SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumor-suppressor functions

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

CAN13113_proof ■ 16 November 2016 ■ 1/11

Cancer Letters xxx (2016) 1e11

Contents lists available at ScienceDirect

Cancer Letters journal homepage: www.elsevier.com/locate/canlet

Original Article

Q4 Q3

SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumor-suppressor functions Liu Mei a, Lianwen Yuan b, Wei Shi a, Shihao Fan a, Chao Tang a, Xueying Fan a, Wanlei Yang c, Yu Qian c, Musaddique Hussain a, Ximei Wu a, * a b c

Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058, China Department of Geriatric Surgery, Second Xiangya Hospital, Central South University, Changsha 410011, China Department of Orthopedics, Shaoxing People's Hospital, Zhejiang University, Shaoxing 312000, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 30 August 2016 Received in revised form 5 November 2016 Accepted 7 November 2016

Large tumor suppressor (Lats) plays a critical role in maintaining cellular homeostasis and is the core to mediate Hippo growth-inhibitory signaling pathway. SUMOylation is a reversible and dynamic process that regulates a variety of cell functions. Here, we show that SUMOylation of Lats1 affects its kinase activity specifically towards Hippo signaling. Small ubiquitin-like modifier (SUMO) 1 interacts with and directly SUMOylates Lats1, whereas loss of SUMOylation pathway function disrupts Lats1 SUMOylation. Among potential SUMOylation sites on hLats1, K751 and K830 are conversed and essential for maintaining the transcriptional output of Hippo signaling, whereas K751 mutation more significantly abolishes SUMO1-induced Lats1 SUMOylation than K830 mutation. Though Lats1 SUMOylation at K751 affects neither its subcellular distribution nor its interactions with YAP and TAZ, it significantly destabilizes the phosphorylated Lats1 (Thr1079 but not Ser909), resulting in the attenuation of Lats1 kinase activity and inhibition of Hippo signaling. Moreover, HepG2 hepatocellular carcinoma cells express significantly more SUMOylated Lats1 than LO2 normal human hepatic cells, and in HepG2 cells or HepG2 cells xenografts, Lats1 SUMOylation at K751 consistently attenuates Lats1 kinase activity and subsequently suppresses Hippo signaling, resulting in not only the promotion of cell proliferation and colony formation but also the suppression of cell apoptosis. Together, we demonstrate that Lats1 SUMOylation at K751 suppresses its kinase activity and subsequently attenuates its tumor-suppressor functions. Thus, this study provides additional insight into how Hippo signaling is regulated and highlights the potentially critical role of Lats1 SUMOylation in tumor development. © 2016 Elsevier Ireland Ltd. All rights reserved.

Keywords: SUMOylation Lats1 Hippo signaling Tumor suppressor

Introduction Large tumor suppressor (Lats) originally identified as a homolog of Drosophila tumor-suppressor Lats belongs to serine/threonine kinases and plays a critical role in maintaining cellular homeostasis

Abbreviations: SUMO, Small ubiquitin-like modifier; Lats, large tumor suppressor; YAP, Yes-associated protein; TAZ, transcriptional co-activator with PDZ-binding motif; Tead, TEA domain transcription factor; CTGF, connective tissue growth factor; CYR61, cysteine-rich angiogenic inducer 61; SAE2, SUMO-1 activating enzyme subunit 2; WT, wild type; Ubc9, ubiquitin conjugating enzyme 9; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CHX, cycloheximide; PTEN, phosphatase and tensin homolog deleted on chromosome 10. * Corresponding author. Department of Pharmacology, School of Medicine, Zhejiang University, No. 866, Yuhangtang Road, Hangzhou 310058, China. Fax: þ86 571 8898 1121. E-mail address: [email protected] (X. Wu).

in metazoans ranging from Drosophila to humans [1,2]. Lats1
/
mice not only exhibit a lack of mammary gland development, infertility, and growth retardation, but also develop soft-tissue sarcomas and ovarian stromal cell tumors and are highly sensitive to carcinogenic treatments [3]. Both Lats1 and Lats2 are involved in mediating Hippo (Hpo) growth-inhibitory signaling pathway. The core to Hippo pathway is a kinase cascade, wherein Ste20-like kinases, Mst1/2, phosphorylate and activate the Lats1/2, and Lats1/2 kinases in turn phosphorylate two major downstream effectors, Yes-associated protein (YAP) and transcriptional coactivator with PDZ-binding motif (TAZ), resulting in their ubiquitination and proteolytic degradation [4,5]. On the other hand, silence of Hippo signaling enhances nuclear location of YAP and TAZ which subsequently bind to TEA domain transcription factors (Tead)1/4 and other transcription factors to promote transcription of target genes, such as connective tissue growth factor (CTGF) and

http://dx.doi.org/10.1016/j.canlet.2016.11.009 0304-3835/© 2016 Elsevier Ireland Ltd. All rights reserved.

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CAN13113_proof ■ 16 November 2016 ■ 2/11

2

L. Mei et al. / Cancer Letters xxx (2016) 1e11

cysteine-rich angiogenic inducer 61 (CYR61) [4,5]. The Hippo signaling plays crucial roles in not only contact inhibition and organ size control but also cancer development [5]. Accumulating evidence has suggested that the Hippo pathway is dysregulated in a variety of malignancies [5e7], and up-regulated YAP/TAZ expression or nuclear accumulation of YAP/TAZ has been observed in many types of tumors including liver, breast, lung, colon, ovary, and others [8e10]. SUMO (small ubiquitin-related modifier) proteins are ubiquitinlike proteins with molecular weights of ~10 kD, and SUMOylation is an evolutionarily conserved ubiquitin-like posttranslational modification of target proteins [11,12]. Human genome encodes four SUMO family proteins, SUMO1-4, and these small molecular weight proteins are covalently attached to substrate lysine residues via an enzymatic cascade analogous to protein ubiquitination [12,13]. Like other posttranslational modifications, SUMOylation is a reversible and dynamic process that regulates the subcellular localization, activity, interaction, and stability of target proteins responsible for a variety of cell functions [11e13]. Many components of the SUMO machinery are highly expressed in cancer tissues, and activated SUMOylation is closely related to tumor growth [14]. Knockdown of the SUMO E1 subunit SUMO-1 activating enzyme subunit 2 (SAE2) potently impairs colon cancer growth in mice, suggesting the functional relevance of SUMOylation for tumor growth [15]. Except that SUMO E1 enzyme is essential for Myc-driven tumors in mice, low SAE levels in patients with Myc-dependent breast cancer correlate closely to longer metastasis-free survival [16]. In the present study, we have identified that Lats1 SUMOylation at Lys751 residue attenuates its kinase activity and subsequently reduces its tumor-suppressor functions. Our data provide the first conclusive evidence that Lats1 SUMOylation contributes to the development of cancer. Materials and methods

Medium; after the diluted DNA and diluted Lipofectamine 2000 reagent were combined, the mixture was and incubated for 30 min at room temperature followed by transfection. For each transfection, 0.6 ml Opti-MEM I Medium was added to the transfection complex, then, the mixture was added to the cells cultured in 0.8 ml/ well of serum-free growth medium. Cells were incubated at 37  C in a CO2 incubator for 6 h. After that, 1.6 ml/well of growth medium containing 20% FCS were added and the cells were incubated for further 24e48 h followed by various treatments. Cytosolic and nuclear fractionation, immunoprecipitation and western blot Cells were washed three times in phosphate buffered saline (PBS) and lysed in RIPA lysis buffer (Beyotime) supplemented with 20 mM N-ethylmaleimide (Sigma), protease inhibitor mixture (Sigma). The cytosolic and nuclear fractions of cells were prepared by using NE-PER Nuclear and Cytoplasmic Extraction Reagents (ThermoScientific, Waltham, MA) as per the manufacturer's instructions. b-tubulin and Histone H3 were used as the internal standards for the cytosolic and nuclear fractions, respectively. In co-immunoprecipitation experiments cells were lysed in RIPA lysis buffer, and cell lysates were cleared by centrifugation at 14,000 g at 4  C for 20 min. The resulting supernatant was subjected to immunoprecipitation with antiMyc antibody overnight at 4  C, then, 40 ml protein A/G PLUS-Agarose were added overnight at 4  C. The agarose beads were washed three times in lysis buffer and the bound proteins were eluted in SDS-PAGE loading buffer. The samples were subjected to SDS-PAGE, followed by western blot as described previously [9,19]. ImageJ software from National Institutes of Health (http://rsb.info.nih.gov/ij/download.html) was used to quantify the immunoreactive bands. Immunoreactive signals from target proteins were normalized to their respective internal standards including bactin, GAPDH, and histone H3, immunoreactive signals from phosphorylated proteins were normalized to their respective total proteins. The mean intensity of the first band was set to 1. Dual-luciferase assays Transient transfection and dual-luciferase assay were performed as described previously [9,19]. Cells were seeded in 24-well plates overnight to reach 70e80% confluence before transfection, 1.5 ml Lipofectamine 2000 reagent, 0.1 mg Lats1 construct, 0.2 mg Tead4 luciferase reporter construct, and 0.04 mg pRL-null expressing Renilla luciferase were used for transfection for 6 h. After that, cells were cultured in fresh growth medium for further 48 h. Then, cells were harvested for the dual-luciferase assay as per manufacturer's instruction (Promega, Madison, WI). Firefly luciferase activity was normalized to Renilla luciferase activity, respectively.

Plasmids Human SUMO1 open reading frame was amplified by PCR using 50 -CGGGATCCATGTCTGACCAGGAGGCAAAACCT-30 as the forward primer and 50 -GGGGTACCCTAAACTGTTGAATGACCCCC-30 as the reverse primer. The PCR product was digested and cloned into the BamHI and KpnI sites of either pXJ40-Flag or pXJ40-Myc expression plasmids (Stratagene, La Jolla, CA). Flag-tagged hLats1, Myc-tagged hLats1, HA-tagged hLats1, Flag-hMst2, Flag-hYAP, HA-hTAZ, and Tead4-luciferase constructs were gifted from Dr. Bin Zhao at Zhejiang University Life Science Institute [17,18]. Point mutations of Lats1 and SUMO1 were introduced by using a KODplus- mutagenesis kit (Toyobo, Osaka, Japan) according to the manufacturer's instructions and were verified by nucleic acid sequencing.

In vitro Lats1 SUMOylation assays Expression of Lats1-WT and Lats1-K751R recombinant proteins was performed by using pBAD in TOP 10 F0 Escherichia coli as per manufacturer's instructions (ThermoScientific). Top 10 F0 recombinant protein expression was induced with Larabinose followed by purification of the His-tagged proteins with a Ni2þ-nitriloacetic acid-agarose affinity column, concentrated by a centrifugal filter, and dissolved in a buffer containing 10 mM Tris (pH 7.0) and 1 mM EDTA. Purified Lats1-WT and Lats1-K751R proteins were used with an in vitro SUMOylation kit (Enzo Life Sciences, Farmingdale, NY) as per the manufacturer's protocol. SUMOylation reactions were incubated at 4  C or 37  C for 60 min, after termination, proteins were subjected to SDS-PAGE followed by western blot with Lats1 antibody.

Cell lines and reagents HEK293T, LO2 normal human hepatic cells, HepG2 human hepatocellular carcinoma cells and Chinese hamster ovary (CHO) cells were purchased from ATCC (Manassas, VA) and cultured in Dulbecco's Modified Eagle Medium supplemented with 10% fetal calf serum (FCS, Hyclone, South Logan, UT). All cell lines were incubated at 37  C with 5% CO2. The following antibodies were purchased as specified: anti-Lats1, anti-phospho Lats1(T1079), anti-phospho Lats1(S909), anti-YAP, antiphospho-YAP(S127), and anti-phospho-YAP(S397) were from Cell Signaling Technology (Danvers, MA); anti-TAZ (sc-48805), anti-phospho-TAZ(Ser89, sc-17610), anti-SUMO1 (sc-9060), anti-Myc, anti-b-actin, anti-Histone H3, anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and anti-rabbit IgG were from Santa Cruz Biotechnology (Santa Cruz, CA); anti-Flag and anti-HA were from Sigma (St Louis, MO) and Beyotime Institute of Biotechnology (Shanghai, China), respectively. The IRDye 680 and 800 second antibodies were from LI-COR Bioscience (Lincoln, Nebraska), whereas cycloheximide (CHX) was purchased from Selleck Chemicals (Houston, TX). Transient transfections Transient transfections were performed by using Lipofectamine 2000 reagent (Life Technologies, Carlsbad, CA) as described previously [9,19]. Briefly, cells were seeded overnight to reach 60e70% confluence before transfection. The transfection complex for a well of 6-well plates was prepared as follows: 0.8e1.6 mg DNA were diluted in 100 ml Opti-MEM I Reduced-Serum Medium (Life technologies), and 2.0e8.0 ml Lipofectamine 2000 reagent were diluted in 100 ml of Opti-MEM I

Immunofluorescent staining After transfection, cells were seeded on coverslips and fixed with 4% paraformaldehyde in neutralized PBS for 15 min followed by permeabilization with 0.1% Triton X-100 for 1 min. Then, cells were washed thoroughly with PBS-Tween (PBST) and blocked with 1% bovine serum albumin for 1 h at room temperature followed by incubation with primary antibody for 1 h. Cells were washed three times with PBST and then incubated with Alexa Fluor 488- or Alexa Fluor 546-tagged secondary antibody (Life Technologies). After washing with PBST, the nuclei were counterstained with 40 ,6-diamidino-2-phenylindole (DAPI). The imagination was performed under a Zeiss fluorescent microscope equipped with an epifluorescence and Axiocam camera system and coupled with axiovision software (Carl Zeiss, Oberkochen, Germany). Quantitative RT-PCR assays Total RNA was extracted using TRIzol reagent (Takara Biotechnology, Dalian, China). Messenger RNA levels of CTGF and CYR61 were determined by quantitative RT-PCR as described previously [9,20]. The relative amounts of each mRNA level were normalized to GAPDH levels, and the differences in mRNA levels were calculated by 2
DDCt method. The primers were designed as follows: GCCCAGACCC AACTATGATTAG (CTGF forward primer) and TCTCCGTACATCTTCCTGTAGT (CTGF reverse primer); GACTGTGAAGATGCGGTTCC (CYR61 forward primer) and CTGTAGAAGGGAAACGCTGC (CYR61 reverse primer).

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CAN13113_proof ■ 16 November 2016 ■ 3/11

L. Mei et al. / Cancer Letters xxx (2016) 1e11 Cell proliferation, colony formation, and apoptosis After transfection, cells were seeded into 96-well plates and cultured for 3 days. Cellular vitality was measured every day by cell counting kit-8 kits (Beyotime) as per manufacturer's instructions. The cytotoxicity (%) ¼ [1
(OD from tested cells)/OD from control cells]*100%, the vitality from cells transfected with empty vector is defined as 1. Establishment of cells stably expressing wild type and mutant Lats1 was performed as described previously [9,21]. Empty vector, Myc-tagged Lats1-WT or Myc-tagged Lats1-K751R was transfected into HepG2 cells. After transfection, cells were selected in the growth medium containing G418 (600 mg/ml; Sigma) for 2 weeks. Cells were diluted and re-plated in 96-well plates at a density of 1 cell/well. The highly Flag-expressing clones were expanded and stored for the following experiments. Clone formation assays were performed as previously described [9,21]. Briefly, cells stably expressing empty vector, Lats1-wild type or Lats1-K751R were seeded in 6-well plates at a density of 1000 cells/well and the medium was carefully changed every 2 days for two weeks. Then, cell colonies were stained with 0.5% crystal violet in 2% ethanol and counted by Clono-Counter software as described previously [9,21]. Apoptosis was examined in the monoplast suspension stained with an Annexin VFITC/PI apoptosis assay kit (Life Techanologies) as per manufacturer's instruction. All samples were analyzed with a FACS calibur flow cytometer (BD, Franklin Lakes, NJ). Mice with xenografts expressing wild type and mutant Lats1 Mouse models bearing HepG2cells xenografts expressing empty vector, wild type (WT) Lats1, Lats1 mutant (K751R) were generated as previously described [9,21]. Briefly, 0.1 ml of Flag-, Flag-Lats1(WT), Flag-Lats1(K751R) stably expressing, HepG2 cells at a density of 1  107 cells/ml were subcutaneously inoculated into left armpit of adult nude mice (n ¼ 10) (SLAC Laboratory Animal Co., Ltd., Shanghai, China). Xenografts started to emerge 15 days after inoculation, and the xenograft volumes were recorded every three days within 36-d. The volume of xenografts at different times was calculated by the formula (V) ¼ (a þ b)  (a)  (b)  (0.2618), *V: xenograft volume; a: short diameter; b: long diameter. Mice were sacrificed on day 40 and the xenografts were harvested for imaging, preparation of protein lysates, isolation of total RNA, and paraffin-embedded histological sections. All mice were housed at Zhejiang University Animal Care Facility according to the institutional guidelines for laboratory animals and the protocol was approved by the Zhejiang University Institutional Animal Care and Use Committee. Ki67 and TUNEL assays Ki67 and TUNEL assays were performed as previously described [9,21]. Xenografts were subjected to preparation of paraffin-embedded tumor tissue sections, and the sections were processed for immunohistochemistry analysis for Ki67 by Ki67 Cell Proliferation Kit (Sangon Biotech, Shanghai, China) and TUNEL staining by One-Step TUNEL assay (Beyotime). The images were captured by Olympus fluorescence microscope, and further analyzed by ImageJ 1.48v software. Histological sections were cut and processed for TUNEL staining. Statistical analysis Numerical data were expressed as mean ± SD, and statistical analyses were performed by one-way ANOVA and TukeyeKramer multiple comparison tests (GraphPad Software Inc., La Jolla, CA). p < 0.05 and p < 0.01 were considered to be statistically significant. Experiments were repeated three times and representative experiments are shown.

Results Lats1 is SUMOylated by SUMO1 To determine the interaction between Lats1 and SUMO1, we performed co-immunoprecipitation assays and immunofluorescent staining. In intact HEK293T (293T) cells, though protein complexes precipitated with a control IgG contained no detectable ~140 kD of SUMOylated Lats1, protein complexes precipitated with a Lats1 antibody obviously contained SUMOylated Lats1 (Fig. 1A), suggesting that SUMOylation possibly occurs between the endogenous SUMO1 and Lats1. This notion is further supported by our immunofluorescent findings showing that both Lats1- (red) (in the web version) and SUMO1- (green) derived immunosignals were robustly detectable, and that an apparent overlapping signal (yellow) was readily observed in the cytoplasm of CHO cells (Fig. 1B). Moreover, in 293T cells transiently expressing Flag-SUMO1 (WT) and Myc-Lats1 (~150 kD), protein complexes precipitated with a Myc antibody contained a predicated ~160 kD of SUMOylated MycLats1 (Fig. 1C), further suggesting that Lats1 interacts with SUMO1

3

and is possibly SUMOylated by SUMO1. SUMO1 conjugation to target proteins involves its carboxy-terminal glycine residue, G97, and a single amino acid substitution (G97A) of SUMO1 is sufficient to disrupt the conjugation to target substrates [22]. Consistently, in 293T cells transiently expressing Flag-SUMO1 (G97A) and MycLats1, mutation of SUMO1 led to a robust diminishment of SUMOylated Myc-Lats1 in protein complexes precipitated by a Myc antibody (Fig. 1C), suggesting that Lats1 is specifically SUMOylated by SUMO1. Finally, SUMO1 conjugation to target proteins involves not only the G97 residue of SUMO1 but also ubiquitin conjugating enzymes 9 (Ubc9), an E2-like enzyme specific for SUMO1 [23]. Ubc9 siRNA markedly reduced the expression of Ubc9 as compared with the scramble siRNA in 293T cells, and protein complexes precipitated with a Myc antibody contained more SUMOylated Myc-Lats1 in 293T cells expressing Myc-lats1, SUMO1 and scramble siRNA than in 293T cells expressing Myc-lats1, SUMO1 and Ubc9 siRNA (Fig. 1D). Thus, these data suggest that Lats1 interacts with SUMO1 and is possibly SUMOylated by SUMO1. Lats1 SUMOylation affects the activity of Hippo signaling SUMO1 conjugation to target proteins involves not only the G97 residue on SUMO1 but also a lysine (K) residue on the target protein [23,24]. The SUMOylation consensus motif is generally identified as a lysine residue immediately preceded by a hydrophobic amino acid (j) and followed by a variable residue (X) and a glutamic acid residue (E), though this widely accepted consensus motif (jKXE) is not inclusive of all described SUMO1 conjugation sites [24]. Computer analysis of the hLats1 sequence revealed several conserved SUMOylation consensus motifs including amino acids 48e51 (AKAE), 504e507 (LKPE), 621e624 (KKDE), 698e701 (AKMD), 750e753 (VKAE), and 829e832 (IKPD) (Fig. 2A). To determine whether these potential SUMOylation sites are involved in Lats1 SUMOylation that contributes to the regulation of Hippo signaling, we substituted arginine (R) residue for these lysine (K) residues in hLats1 and performed the Tead4-luciferase assays in 293T cells. Wild type of Lats1 (WT) decreased Tead4-luciferase activity by 20%, whereas Lats1 mutants including K49R, K505R, K622R, and K699R did not significantly affect Tead4-luciferase activities in comparison with WT (Fig. 2B). Unexpectedly, the K751R mutant reduced Tead4luciferase activity by 50%, whereas the K830R mutant increased Tead4-luciferase activity by 115% in comparison with WT (Fig. 2B). Co-immunoprecipitation was performed to determine whether SUMO1 SUMOylates Lats1 at K751 and K830. In 293T cells expressing Myc-tagged Lats1 or mutants, protein complexes precipitated with a Myc antibody contained abundant WT, K49R, K506R, K622R, K699R, moderate K830R, and least K751R (Fig. 2C). Likewise, in 293T cells expressing Myc-tagged SUMO1 and Flagtagged Lats1 or mutants, protein complexes precipitated with a Myc antibody contained abundant WT, moderate K830R, and least K751R either (Fig. 2C). Thus, K751 is utmostly SUMOylated by SUMO1 in comparison with K830. To determine whether Lats1 is indeed SUMOylated at K751, we performed the in vitro SUMOylation assays. Though the SUMOylated Lats1 was readily detected in the Lats1 recombinant protein-containing reaction mixture with E1, E2, and SUMO1 and incubated at 37  C, the SUMOylated Lats1 was not detectable in the reaction mixture lacking E1, E2, or SUMO1 or incubated at 4  C, and was significantly reduced when K751 was mutated (Fig. 2E and F). Taken together, SUMO1 directly SUMOylates Lats1 on K751, resulting in suppression of Hippo signaling. Lats1 SUMOylation at K751 attenuates its kinase activity In order to examine the kinase activity of Lats1 after SUMOylation at K751, we transfected 293T cells with vector, Myc-tagged

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CAN13113_proof ■ 16 November 2016 ■ 4/11

4

L. Mei et al. / Cancer Letters xxx (2016) 1e11

Fig. 1. SUMO1 interacts with and SUMOylates Lats1. (A) SUMO1 interacts with Lats1 in 293T cells. 293T cells were subjected to preparation of cell lystes, and the protein samples were precipitated with a control IgG or Lats1 antibody. The precipitated protein complex was subjected to SDS-PAGE followed by western blot by using SUMO1 and Lats1 antibodies. (B) SUMO1 interacts with Lats1 in CHO cells. CHO cells were immunostained with Lats1 and SUMO1 antibodies followed by incubation with Alexa Fluor 488- or Alexa Fluor 546tagged secondary antibody, then, the nuclei were counterstained with DAPI, and the imagination was performed under fluorescent microscope. (C) SUMO1 SUMOylates Lats1. 293T cells were transfected with Myc-tagged wild type Lats1 (WT) in combination with either SUMO1 (WT) or SUMO1 mutant (G97A) for 6 h. 24 h after transfection, cells were harvested for preparation of cell lysates and are subjected to co-immunoprecipitation with control IgG or Myc antibody. The immunoprecipitated samples and supernatants of cell lysates were subjected to SDS-PAGE followed by western blot by SUMO1 or Myc antibody. (D) Ubc9 knockdown attenuates Lats1 SUMOylation. 293T cells were transfected with Myc-tagged wild type Lats1 (WT) in combination with SUMO1in the presence of scramble or Ubc9 siRNA for 6 h. 24 h after transfection, cells were harvested for preparation of cell lysates and are subjected to co-immunoprecipitation with control IgG or Myc antibody. The immunoprecipitated samples and supernatants of cell lysates were subjected to SDS-PAGE followed by western blot by SUMO1, Myc Ubc9 or GAPDH antibodies.

WT or Myc-tagged K751R. Expectedly, overexpression of WT robustly increased the corresponding phosphorylation levels of Ser909 and Thr1079 in ~150 kD exogenous Lats1, whereas overexpression of WT affected neither the protein levels of ~130 kD endogenous Lats1 and ~150 kD endogenous Lats2 nor the phosphorylation levels of Ser909 and Thr1079 in endogenous Lats1 and of Ser84 in endogenous Lats2 (Fig. 3A). Interestingly, K751R increased significantly more phosphorylation levels of Thr1079 in exogenous Lats1 than WT, whereas K751R affected neither the protein levels of endogenous Lats1 and Lats2 nor the phosphorylation levels of Ser909 in exogenous Lats1, of Ser909 and Thr1079 in endogenous Lats1, and of Ser84 in endogenous Lats2 in comparison with WT (Fig. 3A). Likewise, K751R affected neither the protein levels of ~60 kD endogenous Mst1/2 nor the phosphorylation levels

of Thr183/Thr180 in endogenous Mst1/2 in comparison with WT (Fig. 3B). Thus, Lats1 SUMOylation at K751 attenuates its kinase activity through decreasing the phospho-Lats1 (Thr1079). To investigate the roles of Lats1 SUMOylation at K751 in suppression of Hippo signaling, we determined the phosphorylation levels of TAZ and YAP. WT slightly increased the phosphorylation levels of Ser127 and Ser397 in ~65 kD endogenous YAP and of Ser89 in ~44 kD endogenous TAZ, but did not obviously affect the levels of endogenous YAP and TAZ (Fig. 3B). However, K751R significantly increased phosphorylation levels of Ser127 and Ser397 in endogenous YAP and of Ser89 in endogenous TAZ, and markedly reduced the levels of endogenous YAP and TAZ in comparison with WT (Fig. 3B). Since Lats1 inhibits YAP and TAZ by phosphorylating and sequestering YAP and TAZ in the cytosol, and

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CAN13113_proof ■ 16 November 2016 ■ 5/11

L. Mei et al. / Cancer Letters xxx (2016) 1e11

5

Fig. 2. SUMOylation of Lats1 affects the activity of Hippo signaling. (A) Potential SUMOylation sites in hLats1 predicted by SUMOsp and seeSUMO software. (B) Mutation of potential SUMOylation sites in hLats1 affects the Tead4-luciferase activity. 293T cells were transfected with wild type Lats1 (WT) or Lats1 mutants in combination with Tead4-luciferase reporter and pRL-null constructs. Cells were then cultured in fresh growth medium for further 48 h followed by dual-luciferase assays. Firefly luciferase activity was normalized to Renilla luciferase activity. (C, D) Mutation of potential SUMOylation sites in hLats1 decreases the SUMOylation of Lats1. 293T cells were transfected with SUMO1 in combination with wild type Lats1, K49R, K505R, K622R, K699R, K751R, K830R, K751R or K830R mutant for 6 h. 24 h after transfection, cells were subjected to coimmunoprecipitation with Myc antibody followed by western blot by using Flag, Myc, SUMO1 antibodies. (E, F) SUMO1 directly SUMOylates Lats1. In vitro SUMOylation assays were performed in Lats1 (WT or/and K751R) recombinant protein-containing reaction mixture containing E1, E2, and SUMO1 and incubated at 37  C or 4  C for 60 min, then, the reaction mixtures were subjected to SDS-PAGE followed by western blot by using Lats1 antibody. Numerical data were expressed as mean ± SD (each n ¼ 4), **p < 0.01 versus cells transfected with vector, þþ p < 0.01 versus cells transfected with WT.

loss of Lats1 causes elevated nuclear accumulation of YAP and TAZ [5,17,18]. We further determined the cytosolic and nuclear levels of TAZ and YAP in 293T cells transiently expression vector, WT or K751R. WT markedly reduced nuclear YAP levels but slightly decreased nuclear TAZ levels, and significantly increased cytosolic YAP but not TAZ levels; however, K751R more robustly negated nuclear YAP and TAZ levels and more significantly increased cytosolic YAP and TAZ levels than WT (Fig. 3C). Furthermore, immunofluorescence indicated that WT was distributed in the same patterns as K751R in 293T cells (Fig. 3D), suggesting that Lats1 SUMOylation at K751 affects neither the subcellular distribution nor the protein level of Lats1. Consistent with western results, immunofluorescence indicated that WT markedly reduced nuclear YAP and TAZ and increased cytosolic YAP and TAZ, whereas K751R further negated nuclear YAP and TAZ and increased cytosolic YAP and TAZ in comparison to WT (Fig. 3D). Thus, Lats1 SUMOylation at K751 attenuates its kinase activity, resulting in suppression of Hippo signaling.

Lats1 SUMOylation at K751 stabilizes the phospho-Lats1 (Thr1079) To explore the mechanism by which Lats1 SUMOylation at K751 suppresses Hippo signaling, we next examined the interactions between K751R and YAP/TAZ and the stability of K751R and phospho-K751R (Thr1079). In 293T cells transfected with Myc-WT or Myc-K751R in the presence of Flag-YAP and HATAZ, protein complexes precipitated with a Myc antibody contained almost the same levels of Flag-YAP and HA-TAZ (Fig. 4A). After transfection with Myc-tagged WT or K751R in the presence of pCIG (GFP expression for monitoring the transfection efficiency), we treated 293T cells with CHX to block the biosynthesis of protein. Both WT and K751R were time-dependently degraded within 12 h, and the degraded rates of WT were similar to those of K751R at different time points (40% versus 40% at 12 h) (Fig. 4B). Notably, phosphorylation of WT at Thr1079 was time-dependently degraded within 12 h, whereas phosphorylation of K751R at Thr1079 exhibited a time-dependent

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CAN13113_proof ■ 16 November 2016 ■ 6/11

6

L. Mei et al. / Cancer Letters xxx (2016) 1e11

Fig. 3. K751R enhances the kinase activity and activates Hippo signaling. (A and B) Effects of k751R on exogenous and endogenous Mst1/2, Lats1/2, YAP, and TAZ activities. 24 h after transfection with vector, Myc-Lats1 or Myc-K751R mutant, 293T cells were subjected to preparation of cell lysates followed by western blots to detect the levels of exogenous pLats1(T1079, S909) and Myc, respectively, and the levels of endogenous p-Mst1/2(T183 for Mst1 and T180 for Mst2), Mst2, p-Lats1(T1079), p-Lats1(S909), Lats1, p-Lats2(S83), Lats2, p-YAP(S127, S347), p-TAZ(S89), YAP, TAZ, and b-actin, respectively. (C) Effects of k751R on nuclear and cytosolic distribution of YAP and TAZ. 24 h after transfection with vector or Myc-tagged wild type of Lats1 and K751R mutant, 293T cells were subjected to preparation of cytosolic and nuclear fractions. Then, the protein samples were subjected to western blots by using the Myc, YAP, and TAZ antibodies, and the a-tubulin and Histone H3 were used as the internal standards for the cytosolic and nuclear fractions, respectively. (D) Mutation of K751 affects the subcellular localization of not the Lats1 but the YAP and TAZ. 293T cells were transfected with HA-tagged vector, WT or K751R and Flag-tagged YAP or TAZ and immunostained with HA and Flag antibodies followed by incubation with Alexa Fluor 488- and 546-tagged secondary antibody, then, the nuclei were counterstained with DAPI, and the imagination was performed under confocal fluorescence microscope.

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CAN13113_proof ■ 16 November 2016 ■ 7/11

L. Mei et al. / Cancer Letters xxx (2016) 1e11

7

Fig. 4. K751R stabilizes the phospho-Lats1 and activates Hippo signaling. (A) The binding of WT and K751R mutant to YAP and TAZ. 24 h after transfection with Flag-YAP and HATAZ in the presence of vector, Myc-tagged Lats1 or K751R mutant, 293T cells were harvested for preparation of cell lysates followed by immunoprecipitation by using Myc antibody. Then, the protein samples were subjected to western blots by Flag, HA, and Myc antibodies. (B) Cyclohexmide chase analysis of WT and K751R mutant degradation. After transfection with Myc-tagged WT or K751R in the presence of pCIG (GFP expression for monitoring the transfection efficiency), 293T cells were treated with cycloheximide at 60 mM for the indicated times. Then, cells were harvested and the protein samples were subjected to western blots for p-Lats1(Thr1079), Myc, GFP, and b-actin. (C) Effects of K751R on the Tead4-luciferase activity in the presence or absence of YAP. 293T cells were transfected with vector, WT or K751R in combination with Tead4-luciferase reporter and pRL-null constructs in the presence of pCIG or pCIG-YAP. Cells were then cultured in fresh growth medium for further 48 h followed by dual-luciferase assays. (D, E) Effects of K751R on the mRNA levels of CTGF and CYR61. After transfection with vector, WT or K751R in combination with or without pCIG-YAP for 6 h, 293T cells were cultured in fresh growth medium for further 48 h. Then, cells were subjected to RNA isolation and quantitative RT-PCR to detect the mRNA levels of CTGF and CYR61. Numerical data were expressed as mean ± SD (each n ¼ 4), *p < 0.05, **p < 0.01 versus cells expressing vector in the presence or absence of YAP; þp < 0.05, þþp < 0.01 versus cells expressing WT in the presence or absence of YAP.

increase; 12 h post CHX treatment, the phosphorylation level of K751R was approximately 4.7-fold more than that of WT (Fig. 4B). Thus, Lats1 SUMOylation at K751 affects not the binding of Lats1 to YAP/TAZ but the stability of phosphorylated Lats1. To further determine the effects of Lats1 SUMOylation at K751 on the transcriptional output of Hippo signaling, we examined Tead4-luciferase activity and mRNA levels of Hippo signaling target genes including CTGF and CYR61. In the absence of YAP, WT decreased the Tead4-luciferase activity by 24%, whereas K751R reduced the Tead4-luciferase activity by 48%; in the presence of YAP, though YAP enhanced Tead4-luciferase activity by 3.4-fold, WT attenuated YAP-induced Tead4-luciferase activity by 23% and K751R mutant decreased YAP-induced Tead4-luciferase activity by 64% (Fig. 4C). Likewise, in the absence of YAP, WT attenuated CTGF and CYR61 mRNA levels by 25% and 20%, respectively, whereas K751R attenuated CTGF and CYR61 mRNA levels by 38% and 30%, respectively (Fig. 4D). In the presence of YAP, YAP enhanced CTGF and CYR61 mRNA levels by 6.0- and 8.0-fold, respectively, whereas WT attenuated YAP-induced CTGF and CYR61 mRNA levels by 48% and 40% and K751R decreased YAP-induced CTGF and CYR61 mRNA levels by 71% and 67%, respectively (Fig. 4E). Together, these data suggest that Lats1 SUMOylation at K751attenuates its kinase and suppresses Hippo signaling through enhancing the degradation of phosphorylated Lats1.

Lats1 SUMOylation at K751 reduces its tumor suppressor functions in vitro Lats1 functions as a tumor suppressor to inhibit cell proliferation and induce cell apoptosis [1e3], and long-term YAP activation, such as Yap transgene in the mouse liver, results in cell transformation and tumor development [25]. To dissect the biological relevance of Lats1 SUMOylation at K751, we examined the tumorsuppressor functions in HepG2 hepatocellular carcinoma cells. SUMOylated Lats1 was expressed more in HepG2 human hepatocellular carcinoma cells than in LO2 human normal hepatic cells (Fig. 5A), suggesting the potential importance of Lats1 SUMOylation in biological behaviors of hepatocellular carcinoma cells. Similar to what was observed in 293T cells, protein complexes precipitated with a Myc antibody from HepG2 cells expressing Flag-SUMO1 and Myc-Lats1 contained more SUMOylated Lats1 than those from HepG2 cells expressing Flag-SUMO1 (G97A) and Myc-Lats1 (Fig. 5B), and protein complexes precipitated with a Myc antibody from HepG2 cells expressing Flag-tagged SUMO1 and Myc-tagged Lats1 or mutant contained abundant WT but little K751R (Fig. 5C). Moreover, K751R increased much more phosphorylation levels of Thr1079 in exogenous Lats1, of Ser127 in endogenous YAP, and of Ser89 in endogenous TAZ than WT (Fig. 5D). Finally, in either the presence or absence of YAP, K751R more significantly reduced the CTGF and CYR61 mRNA levels than WT (Fig. 5E and F).

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CAN13113_proof ■ 16 November 2016 ■ 8/11

8

L. Mei et al. / Cancer Letters xxx (2016) 1e11

Fig. 5. K751R mutant enhances Lats1 tumor suppressor functions in vitro. (A) SUMOylated Lats1 levels in LO2 and HepG2 cells. The same procedure as Fig. 1A was performed in LO2 and HepG2 cells. (B) SUMO1 SUMOylates Lats1 in HepG2 cells. The same procedure as Fig. 1C was performed in HepG2 cells. (C) The same procedure as Fig. 2C was performed in HepG2 cells. (D) Effects of k751R on Lats1, YAP, and TAZ activities in HepG2 cells. The same procedure as Fig. 3A and B was performed in HepG2 cells. (E, F) Effects of K751R on the mRNA levels of CTGF and CYR61 in HepG2 cells. The same procedure as Fig. 4D and E was performed in HepG2 cells. (G) Effects of K751R on cell proliferation in HepG2 cells. After transfected with vector, WT or K751R, HepG2 cells were seeded into 96-well plates and cultured for 3 days. Cellular vitality was measured every day by cell counting kit-8 kits. (H) Effects of K751R on colony formation. Clone formation assays were performed in HepG2 cells stably expressing vector, WT or K751R, after cells were cultured for two weeks in the growth medium. Then, cell colonies were stained and counted by Clono-Counter software. (I, J) Effects of K751R on cell apoptosis. Apoptosis was examined in the monoplastic suspension stained with an Annexin V-FITC/PI apoptosis assay kits. All samples were analyzed with a FACS calibur flow cytometer. Numerical data were expressed as mean ± SD (each n ¼ 4), *p < 0.05, **p < 0.01 versus cells expressing vector; þp < 0.05, þþp < 0.01 versus cells expressing WT.

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CAN13113_proof ■ 16 November 2016 ■ 9/11

L. Mei et al. / Cancer Letters xxx (2016) 1e11

To investigate the effects of Lats1 SUMOylation at K751 on tumor-suppressor functions, we performed the cell proliferation, apoptosis, and colony formation assays in HepG2 cells overexpressing vector, WT or K751R. WT did not significantly affect the proliferation of HepG2 cells within 3-day post inoculation, whereas K751R suppressed cell proliferation by 30% from day 3 (Fig. 5G). Moreover, as compared with the vector, WT reduced the colony formation of HepG2 cells by 60%, whereas K751R decreased the colony formation by 89% on week 2 post inoculation (Fig. 5H). Finally, as compared with the vector, WT induced the early and late apoptotic rates by 4% and 3%, respectively, whereas K751R enhanced early and late apoptotic rates by 17% and 5%, respectively (Fig. 5I and J). Thus, Lats1 SUMOylation at K751 attenuates its tumor-suppressor functions in vitro. Lats1 SUMOylation at K751 attenuates tumor suppressor functions in xenografts To further confirm that Lats1 SUMOylation at K751 attenuates its tumor-suppressor functions in vivo, we generated stably vector-, WT- or K751R-expressing HepG2 cell xenografts in mice. The volumes of HepG2 cell xenografts expressing vector, WT or K751R were time-dependently increased within 40-day post inoculation (Fig. 6A and B). From day 25, the volumes of WT-expressing xenografts were significantly lower than those of vector-expressing xenografts, whereas the volumes of K751R-expressing xenografts were significantly lower than those of WT-expressing xenografts (Fig. 6A and B). On day 40, the volumes from WT-expressing xenografts were 50% of those from vector-expressing xenografts, while the volumes of K751R-expressing xenografts were 44% of

9

those from WT-expressing xenografts (Fig. 6A and B). Consistent with the in vitro results, WT markedly increased the phosphorylated Lats1 (Ther1079) levels and K751R in xenografts resulted in more phosphorylated Lats1 than WT, thought total Lats1 levels in xenografts expressing either WT or K751R appeared no significant difference (Fig. 6C). Likewise, WT in xenografts significantly reduced the mRNA levels of both CTGF and CYR61, whereas K751R in xenografts led to much more decreases in these mRNA levels than WT (Fig. 6D). To investigate the cell proliferation and apoptosis in WT- and K751R-expressing xenografts 40-d post inoculation, we further performed Ki67 and TUNEL staining, respectively. The cell proliferation and apoptotic rates in xenografts expressing vector were 34.5% and 2.8%, respectively, whereas WT decreased the cell proliferation rates by 7.8% and increased the apoptotic rates by 7.3% (Fig. 6E and F). However, K751R decreased the cell proliferation rates by 22.7% and increased the apoptotic rates by 11.3% (Fig. 6E and F). Taken together, these data suggest that Lats1 SUMOylation at K751 attenuates its tumor-suppressor functions in HepG2 cell xenografts. Discussion To the best of our knowledge, the present study by in vitro cell culture and in vivo xenograft approaches is the first work uncovering that Lats1 SUMOylation at K751 destabilizes the phosphorylated Last1, resulting in the suppression of its kinase activity and consequent attenuation of its tumor-suppressor functions (Fig. 7). Hippo signaling pathway is involved in a variety of critical biological processes and human diseases, including organ growth control, stem cell function, tissue regeneration and tumor

Fig. 6. K751R enhances the tumor-suppressor functions in HepG2 cell xenografts. Mouse models bearing HepG2cell xenografts expressing vector, WT or K751R were generated, (A) xenograft volumes and the body weight were recorded every three days, 15-days post inoculation. Mice were sacrificed on day 40 and the xenografts were harvested for imaging (B), preparation of protein lysates followed by western blots for protein levels of p-Lats1(T1079), Lats1, and GAPDH (C), isolation of total RNA for mRNA levels of CTGF and CYR61 (D), and paraffin-embedded sections for immunohistochemistry staining of Ki67 and TUNEL (E and F). Numerical data were expressed as mean ± SD (each n ¼ 10), *p < 0.05, **p < 0.01 versus xenografts expressing vector; þp < 0.05, þþp < 0.01 versus xenografts expressing WT.

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CAN13113_proof ■ 16 November 2016 ■ 10/11

10

L. Mei et al. / Cancer Letters xxx (2016) 1e11

Fig. 7. The proposed model for Lats1 SUMOylation at K751 in attenuating Hippo signaling and its tumor-suppressor functions. SUMO1 interacts with and directly SUMOylates Lats1 at K751 to attenuate the kinase activity, which in turn decreases the phosphorylation of YAP and TAZ, resulting in their nuclear location and consequent tumor growth.

suppression [1e3]. SUMOylation is a pivotal modifier that determines the activation, deactivation or subcellular localization of signaling proteins, facilitating the initiation, amplification and transduction of signaling [14e16]. Up to date, only Lapi and his colleagues have reported that YAP is stabilized by SUMOylation at Lys97 and Lys242 after cisplatin treatment [26], whether SUMOylation occurs at the other key components of Hippo signaling is completely unknown. In the present study, SUMOylation of Lats1 by SUMO1 is supported by the following evidence: (1) Lats1 interacts with SUMO1; (2) mutation of SUMO1 at G97 decreases SUMOylated Lats1 levels; (3) knockdown of Ubc9 expression specifically reduces SUMOylated Lats1 levels; (4) Lats1 mutation at K751 and K830 robustly attenuates SUMOylated Lats1 levels. This issue is further substantiated by the in vitro SUMOylation assays indicating that mutation of K751 results in significant abolishment of Lats1 SUMOylation. Though K830 is likely to be more important than K751 in regulation of Hippo signaling, mutation of K751 on Lats1 reduces much more SUMOylated Lats1 than mutation of K830 on Lats1, we therefore focus on the resultant effects of Lats1 SUMOylation at K751 instead of K830 in the present study. Interestingly, though Lats1 SUMOylation at K751 affects neither its subcellular localization nor interaction between YAP/TAZ, it significantly attenuates phosphorylation of Lats1 at Thr1079, which leads to inactivation of Lats1 and in turn suppresses the Hippo signaling. Consistent with our findings, previous studies have indicated that SUMOylation regulates the activity of AMP-activated protein kinase [27e29], protein kinase C-q [30], protein kinase B [21e33], and glucokinase [34]. Though SUMOylation at K751 has no significant effects on the stability of Lats1, it indeed destabilizes the phosphorylated Lats1 (Thr1079). This finding prompts us to conclude that destabilization of phospho-Lats1 contributes to the attenuation of its kinase activity, and to speculate that SUMOylation on phospho-

Lats1 facilitates its binding with E3 ligase, such as Itch, thereby promoting ubiquitination-mediated degradation of phospho-Lats1. Though mass spectrometry indicates that Lats1 is modified by the addition of a single ubiquitin chain at K830 but not K751 of Lats1, K830R mutation doesn't reduce polyubiquitylation of Lats1, pointing to compensatory ubiquitylation of additional lysine residues [35]. Because K830 lies within the kinase domain, polyubiquitylation of Lats1 may inhibit kinase activity by interfering with binding of ATP or recruitment of substrates [35]. Unexpectedly, we find that K830 of Lats1 is potentially SUMOylated by SUMO1 and K830R mutation attenuates the transcriptional output of Hippo signaling, predicating that Lats1 SUMOylation at K830 enhances the kinase activity. Further experiments are needed to explain this discrepancy. Consistent with our findings, YAP is stabilized by SUMOylation at Lys97 and Lys242 after cisplatin treatment [26], PIASxa functions as a SUMO E3 ligase enhances phosphatase and tensin homolog deleted on chromosome 10 (PTEN) protein stability by reducing PTEN ubiquitination [36], SUMOylation of pancreatic glucokinase regulates its cellular stability and activity [34], and SUMOylation of p68 and p72 RNA helicases affects protein stability and transactivation potential [37]. Genetic studies in mouse models and genomic analyses of human tumors indicate that Lats1/2 can function as tumor suppressors and YAP as an oncogene [3,38,39]. Up to date, though the role of SUMOylation inhibitor in HepG2 biological behaviors has not yet been reported, SUMOylation is associated with the tumorigenesis, angiogenesis, and multidrug resistance of hepatocellular carcinoma [40e42]. Ubc9 inhibitors, such as spectomycin B1, have potential as therapeutic agents against hormone-dependent breast cancers and omordin Ic, a new natural SENP1 inhibitor, inhibits prostate cancer cell proliferation [43,44]. SUMOylation of Lats1 at K751 attenuates Lats1 kinase activity and rationally reduces its tumor-suppressor functions. This notion is support by our data showing that K751R attenuates the nuclear accumulation of YAP and TAZ (predominantly YAP), resulting in reduction of cell proliferation and enhancement of cell apoptosis in both cultured HepG2 cells and HepG2 cell xenografts, consistent with previous study indicating that loss of Lats1 promotes growth and metastasis of gastric cancer cells through upregulation of YAP [45]. Correspondingly, previous studies also showing that SUMOylation of merlin, an activator of Hippo pathway, is required for its tumor suppressor activity [46], SUMOylation in Sirt6 deacetylation of H3 modulates tumor suppressive activity [47], and ubiquitin and SUMO regulate the tumor suppressor function of Class III phosphatidylinositol 3-kinase complex [48]. Given the fact that SUMOylation occurs frequently in human cancers and that the Hippo pathway and YAP/TAZ are deregulated in human cancer [6e9,14e16], the present study identifying the Lats1 SUMOylation possibly provides a new mechanism underlying the initiation and development of human cancers and a new strategy for therapeutic intervention in human cancers. Funding This work was supported by 973 Program (No. 2011CB944403) and National Natural Science Foundation of China (nos. 31571493, 31271561, 31071292, 81370713). Acknowledgments We thank Dr. Bin Zhao from Zhejiang University Life Science Institute for his constructs. Conflict of interest The authors declare no conflict of interest for this work.

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

CAN13113_proof ■ 16 November 2016 ■ 11/11

L. Mei et al. / Cancer Letters xxx (2016) 1e11

References

Q1

[1] T. Xu, W. Wang, S. Zhang, R.A. Stewart, W. Yu, Identifying tumor suppressors in genetic mosaics: the Drosophila lats gene encodes a putative protein kinase, Development 121 (1995) 1053e1063. [2] G.S. Turenchalk, M.A. St John, W. Tao, T. Xu, The role of lats in cell cycle regulation and tumorigenesis, Biochim. Biophys. Acta 1424 (1999) M9eM16. [3] M. John, W.F. Tao, X.L. Fei, R. Fukumoto, M.L. Carcangiu, D.G. Brownstein, et al., Mice deficient of Lats1 develop soft-tissue sarcomas, ovarian tumours and pituitary dysfunction, Nature 21 (1999) 182e186. [4] L.J. Saucedo, B.A. Edgar, Filling out the Hippo pathway, Nat. Rev. Mol. Cell Biol. 8 (2007) 613e621. [5] F.X. Yu, B. Zhao, K.L. Guan, Hippo pathway in organ size control, tissue homeostasis, and cancer, Cell 163 (2015) 811e828. [6] K. Harvey, N. Tapon, The Salvador-Warts-Hippo pathwaydan emerging tumour-suppressor network, Nat. Rev. Cancer 7 (2007) 182e191. [7] D. Zhou, C. Conrad, F. Xia, J.S. Park, B. Payer, Y. Yin, et al., Mst1 and Mst2 maintain hepatocyte quiescence and suppress hepatocellular carcinoma development through inactivation of the Yap1 oncogene, Cancer Cell 16 (2009) 425e438. [8] S.W. Chan, C.J. Lim, K. Guo, C.P. Ng, I. Lee, W. Hunziker, et al., A role for TAZ in migration, invasion, and tumorigenesis of breast cancer cells, Cancer Res. 68 (2008) 2592e2598. [9] N.H. Liu, L. Mei, X.Y. Fan, C. Tang, X. Ji, X.H. Hu, et al., Phosphodiesterase 5/ protein kinase G signal governs stemness of prostate cancer stem cells through Hippo pathway, Cancer Lett. 378 (2016) 38e50. [10] A.A. Steinhardt, M.F. Gayyed, A.P. Klein, J. Dong, A. Maitra, D. Pan, et al., Expression of Yes-associated protein in common solid tumors, Hum. Pathol. 39 (2008) 1582e1589. [11] R.T. Hay, SUMO: a history of modification, Mol. Cell 18 (2005) 1e12. [12] J.R. Gareau, C.D. Lima, The SUMO pathway: emerging mechanisms that shape specificity, conjugation and recognition, Nat. Rev. Mol. Cell Biol. 11 (2010) 861e871. [13] R. Geiss-Friedlander, F. Melchior, Concepts in sumoylation: a decade on, Nat. Rev. Mol. Cell Biol. 8 (2007) 947e956. [14] K. Eifler, A.C. Vertegaal, SUMOylation-mediated regulation of cell cycle progression and Cancer, Trends Biochem. Sci. 40 (2015) 779e993. [15] X.Y. He, J. Riceberg, S.M. Pulukuri, S. Grossman, V. Shinde, P. Shah, et al., Characterization of the loss of SUMO pathway function on cancer cells and tumor proliferation, PLoS One 10 (2015) e0123882. [16] J.D. Kessler, K.T. Kahle, T.T. Sun, K.L. Meerbrey, M.R. Schlabach, E.M. Schmitt, et al., A SUMOylation-dependent transcriptional subprogram is required for Myc-driven tumorigenesis, Science 335 (2012) 348e353. [17] B. Zhao, X. Ye, J. Yu, L. Li, W. Li, S. Li, et al., TEAD mediates YAP-dependent gene induction and growth control, Genes Dev. 22 (2008) 1962e1971. [18] B. Zhao, L. Li, L. Wang, C.Y. Wang, J. Yu, K.L. Guan, Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis, Genes Dev. 26 (2012) 54e68. [19] J.R. Wang, C.J. Wang, C.Y. Xu, X.K. Wu, D. Hong, W. Shi, et al., Signaling cascades governing Cdc42-mediated chondrogenic differentiation and mensenchymal condensation, Genetics 202 (2016) 1055e1069. [20] C. Tang, L.F. Tang, X.K. Wu, W.Y. Xiong, H.F. Ruan, M. Hussain, et al., Gliomaassociated oncogene 2 is essential for trophoblastic fusion by forming a transcriptional complex with glial cell missing-a, J. Biol. Chem. 291 (2016) 5611e5622. [21] H.F. Ruan, H. Luo, J.R. Wang, X. Ji, Z.M. Zhang, J.S. Wu, et al., Smoothenedindependent activation of hedgehog signaling by rearranged during transfection promotes neuroblastoma cell proliferation and tumor growth, Biochim. Biophys. Acta 1860 (2016) 1961e1972. [22] T. Kamitani, H.P. Nguyen, E.T. Yeh, Preferential modification of nuclear proteins by a novel ubiquitin-like molecule, J. Biol. Chem. 272 (1997) 14001e14004. [23] L. Gong, T. Kamitani, K. Fujise, L.S. Caskey, E.T. Yeh, Preferential interaction of sentrin with a ubiquitin-conjugating enzyme, Ubc9, J. Biol. Chem. 272 (1997) 28198e28201. [24] R.T. Hay, Protein modification by SUMO, Ann. Rev. Biochem. 73 (2004) 355e382. [25] J.X. Dong, G. Feldmann, J.B. Huang, S. Wu, N.L. Zhang, S.A. Comerford, et al., Elucidation of a universal size-control mechanism in Drosophila and mammals, Cell 130 (2007) 1120e1133.

11

[26] E. Lapi, S.D. Agostino, S. Donzelli, H. Gal, E. Domany, G. Rechavi, et al., PML, YAP, and p73 are components of a proapoptotic autoregulatory feedback loop, Mol. Cell 32 (2008) 803e814. [27] Y. Yan, S. Ollila, I.P. Wong, T. Vallenius, J.J. Palvimo, K. Vaahtomeri, et al., Nat. Commun. 6 (2015) 11e12. [28] T. Rubio, S. Vernia, P. Sanz, Sumoylation of AMPKb2 subunit enhances AMPactivated protein kinase activity, Mol. Biol. Cell 24 (2013) 1801e1811. [29] J. Ritho, S.T. Arold, E.T. Yeh, A critical SUMO1 modification of LKB1 regulates AMPK activity during energy stress, Cell Rep. 12 (2015) 734e742. [30] X.D. Wang, Y. Gong, Z.L. Chen, B.N. Gong, J.J. Xie, C.Q. Zhong, TCR- induced sumoylation of the kinase PKC-q controls T cell synapse organization and T cell activation, Nat. Immunol. 16 1195e1203. Q2 [31] C.H. Lin, S.Y. Liu, E.H. Lee, SUMO modification of Akt regulates global SUMOylation and substrate SUMOylation specificity through Akt phosphorylation of Ubc9 and SUMO1, Oncogene 35 (2016) 595e607. lez-San[32] C.F. de la Cruz-Herrera, M. Campagna, V. Lang, J. del Carmen Gonza tamaría, L. Marcos-Villar, A. Vidal, et al., SUMOylation regulates AKT1 activity, Oncogene 34 (2015) 1442e1450. [33] R. Li, J. Wei, C. Jiang, D.M. Liu, L. Deng, K. Zhang, et al., Akt SUMOylation regulates cell proliferation and tumorigenesis, Cancer Res. 73 (2013) 5742e5753. [34] I. Aukrust, L. Bjørkhaug, M. Negahdar, J. Molnes, B.B. Johansson, Y. Müller, SUMOylation of pancreatic glucokinase regulates its cellular stability and activity, J. Biol. Chem. 288 (2013) 5951e5962. [35] W. Li, J. Cooper, L. Zhou, C.Y. Yang, H. Erdjument-Bromage, D. Zagzag, Merlin/ NF2 loss-driven tumorigenesis linked to CRL4(DCAF1)-mediated inhibition of the hippo pathway kinases Lats1 and 2 in the nucleus, Cancer Cell 26 (2014) 48e60. [36] W.B. Wang, Y.F. Chen, S.Y. Wang, N.G. Hu, Z.Y. Cao, W.G. Wang, et al., PIASxa ligase enhances SUMO1 modification of PTEN protein as a SUMO E3 ligase, J. Biol. Chem. 289 (2014) 3217e3230. [37] S.M. Mooney, J.P. Grande, J.L. Salisbury, R. Janknecht, Sumoylation of p68 and p72 RNA helicases affects protein stability and transactivation potential, Biochemistry 49 (2010) 1e10. [38] M. Overholtzer, J. Zhang, G.A. Smolen, B. Muir, W. Li, D.C. Sgroi, et al., Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 12405e12410. [39] L. Zender, M.S. Spector, W. Xue, P. Flemming, C. Cordon-Cardo, J. Silke, et al., Identification and validation of oncogenes in liver cancer using an integrative oncogenomic approach, Cell 125 (2006) 1253e1267. [40] J. Li, Y. Xu, X.D. Long, W. Wang, H.K. Jiao, Z. Mei, et al., SUMO inhibitors Cbx4 governs HIF-1a to potentiate angiogenesis of hepatocellular carcinoma by its SUMO E3 ligase activity, Cancer Cell 25 (2014) 118e131. [41] Y. Qin, H. Bao, Y. Pan, M. Yin, Y. Liu, S. Wu, et al., SUMOylation alterations are associated with multidrug resistance in hepatocellular carcinoma, Mol. Med. Rep. 9 (2014) 877e881. [42] Z.L. Jin, H. Pei, Y.H. Xu, J. Yu, T. Deng, The SUMO-specific protease SENP5 controls DNA damage response and promotes tumorigenesis in hepatocellular carcinoma, Eur. Rev. Med. Pharmacol. Sci. 20 (2016) 3566e3573. [43] J. Wu, H. Lei, J. Zhang, X. Chen, C. Tang, W. Wang, et al., Momordin Ic, a new natural SENP1 inhibitor, inhibits prostate cancer cell proliferation, Oncotarget (2016 Jul 16), http://dx.doi.org/10.18632/oncotarget. [44] M. Hirohama, A. Kumar, I. Fukuda, S. Matsuoka, Y. Igarashi, H. Saitoh, et al., Spectomycin B1 as a novel SUMOylation inhibitor that directly binds to SUMO E2, ACS Chem. Biol. 8 (2013) 2635e2642. [45] J. Zhang, G. Wang, S.J. Chu, J.S. Zhu, R. Zhang, W.W. Lu, et al., Loss of large tumor suppressor 1 promotes growth and metastasis of gastric cancer cells through upregulation of the YAP signaling, Oncotarget 7 (2016) 16180e16193. [46] Q. Qi, X. Liu, D.J. Brat, K. Ye, Merlin sumoylation is required for its tumor suppressor activity, Oncogene 33 (2014) 4893e4903. [47] J. Cai, Y. Zuo, T. Wang, Y. Cao, R. Cai, F.L. Chen, et al., A crucial role of SUMOylation in modulating Sirt6 deacetylation of H3 at lysine 56 and its tumorsuppressive activity, Oncogene (2016), http://dx.doi.org/10.1038/ onc.2016.24. [48] C. Reidick, F. Magraoui, H.E. Meyer, H. Stenmark, H.W. Platta, Regulation of the tumor-suppressor function of the Class III phosphatidylinositol 3-Kinase complex by ubiquitin and SUMO, Cancers (Basel) 7 (2014) 1e29.

Please cite this article in press as: L. Mei, et al., SUMOylation of large tumor suppressor 1 at Lys751 attenuates its kinase activity and tumorsuppressor functions, Cancer Letters (2016), http://dx.doi.org/10.1016/j.canlet.2016.11.009

57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112