the released product as a percentage of the total counts per gel lane, thereby correcting for any variation between the total counts of individual in vitro translation reactions. This assay has been well characterized for the quantitation of actin and tubulin binding to CCT [27,28] and for actin and tubulin binding to CCT in the presence of the 23C monoclonal antibody [16]. The binding of the εAD1 antibody to CCT results in a change in

2316

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

Fig. 4 – Microinjection of εAD1 mAb into synchronous Swiss 3T3 cells results in a delay in cell cycle progression. Swiss 3T3 cells were treated with 2.5 μM nocodazole for 1 h at 37°C to depolymerize microtubules (A). Significant regrowth of microtubules upon the washing out of nocodazole was able to occur following a 15-min incubation in the presence of 18 μM cyclohexamide (B). Cells pre-microinjected with εAD1 mAb were analyzed at 5 min (C), 15 min (D) and 30 min (E) following removal of nocodazole. Cells were stained for α-tubulin (red) and with anti-rat-FITC to detect cells injected with εAD1 mAb. The white bar in panel E corresponds to 50 μm in panels A–E. BrdU incorporation into the nuclei of synchronous Swiss 3T3 cells was monitored using anti-BrdU rat mAb (green) 18, 21, 25 and 30 h post-serum addition (F–I). G0-arrested Swiss 3T3 cells microinjected with εAD1 or rat IgG (red) prior to cell cycle re-entry and fixed at 21 h post-εAD1 injection (J), 21 h post-rat IgG injection (K) and 25 h post-εAD1 injection (L). BrdU incorporation (using a mouse mAb to BrdU-FITC conjugate) indicated a delay in S phase progression specifically when εAD1 was present. The white bar in panel L corresponds to 50 μm in panels J–L. Monospecificity of the εAD1 mAb was confirmed by probing Western blots of whole Swiss 3T3 cell lysate (M). Synchronous Swiss 3T3 cells were metabolically labeled for 1 h mid-G1, a post-nuclear supernatant prepared and CCT complexes isolated by sucrose gradient fractionation. CCT was immunoprecipitated under non-denaturing conditions with εAD1 mAb, and proteins resolved by IEF-PAGE (N). CCT subunits (α, β, γ, δ, ε, ζ, η and θ) and co-precipitating actin (act) and tubulin (tub) are indicated.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

Table 2 – Summary of antibody microinjection experiments Hours Microinjection Total No. of postcells experiments serum addition 19 20

21

22 25 30

εAD1 Non-injected εAD1 Rat IgG Non-injected εAD1 Rat IgG Non-injected εAD1 Non-injected εAD1 Non-injected εAD1 Non-injected

43 87 184 61 522 77 50 160 57 294 79 193 60 112

1 1 3 3 4 2 2 2 2 2 2 2 1 1

Percent BrdUpositive nuclei 23.2 87 41.3 ± 9 70 ± 2.45 79.75 ± 3.69 30.5 69.5 86 57 92 77.5 93.5 83 93

Swiss 3T3 cells were arrested in G0 by serum starvation and microinjected with either εAD1 mAb or purified rat IgG to act as a control for microinjection (both 1.3 mg/ml in PBS) then stimulated to re-enter the cell cycle by addition of 20% FCS in DMEM in the presence of BrdU. Cells were fixed and permeabilized at 19, 20, 21, 22, 25 and 30 h post-serum addition then probed with anti-rat TRITC-conjugated antibody to identify injected cells and with an anti-BrdU FITC-conjugated antibody. The number of BrdU positive nuclei was calculated as a percentage of total nuclei with noninjected cells from each time point also counted.

electrophoretic mobility during native PAGE whereby antibody-bound CCT exhibits reduced mobility relative to unbound CCT. When β-actin is translated in a rabbit reticulocyte lysate system in the presence of εAD1 mAb, actin binds to and is processed by CCT (Fig. 5A). The reduced mobility of CCT during native PAGE, observed at all time points analyzed, confirms the interaction of L-[35S] methionine-labeled actin with antibody-bound CCT. Although the binding of the antibody does not prevent the binding of substrate to CCT, the relative levels of actin binding and the timing of its interactions with CCT are altered and the yield of native actin is reduced. Similar results were obtained during the in vitro translation of α-tubulin (data not shown). For both actin and tubulin, the relative levels of substrate bound to CCT were higher than in the absence of antibody, with a slight time delay in the maximum CCT binding observed. To distinguish between the binding, folding and release phases of substrate interactions with CCT, the binding of wildtype actin and a fragment of actin were studied at a higher antibody concentration (57 μg/ml instead of 17.2 μg/ml) to ensure that both rings of the chaperonin were bound by antibody. At the higher antibody concentration, the inhibitory effect upon wild-type actin was similar to that found at 17.2 μg/ml, but interactions between CCT and a fragment of actin coupled to Ha-ras, which is able to bind CCT and equilibrates [5], remain unchanged in the presence of the high concentration of antibody (Fig. 5B). This indicates that εAD1 binding may have less effect on the initial capture of substrates, which is the step that we are measuring in the Haras-actin fragment assay [29], than on subsequent steps in the

2317

folding mechanism. It is likely that the rate of substrate folding is altered in the presence of antibody, possibly due to constraints on conformational changes in the helical protrusions required during the folding cycle, rather than the antibody directly obscuring a substrate binding site which we believe are located well below the helical protrusions where εAD1 binds [4]. Since both the CCTβ and CCTε subunits are involved in substrate capture in the two binding modes, it is understandable that substrate capture might not be inhibited completely by εAD1 binding to CCTε alone [21]. We conclude that microinjection of the εAD1 mAb results in subtle changes in the rate at which CCT processes its major substrates actin and tubulin rather than the direct inhibition of substrate binding. It would therefore appear that the rate at which CCT is able to process newly folded actin and tubulin is critical for cell cycle progression and that altering this processing rate results in significant effects on cell cycle progression through G1/S phase.

Not all CCT–protein interactions are affected by the εAD1 antibody While it is probable that changing the rate of CCT activity in vivo is most likely to impact upon its major substrates actin and tubulin, we wished to address the possibility that the delay in cell cycle progression could be the result of inhibiting CCT interactions with a low abundance folding substrate which is directly involved in cell cycle progression through G1/ S phase. We therefore studied the binding of Cdh1 and cyclin E to CCT in the presence of this mAb. Cdh1, which is required during G1 to activate Anaphase Promoting Complex (APC), was recently identified as a substrate for CCT [30]. We showed recently that in rabbit reticulocyte lysate functional yeast Cdh1 is produced through the action of CCT and it can activate APC E3 ligase activity on cyclin B [31]. Full-length S. cerevisiae Cdh1 was translated in the presence and absence of εAD1 mAb and the binding to CCT of newly synthesized Cdh1 analyzed by native PAGE followed by phosphorimaging (Fig. 6A). The presence of this antibody bound to CCT does not alter the rate of Cdh1:CCT interactions, and no change in the production of native Cdh1 was observed (Fig. 6B). In the case of cyclin E (required for transition through G1/S), the levels of binding to CCT are much lower than those seen for actin and Cdh1 (approximately 5% of total counts associated with CCT after 40 min, data not shown), and rather than being released by CCT, cyclin E appears to accumulate at low levels on CCT. When cyclin E is translated in the presence of the εAD1 mAb, there is no detectable binding of cyclin E to CCT, yet the production of the faster migrating band is unchanged (Fig. 6C). An antibody that recognizes Cdk2, the binding partner of cyclin E in vivo, was used to confirm that this band corresponds to a complex between cyclin E and endogenous Cdk2, demonstrating that the cyclin E produced is both native and functional (Fig. 6D). Therefore, while the binding of the εAD1 antibody to CCT appears to prevent cyclin E binding to CCT, this does not inhibit the production of native cyclin E. It is therefore unlikely that the delay in G1/S phase progression observed upon the microinjection of the εAD1 antibody is due to an inhibition in the production of native cyclin E. Furthermore, these data are indicative that cyclin E is not

2318

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

Fig. 5 – εAD1 mAb binding to CCT in rabbit reticulocyte lysate results in an increase in substrate processing time. β-actin in vitro translations were carried at 30°C in rabbit reticulocyte lysate (Promega) in the presence and absence of 17.2 μg/ml εAD1 mAb (A) and time course samples analyzed by Native PAGE. The far right lane on each gel corresponds to the final time point of either the control or antibody sample to allow for comparisons between antibody-shifted and non-shifted CCT to be made. Quantitation of incorporated [35S] methionine was carried out using a Molecular Dynamics Storm Phosphorimager 860 system. The levels of CCT-bound substrate were calculated as a percentage of the total counts in each lane. Closed squares represent control samples, and open squares samples in the presence of antibody. Full-length β-actin and truncated fusion of actin Ha-ras-actin ii + iii were translated in the presence and absence of εAD1 mAb at a final concentration of 57 μg/ml (B). The two possible CCT-binding orientations of full-length β-actin and the truncated β-actin fragment containing subdomains 3 and 4 are illustrated [27].

dependent on interactions with CCT to reach its native conformation. To address this further, cyclin E was translated in the presence of the 23C mAb which binds to CCTα

and has been shown to have no effect on the binding and processing of actin and tubulin in rabbit reticulocyte lysate [16]. The presence of the 23C mAb also prevents the binding

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

2319

Fig. 6 – Production of native Cdh1 and cyclin E in rabbit reticulocyte lysate is not affected by εAD1 mAb binding to CCT. Full-length S. cerevisiae Cdh1 was translated in rabbit reticulocyte lysate (Promega) in the presence and absence of εAD1 mAb at a final concentration of 17.2 μg/ml. Cdh1 binding to CCT in the presence and absence of antibody analyzed by binding during native PAGE is shown (A). The positions of CCT, CCT shifted by antibody (CCTs) and monomeric Cdh1 are indicated. The percentages of Cdh1 bound to CCT (squares) and folded monomeric Cdh1 (triangles) were calculated as a percentage of total counts per lane (B), closed symbols represent control samples and open symbols samples in the presence of antibody. Cyclin E in vitro translations in the presence and absence of εAD1 mAb (C) were analyzed on a 6% native gel followed by autoradiography. 1.5 μl samples of cyclin E translated in the presence and absence of εAD1 mAb for 30 min were incubated with 2 μl anti-Cdk2 polyclonal antibody in a final volume of 10 μl with PBS and incubated on ice for 20 min. 1.5 μl sample buffer was added, and the entire sample resolved on a 6% native gel followed by autoradiography (D). The positions of cyclin E and cyclin E shifted by antibody (cyclin Es) are indicated. Cyclin E in vitro translations in the presence and absence of 23C mAb was analyzed on a 6% native gel followed by autoradiography (E).

of cyclin E to CCT but not the production of the cyclin E/Cdk2 complex (Fig. 6E). This indicates that the elimination of cyclin E binding to CCT may not be due to a direct inhibition of its binding site by either mAb but may reflect disturbance of a CCT conformation(s) that binds cyclin E. In our native PAGE assay system, there is a clear difference between the way in which actin and Cdh1 (known to be genuine folding substrates of CCT) bind to and are processed by CCT and the way in which cyclin E slowly accumulates on CCT. These observations agree with studies of Yokota et al. (1999) [32] who found little association of cyclin E with CCT during the G1 phase of the cell cycle. Together, these two studies suggest that cyclin E may not be a stringent substrate, completely dependent on interactions with CCT to reach its native form.

Reduction in the levels of native actin in CCTζ-1 siRNA-treated BE cells We determined the conformational state of the actin produced when the levels of CCT were greatly reduced. This was achieved by analyzing the levels of newly synthesized actin which were able to bind DNaseI; this assay having previously been used to analyze the processing of actin by CCT in vivo [11]. One day after transfection, there is a reduction in the amount of actin, produced in a 30-min labeling period, able to bind DNaseI in the siRNA-treated sample compared to the mock transfection. This reduction is more pronounced on day 3 post-transfection, consistent with less actin being processed as levels of CCT decrease (Fig. 7A). Analysis by SDS-PAGE of the pellets and supernatants generated from the post-nuclear

2320

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

cells, the phalloidin is concentrated at discrete membrane ruffles (Fig. 8E) that also contain G-actin (Fig. 8F) and colocalize in the merged image (Fig. 8G). However, in the siRNAtreated cells, the F-actin signal appears to be distributed all around the plasma membrane, with no discrete leading edges visible (Fig. 8H). Furthermore, there are no concentrations of G-actin at the plasma membrane, instead a granular staining in the cytoplasm is observed (Fig. 8I). The merged image of Gand F-actin (Fig. 8J) clearly shows that there is no co-staining of the actin granules with phalloidin. Microtubules in control cells (Figs. 8K and L) and in siRNAtreated cells (Figs. 8M and N) were stained with an anti-αtubulin antibody (Figs. 8K and M) and the images merged with phalloidin staining (Figs. 8L and N). Following the siRNA treatment, microtubules appear to be disordered, and there is little co-localization of microtubules and microfilaments (compare Figs. 8L and N). The staining pattern of myosin IIA in control cells (Fig. 8O) and myosin IIA-phalloidin co-stain (Fig. 8P) was compared with that in corresponding siRNAtreated cells (Figs. 8Q and R). Following siRNA treatment, there appears to be a reduction in the levels of myosin IIA staining and a decrease in the levels of co-localization with phalloidin.

Motility assays in BE cells depleted of CCTζ-1

Fig. 7 – Reduction in CCT levels reduces the levels of native actin production in vivo. The native actin content of triplicate samples of [35S] methionine-labeled post-nuclear supernatants was analyzed by DNaseI binding followed by quantitation using a Molecular Dynamics Storm Phosphorimager and Image Quant software. Samples were standardized according to the input counts, and the levels of native actin recovered in the siRNA-treated samples expressed as a percentage of the native actin recovered in the control (A). The post-nuclear supernatants and pellets were analyzed by SDS-PAGE using standardized loading volumes to allow for a direct comparison to be made between the pellets (P) and supernatants (S) from the control and siRNA-treated cells to be made (B). supernatant preparation showed no increase in total aggregated protein following the siRNA targeting of CCT (Fig. 7B).

Reductions in CCT levels result in a disordered cytoskeleton Immunofluorescence analysis was carried out on BE cells 3 days after mock and siRNA transfections. To confirm the general integrity of the cells following CCT-targeted siRNA treatment, cells were stained with the 23C mAb which detects the Golgi coatomer protein β/-COP [20] and no differences in staining were observed (Figs. 8A and B). The AC15 actin mAb, which in these cells predominantly stains G-actin, detected small, granular particles in the siRNA-treated cells that were not present in the control cells (Figs. 8C and D). The composition of the granular particles was analyzed further by co-staining with phalloidin to detect F-actin. In the control

Motility of the BE cells following mock transfection is shown in Video 1 starting 20 h post-transfection, and the corresponding siRNA-treated cells are shown in Video 2. The cells with reduced CCT levels are able to move, but their morphology is markedly different, with the cells appearing larger and flatter than the control cells. The extensive leading edges seen by phalloidin staining in Fig. 8 in the siRNA-treated cells are visible by phase-contrast microscopy and account for a much larger area of the plasma membrane than in the control cells. The siRNA-treated cells also appear to have lost adhesions at the retracting rear edge of the cell, which are clearly visible in the control cells.

Discussion CCT function is linked to mammalian cell cycle progression In several mammalian cell lines, it has been demonstrated that CCT subunit levels are primarily controlled at the mRNA level and that in mouse DA3 myeloid cells maximum CCT protein and mRNA levels occur at the G1/S transition through early S phase [32]. In synchronized cells, the total level of CCT complex increases several fold by S phase and high levels of tubulins are associated with the S phase CCT population with α-tubulin, in particular, showing a spike of synthesis and CCT association at the G1/S transition. Actin does not show this cell cycle association with CCT since β-actin is fairly constantly synthesized during the cell cycle [32] and also because actin transits CCT more rapidly than tubulin in vivo [7]. Interestingly, the treatment of rat fibroblasts with the actin-binding drug dihydrocytochalasin B at insufficient concentrations to effect cell cleavage and adhesion induces an arrest in G1, a process which requires the function of retinoblastoma pocket

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

2321

Fig. 8 – Reduction of CCT levels leads to disorganization of the microfilament cytoskeleton. Control mock-transfected siRNA CCTζ-1-targeted BE cells were analyzed 3 days post-transfection by immunofluorescence. The integrity of the Golgi was confirmed by staining for β/-cop, and no difference was noted between the control (A) and siRNA-treated (B). However, G-actin staining changed from diffuse in the control (C) to diffuse with aggregated speckles in the siRNA cells (D). The white bar in panel D corresponds to 50 μm in panels A–D. F- and G-actin are compared in control cells, phalloidin (E), AC15 (F) and merged (G) to that in siRNA cells (H–J), with clear differences in the size of leading edges visible. The white bar in panel J corresponds to 50 μm in panels E–J. α-Tubulin and the merge with phalloidin are shown in control (K and L) and siRNA cells (M and N). The extensive F-actin-rich leading edges in the CCT-depleted cells do not co-stain for α-tubulin. Myosin IIA and the merge with phalloidin in control cells (O and P) are compared to siRNA cells (Q and R) indicating that there is little co-staining of F-actin at the leading edge and myosin IIA in the siRNA-treated cells. The white bar in panel R corresponds to 50 μm in panels K–R.

proteins, while treatment with nocodazole to depolymerize microtubules does not lead to such an arrest [33]. This suggests that the integrity of the actin system during early G1 stages of the cell cycle is critical for subsequent progression through S phase.

In this study, we have used both siRNA technology and the microinjection of an inhibitory antibody to study the requirements for CCT during cell cycle progression. This has allowed us to compare subtle changes in CCT activity to the consequences of the depletion of the CCT complex. When

2322

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

we reduce CCT levels by siRNA targeting three separate subunits, a complete and rapid arrest in cell division is observed without checkpoint activation. CCT depletion has a much more severe effect on tubulin synthesis and stability than on actin synthesis rates, yet the reliance of actin upon CCT is clearly demonstrated by the dramatic increase of nonnative G-actin in the cell following CCT depletion. When the rate of CCT activity is altered by the microinjection of an inhibitory antibody, a clear delay in cell cycle progression through G1/S is observed, demonstrating a close correlation between CCT activity and this phase of cell cycle transit as the binding of this antibody to CCT results in a change in the processing rates of actin and tubulin rather than a block in their production. Our study does not discriminate the relative effects of CCT depletion on tubulin compared to actin but points to a high level of CCT activity being required for G1/S progression. This is consistent with our observations of inhibition of cell division upon CCT depletion by siRNA treatment as this occurs with 24 h of treatment when the level of CCT reduction is not yet maximal and the pools of total actin and tubulin are unaffected. In a study in the yeast system [30], a delay in DNA synthesis was observed in synchronized cells that had a mutation in the ATP binding pocket of the CCTα subunit, although the cells continue to increase in mass and size, and this behavior is consistent with our results in mammalian cells. Recently, a genome-wide analysis identified 3% of the genes in yeast which show haploinsufficiency for growth in rich media [34]. Remarkably, seven out of the eight CCT genes show haploinsufficiency with one of the highest enrichment P values of all multisubunit genes in yeast.

Reliance upon CCT activity by tubulin and actin When CCT complex levels are reduced by approximately 90%, there is no global effect on protein synthesis nor is there any detectable formation of large protein aggregates. We observed no dramatic changes in the 2D gel maps of cytosolic polypeptides, and this result is in stark contrast to the depletion of the general bacterial chaperonin GroEL, which resulted in immediate and profound protein aggregation of 16/ 35 proteins detected on 2D gels [35]. This indicates a fundamental difference in the degree of reliance upon chaperonins between prokaryotes and eukaryotes, as we originally suggested [36]. Upon reduction of CCT levels, the levels of α, β and γ-tubulin are all reduced, all of which require interactions with CCT to reach their native state [37]. The reduction in levels of newly synthesized tubulins seen here is consistent with either down-regulation of tubulin synthesis or a rapid degradation of misfolded tubulin due to insufficient CCT levels. Intriguingly, there is very little effect on the synthesis of actin (almost 100% on day 1 of the siRNA treatment only falling to 70% on day 3). This led us to perform a detailed analysis of both the native state and the localization of actin following siRNA targeting of CCT. Utilizing a previously described method for analyzing levels of native G-actin in vivo [11], we demonstrated that, as CCT levels are reduced, there is a reduction in the levels of native actin produced and, furthermore, a punctuate actin staining pattern is seen by immunofluorescence, possibly representing small actin aggre-

gates. It therefore appears that the cell has no rapid mechanism to deal with misfolded actin nor a feedback mechanism to prevent actin synthesis when it cannot be processed to its native state by CCT, unlike the levels of α- and β-tubulin which are known to be closely regulated at the mRNA level [38]. Therefore, it would appear that there is an absolute reliance on CCT activity for maintenance of actin folding and also the prevention of actin aggregates forming within cells.

CCT activity influences cell motility Because of the reliance by actin and tubulin on CCT in vivo for their correct folding, any constraints at all on the activity of CCT would be predicted to affect both the actin- and tubulinbased cytoskeletal structures. For example, a single point mutation in the apical domain of the CCTδ subunit [5] not only has a profound effect on the actin cytoskeleton in yeast but also sensitizes cells to the anti-tubulin inhibitor benomyl, suggesting that even subtle changes in substrate binding to or processing by CCT can result in significant effects on the function of both cytoskeletal substrates [39]. The changes in actin localization seen here upon the reduction in CCT levels by siRNA are intriguing and give an insight into how the G/F-actin system is linked to CCT activity. In control BE cells, a significant concentration of actin detected by the mAb AC15 is seen at the leading edges of the BE cells. Although this staining happens to co-localize with phalloidin-stained F-actin, the AC15 stain does not appear filamentous, indicating that a pool of G-actin is co-localized with the F-actin at the leading edge. When CCT levels are reduced, thereby inhibiting native G-actin production, no Gactin signal is seen at the plasma membrane, suggesting that the G-actin localized at the leading edge of the control cells may be newly synthesized and newly folded actin. The changes in F-actin localization between control and siRNAtreated BE cells are striking, with the proportion of the plasma membrane that forms an F-actin staining leading edge increasing dramatically when CCT levels are reduced. The large leading edges which are seen by both phalloidin staining and by phase-contrast microscopy during time-lapse experiments do not co-stain for tubulin or myosin, suggesting that this membrane extension is largely actin-driven. The large leading edge phenotype could be due to a lack of integrity in the actin/myosin-based cytoskeleton due to misfolded myosin (the muscle form of myosin has been shown to interact with CCT in rabbit reticulocyte lysate [40]) or the result of incorrect levels of newly synthesized G-actin. The lack of a retracting rear edge in the CCT-depleted cells is again consistent with an incorrect organization of the actin/myosin cytoskeleton. If a control mechanism exists whereby folding of newly synthesized actin helps define the initiation sites of actin polymerization of a leading edge, the default may simply be unrestricted polymerization of the large actin pools at the plasma membrane, resulting in very large leading edges. It is now well established that β-actin mRNA is concentrated to the leading lamella in many cell types through the 54 nucleotide “zip code” located in 3′ untranslated region of the RNA transcript, and it is postulated that this mechanism helps cells to accumulate the large stores of localized β-actin that

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

are required for correct leading edge formation [41]. Antisense treatment of chick embryo fibroblast cells with oligonucleotides to the “zip code” affects directionality and persistence of their movement but not rate of movement [41], and interestingly these behaviors appear strikingly similar to those of the BE cells with knocked-down CCT activity in our experiments. Since CCT is absolutely required for actin folding, it makes sense that reduction of CCT activity mimics reduction of actin mRNA subcellular localization and the involvement of CCT function in this system clearly merits further study. CCT has been shown to reduce the rate of actin polymerization in vitro without affecting final yields, with some CCT subunits remaining bound to F-actin following polymerization [25] and therefore this activity may also contribute to the mechanism for controlling actin polymerization through CCT activity. Our work indicates that high levels of substrate flow through the CCT system are essential for both cell cycle progression and the organization and integrity of the actinand tubulin-based cytoskeletal systems. The use of the CCT machine by actin and tubulin to attain their native states evolved very early in the eukaryotic lineage [8]. It now seems that the hard-wiring of cytoskeletal protein folding subsequently became integrated into cell cycle control mechanisms in yeast [30] and mammalian cells.

Acknowledgments We thank Hugh Paterson for advice with microinjection assays and time-lapse microscopy. This work has been supported by Cancer Research UK. JG has been supported by Vetenskapsrådet since September 2004 (Forskarassistent grant 621-2003-2654).

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.yexcr.2006.03.028.

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17] REFERENCES

[1] H. Kubota, G. Hynes, A. Carne, A. Ashworth, K. Willison, Identification of six Tcp-1-related genes encoding divergent subunits of the TCP-1-containing chaperonin, Curr. Biol. 4 (1994) 89–99. [2] A.K. Liou, K.R. Willison, Elucidation of the subunit orientation in CCT (chaperonin containing TCP1) from the subunit composition of CCT micro-complexes, EMBO J. 16 (1997) 4311–4316. [3] S. Kim, K.R. Willison, A.L. Horwich, Cytosolic chaperonin subunits have a conserved ATPase domain but diverged polypeptide-binding domains, TIBS 19 (1994) 543–548. [4] G. Pappenberger, J.A. Wilsher, S.M. Roe, D.J. Counsell, K.R. Willison, L.H. Pearl, Crystal structure of the CCTgamma apical domain: implications for substrate binding to the eukaryotic cytosolic chaperonin, J. Mol. Biol. 318 (2002) 1367–1379. [5] O. Llorca, E.A. McCormack, G. Hynes, J. Grantham, J. Cordell, J.L. Carrascosa, K.R. Willison, J.J. Fernandez, J.M. Valpuesta,

[18]

[19]

[20]

[21]

[22]

2323

Eukaryotic type II chaperonin CCT interacts with actin through specific subunits, Nature 402 (1999) 693–696. O. Llorca, J. Martin-Benito, M. Ritco-Vonsovici, J. Grantham, G.M. Hynes, K.R. Willison, J.L. Carrascosa, J.M. Valpuesta, Eukaryotic chaperonin CCT stabilizes actin and tubulin folding intermediates in open quasi-native conformations, EMBO J. 19 (2000) 5971–5979. H. Sternlicht, G.W. Farr, M.L. Sternlicht, J.K. Driscoll, K. Willison, M.B. Yaffee, The t-complex polypeptide 1 is a chaperonin for tubulin and actin in vivo, Proc. Natl. Acad. Sci. 90 (1993) 9422–9426. K.R. Willison, J. Grantham, The roles of cytosolic chaperonin, CCT, in normal cell growth, in: P. Lund (Ed.), Molecular Chaperones: Frontiers in Molecular Biology, Oxford Univ. Press, Oxford, 2001. J.M. Valpuesta, J. Martin-Benito, P. Gomez-Puertas, J.L. Carrascosa, K.R. Willison, Structure and function of a protein folding machine: the eukaryotic cytosolic chaperonin CCT, FEBS Lett. 529 (2002) 11–16. D.E. Feldman, V. Thulasiraman, R.G. Ferreyra, J. Frydman, Formation of the VHL-Elongin BC tumor suppressor complex is mediated by the chaperonin TRiC, Mol. Cell 4 (1999) 1051–1061. J.N. McLaughlin, C.D. Thulin, S.J. Hart, K.A. Resing, N.G. Ahn, B.M. Willardson, Regulatory interaction of phosducin-like protein with the cytosolic chaperonin complex, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 7962–7967. S. Yokota, H. Yanagi, T. Yura, H. Kubota, Cytosolic chaperonin-containing t-complex polypeptide 1 changes the content of a particular subunit species concomitant with substrate binding and folding activities during the cell cycle, Eur. J. Biochem. 268 (2001) 4664–4673. B. Weinstein, F. Soloman, Phenotypic consequences of tubulin overproduction in Saccharomyces cerevisiae: differences between alpha-tubulin and beta-tubulin, Mol. Cell. Biol. 10 (1990) 5295–5304. K. Siegers, T. Waldmann, M.R. Leroux, K. Grein, A. Shevchenko, E., Schiebel, F.U. Hartl, Compartmentation of protein folding in vivo: sequestration of non-native polypeptide by the chaperonin-GimC system, EMBO J. 18 (1999) 75–84. S. Lacefield, F. Soloman, A novel step in beta-tubulin folding is important for heterodimer formation in Saccharomyces cerevisiae, Genetics 165 (2003) 531–541. J. Grantham, O. Llorca, J.M. Valpuesta, K.R. Willison, Partial occlusion of both cavities of the eukaryotic chaperonin with antibody has no effect upon the rates of beta-actin or alpha-tubulin folding, J. Biol. Chem. 275 (2000) 4587–4591. O. Llorca, J. Martin-Benito, J. Grantham, M. Ritco-Vonsovici, K.R. Willison, J.L. Carrascosa, J.M. Valpuesta, The ‘sequential allosteric ring’ mechanism in the eukaryotic chaperonin-assisted folding of actin and tubulin, EMBO J. 20 (2001) 4065–4075. P.H. O'Farrell, High resolution two-dimensional electrophoresis of proteins, J. Biol. Chem. 250 (1975) 4007–4021. J. Kunisawa, N. Shastri, The group II chaperonin TRiC protects proteolytic intermediates from degradation in the MHC class I antigen processing pathway, Mol. Cell 12 (2003) 565–576. K.J. Harrison-Lavoie, V.A. Lewis, G.M. Hynes, K.S. Collison, E. Nutland, K.R. Willison, A 102 kDa subunit of a Golgiassociated particle has homology to b subunits of trimeric G proteins, EMBO J. 12 (1993) 2847–2853. G.M. Hynes, K.R. Willison, Individual subunits of the eukaryotic cytoplasmic chaperonin mediate interactions with binding sites located on subdomains of b-actin, J. Biol. Chem. 275 (2000) 18985–18994. H. Kubota, G.M. Hynes, S.M. Kerr, K.R. Willison,

2324

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 2 ( 2 00 6 ) 2 3 0 9 –23 2 4

Tissue-specific subunit of the mouse cytosolic chaperonin-containing TCP-1, FEBS 402 (1997) 53–56. E. Vial, E. Sahai, C.J. Marshall, ERK-MAPK signalling coordinately regulates activity of Rac1 and RhoA for tumor cell motility, Cancer Cell 4 (2003) 67–79. X. Liu, C.-Y. Lin, M. Lei, S. Lan, T. Zhou, R.L. Erikson, CCT chaperonin complex is required for the biogenesis of functional PLK1, Mol. Cell. Biol. 25 (2005) 4993–5010. J. Grantham, L.W. Ruddock, A. Roobol, M.J. Carden, Eukaryotic chaperonin containing T-complex polypeptide 1 interacts with filamentous actin and reduces the initial rate of actin polymerization in vitro, Cell Stress Chaperones 7 (2002) 235–242. S. Cowley, H. Paterson, P. Kemp, C.J. Marshall, Activation of MAP kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells, Cell 77 (1994) 841–852. E.A. McCormack, O. Llorca, J.L. Carrascosa, J.M. Valpuesta, K. Willison, Point mutations in a hinge linking the small and large domains of beta-actin result in trapped folding intermediates bound to cytosolic chaperonin CCT, J. Struct. Biol. 135 (2001) 198–204. M. Ritco-Vonsovici, K.R. Willison, Defining the eukaryotic cytosolic chaperonin-binding sites in human tubulins, JMB 304 (2000) 81–98. E.A. McCormack, M.J. Rohman, K.R. Willison, Mutational screen identifies critical amino acid residues of beta-actin mediating interaction between its folding intermediates and eukaryotic cytosolic chaperonin CCT, J. Struct. Biol. 135 (2001) 185–197. A. Camasses, A. Bogdanova, A. Shevchenko, W. Zachariae, The CCT chaperonin promotes activation of the anaphasepromoting complex through the generation of functional Cdc20, Mol. Cell 12 (2003) 87–100. L. Passmore, E.A. McCormack, S.W.N. Au, A. Paul, K.R.

[32]

[33]

[34]

[35]

[36]

[37]

[38] [39]

[40]

[41]

Willison, J.W.H.D. Barford, Doc1 mediated the activity of the anaphase-promoting complex by contributing to substrate recognition, EMBO J. 22 (2003) 786–796. S. Yokota, H. Yanagi, T. Yura, H. Kubota, Cytosolic chaperonin is up-regulated during cell growth, J. Biol. Chem. 274 (1999) 37070. O.D. Lohez, C. Reynaud, F. Borel, P.R. Anderson, R.L. Margolis, Arrest of mammalian fibroblasts in G1 in response to actin inhibitin is dependent on retinoblastoma pocket proteins but not on p53, J. Cell Biol. 161 (2003) 67–77. A.M. Deutschbauer, D.F. Jaramillo, M. Proctor, J. Kumm, M.E. Hillenmeyer, R.W. Davies, C. Nislow, G. Giaever, Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast, Genetics 169 (2005) 1915–1925. A.L. Horwich, K.B. Low, W.A. Fenton, I.N. Hirshfield, K. Furtak, Folding in vivo of bacterial cytoplasmic proteins: role of GroEL, Cell 74 (1993) 909–977. K.R. Willison, H. Kubota, The structure, function and genetics of the chaperonin containing TCP-1 (CCT) in eukaryotic cytosol, The Biology of Heat Shock Proteins and Molecular Chaperones, CHS Press, N. Y., 1994 N.J. Cowan, S.A. Lewis, Type II chaperonins, prefoldin and the tubulin-specific chaperones, Adv. Protein Chem. 59 (2001) 73–104. D.W. Cleveland, K.F. Sullivan, Molecular biology and genetics of tubulin, Annu. Rev. Biochem. 54 (1985) 331–366. D.B. Vinh, D.G. Drubin, A yeast TCP-1-like protein is required for actin function in vivo, Proc. Natl. Acad. Sci. 91 (1994) 9116–9120. R. Srikakulam, D.A. Winkelmann, Myosin II folding is mediated by a molecular chaperonin, J. Biol. Chem. 274 (1999) 27265–27273. E.A. Shestakova, R.H. Singer, J. Condeelis, The physiological significance of b-actin mRNA localisation in determining cell polarity and directional motility, Proc. Natl. Acad. Sci. 98 (2001) 7045–7050.