- Email: [email protected]
Sudden infant death syndrome due to parainfluenza virus 2 associated with hemophagocytic syndrome
Journal of Infection (2004) 49, 329–332
www.elsevierhealth.com/journals/jinf
CASE REPORT
Sudden infant death syndrome due to parainfluenza virus 2 associated with hemophagocytic syndrome Yasuyo Kashiwagia,*, Hisashi Kawashimaa, Yuki Kanetakaa, Hiroaki Ioia, Kouji Takekumaa, Akinori Hoshikaa, Jun Matsubayashib, Kiyoshi Mukaib a
Department of Pediatrics, Tokyo Medical University, 6-7-1 Nishishinjuku, Shinjuku-ku, Tokyo 160-0023, Japan b Department of Pathology, Tokyo Medical University, Tokyo 160-0023, Japan Accepted 4 October 2003 Available online 14 November 2003
KEYWORDS Sudden infant death syndrome (SIDS); Parainfluenza virus type 2 (PIV2); Hemophagocytic syndrome (HPS)
Summary We report a child with Sudden Infant Death Syndrome (SIDS), aged 16 months. The histological findings of tonsils, spleen, and bone marrow revealed many hemophagocytic cells. Parainfluenza virus type 2 (PIV2) was cultured in the nasopharynx and detected by reverse-transcription (RT)-PCR in liver tissue and bone marrow. His laboratory data of elevated level of ferritin and IL-6 suggested hemophagocytic syndrome (HPS). It is suspected that PIV2 infection in infants is a risk factor for SIDS. Q 2003 The British Infection Society. Published by Elsevier Ltd. All rights reserved.
Introduction The causes of Sudden Infant Death Syndrome (SIDS) are unknown. There are many reports suggesting that respiratory viral infection is associated with some cases of SIDS.1,2 Shu et al. reported that 11 of 45 (24.4%) SIDS cases were positive in respiratory viral infection by non-isotopic in situ hybridization (NISH) compared to 1 of 30 (3.3%) non-SIDS cases.3 In the 11 cases which were positive, there were eight cases of adenovirus type 5, two of respiratory syncytial virus (RSV), and one case of parainfluenza virus type 2. *Corresponding author. Tel.: þ 81-3-3344-0643; fax: þ81-33342-6111. E-mail address: [email protected]
Human parainfluenza viruses (PIV) type 1, 2, 3 and 4 are medically important respiratory pathogens which can cause severe lower respiratory tract illness in infants and young children. PIV are distributed world-wide and infections caused by them are common. Most people contract their first infection early in childhood and repeat infections can occur throughout life. PIV is not severe in healthy children over 3 or 4 years of age and adults, though severe lower respiratory tract infection is caused in immunocompromised patients.4 We report a SIDS male infant aged 16 months. The histological findings of his bone marrow revealed many hemophagocytic cells. PIV type 2 (PIV2) was cultured in the nasopharynx and detected by reverse transcription (RT)-PCR in his autopsy materials—liver tissue and bone marrow.
0163-4453/$30.00 Q 2003 The British Infection Society. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.jinf.2003.10.002
330
Y. Kashiwagi et al.
Case report A 16 month old male infant was transported to our institute because of cardio pulmonary arrest. He was the product of a normal pregnancy and vaginal delivery. His birth weight was normal and he was healthy until this episode. He had showed symptoms of mild cold the day before admission. At the time he consulted another clinic, he had high fever and sudden genetic tonic convulsion started. On the way to our institute, his breath and heart stopped. Five minutes later, his breath and heart recovered by resuscitation. On arrival at our institute, his conscious level was 300/3-3-9, and blood pressure was low. His laboratory data is shown in Table 1. Blood culture, antigen of influenza virus, Adenovirus, Rota virus and RS virus were all negative. After 8 h, the patient’s white blood cell count and haemoglobin decreased from 7300 ml21 and 12 g/dl which was counted at admission to 3100 ml21 and 9.9 g/dl, respectively, and the platelet count from 12.4 £ 104 ml21 to 2.7 £ 104 ml21. The patient’s initial serum ferritin concentration and IL-6 was 6380 ng/ml and 827 pg/ml, respectively. Though he was treated in intensive care including hypothermia therapy and steroid pulse therapy, he died after 20 h. An autopsy was done within 12 h. Samples from various organs (brain, heart, lung, liver, spleen, kidney and bone marrow) were obtained during autopsy. Severe brain edema was found and histological findings revealed many hemophagocytic cells in tonsils, spleen, and bone marrow (Fig. 1). PIV2 was positive by conventional viral culture in the nasopharynx. For PIV2 RT-PCR, total RNA was extracted from the clinical samples using Qiamp RNA Mini Kit (Qiagen, Japan). The RNA samples were resuspected in 20 ml of TE. The oligonucleotide primers were chosen from conserved regions of
Table 1 Laboratory data on admission. WBC 7300 ml21 RBC 589 £ 104 ml21 Hb 14.7 g/dl PLT 12.4 £ 104 ml21 NH3 67 mg/dl Blood analysis (artery) pH 7.200 pO2 113.9 mmHg pCO2 53.6 mmHg HCO3 20.5 mmol/l BE 27.7 mmol/l CRP ,0.3 mg/dl
AST ALT LDH TP T-Bil BUN
272 U/l 38 U/l 2647 U/l 5.0 g/dl 0.22 mg/dl 26.8 mg/dl
Glu CPK Na K TG Tcho
53 mg/dl 135 IU/l 137 mEq/l 5.2 mEq/l 88 mg/dl 28 mg/dl
Cerebrospinal fluid Cell count 3/3 Protein 14 g/dl Glu 121 mg/dl
Ferritin 6380 ng/ml IL-6 827 pg/ml TNF-a 5 pg/ml
Normal range; ferritin 27–320 ng/ml; IL-6 ,4 pg/ml.
the hemagglutinin-neuraminidase gene. RNA was reverse-transcribed to cDNA with AMV reversetranscriptase (Life Sciences, St Petersburg, FL), using PIP2 þ primer (50 AACAATCTGCTGCAGCATTT30 ) for 1 h at 42 8C. First PCR was done with Taq DNA polymerase (TaKaRa, Tokyo) with a set of PIP2 þ and PIP2 2 primer (50 ATGTCAGACAATGGGCAAAT30 ). Nested PCR was performed with PIS2 þ (5 0 CCATTTACCTAAGTGATGGAAT30 ) and PIS2 2 primer(5 0 GCCCTGTTGTATTTGGAAGAGA3 0 ) with amplified 161 bp nucleotides between the primers. PCR was done during 32 cycles of denaturation (94 8C for 1 min), annealing (55 8C for 1 min), and extension (72 8C for 1 min). PCR products were electrophoresed through 3% agarose gel (NuSieve 3:1, FMC Bioproducts, Rockland, ME) and were stained with ethidium bromide. RT-PCR was positive in liver tissue and bone marrow. Positive PCR products were purified and a direct sequence was carried out on a DYEnamic Direct Cycle Sequencing kit with 7-deaza-dGTP (Amersham, USA). Nucleotide sequence was analyzed with a 4200G DNA sequencer (LI-COR, USA).
Discussion Various hypotheses to explain SIDS have been postulated, maternal smoking, absence of breast feeding, winter peak, prone sleeping position and poor socio-economic situation of the family etc. While no causes have been clearly identified, there are several evidences suggesting that respiratory viral infections are related in some cases of SIDS5— influenza virus,6 RS virus,3 Rhinovirus,7 Adenovirus,3 Cytomegalovirus,8 Rota virus,9 Enterovirus10 and PIV. It has been suggested that virus infections with bacterial toxins and/or maternal smoking etc. might induce cytokine activity. Blackwell et al.11 suggested uncontrolled cytokine responses might lead to unexplained deaths. PIV are non-segmented RNA viruses that belong to the Paramyxovirus (PIV type 1 and PIV type 3) and Rubulavirus (PIV type 2 and PIV type 4) genera of the family Paramyxoviridae.12 PIV are important respiratory pathogens and are major causes of croup, bronchiolitis, and pneumonia in infants and very young children.13 They have been estimated to be the cause of 40% of acute respiratory tract illnesses in children.14 The diagnosis of PIV infections is difficult because the clinical symptoms are similar to other pathogens. Viral isolation and serology are used for the diagnosis of PIV, but those are not rapid. Direct antigen detection methods are widely used and rapid, but their results
SIDS due to PIV2 associated with HPS
331
Figure 1 Many hemophagocytic cells were found in bone marrow ( £ 200 HE stain).
are variable sensitivities on the virus.15 For a rapid and sensitive detection of PIV, RT-PCR assays have been shown with expected high sensitivity.16 In the present case, PIV2 was isolated by conventional viral culture in the nasopharynx. RTPCR for PIV2 was positive in bone marrow and liver tissue. In positive PCR products, PIV2 was identified by direct sequencing. It was reported that only mild inflammatory changes were found and significant necropsy findings were absent in SIDS.17 In the present case, severe brain oedema was found and his histological findings in tonsils, spleen, and bone marrow revealed many hemophagocytic cells. We supposed that his diagnosis was hemophagocytic syndrome (HPS) caused by infection of PIV2. His laboratory data findings—cytopenia in at least two cell lines and elevated level of ferritin and IL-6—suggested HPS. Very few cases about the association between HPS and SIDS have been reported. Gauvin et al.18 reported two cases of HPS presented as a component of multiple organ dysfunction syndrome and Chen et al.19 reported a series of 10 cases of fulminant HPS, but all patients died within 2 – 3 weeks. In HPS, T-cell activation leads to secondary macrophage activation20 and this abnormal immune response is induced by various triggering factors such as viral or bacterial infections. Although the pathogenesis of the central nerve system lesions in HPS remains unclear, the role of hypercytokininemia by abnormal immune response is suspected to
be important.21 We suspected that he was infected by PIV2 and it triggered HPS and CNS involvement. This report is a first case of fatal HPS caused by PIV2 and it is suspected that PIV2 infection in infants is a risk factor in SIDS.
References 1. Csukas Z, Rozgonyi F, Toro K, Sotonyi P, Jankovics I. Potential role of microbiological agents in sudden infant death syndrome. Acta Micro et Immuno Hungaria 1998;45: 341—8. 2. Patrick WJA, Carrington D, Armstrong AA, et al. Eight year study of viral isolates from cot deaths in Glasgow. Scot Med J 1989;34:462—4. 3. An SF, Gould S, Keeling JW, Fleming KA. Role of respiratory viral infection in SIDS: detection of viral nucleic acid by in situ hybridization. J Pathol 1993;171:271—8. 4. Jarvis WR, Middleton PJ, Gelfand EW. Parainfluenza pneumonia in severe combined immunodeficiency disease. J Pediatr 1979;94:423—5. 5. Raza MW, Caroline Blackwell C. Sudden infant death syndrome, virus infections and cytokines. FEMA Immunol Med Microbiol 1999;25:85—96. 6. Nelson KE, Greenberg MA, Mufson MA, Moses VK. The sudden infant death syndrome and epidemic viral disease. Am J Epidemiol 1975;101:423—30. 7. Las Heras J, Swanson VL. Sudden death of an infant with rhinovirus infection complicating bronchial asthma: case report. Pediatr Pathol 1983;1:319—23. 8. Bajonwoski T, Wiegand P, Pring-Akerblon P, Adrian T, Jorch G, Brinkmann B. Detection and significance of adenoviruses in cases of sudden infant death. Virchows Arch 1996;428: 113—8. 9. Bettiol SS, Radcliff FJ, Hunt AL, Goldsmid JM. Bacterial flora
332
of Tasmanian SIDS infants with special reference to pathogenic strains of Escherichia coli. Epidemiol Infect 1994;112: 275—84. 10. Shimizu C, Rambaud C, Cheron G, Rouzioux C, Lozinski GM, Rao A, Stanway G, Krous HF, Burns JC. Molecular identification of viruses in sudden infant death associated with myocarditis and pericarditis. Pediatr Infect Dis J 1995;14: 548—88. 11. Blackwell CC, Weir DM, Busuttil A, Saadi AT, Essery SD, Raza MW, James VS, Mackenzie DAC. The role of infectious agents in sudden infant death syndrome. FEMS Immunol Med Microbiol 1994;9:91—100. 12. Murphy FA, Fauquet CM, Bishop DHL, Ghabrial SA, Jawis AW, Martelli GP, Mayo MA, Summers MD, editors. Virus taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses. Arch. Virol. Suppl, 10.; 1995. p. 1—586. 13. Vainionpaa R, Hyypia T. Biology of parainfluenza viruses. Clin Microbiol Rev 1994;7:265—75. 14. Reed G, Jewett PH, Thompson J, Tollefson S, Wright PF. Epidemiology and clinical impact of parainfluenza virus infections in otherwise healthy infants and young children ,5 years old. J Infect Dis 1997;175:807—13. 15. Henrickson KJ. Human parainfluenza viruses. In: Lennette
Y. Kashiwagi et al.
16.
17.
18.
19.
20. 21.
EH, Lennette DA, Lennette ET, editors. Diagnostic Procedures for Viral, Rickettsial, and Chlamydial Infection. 7th ed. Washington, DC: American Public Health Association; 1995. p. 481—94. Echevarria JE, Erdman DD, Swierkosz EM, Holloway BP, Anderson LJ. Simultaneous detection and identification of human parainfluenza viruses 1, 2, and 3 from clinical samples by multiplex PCR. J Clin Microbiol 1998;36:1388—91. Naeye RL, Fisher R, Rubin HR, Demers L. Selected hormone levels in victims of sudden infant death syndrome. Paediatrics 1980;65:1134—6. Gauvin F, Toledano B, Champagne J, Lacroix J. Reactive hemophagocytic syndrome presenting as a component of multiple organ dysfunction syndrome. Crit Care Med 2000; 28(9):3341—5. Chen RL, Su IJ, Lin KH, et al. Fulminant childhood hemophagocytic syndrome mimicking histiocytic medullary reticulosis—an atypical form of Epstein—Barr virus infection. Am J Clin Pathol 1991;96:171—6. Streiffer RH. Severe neutropenia and infectious mononucleosis. Brief report. J Miss State Med Assoc 1984;25:295—7. Imashuku S. Differential diagnosis of hemophagocytic syndrome: underlying disorders and selection of the most effective treatment. Int J Hematol 1997;66:135—51.
www.elsevierhealth.com/journals/jinf
CASE REPORT
Sudden infant death syndrome due to parainfluenza virus 2 associated with hemophagocytic syndrome Yasuyo Kashiwagia,*, Hisashi Kawashimaa, Yuki Kanetakaa, Hiroaki Ioia, Kouji Takekumaa, Akinori Hoshikaa, Jun Matsubayashib, Kiyoshi Mukaib a
Department of Pediatrics, Tokyo Medical University, 6-7-1 Nishishinjuku, Shinjuku-ku, Tokyo 160-0023, Japan b Department of Pathology, Tokyo Medical University, Tokyo 160-0023, Japan Accepted 4 October 2003 Available online 14 November 2003
KEYWORDS Sudden infant death syndrome (SIDS); Parainfluenza virus type 2 (PIV2); Hemophagocytic syndrome (HPS)
Summary We report a child with Sudden Infant Death Syndrome (SIDS), aged 16 months. The histological findings of tonsils, spleen, and bone marrow revealed many hemophagocytic cells. Parainfluenza virus type 2 (PIV2) was cultured in the nasopharynx and detected by reverse-transcription (RT)-PCR in liver tissue and bone marrow. His laboratory data of elevated level of ferritin and IL-6 suggested hemophagocytic syndrome (HPS). It is suspected that PIV2 infection in infants is a risk factor for SIDS. Q 2003 The British Infection Society. Published by Elsevier Ltd. All rights reserved.
Introduction The causes of Sudden Infant Death Syndrome (SIDS) are unknown. There are many reports suggesting that respiratory viral infection is associated with some cases of SIDS.1,2 Shu et al. reported that 11 of 45 (24.4%) SIDS cases were positive in respiratory viral infection by non-isotopic in situ hybridization (NISH) compared to 1 of 30 (3.3%) non-SIDS cases.3 In the 11 cases which were positive, there were eight cases of adenovirus type 5, two of respiratory syncytial virus (RSV), and one case of parainfluenza virus type 2. *Corresponding author. Tel.: þ 81-3-3344-0643; fax: þ81-33342-6111. E-mail address: [email protected]
Human parainfluenza viruses (PIV) type 1, 2, 3 and 4 are medically important respiratory pathogens which can cause severe lower respiratory tract illness in infants and young children. PIV are distributed world-wide and infections caused by them are common. Most people contract their first infection early in childhood and repeat infections can occur throughout life. PIV is not severe in healthy children over 3 or 4 years of age and adults, though severe lower respiratory tract infection is caused in immunocompromised patients.4 We report a SIDS male infant aged 16 months. The histological findings of his bone marrow revealed many hemophagocytic cells. PIV type 2 (PIV2) was cultured in the nasopharynx and detected by reverse transcription (RT)-PCR in his autopsy materials—liver tissue and bone marrow.
0163-4453/$30.00 Q 2003 The British Infection Society. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.jinf.2003.10.002
330
Y. Kashiwagi et al.
Case report A 16 month old male infant was transported to our institute because of cardio pulmonary arrest. He was the product of a normal pregnancy and vaginal delivery. His birth weight was normal and he was healthy until this episode. He had showed symptoms of mild cold the day before admission. At the time he consulted another clinic, he had high fever and sudden genetic tonic convulsion started. On the way to our institute, his breath and heart stopped. Five minutes later, his breath and heart recovered by resuscitation. On arrival at our institute, his conscious level was 300/3-3-9, and blood pressure was low. His laboratory data is shown in Table 1. Blood culture, antigen of influenza virus, Adenovirus, Rota virus and RS virus were all negative. After 8 h, the patient’s white blood cell count and haemoglobin decreased from 7300 ml21 and 12 g/dl which was counted at admission to 3100 ml21 and 9.9 g/dl, respectively, and the platelet count from 12.4 £ 104 ml21 to 2.7 £ 104 ml21. The patient’s initial serum ferritin concentration and IL-6 was 6380 ng/ml and 827 pg/ml, respectively. Though he was treated in intensive care including hypothermia therapy and steroid pulse therapy, he died after 20 h. An autopsy was done within 12 h. Samples from various organs (brain, heart, lung, liver, spleen, kidney and bone marrow) were obtained during autopsy. Severe brain edema was found and histological findings revealed many hemophagocytic cells in tonsils, spleen, and bone marrow (Fig. 1). PIV2 was positive by conventional viral culture in the nasopharynx. For PIV2 RT-PCR, total RNA was extracted from the clinical samples using Qiamp RNA Mini Kit (Qiagen, Japan). The RNA samples were resuspected in 20 ml of TE. The oligonucleotide primers were chosen from conserved regions of
Table 1 Laboratory data on admission. WBC 7300 ml21 RBC 589 £ 104 ml21 Hb 14.7 g/dl PLT 12.4 £ 104 ml21 NH3 67 mg/dl Blood analysis (artery) pH 7.200 pO2 113.9 mmHg pCO2 53.6 mmHg HCO3 20.5 mmol/l BE 27.7 mmol/l CRP ,0.3 mg/dl
AST ALT LDH TP T-Bil BUN
272 U/l 38 U/l 2647 U/l 5.0 g/dl 0.22 mg/dl 26.8 mg/dl
Glu CPK Na K TG Tcho
53 mg/dl 135 IU/l 137 mEq/l 5.2 mEq/l 88 mg/dl 28 mg/dl
Cerebrospinal fluid Cell count 3/3 Protein 14 g/dl Glu 121 mg/dl
Ferritin 6380 ng/ml IL-6 827 pg/ml TNF-a 5 pg/ml
Normal range; ferritin 27–320 ng/ml; IL-6 ,4 pg/ml.
the hemagglutinin-neuraminidase gene. RNA was reverse-transcribed to cDNA with AMV reversetranscriptase (Life Sciences, St Petersburg, FL), using PIP2 þ primer (50 AACAATCTGCTGCAGCATTT30 ) for 1 h at 42 8C. First PCR was done with Taq DNA polymerase (TaKaRa, Tokyo) with a set of PIP2 þ and PIP2 2 primer (50 ATGTCAGACAATGGGCAAAT30 ). Nested PCR was performed with PIS2 þ (5 0 CCATTTACCTAAGTGATGGAAT30 ) and PIS2 2 primer(5 0 GCCCTGTTGTATTTGGAAGAGA3 0 ) with amplified 161 bp nucleotides between the primers. PCR was done during 32 cycles of denaturation (94 8C for 1 min), annealing (55 8C for 1 min), and extension (72 8C for 1 min). PCR products were electrophoresed through 3% agarose gel (NuSieve 3:1, FMC Bioproducts, Rockland, ME) and were stained with ethidium bromide. RT-PCR was positive in liver tissue and bone marrow. Positive PCR products were purified and a direct sequence was carried out on a DYEnamic Direct Cycle Sequencing kit with 7-deaza-dGTP (Amersham, USA). Nucleotide sequence was analyzed with a 4200G DNA sequencer (LI-COR, USA).
Discussion Various hypotheses to explain SIDS have been postulated, maternal smoking, absence of breast feeding, winter peak, prone sleeping position and poor socio-economic situation of the family etc. While no causes have been clearly identified, there are several evidences suggesting that respiratory viral infections are related in some cases of SIDS5— influenza virus,6 RS virus,3 Rhinovirus,7 Adenovirus,3 Cytomegalovirus,8 Rota virus,9 Enterovirus10 and PIV. It has been suggested that virus infections with bacterial toxins and/or maternal smoking etc. might induce cytokine activity. Blackwell et al.11 suggested uncontrolled cytokine responses might lead to unexplained deaths. PIV are non-segmented RNA viruses that belong to the Paramyxovirus (PIV type 1 and PIV type 3) and Rubulavirus (PIV type 2 and PIV type 4) genera of the family Paramyxoviridae.12 PIV are important respiratory pathogens and are major causes of croup, bronchiolitis, and pneumonia in infants and very young children.13 They have been estimated to be the cause of 40% of acute respiratory tract illnesses in children.14 The diagnosis of PIV infections is difficult because the clinical symptoms are similar to other pathogens. Viral isolation and serology are used for the diagnosis of PIV, but those are not rapid. Direct antigen detection methods are widely used and rapid, but their results
SIDS due to PIV2 associated with HPS
331
Figure 1 Many hemophagocytic cells were found in bone marrow ( £ 200 HE stain).
are variable sensitivities on the virus.15 For a rapid and sensitive detection of PIV, RT-PCR assays have been shown with expected high sensitivity.16 In the present case, PIV2 was isolated by conventional viral culture in the nasopharynx. RTPCR for PIV2 was positive in bone marrow and liver tissue. In positive PCR products, PIV2 was identified by direct sequencing. It was reported that only mild inflammatory changes were found and significant necropsy findings were absent in SIDS.17 In the present case, severe brain oedema was found and his histological findings in tonsils, spleen, and bone marrow revealed many hemophagocytic cells. We supposed that his diagnosis was hemophagocytic syndrome (HPS) caused by infection of PIV2. His laboratory data findings—cytopenia in at least two cell lines and elevated level of ferritin and IL-6—suggested HPS. Very few cases about the association between HPS and SIDS have been reported. Gauvin et al.18 reported two cases of HPS presented as a component of multiple organ dysfunction syndrome and Chen et al.19 reported a series of 10 cases of fulminant HPS, but all patients died within 2 – 3 weeks. In HPS, T-cell activation leads to secondary macrophage activation20 and this abnormal immune response is induced by various triggering factors such as viral or bacterial infections. Although the pathogenesis of the central nerve system lesions in HPS remains unclear, the role of hypercytokininemia by abnormal immune response is suspected to
be important.21 We suspected that he was infected by PIV2 and it triggered HPS and CNS involvement. This report is a first case of fatal HPS caused by PIV2 and it is suspected that PIV2 infection in infants is a risk factor in SIDS.
References 1. Csukas Z, Rozgonyi F, Toro K, Sotonyi P, Jankovics I. Potential role of microbiological agents in sudden infant death syndrome. Acta Micro et Immuno Hungaria 1998;45: 341—8. 2. Patrick WJA, Carrington D, Armstrong AA, et al. Eight year study of viral isolates from cot deaths in Glasgow. Scot Med J 1989;34:462—4. 3. An SF, Gould S, Keeling JW, Fleming KA. Role of respiratory viral infection in SIDS: detection of viral nucleic acid by in situ hybridization. J Pathol 1993;171:271—8. 4. Jarvis WR, Middleton PJ, Gelfand EW. Parainfluenza pneumonia in severe combined immunodeficiency disease. J Pediatr 1979;94:423—5. 5. Raza MW, Caroline Blackwell C. Sudden infant death syndrome, virus infections and cytokines. FEMA Immunol Med Microbiol 1999;25:85—96. 6. Nelson KE, Greenberg MA, Mufson MA, Moses VK. The sudden infant death syndrome and epidemic viral disease. Am J Epidemiol 1975;101:423—30. 7. Las Heras J, Swanson VL. Sudden death of an infant with rhinovirus infection complicating bronchial asthma: case report. Pediatr Pathol 1983;1:319—23. 8. Bajonwoski T, Wiegand P, Pring-Akerblon P, Adrian T, Jorch G, Brinkmann B. Detection and significance of adenoviruses in cases of sudden infant death. Virchows Arch 1996;428: 113—8. 9. Bettiol SS, Radcliff FJ, Hunt AL, Goldsmid JM. Bacterial flora
332
of Tasmanian SIDS infants with special reference to pathogenic strains of Escherichia coli. Epidemiol Infect 1994;112: 275—84. 10. Shimizu C, Rambaud C, Cheron G, Rouzioux C, Lozinski GM, Rao A, Stanway G, Krous HF, Burns JC. Molecular identification of viruses in sudden infant death associated with myocarditis and pericarditis. Pediatr Infect Dis J 1995;14: 548—88. 11. Blackwell CC, Weir DM, Busuttil A, Saadi AT, Essery SD, Raza MW, James VS, Mackenzie DAC. The role of infectious agents in sudden infant death syndrome. FEMS Immunol Med Microbiol 1994;9:91—100. 12. Murphy FA, Fauquet CM, Bishop DHL, Ghabrial SA, Jawis AW, Martelli GP, Mayo MA, Summers MD, editors. Virus taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses. Arch. Virol. Suppl, 10.; 1995. p. 1—586. 13. Vainionpaa R, Hyypia T. Biology of parainfluenza viruses. Clin Microbiol Rev 1994;7:265—75. 14. Reed G, Jewett PH, Thompson J, Tollefson S, Wright PF. Epidemiology and clinical impact of parainfluenza virus infections in otherwise healthy infants and young children ,5 years old. J Infect Dis 1997;175:807—13. 15. Henrickson KJ. Human parainfluenza viruses. In: Lennette
Y. Kashiwagi et al.
16.
17.
18.
19.
20. 21.
EH, Lennette DA, Lennette ET, editors. Diagnostic Procedures for Viral, Rickettsial, and Chlamydial Infection. 7th ed. Washington, DC: American Public Health Association; 1995. p. 481—94. Echevarria JE, Erdman DD, Swierkosz EM, Holloway BP, Anderson LJ. Simultaneous detection and identification of human parainfluenza viruses 1, 2, and 3 from clinical samples by multiplex PCR. J Clin Microbiol 1998;36:1388—91. Naeye RL, Fisher R, Rubin HR, Demers L. Selected hormone levels in victims of sudden infant death syndrome. Paediatrics 1980;65:1134—6. Gauvin F, Toledano B, Champagne J, Lacroix J. Reactive hemophagocytic syndrome presenting as a component of multiple organ dysfunction syndrome. Crit Care Med 2000; 28(9):3341—5. Chen RL, Su IJ, Lin KH, et al. Fulminant childhood hemophagocytic syndrome mimicking histiocytic medullary reticulosis—an atypical form of Epstein—Barr virus infection. Am J Clin Pathol 1991;96:171—6. Streiffer RH. Severe neutropenia and infectious mononucleosis. Brief report. J Miss State Med Assoc 1984;25:295—7. Imashuku S. Differential diagnosis of hemophagocytic syndrome: underlying disorders and selection of the most effective treatment. Int J Hematol 1997;66:135—51.