- Email: [email protected]
Subtype B avian metapneumovirus resembles subtype A more closely than subtype C or human metapneumovirus with respect to the phosphoprotein, and second matrix and small hydrophobic proteins
Virus Research 92 (2003) 171 /178 www.elsevier.com/locate/virusres
Subtype B avian metapneumovirus resembles subtype A more closely than subtype C or human metapneumovirus with respect to the phosphoprotein, and second matrix and small hydrophobic proteins Janet Ashley Jacobs a, M. Kariuki Njenga b, Rene Alvarez a, Karen Mawditt c, Paul Britton c, Dave Cavanagh c,*, Bruce S. Seal a a
Southeast Poultry Research Laboratory, Agricultural Research Service, US Department of Agriculture, 934 College Station Road, Athens, GA 30605, USA b Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Minnesota, 1971 Commonwealth Avenue, St. Paul, MN 55108, USA c Institute for Animal Health, Compton Laboratory, Compton, Newbury RG20 7NN, UK Received 15 August 2002; received in revised form 19 December 2002; accepted 19 December 2002
Abstract Avian metapneumovirus (aMPV) subtype B (aMPV/B) nucleotide sequences were obtained for the phosphoprotein (P), second matrix protein (M2), and small hydrophobic protein (SH) genes. By comparison with sequences from other metapneumoviruses, aMPV/B was most similar to subtype A aMPV (aMPV/A) relative to the US subtype C isolates (aMPV/C) and human metapneumovirus (hMPV). Strictly conserved residues common to all members of the Pneumovirinae were identified in the predicted amino acid sequences of the P and M2 protein-predicted amino acid sequences. The Cys3-His1 motif, thought to be important for binding zinc, was also present in the aMPV M2 predicted protein sequences. For both the P and M2-1 proteinpredicted amino acid sequences, aMPV/B was most similar to aMPV/A (72 and 89% identity, respectively), having only approximately 52 and 70% identity, respectively, relative to aMPV/C and hMPV. Differences were more marked in the M2-2 proteins, subtype B having 64% identity with subtype A but 5/25% identity with subtype C and hMPV. The A and B subtypes of aMPV had predicted amino acid sequence identities for the SH protein of 47%, and less than 20% with that of hMPV. An SH gene was not detected in the aMPV/C. Phylogenetically, aMPV/B clustered with aMPV/A, while aMPV/C grouped with hMPV. # 2003 Elsevier Science B.V. All rights reserved. Keywords: Turkey rhinotracheitis virus; Paramyxovirus; Emerging diseases; Veterinary virology
1. Introduction The first documented outbreak of avian metapneumovirus (aMPV) occurred in South Africa during the late 1970s, when it caused turkey rhinotracheitis (TRT). Since then, aMPV has been isolated in Europe, Asia, Israel, and South America (reviewed by Jones, 1996; Alexander, 1997; Cook, 2000; Cook and Cavanagh, 2002). Sequence analysis of the G glycoprotein gene revealed that the known isolates, although serologically
* Corresponding author. Tel.: /44-1635-577273; fax: /44-1635577263. E-mail address: [email protected] (D. Cavanagh).
related, were of two distinct subtypes, A and B (Juhasz and Easton, 1994). Subtypes A and B predominated in the UK and continental Europe, respectively (Naylor et al., 1997), though it is now known that both subtypes were present concurrently in continental Europe (Ba¨yon-Auboyer et al., 1999; Hafez et al., 2000). Until February 1997, when aMPV was isolated from commercial turkeys in Colorado, the US had been considered aMPV-free (Senne et al., 1997). The lack of serological reactivity by Colorado isolate-infected birds with aMPV/A and aMPV/B (Cook et al., 1999), along with genomic sequence divergence of these viruses (Seal et al., 2000), indicated emergence of a new aMPV, subtype C (aMPV/C). Avian metapneumoviruses distinct genetically from the A, B, and C subtypes, and
0168-1702/03/$ - see front matter # 2003 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 3 ) 0 0 0 4 1 - 8
172
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
putatively referred to as subtype D, are now known to have been circulating in France in 1985 (Ba¨yon-Auboyer et al., 2000), and human metapneumoviruses (hMPVs) have recently been reported (van den Hoogen et al., 2001). Avian MPVs of subtypes A and B have been frequently detected in chickens (Cavanagh et al., 1999; Cook et al., 2001) and contribute to swollen head syndrome (SHS) in chickens, in conjunction with secondary bacterial infection (Jones, 1996; Alexander, 1997; Majo et al., 1997; Cook, 2000). Both subtypes have recently been detected in pheasants (Phasianus colchicus ) in the UK (Welchman et al., 2002). In turkeys aMPVs of subtypes A, B, and C cause morbidity of 90/ 100% and mortality of 0 /30%, which can rise to 90% in conjunction with secondary bacterial infection (Jones, 1996; Alexander, 1997; Cook, 2000). The disease caused by aMPV/C persists in north-central US turkey flocks (Goyal et al., 2000; Shin et al., 2002). The hMPV was first isolated from young children in The Netherlands experiencing respiratory tract infections (van den Hoogen et al., 2001), and was subsequently detected in Australia (Nissen et al., 2002) and North America (Peret et al., 2002). Pneumoviruses are members of the family Paramyxoviridae that contain a nonsegmented, negative-sense RNA genome of approximately 13/15 kb. Viruses related to aMPV include human (HRSV), bovine (BRSV), ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice (PnVM; Collins et al., 1996a,b). The gene order of subtypes A and B aMPVs is 3?-N-P-M-F-M2-SH-G-L-5? (Ling et al., 1992; Yu et al., 1992b), which is the same as that of hMPV (van den Hoogen et al., 2002) but different from that of the Pneumovirus genus (3?-NS1-NS2-N-P-M-SH-G-F-M2L-5?; Collins et al., 1996a,b). Due to its differing gene arrangement compared to Pneumovirus species, smaller polymerase gene (Randhawa et al., 1996b), and the lack of nonstructural proteins (Randhawa et al., 1997), aMPV has been proposed to be the type species of a new genus, Metapneumovirus , within the subfamily Pneumovirinae (Pringle, 1998). The whole genome of aMPV/A has been sequenced (N gene, Li et al., 1996; Randhawa et al., 1997; phosphoprotein (P), Ling et al., 1995; M, Yu et al., 1992b; F, Yu et al., 1991; second matrix protein (M2), Ling et al., 1992; Yu et al., 1992a; small hydrophobic protein (SH), Ling et al., 1992; Yu et al., 1992a; G, Ling et al., 1992; L, Randhawa et al., 1996b) but only the N (Li et al., 1996), F (Naylor et al., 1998), and G (Juhasz and Easton, 1994) genes of aMPV/B. Only the N, P (Dar et al., 2001), M, and F (Seal, 1998; Seal et al., 2000; Tarpey et al., 2001) gene sequences of aMPV/C have been published. The G gene and parts of the F and L genes of the putative subtype D have been sequenced
(Ba¨yon-Auboyer et al., 2000), as have all the genes of hAMP (van den Hoogen et al., 2001, 2002). In this paper, we report the sequence of P, M2, and SH genes of subtype B aAPV and the absence of the SH gene in aMPV/C virus. All the genes of aMPV/B, with the exception of the L gene, have now been sequenced, although a number of isolates have been investigated; there is no a contiguous sequence for one particular isolate (N gene, Li et al., 1996; M, Randhawa et al., 1996a; F, Naylor et al., 1998; G, Juhasz and Easton, 1994).
2. Materials and methods 2.1. Cells and virus strains Primary chick embryo fibroblast (CEF), VERO cells, and chick embryo tracheal organ cultures were cultured using standard techniques and aMPV isolates were propagated as reported (Alexander, 1997; Cook et al., 1999). Two subtype B aMPVs were examined, aMPV/ Hungary/6574/90/B and aMPV/UK/11/94/B, and one subtype A isolate, aMPV/UK/14-1/85/A. An aMPV/C isolate from the north-central state of Minnesota in the US along with the original Colorado isolate were also included for sequence analysis (Shin et al., 2002). 2.2. RNA extraction and RT-PCR RNA was purified by guanidinium extraction (Chirgwin et al., 1979) of aMPV-infected cells and ultracentrifugation through 5.5 M CsCl (Glisin et al., 1974). Gene-specific cDNA of aMPV/Hungary/657-4/90/B was synthesized by RT-PCR (Belyavsky et al., 1989) utilizing an oligo-dT primer (GGGAGGCCCT15) with a conserved AMPV 5? primer for each gene (N gene, GGGACAAGTIAAAATGTCTCT; P gene, GGGACAAGTIAIAATGTCITT; and M2 gene, GGACAAGTGAAGATGTCTIG), by amplification from cDNA (Seal et al., 2000). The 5? primers were designed from the PRIMER2 (Scientific Education Software) program. Amplified products were cloned using TOPOXL cloning systems (Mead et al., 1991) according to the directions of the manufacturer (Invitrogen, Inc.). Double-stranded sequencing with Taq polymerase (Applied Biosystems, Inc.) and fluorescent-labeled dideoxynucleotides was performed on at least five separate clones for each gene with an automated sequencer (Smith et al., 1986). The M2 and SH genes of aMPV/UK/11/94/B were amplified using oligonucleotides located in the flanking fusion and G glycoprotein genes: F15/B (GTGGTTAAAAAGAGGAAAGCC, located 60 nucleotides before the end of the F protein-coding sequence) and G16/B (GTCAAGCCTAAGGCTGATA, located 115 from the start of the G protein-
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
coding sequence). A 1.6 kb PCR product was sequenced initially using the same oligonucleotides, followed by walking along the gene. The 3? half of the SH gene, including the non-coding regions before the start of the G gene, was amplified and sequenced for aMPV/ Hungary/657-4/90/B and aMPV/Hungary/2/95/B, and for three subtype A isolates, aMPV/UK/14-1/85/A, aMPV/UK/61/91/A, and aMPV/South Africa/78/A.
173
The aMPV subtype C isolates shared greater sequence identity (65%) with the human isolate than with the subtypes A and B avian viruses. There was a high proportion of proline and glutamate residues in the Nterminal and C-terminal regions, respectively, of P in the B subtype virus, similar to other pneumoviruses (Ling et al., 1995). 3.2. M2 protein
2.3. Data analysis Editing of nucleotide sequences, prediction of amino acid sequences, and protein computer structure predictions were completed using GeneWorks (Accelrys, Inc.). Contiguous coding sequences of the N and P genes were aligned (Thompson et al., 1994) for those isolates available to complete phylogenetic analysis. Nucleotide sequence analysis, including determination of synonymous and nonsynonymous substitutions (Nei and Gojobori, 1986), was completed using the Molecular Evolutionary Genetics Analysis system (Kumar et al., 1993). Relationships among the Pneumovirinae were determined utilizing the Phylogenetic Analysis Using Parsimony (PAUP; Swofford, 1998) software, with Newcastle disease virus (Locke et al., 2000; Seal et al., 2002) as an outgroup (Smith, 1994) and 2000 bootstrap replications (Hedges, 1992). 2.4. Nucleotide sequence accession numbers The nucleotide sequences reported have the following GenBank accession numbers: aMPV/Hungary/657-4/90/ B */AF325442 (N gene), AF325443 (P gene), AF356650 (M2 gene); aMPV/UK/11/94/B */AJ492378 (M2 and SH genes, and M2-SH and SH-G intergenic regions); aMPV/MN8/C */AY028565 (N gene), AY028579 (P gene), AY028552 (M2 gene).
3. Results 3.1. N and P protein genes The nucleotide sequence of the N gene of aMPV/ Hungary/657-4/90/B was determined for comparative purposes. It was 98% identical to the published aMPV/ Italy/2119/88/B sequence with only 74% nucleotide sequence identity to the N gene of aMPV/A reported by Li et al. (1996). Alignment of the predicted amino acid sequences for P (Fig. 1) resulted in a 39% identity among all the metapneumovirus isolates. The A and B aMPV subtypes shared 72% identity with each other but only 53% amino acid identity with the subtype C isolates, as previously shown when subtypes A and C sequences were compared (Dar et al., 2001) and 51% identity with hMPV.
The M2 gene has two open reading frames (ORFs), M2-1 and M2-2. The subtype B M2-1 predicted amino acid sequence was 89% identical to that of aMPV/A and 70% identical to the aMPV/C or hMPV M2-1 predicted amino acid sequences (Fig. 2A). The M2-1 protein is important for transcription elongation (Collins et al., 1996a,b) as well as intergenic read-through (Ferns and Collins, 1999). Analysis of mammalian pneumoviruses has revealed a conserved Cys-X7-Cys-X5-Cys-X3-H1 zinc-binding motif in the N-terminus of M2-1, this motif being essential for function of the protein in RSV (Hardy and Wertz, 2000). All three of the aMPV subtypes examined had this zinc-binding motif (Fig. 2A). The M2-2 protein of RSV is hypothesized to be involved in the switch between RNA replication and transcription (Bermingham and Collins, 1999). A second ORF, M2-2, was identified in the aMPV/B isolate as well as in the other aPMV isolates examined (Fig. 2B), although an M2-2 protein has not been detected in cell culture among the avian pneumoviruses (Ahmadian et al., 1999). The subtype B M2-2 predicted amino acid sequence was 64% identical to that of aMPV/A but only 20 and 25% identical to the aMPV/C or hMPV M2-1 predicted amino acid sequences, respectively (Fig. 2A). 3.3. SH protein Alignment of the predicted amino acid sequences of the SH integral membrane proteins resulted in the observation that aMPV/UK/11/94/B had a one amino acid insert compared to the aMPV type A virus with a CAG encoding a glutamine residue (Q) at residue 109. This difference was confirmed by sequencing the relevant part of the SH genes of two other subtype B aMPVs and three subtype A aMPVs. The aMPV subtypes B and A predicted amino acid sequences for SH share 47% sequence identity, but have only 11% (type B) and 18% (type A) with the hPMV sequences (Fig. 3). Although the predicted amino acid sequence identities were not high, the hydropathicity plots for the predicted proteins were very similar in character, with the N-terminal being hydrophilic and a hydrophobic core (van den Hoogen et al., 2002). No SH gene was detected in the subtype C aMPV (Alvarez and Seal, unpublished observations).
174
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
Fig. 1. Predicted amino acid sequence alignment of metapneumovirus phosphoproteins (P). A dot (.) in the consensus line denotes an absence of consensus. A dot (.) in individual sequence lines indicates identity with the consensus sequence. A dash ( /) in the consensus line denotes an absence of an amino acid in the majority of the five viruses. A dash ( /) in individual sequence lines denotes an absence of an amino acid relative to the majority of the five viruses. Those amino acid residues that are strictly conserved among the Pneumovirinae , i.e. including the genus Pneumovirus , are underlined. aMPV/3BV/UK/A (Ling et al., 1995); aMPV/Hungary/B is aMPV/Hungary/6574/90/B, this report; aMPV/MN8/US/C and aMPV/CO/ US/C (Dar et al., 2001); hMPV/00-1 (van den Hoogen, 2002).
3.4. Non-coding and intergenic regions The intergenic region between the F and M2 genes comprised two nucleotides for all three aMPV subtypes: UU, GU, and UU for subtypes A, B, and C, respectively. All three subtypes had the same M2 gene start sequence, GGGACAAGU, in common with most of the other genes. The transcription termination/polyadenylation signals of the M2 gene were similar amongst the three subtypes
of aMPV: AGUUA AUUAAAAA AAA , AGUUA UAUAAAAA CAA , and AGUUA AUAAAAAA AA , for subtypes A, B, and C, respectively (identical nucleotides are italicized). In contrast, there was virtually no similarity amongst the downstream intergenic regions. Subtypes A and B had intergenic regions of the same length (25 bases) but largely different sequence: CCAA UUA AGC UAUAAG UCCAAA AA A for subtype A, and UUGA GCA GCC CCCCCG AAAAAA GA T for subtype B (identical nucleotides are italicized). The gene immedi-
Fig. 2. Predicted amino acid sequence alignment of metapneumovirus M2 proteins. (A) M2-1 sequences and (B) internal ORF M2-2 sequences. A dot (.) in the consensus lines denotes an absence of consensus. A dot (.) in individual sequence lines indicates identity with the consensus sequence. A dash ( /) in the consensus lines denotes an absence of an amino acid in the majority of the five viruses. A dash ( /) in individual sequence lines denotes an absence of an amino acid relative to the majority of the five viruses. Those amino acid residues that are strictly conserved within the Pneumovirinae are underlined while the Cys3-His1 motif residues among the M2-1 proteins of the Pneumovirinae are designated with an asterisk in (A). Conserved cysteines in (B) are marked with an asterisk. The key to the isolates is shown in the legend to Fig. 1.
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
175
Fig. 3. Predicted amino acid sequence alignment of metapneumovirus small hydrophobic (SH) integral membrane proteins. A dot (.) in the consensus line denotes an absence of consensus. A dot (.) in individual sequence lines indicates identity with the consensus sequence. A dash ( /) in the consensus line denotes an absence of an amino acid in the majority of the five viruses. A dash ( /) in individual sequence lines denotes an absence of an amino acid relative to the majority of the five viruses. Conserved cysteines are marked with an asterisk. aMPV/CVL14-1/UK/A (Ling et al., 1992); aMPV/11-94/UK/B, this report; hMPV/00-1 (van den Hoogen, 2002).
ately following the M2 gene in subtypes A and B was the SH gene. However, in the case of subtype C, the gene adjacent to the 3? end of the M2 was the G gene; no SH gene was detected. This has been confirmed by the sequencing of four subtype C isolates (Alvarez and Seal, unpublished observations). The intergenic region between the M2 and G genes of subtype C virus was UU. The transcription termination/polyadenylation signals of the SH genes of subtypes A and B aMPVs were of the same length, A UUUAAUUAAAA and A GUUAAUUAAAA , respectively (identical nucleotides are italicized), as were the SH-G intergenic regions, AGA AA GGUC and UCA GA AGAC . In the noncoding region between the SH translation stop codon and the transcription termination/polyadenylation sequence at the end of the SH gene the subtype B virus had 26 additional nucleotides. This difference was confirmed by sequencing the relevant part of the SH genes of three isolates of both subtypes B and A aMPVs.
4. Discussion The P protein is the most variable, after the G glycoprotein, among paramyxoviruses (Pringle, 1991) and this was true among the aMPV subtypes. Among the avian and human MPVs only 39% amino acid identity was shared in the P protein. Phylogenetic analysis was performed utilizing a contiguous nucleotide coding sequence of the N and P genes; aMPV/B clustered most closely with the aMPV/A (Fig. 4). As demonstrated for the M (Seal, 1998) and F (Seal et al., 2000) genes, the aMPV/C isolates separated phylogenetically distinct from subtypes A and B. Most notably, aMPV/C segregated closest to hMPV, with extremely high bootstrap confidence levels. The amino acid identity between the P proteins of aMPV/C and hMPV was almost as high (65%) as between aMPV
subtypes A and B (72%). Comparison of the M2-1 and M2-2 amino acid sequences revealed the same relationships as the P proteins. The more distant relationship of aMPV/C to subtypes A and B revealed by the gene sequencing to-date has been reflected by antigenic analysis. Antigenic differences do occur between A and B subtypes aMPV isolates, revealed by monoclonal antibodies, but they behave as one serotype in neutralization tests (Collins et al., 1993; Cook et al., 1993). Subtype C virus was found to be serologically less related to A and B subtypes (Cook et al., 1999). The SH protein is not a feature of all genera within the Paramyxoviridae; it is absent from the genomes of Respirovirus and Morbillivirus and present in Rubulavirus and Pneumovirus (Lamb et al., 2000). Although an SH gene is present in aMPVs A and B, there was only 47% amino acid identity between these subtypes and less than 20% identity with the putative SH protein of hMPV. An SH protein was not detected in aMPV/C. The SH protein of human RS virus is only about onethird of the size of that of hMPV and the A and B subtypes of aMPV, the C-terminal two-thirds being absent (van den Hoogen et al., 2002).
Acknowledgements Appreciation is extended to Joyce Bennett for nucleotide sequencing, and Melissa Scott for technical assistance. Gratitude is extended to Elizabeth Turpin for assistance with propagation of aMPV A and B subtypes in BL3Ag containment. These investigations were supported by USDA, ARS, CRIS project number 661232000-015-00D-085, US Poultry and Egg Association Grant No. 404 to BSS, Intervet, UK, and the Department of the Environment, Food and Rural Affairs (project number OD0712), UK.
176
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
Fig. 4. Phylogenetic relationships among metapneumoviruses. Following alignment of contiguous nucleotide coding sequences for the N and P genes, a rooted phylogram was generated by maximum parsimony utilizing Newcastle disease virus as an outgroup. Absolute distances are presented above each branch with bootstrap confidence levels in parentheses. HRSV, human respiratory syncytial virus; BRSV, bovine respiratory syncytial virus; PnVM, pneumonia virus of mice; NDV/B1, B1 strain of Newcastle disease virus.
References Ahmadian, G., Chambers, P., Easton, A.J., 1999. Detection and characterization of proteins encoded by the second ORF of the M2 gene of pneumoviruses. J. Gen. Virol. 80, 2011 /2016. Alexander, D.J., 1997. Newcastle disease and other Paramyxoviridae infections. In: Calnek, B.W., Barnes, H.J., Beard, C.W., McDougald, L., Saif, Y.M., Jr. (Eds.), Diseases of Poultry, 10th ed.. Iowa State University Press, Ames, IA, pp. 541 /569. Ba¨yon-Auboyer, M.H., Jestin, V., Toquin, D., Cherbonnel, M., Eterradossi, N., 1999. Comparison of F, G and N based RT PCR protocols with conventional virological procedures for the detection and typing of turkey rhinotracheitis virus. Arch. Virol. 144, 1091 /1109.
Ba¨yon-Auboyer, M.H., Arnauld, C., Toquin, D., Eterdossi, N., 2000. Nucleotide sequences of the F, L and G protein genes of two nonA/non-B avian pneumoviruses (APV) reveal a novel APV subgroup. J. Gen. Virol. 81, 2723 /2733. Belyavsky, A., Vinogradova, T., Rajewsky, K., 1989. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells. Nucleic Acids Res. 17, 2919 /2932. Bermingham, A., Collins, P.L., 1999. The M2-2 protein of human respiratory syncytial virus is a regulatory factor involved in the balance between RNA replication and transcription. Proc. Natl. Acad. Sci. USA 96, 11259 /11264. Cavanagh, D., Mawditt, K., Britton, P., Naylor, C.J., 1999. Longitudinal field studies of infectious bronchitis virus and avian pneumovirus in broilers using type-specific polymerase chain reactions. Avian Pathol. 28, 593 /605.
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178 Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J., Rutter, W.J., 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294 /5299. Collins, M.S., Gough, R.E., Alexander, D.J., 1993. Antigenic differentiation of avian pneumovirus isolates using polyclonal antisera and mouse monoclonal antibodies. Avian Pathol. 22, 469 /479. Collins, P.L., Hill, M.G., Cristina, J., Grosfeld, H., 1996a. Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus. Proc. Natl. Acad. Sci. USA 93, 81 /85. Collins, P.L., McIntosh, K., Chanock, R.M., 1996b. Respiratory syncytial virus. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, 3rd ed. (Chapter 44). Lippencott-Raven Publishers, Philadelphia, PA, pp. 1313 /1351. Cook, J.K., 2000. Avian pneumovirus infections of turkeys and chickens. Vet. J. 160, 118 /125. Cook, J.K.A., Cavanagh, D., 2002. Detection and differentiation of avian pneumoviruses (metapneumoviruses). Avian Pathol. 31, 117 /132. Cook, J.K., Jones, B.V., Ellis, M.M., Ling, L., Cavanagh, D., 1993. Antigenic differentiation of strains of turkey rhinotracheitis virus using monoclonal antibodies. Avian Pathol. 22, 257 /273. Cook, J.K., Huggins, M.B., Orbell, S.J., Senne, D.A., 1999. Preliminary antigenic characterization of an avian pneumovirus isolated from commercial turkeys in Colorado, USA. Avian Pathol. 28, 607 /617. Cook, J.K.A., Huggins, M.B., Orbell, S.J., Mawditt, K., Cavanagh, D., 2001. Infectious bronchitis virus vaccine interferes with the replication of avian pneumovirus vaccine in domestic fowl. Avian Pathol. 30, 233 /242. Dar, A.M., Munir, S., Goyal, S.M., Abrahamsen, M.S., Kapur, V., 2001. Sequence analysis of the nucleocapsid and phosphoprotein genes of avian pneumoviruses circulating in the US. Virus Res. 79, 15 /25. Ferns, R., Collins, P.L., 1999. Role of the M2-1 transcription antitermination protein of respiratory syncytial virus in sequential transcription. J. Virol. 73, 5852 /5864. Glisin, V., Crkvenjakov, R., Byers, C., 1974. Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry 13, 2633 /2637. Goyal, S.M., Chiang, S.J., Dar, A.M., Nagaraja, K.V., Shaw, D.P., Halvorson, D.A., Kapur, V., 2000. Isolation of avian pneumovirus from an outbreak of respiratory illness in Minnesota turkeys. J. Vet. Diagn. Invest. 12, 166 /168. Hafez, H.M., Hess, M., Pruss, C., Naylor, C.J., Cavanagh, D., 2000. Presence of avian pneumovirus type A in continental Europe during 1980s. J. Vet. Med. B 47, 629 /663. Hardy, R.W., Wertz, G.W., 2000. The Cys3-His1 motif of respiratory syncytial virus M2-1 protein is essential for protein function. J. Virol. 74, 5880 /5885. Hedges, S.B., 1992. The number of replications needed for accurate estimation of the bootstrap value in phylogenetic studies. Mol. Biol. Evol. 9, 366 /369. Jones, R.C., 1996. Avian pneumovirus infection: questions still unanswered. Avian Pathol. 25, 639 /648. Juhasz, K., Easton, A.J., 1994. Extensive sequence variation in the attachment (G) protein gene of avian pneumovirus: evidence for two distinct subgroups. J. Gen. Virol. 75, 2873 /2880. Kumar, S., Tamura, K., Nei, M., 1993. MEGA: Molecular Evolutionary Genetics Analysis, version 1.01. The Pennsylvania State University, University Park, PA, p. 16802. Lamb, R.A., Collins, P.L., Kolakofsky, D., Melero, J.A., Nagai, Y., Oldstone, M.B.A., Pringle, C.R., Rima, B.K., 2000. Family Paramyxoviridae. In: Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., Wickner, R.B. (Eds.), Virus Taxonomy. Academic Press, New York, pp. 827 /834.
177
Li, J., Ling, R., Randhawa, J.S., Shaw, K., Davis, P.J., Juhasz, K., Pringle, C.R., Easton, A.J., Cavanagh, D., 1996. Sequence of the nucleocapsid protein gene of subgroups A and B avian pneumoviruses. Virus Res. 41, 185 /191. Ling, R., Easton, A.J., Pringle, C.R., 1992. Sequence analysis of the 22K, SH and G genes of turkey rhinotracheitis virus and their intergenic regions reveal a gene order different from that of other pneumoviruses. J. Gen. Virol. 73, 1709 /1715. Ling, R., Davis, P.J., Yu, Q., Wood, C.M., Pringle, C.R., Cavanagh, D., Easton, A.J., 1995. Sequence and in vitro expression of the phosphoprotein gene of avian pneumovirus. Virus Res. 36, 247 / 257. Locke, D.P., Sellers, H.S., Crawford, J.M., Schultz-Cherry, S., King, D.J., Meinersmann, R.J., Seal, B.S., 2000. Newcastle disease virus phosphoprotein gene analysis and transcriptional editing in avian cells. Virus Res. 69, 55 /68. Majo, N., Gibert, X., Vilafranca, M., O’Loan, C.J., Allan, G.M., Costa, L., Pages, A., Ramis, A., 1997. Turkey rhinotracheitis virus and Escherichia coli experimental infection in chickens: histopathological, immunocytochemical and microbiological study. Vet. Microbiol. 57, 29 /40. Mead, D.A., Pey, N.K., Herrnstadt, C., Marcil, R.A., Smith, L.M., 1991. A universal method for the direct cloning of PCR amplified nucleic acid. Biotechnology 9, 657 /662. Naylor, C., Shaw, K., Britton, P., Caavanagh, D., 1997. Appearance of type B avian pneumovirus in Great Britain. Avian Pathol. 26, 327 /338. Naylor, C.J., Britton, P., Cavanagh, D., 1998. The ectodomains but not the transmembrane domains of the fusion proteins of subtypes A and B avian pneumovirus are conserved to a similar extent as those of human respiratory syncytial virus. J. Gen. Virol. 79, 1393 / 1398. Nei, M., Gojobori, T., 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3, 418 /426. Nissen, M.D., Siebert, D.J., Mackay, I.M., Sloots, T.P., Withers, S.J., 2002. Evidence of human metapneumovirus in Australian children. Med. J. Aust. 176, 188. Peret, T.C.T., Boivin, G., Li, Y., Couillard, M., Humphrey, C., Osterhaus, A.D.M.E., Erdman, D.D., Anderson, L.J., 2002. Characterization of human metapneumoviruses isolated from patients in North America. J. Infect. Dis. 185, 1660 /1663. Pringle, C.R., 1991. The genetics of paramyxoviruses. In: Kingsbury, D.W. (Ed.), The Paramyxoviruses. Plenum Press, New York, pp. 1 /32. Pringle, C.R., 1998. Virus taxonomy */San Diego, 1998. Arch. Virol. 143, 1449 /1459. Randhawa, J.S., Pringle, C.R., Easton, A.J., 1996a. Nucleotide sequence of the matrix protein gene of a subgroup B avian pneumovirus. Virus Genes 12, 179 /183. Randhawa, J.S., Wilson, S.D., Tolley, K.P., Cavanagh, D., Pringle, C.R., Easton, A.J., 1996b. Nucleotide sequence of the gene encoding the viral polymerase of avian pneumovirus. J. Gen. Virol. 77, 3047 /3051. Randhawa, J.S., Marriott, A.C., Pringle, C.R., Easton, A.J., 1997. Rescue of synthetic minireplicons establishes the absence of the NS1 and NS2 genes from avian pneumovirus. J. Virol. 71, 9849 / 9854. Seal, B.S., 1998. Matrix protein gene nucleotide and predicted amino acid sequence demonstrate that the first US avian pneumovirus isolate is distinct from European strains. Virus Res. 58, 45 /52. Seal, B.S., Sellers, H.S., Meinersmann, R.J., 2000. Fusion protein predicted amino acid sequence of the first US avian pneumovirus isolate and lack of heterogeneity among other US isolates. Virus Res. 66, 139 /147. Seal, B.S., Crawford, J.M., Sellers, H.S., Locke, D.P., King, D.J., 2002. Nucleotide sequence analysis of the Newcastle disease virus
178
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
nucleocapsid protein gene and phylogenetic relationships among the Paramyxoviridae. Virus Res. 83, 119 /129. Senne, D.A., Edson, R.K., Pederson, J.C., Panigrahy, B., 1997. Avian pneumovirus update. In: Proceedings of the 134th Annual Congress of the American Veterinary Medical Association, p. 190. Shin, H.-J., Cameron, K.T., Jacobs, J.A., Turpin, E.A., Halvorson, D.A., Goyal, S.M., Nagaraja, K.V., Kumar, M.C., Lauer, D.C., Seal, B.S., Njenga, M.K., 2002. Molecular epidemiology of subgroup C avian pneumoviruses isolated in the United States and comparison with subgroup A and B viruses. J. Clin. Microbiol. 40, 1687 /1693. Smith, A.B., 1994. Rooting molecular trees: problems and strategies. J. Linn. Soc. 51, 279 /292. Smith, L.M., Sanders, J.Z., Kaiser, R.J., Hughs, P., Dodd, C., Connell, C.R., Heines, C., Kent, S.B.H., Hood, L.E., 1986. Fluorescence detection in automated DNA sequence analysis. Nature 321, 673 /681. Swofford, D., 1998. PAUP 4.0: Phylogenetic Analysis Using Parsimony. Smithsonian Institution, Sinauer Associates, Inc, Sunderland, MA. Tarpey, I., Huggins, M.B., Davis, P.J., Shilleto, R., Orbell, S.J., Cook, J.K.A., 2001. Cloning, expression and immunogenicity of the avian pneumovirus (Colorado isolate) F protein. Avian Pathol. 30, 471 / 474. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTALW: improving the sensitivity of progressive multiple sequence align-
ment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673 /4680. van den Hoogen, B.G., de Jong, J.C., Groen, J., Kuiken, T., de Groot, R., Fouchier, R.A.M., Osterhaus, A.D.M.E., 2001. A newly discovered human pneumovirus isolated from young children with respiratory tract disease. Nature Med. 7, 719 /724. van den Hoogen, B.G., Besterbroer, T.M., Osterhaus, D.M.E., Fouchier, R.A.M., 2002. Analysis of the genome of a human metapneumovirus. Virology 295, 119 /132. Welchman, D.B., Bradbury, J.M., Cavanagh, D., Aebischer, N.J., 2002. Infectious agents associated with respiratory disease in pheasants. Vet. Rec. 150, 658 /664. Yu, Q., Davis, P.J., Barrett, T., Binns, M.M., Boursnell, M.E., Cavanagh, D., 1991. Deduced amino acid sequence of the fusion glycoprotein of turkey rhinotracheitis virus has greater identity with that of human respiratory syncytial virus, a pneumovirus, than that of paramyxoviruses and morbilliviruses. J. Gen. Virol. 72, 75 /81. Yu, Q., Davis, P.J., Brown, T.D., Cavanagh, D., 1992a. Sequence and in vitro expression of the M2 gene of turkey rhinotracheitis pneumovirus. J. Gen. Virol. 73, 1355 /1363. Yu, Q., Davis, P.J., Li, J., Cavanagh, D., 1992b. Cloning and sequencing of the matrix protein (M) gene of turkey rhinotracheitis virus reveal a gene order different from that of respiratory syncytial virus. Virology 186, 426 /434.
Subtype B avian metapneumovirus resembles subtype A more closely than subtype C or human metapneumovirus with respect to the phosphoprotein, and second matrix and small hydrophobic proteins Janet Ashley Jacobs a, M. Kariuki Njenga b, Rene Alvarez a, Karen Mawditt c, Paul Britton c, Dave Cavanagh c,*, Bruce S. Seal a a
Southeast Poultry Research Laboratory, Agricultural Research Service, US Department of Agriculture, 934 College Station Road, Athens, GA 30605, USA b Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Minnesota, 1971 Commonwealth Avenue, St. Paul, MN 55108, USA c Institute for Animal Health, Compton Laboratory, Compton, Newbury RG20 7NN, UK Received 15 August 2002; received in revised form 19 December 2002; accepted 19 December 2002
Abstract Avian metapneumovirus (aMPV) subtype B (aMPV/B) nucleotide sequences were obtained for the phosphoprotein (P), second matrix protein (M2), and small hydrophobic protein (SH) genes. By comparison with sequences from other metapneumoviruses, aMPV/B was most similar to subtype A aMPV (aMPV/A) relative to the US subtype C isolates (aMPV/C) and human metapneumovirus (hMPV). Strictly conserved residues common to all members of the Pneumovirinae were identified in the predicted amino acid sequences of the P and M2 protein-predicted amino acid sequences. The Cys3-His1 motif, thought to be important for binding zinc, was also present in the aMPV M2 predicted protein sequences. For both the P and M2-1 proteinpredicted amino acid sequences, aMPV/B was most similar to aMPV/A (72 and 89% identity, respectively), having only approximately 52 and 70% identity, respectively, relative to aMPV/C and hMPV. Differences were more marked in the M2-2 proteins, subtype B having 64% identity with subtype A but 5/25% identity with subtype C and hMPV. The A and B subtypes of aMPV had predicted amino acid sequence identities for the SH protein of 47%, and less than 20% with that of hMPV. An SH gene was not detected in the aMPV/C. Phylogenetically, aMPV/B clustered with aMPV/A, while aMPV/C grouped with hMPV. # 2003 Elsevier Science B.V. All rights reserved. Keywords: Turkey rhinotracheitis virus; Paramyxovirus; Emerging diseases; Veterinary virology
1. Introduction The first documented outbreak of avian metapneumovirus (aMPV) occurred in South Africa during the late 1970s, when it caused turkey rhinotracheitis (TRT). Since then, aMPV has been isolated in Europe, Asia, Israel, and South America (reviewed by Jones, 1996; Alexander, 1997; Cook, 2000; Cook and Cavanagh, 2002). Sequence analysis of the G glycoprotein gene revealed that the known isolates, although serologically
* Corresponding author. Tel.: /44-1635-577273; fax: /44-1635577263. E-mail address: [email protected] (D. Cavanagh).
related, were of two distinct subtypes, A and B (Juhasz and Easton, 1994). Subtypes A and B predominated in the UK and continental Europe, respectively (Naylor et al., 1997), though it is now known that both subtypes were present concurrently in continental Europe (Ba¨yon-Auboyer et al., 1999; Hafez et al., 2000). Until February 1997, when aMPV was isolated from commercial turkeys in Colorado, the US had been considered aMPV-free (Senne et al., 1997). The lack of serological reactivity by Colorado isolate-infected birds with aMPV/A and aMPV/B (Cook et al., 1999), along with genomic sequence divergence of these viruses (Seal et al., 2000), indicated emergence of a new aMPV, subtype C (aMPV/C). Avian metapneumoviruses distinct genetically from the A, B, and C subtypes, and
0168-1702/03/$ - see front matter # 2003 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 3 ) 0 0 0 4 1 - 8
172
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
putatively referred to as subtype D, are now known to have been circulating in France in 1985 (Ba¨yon-Auboyer et al., 2000), and human metapneumoviruses (hMPVs) have recently been reported (van den Hoogen et al., 2001). Avian MPVs of subtypes A and B have been frequently detected in chickens (Cavanagh et al., 1999; Cook et al., 2001) and contribute to swollen head syndrome (SHS) in chickens, in conjunction with secondary bacterial infection (Jones, 1996; Alexander, 1997; Majo et al., 1997; Cook, 2000). Both subtypes have recently been detected in pheasants (Phasianus colchicus ) in the UK (Welchman et al., 2002). In turkeys aMPVs of subtypes A, B, and C cause morbidity of 90/ 100% and mortality of 0 /30%, which can rise to 90% in conjunction with secondary bacterial infection (Jones, 1996; Alexander, 1997; Cook, 2000). The disease caused by aMPV/C persists in north-central US turkey flocks (Goyal et al., 2000; Shin et al., 2002). The hMPV was first isolated from young children in The Netherlands experiencing respiratory tract infections (van den Hoogen et al., 2001), and was subsequently detected in Australia (Nissen et al., 2002) and North America (Peret et al., 2002). Pneumoviruses are members of the family Paramyxoviridae that contain a nonsegmented, negative-sense RNA genome of approximately 13/15 kb. Viruses related to aMPV include human (HRSV), bovine (BRSV), ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice (PnVM; Collins et al., 1996a,b). The gene order of subtypes A and B aMPVs is 3?-N-P-M-F-M2-SH-G-L-5? (Ling et al., 1992; Yu et al., 1992b), which is the same as that of hMPV (van den Hoogen et al., 2002) but different from that of the Pneumovirus genus (3?-NS1-NS2-N-P-M-SH-G-F-M2L-5?; Collins et al., 1996a,b). Due to its differing gene arrangement compared to Pneumovirus species, smaller polymerase gene (Randhawa et al., 1996b), and the lack of nonstructural proteins (Randhawa et al., 1997), aMPV has been proposed to be the type species of a new genus, Metapneumovirus , within the subfamily Pneumovirinae (Pringle, 1998). The whole genome of aMPV/A has been sequenced (N gene, Li et al., 1996; Randhawa et al., 1997; phosphoprotein (P), Ling et al., 1995; M, Yu et al., 1992b; F, Yu et al., 1991; second matrix protein (M2), Ling et al., 1992; Yu et al., 1992a; small hydrophobic protein (SH), Ling et al., 1992; Yu et al., 1992a; G, Ling et al., 1992; L, Randhawa et al., 1996b) but only the N (Li et al., 1996), F (Naylor et al., 1998), and G (Juhasz and Easton, 1994) genes of aMPV/B. Only the N, P (Dar et al., 2001), M, and F (Seal, 1998; Seal et al., 2000; Tarpey et al., 2001) gene sequences of aMPV/C have been published. The G gene and parts of the F and L genes of the putative subtype D have been sequenced
(Ba¨yon-Auboyer et al., 2000), as have all the genes of hAMP (van den Hoogen et al., 2001, 2002). In this paper, we report the sequence of P, M2, and SH genes of subtype B aAPV and the absence of the SH gene in aMPV/C virus. All the genes of aMPV/B, with the exception of the L gene, have now been sequenced, although a number of isolates have been investigated; there is no a contiguous sequence for one particular isolate (N gene, Li et al., 1996; M, Randhawa et al., 1996a; F, Naylor et al., 1998; G, Juhasz and Easton, 1994).
2. Materials and methods 2.1. Cells and virus strains Primary chick embryo fibroblast (CEF), VERO cells, and chick embryo tracheal organ cultures were cultured using standard techniques and aMPV isolates were propagated as reported (Alexander, 1997; Cook et al., 1999). Two subtype B aMPVs were examined, aMPV/ Hungary/6574/90/B and aMPV/UK/11/94/B, and one subtype A isolate, aMPV/UK/14-1/85/A. An aMPV/C isolate from the north-central state of Minnesota in the US along with the original Colorado isolate were also included for sequence analysis (Shin et al., 2002). 2.2. RNA extraction and RT-PCR RNA was purified by guanidinium extraction (Chirgwin et al., 1979) of aMPV-infected cells and ultracentrifugation through 5.5 M CsCl (Glisin et al., 1974). Gene-specific cDNA of aMPV/Hungary/657-4/90/B was synthesized by RT-PCR (Belyavsky et al., 1989) utilizing an oligo-dT primer (GGGAGGCCCT15) with a conserved AMPV 5? primer for each gene (N gene, GGGACAAGTIAAAATGTCTCT; P gene, GGGACAAGTIAIAATGTCITT; and M2 gene, GGACAAGTGAAGATGTCTIG), by amplification from cDNA (Seal et al., 2000). The 5? primers were designed from the PRIMER2 (Scientific Education Software) program. Amplified products were cloned using TOPOXL cloning systems (Mead et al., 1991) according to the directions of the manufacturer (Invitrogen, Inc.). Double-stranded sequencing with Taq polymerase (Applied Biosystems, Inc.) and fluorescent-labeled dideoxynucleotides was performed on at least five separate clones for each gene with an automated sequencer (Smith et al., 1986). The M2 and SH genes of aMPV/UK/11/94/B were amplified using oligonucleotides located in the flanking fusion and G glycoprotein genes: F15/B (GTGGTTAAAAAGAGGAAAGCC, located 60 nucleotides before the end of the F protein-coding sequence) and G16/B (GTCAAGCCTAAGGCTGATA, located 115 from the start of the G protein-
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
coding sequence). A 1.6 kb PCR product was sequenced initially using the same oligonucleotides, followed by walking along the gene. The 3? half of the SH gene, including the non-coding regions before the start of the G gene, was amplified and sequenced for aMPV/ Hungary/657-4/90/B and aMPV/Hungary/2/95/B, and for three subtype A isolates, aMPV/UK/14-1/85/A, aMPV/UK/61/91/A, and aMPV/South Africa/78/A.
173
The aMPV subtype C isolates shared greater sequence identity (65%) with the human isolate than with the subtypes A and B avian viruses. There was a high proportion of proline and glutamate residues in the Nterminal and C-terminal regions, respectively, of P in the B subtype virus, similar to other pneumoviruses (Ling et al., 1995). 3.2. M2 protein
2.3. Data analysis Editing of nucleotide sequences, prediction of amino acid sequences, and protein computer structure predictions were completed using GeneWorks (Accelrys, Inc.). Contiguous coding sequences of the N and P genes were aligned (Thompson et al., 1994) for those isolates available to complete phylogenetic analysis. Nucleotide sequence analysis, including determination of synonymous and nonsynonymous substitutions (Nei and Gojobori, 1986), was completed using the Molecular Evolutionary Genetics Analysis system (Kumar et al., 1993). Relationships among the Pneumovirinae were determined utilizing the Phylogenetic Analysis Using Parsimony (PAUP; Swofford, 1998) software, with Newcastle disease virus (Locke et al., 2000; Seal et al., 2002) as an outgroup (Smith, 1994) and 2000 bootstrap replications (Hedges, 1992). 2.4. Nucleotide sequence accession numbers The nucleotide sequences reported have the following GenBank accession numbers: aMPV/Hungary/657-4/90/ B */AF325442 (N gene), AF325443 (P gene), AF356650 (M2 gene); aMPV/UK/11/94/B */AJ492378 (M2 and SH genes, and M2-SH and SH-G intergenic regions); aMPV/MN8/C */AY028565 (N gene), AY028579 (P gene), AY028552 (M2 gene).
3. Results 3.1. N and P protein genes The nucleotide sequence of the N gene of aMPV/ Hungary/657-4/90/B was determined for comparative purposes. It was 98% identical to the published aMPV/ Italy/2119/88/B sequence with only 74% nucleotide sequence identity to the N gene of aMPV/A reported by Li et al. (1996). Alignment of the predicted amino acid sequences for P (Fig. 1) resulted in a 39% identity among all the metapneumovirus isolates. The A and B aMPV subtypes shared 72% identity with each other but only 53% amino acid identity with the subtype C isolates, as previously shown when subtypes A and C sequences were compared (Dar et al., 2001) and 51% identity with hMPV.
The M2 gene has two open reading frames (ORFs), M2-1 and M2-2. The subtype B M2-1 predicted amino acid sequence was 89% identical to that of aMPV/A and 70% identical to the aMPV/C or hMPV M2-1 predicted amino acid sequences (Fig. 2A). The M2-1 protein is important for transcription elongation (Collins et al., 1996a,b) as well as intergenic read-through (Ferns and Collins, 1999). Analysis of mammalian pneumoviruses has revealed a conserved Cys-X7-Cys-X5-Cys-X3-H1 zinc-binding motif in the N-terminus of M2-1, this motif being essential for function of the protein in RSV (Hardy and Wertz, 2000). All three of the aMPV subtypes examined had this zinc-binding motif (Fig. 2A). The M2-2 protein of RSV is hypothesized to be involved in the switch between RNA replication and transcription (Bermingham and Collins, 1999). A second ORF, M2-2, was identified in the aMPV/B isolate as well as in the other aPMV isolates examined (Fig. 2B), although an M2-2 protein has not been detected in cell culture among the avian pneumoviruses (Ahmadian et al., 1999). The subtype B M2-2 predicted amino acid sequence was 64% identical to that of aMPV/A but only 20 and 25% identical to the aMPV/C or hMPV M2-1 predicted amino acid sequences, respectively (Fig. 2A). 3.3. SH protein Alignment of the predicted amino acid sequences of the SH integral membrane proteins resulted in the observation that aMPV/UK/11/94/B had a one amino acid insert compared to the aMPV type A virus with a CAG encoding a glutamine residue (Q) at residue 109. This difference was confirmed by sequencing the relevant part of the SH genes of two other subtype B aMPVs and three subtype A aMPVs. The aMPV subtypes B and A predicted amino acid sequences for SH share 47% sequence identity, but have only 11% (type B) and 18% (type A) with the hPMV sequences (Fig. 3). Although the predicted amino acid sequence identities were not high, the hydropathicity plots for the predicted proteins were very similar in character, with the N-terminal being hydrophilic and a hydrophobic core (van den Hoogen et al., 2002). No SH gene was detected in the subtype C aMPV (Alvarez and Seal, unpublished observations).
174
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
Fig. 1. Predicted amino acid sequence alignment of metapneumovirus phosphoproteins (P). A dot (.) in the consensus line denotes an absence of consensus. A dot (.) in individual sequence lines indicates identity with the consensus sequence. A dash ( /) in the consensus line denotes an absence of an amino acid in the majority of the five viruses. A dash ( /) in individual sequence lines denotes an absence of an amino acid relative to the majority of the five viruses. Those amino acid residues that are strictly conserved among the Pneumovirinae , i.e. including the genus Pneumovirus , are underlined. aMPV/3BV/UK/A (Ling et al., 1995); aMPV/Hungary/B is aMPV/Hungary/6574/90/B, this report; aMPV/MN8/US/C and aMPV/CO/ US/C (Dar et al., 2001); hMPV/00-1 (van den Hoogen, 2002).
3.4. Non-coding and intergenic regions The intergenic region between the F and M2 genes comprised two nucleotides for all three aMPV subtypes: UU, GU, and UU for subtypes A, B, and C, respectively. All three subtypes had the same M2 gene start sequence, GGGACAAGU, in common with most of the other genes. The transcription termination/polyadenylation signals of the M2 gene were similar amongst the three subtypes
of aMPV: AGUUA AUUAAAAA AAA , AGUUA UAUAAAAA CAA , and AGUUA AUAAAAAA AA , for subtypes A, B, and C, respectively (identical nucleotides are italicized). In contrast, there was virtually no similarity amongst the downstream intergenic regions. Subtypes A and B had intergenic regions of the same length (25 bases) but largely different sequence: CCAA UUA AGC UAUAAG UCCAAA AA A for subtype A, and UUGA GCA GCC CCCCCG AAAAAA GA T for subtype B (identical nucleotides are italicized). The gene immedi-
Fig. 2. Predicted amino acid sequence alignment of metapneumovirus M2 proteins. (A) M2-1 sequences and (B) internal ORF M2-2 sequences. A dot (.) in the consensus lines denotes an absence of consensus. A dot (.) in individual sequence lines indicates identity with the consensus sequence. A dash ( /) in the consensus lines denotes an absence of an amino acid in the majority of the five viruses. A dash ( /) in individual sequence lines denotes an absence of an amino acid relative to the majority of the five viruses. Those amino acid residues that are strictly conserved within the Pneumovirinae are underlined while the Cys3-His1 motif residues among the M2-1 proteins of the Pneumovirinae are designated with an asterisk in (A). Conserved cysteines in (B) are marked with an asterisk. The key to the isolates is shown in the legend to Fig. 1.
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
175
Fig. 3. Predicted amino acid sequence alignment of metapneumovirus small hydrophobic (SH) integral membrane proteins. A dot (.) in the consensus line denotes an absence of consensus. A dot (.) in individual sequence lines indicates identity with the consensus sequence. A dash ( /) in the consensus line denotes an absence of an amino acid in the majority of the five viruses. A dash ( /) in individual sequence lines denotes an absence of an amino acid relative to the majority of the five viruses. Conserved cysteines are marked with an asterisk. aMPV/CVL14-1/UK/A (Ling et al., 1992); aMPV/11-94/UK/B, this report; hMPV/00-1 (van den Hoogen, 2002).
ately following the M2 gene in subtypes A and B was the SH gene. However, in the case of subtype C, the gene adjacent to the 3? end of the M2 was the G gene; no SH gene was detected. This has been confirmed by the sequencing of four subtype C isolates (Alvarez and Seal, unpublished observations). The intergenic region between the M2 and G genes of subtype C virus was UU. The transcription termination/polyadenylation signals of the SH genes of subtypes A and B aMPVs were of the same length, A UUUAAUUAAAA and A GUUAAUUAAAA , respectively (identical nucleotides are italicized), as were the SH-G intergenic regions, AGA AA GGUC and UCA GA AGAC . In the noncoding region between the SH translation stop codon and the transcription termination/polyadenylation sequence at the end of the SH gene the subtype B virus had 26 additional nucleotides. This difference was confirmed by sequencing the relevant part of the SH genes of three isolates of both subtypes B and A aMPVs.
4. Discussion The P protein is the most variable, after the G glycoprotein, among paramyxoviruses (Pringle, 1991) and this was true among the aMPV subtypes. Among the avian and human MPVs only 39% amino acid identity was shared in the P protein. Phylogenetic analysis was performed utilizing a contiguous nucleotide coding sequence of the N and P genes; aMPV/B clustered most closely with the aMPV/A (Fig. 4). As demonstrated for the M (Seal, 1998) and F (Seal et al., 2000) genes, the aMPV/C isolates separated phylogenetically distinct from subtypes A and B. Most notably, aMPV/C segregated closest to hMPV, with extremely high bootstrap confidence levels. The amino acid identity between the P proteins of aMPV/C and hMPV was almost as high (65%) as between aMPV
subtypes A and B (72%). Comparison of the M2-1 and M2-2 amino acid sequences revealed the same relationships as the P proteins. The more distant relationship of aMPV/C to subtypes A and B revealed by the gene sequencing to-date has been reflected by antigenic analysis. Antigenic differences do occur between A and B subtypes aMPV isolates, revealed by monoclonal antibodies, but they behave as one serotype in neutralization tests (Collins et al., 1993; Cook et al., 1993). Subtype C virus was found to be serologically less related to A and B subtypes (Cook et al., 1999). The SH protein is not a feature of all genera within the Paramyxoviridae; it is absent from the genomes of Respirovirus and Morbillivirus and present in Rubulavirus and Pneumovirus (Lamb et al., 2000). Although an SH gene is present in aMPVs A and B, there was only 47% amino acid identity between these subtypes and less than 20% identity with the putative SH protein of hMPV. An SH protein was not detected in aMPV/C. The SH protein of human RS virus is only about onethird of the size of that of hMPV and the A and B subtypes of aMPV, the C-terminal two-thirds being absent (van den Hoogen et al., 2002).
Acknowledgements Appreciation is extended to Joyce Bennett for nucleotide sequencing, and Melissa Scott for technical assistance. Gratitude is extended to Elizabeth Turpin for assistance with propagation of aMPV A and B subtypes in BL3Ag containment. These investigations were supported by USDA, ARS, CRIS project number 661232000-015-00D-085, US Poultry and Egg Association Grant No. 404 to BSS, Intervet, UK, and the Department of the Environment, Food and Rural Affairs (project number OD0712), UK.
176
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
Fig. 4. Phylogenetic relationships among metapneumoviruses. Following alignment of contiguous nucleotide coding sequences for the N and P genes, a rooted phylogram was generated by maximum parsimony utilizing Newcastle disease virus as an outgroup. Absolute distances are presented above each branch with bootstrap confidence levels in parentheses. HRSV, human respiratory syncytial virus; BRSV, bovine respiratory syncytial virus; PnVM, pneumonia virus of mice; NDV/B1, B1 strain of Newcastle disease virus.
References Ahmadian, G., Chambers, P., Easton, A.J., 1999. Detection and characterization of proteins encoded by the second ORF of the M2 gene of pneumoviruses. J. Gen. Virol. 80, 2011 /2016. Alexander, D.J., 1997. Newcastle disease and other Paramyxoviridae infections. In: Calnek, B.W., Barnes, H.J., Beard, C.W., McDougald, L., Saif, Y.M., Jr. (Eds.), Diseases of Poultry, 10th ed.. Iowa State University Press, Ames, IA, pp. 541 /569. Ba¨yon-Auboyer, M.H., Jestin, V., Toquin, D., Cherbonnel, M., Eterradossi, N., 1999. Comparison of F, G and N based RT PCR protocols with conventional virological procedures for the detection and typing of turkey rhinotracheitis virus. Arch. Virol. 144, 1091 /1109.
Ba¨yon-Auboyer, M.H., Arnauld, C., Toquin, D., Eterdossi, N., 2000. Nucleotide sequences of the F, L and G protein genes of two nonA/non-B avian pneumoviruses (APV) reveal a novel APV subgroup. J. Gen. Virol. 81, 2723 /2733. Belyavsky, A., Vinogradova, T., Rajewsky, K., 1989. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells. Nucleic Acids Res. 17, 2919 /2932. Bermingham, A., Collins, P.L., 1999. The M2-2 protein of human respiratory syncytial virus is a regulatory factor involved in the balance between RNA replication and transcription. Proc. Natl. Acad. Sci. USA 96, 11259 /11264. Cavanagh, D., Mawditt, K., Britton, P., Naylor, C.J., 1999. Longitudinal field studies of infectious bronchitis virus and avian pneumovirus in broilers using type-specific polymerase chain reactions. Avian Pathol. 28, 593 /605.
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178 Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J., Rutter, W.J., 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294 /5299. Collins, M.S., Gough, R.E., Alexander, D.J., 1993. Antigenic differentiation of avian pneumovirus isolates using polyclonal antisera and mouse monoclonal antibodies. Avian Pathol. 22, 469 /479. Collins, P.L., Hill, M.G., Cristina, J., Grosfeld, H., 1996a. Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus. Proc. Natl. Acad. Sci. USA 93, 81 /85. Collins, P.L., McIntosh, K., Chanock, R.M., 1996b. Respiratory syncytial virus. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, 3rd ed. (Chapter 44). Lippencott-Raven Publishers, Philadelphia, PA, pp. 1313 /1351. Cook, J.K., 2000. Avian pneumovirus infections of turkeys and chickens. Vet. J. 160, 118 /125. Cook, J.K.A., Cavanagh, D., 2002. Detection and differentiation of avian pneumoviruses (metapneumoviruses). Avian Pathol. 31, 117 /132. Cook, J.K., Jones, B.V., Ellis, M.M., Ling, L., Cavanagh, D., 1993. Antigenic differentiation of strains of turkey rhinotracheitis virus using monoclonal antibodies. Avian Pathol. 22, 257 /273. Cook, J.K., Huggins, M.B., Orbell, S.J., Senne, D.A., 1999. Preliminary antigenic characterization of an avian pneumovirus isolated from commercial turkeys in Colorado, USA. Avian Pathol. 28, 607 /617. Cook, J.K.A., Huggins, M.B., Orbell, S.J., Mawditt, K., Cavanagh, D., 2001. Infectious bronchitis virus vaccine interferes with the replication of avian pneumovirus vaccine in domestic fowl. Avian Pathol. 30, 233 /242. Dar, A.M., Munir, S., Goyal, S.M., Abrahamsen, M.S., Kapur, V., 2001. Sequence analysis of the nucleocapsid and phosphoprotein genes of avian pneumoviruses circulating in the US. Virus Res. 79, 15 /25. Ferns, R., Collins, P.L., 1999. Role of the M2-1 transcription antitermination protein of respiratory syncytial virus in sequential transcription. J. Virol. 73, 5852 /5864. Glisin, V., Crkvenjakov, R., Byers, C., 1974. Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry 13, 2633 /2637. Goyal, S.M., Chiang, S.J., Dar, A.M., Nagaraja, K.V., Shaw, D.P., Halvorson, D.A., Kapur, V., 2000. Isolation of avian pneumovirus from an outbreak of respiratory illness in Minnesota turkeys. J. Vet. Diagn. Invest. 12, 166 /168. Hafez, H.M., Hess, M., Pruss, C., Naylor, C.J., Cavanagh, D., 2000. Presence of avian pneumovirus type A in continental Europe during 1980s. J. Vet. Med. B 47, 629 /663. Hardy, R.W., Wertz, G.W., 2000. The Cys3-His1 motif of respiratory syncytial virus M2-1 protein is essential for protein function. J. Virol. 74, 5880 /5885. Hedges, S.B., 1992. The number of replications needed for accurate estimation of the bootstrap value in phylogenetic studies. Mol. Biol. Evol. 9, 366 /369. Jones, R.C., 1996. Avian pneumovirus infection: questions still unanswered. Avian Pathol. 25, 639 /648. Juhasz, K., Easton, A.J., 1994. Extensive sequence variation in the attachment (G) protein gene of avian pneumovirus: evidence for two distinct subgroups. J. Gen. Virol. 75, 2873 /2880. Kumar, S., Tamura, K., Nei, M., 1993. MEGA: Molecular Evolutionary Genetics Analysis, version 1.01. The Pennsylvania State University, University Park, PA, p. 16802. Lamb, R.A., Collins, P.L., Kolakofsky, D., Melero, J.A., Nagai, Y., Oldstone, M.B.A., Pringle, C.R., Rima, B.K., 2000. Family Paramyxoviridae. In: Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., Wickner, R.B. (Eds.), Virus Taxonomy. Academic Press, New York, pp. 827 /834.
177
Li, J., Ling, R., Randhawa, J.S., Shaw, K., Davis, P.J., Juhasz, K., Pringle, C.R., Easton, A.J., Cavanagh, D., 1996. Sequence of the nucleocapsid protein gene of subgroups A and B avian pneumoviruses. Virus Res. 41, 185 /191. Ling, R., Easton, A.J., Pringle, C.R., 1992. Sequence analysis of the 22K, SH and G genes of turkey rhinotracheitis virus and their intergenic regions reveal a gene order different from that of other pneumoviruses. J. Gen. Virol. 73, 1709 /1715. Ling, R., Davis, P.J., Yu, Q., Wood, C.M., Pringle, C.R., Cavanagh, D., Easton, A.J., 1995. Sequence and in vitro expression of the phosphoprotein gene of avian pneumovirus. Virus Res. 36, 247 / 257. Locke, D.P., Sellers, H.S., Crawford, J.M., Schultz-Cherry, S., King, D.J., Meinersmann, R.J., Seal, B.S., 2000. Newcastle disease virus phosphoprotein gene analysis and transcriptional editing in avian cells. Virus Res. 69, 55 /68. Majo, N., Gibert, X., Vilafranca, M., O’Loan, C.J., Allan, G.M., Costa, L., Pages, A., Ramis, A., 1997. Turkey rhinotracheitis virus and Escherichia coli experimental infection in chickens: histopathological, immunocytochemical and microbiological study. Vet. Microbiol. 57, 29 /40. Mead, D.A., Pey, N.K., Herrnstadt, C., Marcil, R.A., Smith, L.M., 1991. A universal method for the direct cloning of PCR amplified nucleic acid. Biotechnology 9, 657 /662. Naylor, C., Shaw, K., Britton, P., Caavanagh, D., 1997. Appearance of type B avian pneumovirus in Great Britain. Avian Pathol. 26, 327 /338. Naylor, C.J., Britton, P., Cavanagh, D., 1998. The ectodomains but not the transmembrane domains of the fusion proteins of subtypes A and B avian pneumovirus are conserved to a similar extent as those of human respiratory syncytial virus. J. Gen. Virol. 79, 1393 / 1398. Nei, M., Gojobori, T., 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3, 418 /426. Nissen, M.D., Siebert, D.J., Mackay, I.M., Sloots, T.P., Withers, S.J., 2002. Evidence of human metapneumovirus in Australian children. Med. J. Aust. 176, 188. Peret, T.C.T., Boivin, G., Li, Y., Couillard, M., Humphrey, C., Osterhaus, A.D.M.E., Erdman, D.D., Anderson, L.J., 2002. Characterization of human metapneumoviruses isolated from patients in North America. J. Infect. Dis. 185, 1660 /1663. Pringle, C.R., 1991. The genetics of paramyxoviruses. In: Kingsbury, D.W. (Ed.), The Paramyxoviruses. Plenum Press, New York, pp. 1 /32. Pringle, C.R., 1998. Virus taxonomy */San Diego, 1998. Arch. Virol. 143, 1449 /1459. Randhawa, J.S., Pringle, C.R., Easton, A.J., 1996a. Nucleotide sequence of the matrix protein gene of a subgroup B avian pneumovirus. Virus Genes 12, 179 /183. Randhawa, J.S., Wilson, S.D., Tolley, K.P., Cavanagh, D., Pringle, C.R., Easton, A.J., 1996b. Nucleotide sequence of the gene encoding the viral polymerase of avian pneumovirus. J. Gen. Virol. 77, 3047 /3051. Randhawa, J.S., Marriott, A.C., Pringle, C.R., Easton, A.J., 1997. Rescue of synthetic minireplicons establishes the absence of the NS1 and NS2 genes from avian pneumovirus. J. Virol. 71, 9849 / 9854. Seal, B.S., 1998. Matrix protein gene nucleotide and predicted amino acid sequence demonstrate that the first US avian pneumovirus isolate is distinct from European strains. Virus Res. 58, 45 /52. Seal, B.S., Sellers, H.S., Meinersmann, R.J., 2000. Fusion protein predicted amino acid sequence of the first US avian pneumovirus isolate and lack of heterogeneity among other US isolates. Virus Res. 66, 139 /147. Seal, B.S., Crawford, J.M., Sellers, H.S., Locke, D.P., King, D.J., 2002. Nucleotide sequence analysis of the Newcastle disease virus
178
J.A. Jacobs et al. / Virus Research 92 (2003) 171 /178
nucleocapsid protein gene and phylogenetic relationships among the Paramyxoviridae. Virus Res. 83, 119 /129. Senne, D.A., Edson, R.K., Pederson, J.C., Panigrahy, B., 1997. Avian pneumovirus update. In: Proceedings of the 134th Annual Congress of the American Veterinary Medical Association, p. 190. Shin, H.-J., Cameron, K.T., Jacobs, J.A., Turpin, E.A., Halvorson, D.A., Goyal, S.M., Nagaraja, K.V., Kumar, M.C., Lauer, D.C., Seal, B.S., Njenga, M.K., 2002. Molecular epidemiology of subgroup C avian pneumoviruses isolated in the United States and comparison with subgroup A and B viruses. J. Clin. Microbiol. 40, 1687 /1693. Smith, A.B., 1994. Rooting molecular trees: problems and strategies. J. Linn. Soc. 51, 279 /292. Smith, L.M., Sanders, J.Z., Kaiser, R.J., Hughs, P., Dodd, C., Connell, C.R., Heines, C., Kent, S.B.H., Hood, L.E., 1986. Fluorescence detection in automated DNA sequence analysis. Nature 321, 673 /681. Swofford, D., 1998. PAUP 4.0: Phylogenetic Analysis Using Parsimony. Smithsonian Institution, Sinauer Associates, Inc, Sunderland, MA. Tarpey, I., Huggins, M.B., Davis, P.J., Shilleto, R., Orbell, S.J., Cook, J.K.A., 2001. Cloning, expression and immunogenicity of the avian pneumovirus (Colorado isolate) F protein. Avian Pathol. 30, 471 / 474. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTALW: improving the sensitivity of progressive multiple sequence align-
ment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673 /4680. van den Hoogen, B.G., de Jong, J.C., Groen, J., Kuiken, T., de Groot, R., Fouchier, R.A.M., Osterhaus, A.D.M.E., 2001. A newly discovered human pneumovirus isolated from young children with respiratory tract disease. Nature Med. 7, 719 /724. van den Hoogen, B.G., Besterbroer, T.M., Osterhaus, D.M.E., Fouchier, R.A.M., 2002. Analysis of the genome of a human metapneumovirus. Virology 295, 119 /132. Welchman, D.B., Bradbury, J.M., Cavanagh, D., Aebischer, N.J., 2002. Infectious agents associated with respiratory disease in pheasants. Vet. Rec. 150, 658 /664. Yu, Q., Davis, P.J., Barrett, T., Binns, M.M., Boursnell, M.E., Cavanagh, D., 1991. Deduced amino acid sequence of the fusion glycoprotein of turkey rhinotracheitis virus has greater identity with that of human respiratory syncytial virus, a pneumovirus, than that of paramyxoviruses and morbilliviruses. J. Gen. Virol. 72, 75 /81. Yu, Q., Davis, P.J., Brown, T.D., Cavanagh, D., 1992a. Sequence and in vitro expression of the M2 gene of turkey rhinotracheitis pneumovirus. J. Gen. Virol. 73, 1355 /1363. Yu, Q., Davis, P.J., Li, J., Cavanagh, D., 1992b. Cloning and sequencing of the matrix protein (M) gene of turkey rhinotracheitis virus reveal a gene order different from that of respiratory syncytial virus. Virology 186, 426 /434.