Supplementation with plant growth promoting rhizobacteria (PGPR) alleviates cadmium toxicity in Solanum lycopersicum by modulating the expression of secondary metabolites

Chemosphere 230 (2019) 628e639

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Supplementation with plant growth promoting rhizobacteria (PGPR) alleviates cadmium toxicity in Solanum lycopersicum by modulating the expression of secondary metabolites Kanika Khanna a, Vijay Lakshmi Jamwal b, Anket Sharma a, c, Sumit G. Gandhi b, *, Puja Ohri d, Renu Bhardwaj a, *, Asma A. Al-Huqail e, Manzer H. Siddiqui e, Hayssam M. Ali e, Parvaiz Ahmad f, g, * a

Department of Botanical and Environmental Sciences, Guru Nanak Dev University, Amritsar, 143005, India Indian Institute of Integrative Medicine (CSIR-IIIM), Council of Scientific and Industrial Research, Canal Road, Jammu, 180 001, India c State Key Laboratory of Subtropical Silviculture, Zhejiang A&F University, Hangzhou, 311300, China d Department of Zoology, Guru Nanak Dev University, Amritsar, 143005, India e Chair of Climate Change, Environmental Development and Vegetation Cover, Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, 11451, Saudi Arabia f Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, 11451, Saudi Arabia g Department of Botany, S.P. College Srinagar, Jammu and Kashmir, India b

h i g h l i g h t s
Cd induced toxicity in S. lycopersicum expressed in terms of phenolic compounds, osmoprotectants and organic acids.
Supplementation of Pseudomonas aeruginosa and Burkholderia gladioli alleviated Cd toxicity in S. lycopersicum seedlings.
Phenolic compounds, organic acids and osmoprotectatants were enhanced upon microbial inoculations in Cd stressed seedlings.
The genes encoding enzymes for phenol and organic acid metabolism were upregulated as observed by qRT-PCR.
The present study commends the use of PGPR against heavy metal tolerance in plants.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 10 March 2019 Received in revised form 6 May 2019 Accepted 10 May 2019 Available online 16 May 2019

The current study evaluated the synergistic role of Plant growth promoting rhizobacteria (PGPR), Pseudomonas aeruginosa and Burkholderia gladioli on different physiological, biochemical and molecular activities of 10-days old Solanum lycopersicum seedlings under Cd stress. Cd toxicity altered the levels of phenolic compounds (total phenols (30.2%), flavonoids (92.7%), anthocyanin (59.5%), polyphenols (368.7%)), osmolytes (total osmolytes (10.3%), total carbohydrates (94%), reducing sugars (64.5%), trehalose (112.5%), glycine betaine (59%), proline (54.8%), and free amino acids (63%)), and organic acids in S. lycopersicum seedlings. Inoculation of P. aeruginosa and B. gladioli alleviated Cd-induced toxicity, which was manifested through enhanced phenolic compound levels and osmolytes. Additionally, the levels of low molecular weight organic acids (fumaric acid, malic acid, succinic acid, and citric acid) were also elevated. The expression of genes encoding enzymes for phenols and organic acid metabolism were also studied to be modulated that included CHS (chalcone synthase; 138.4%), PAL (phenylalanine ammonia lyase; 206.7%), CS (citrate synthase; 61.3%), SUCLG1 (succinyl Co-A ligase; 33.6%), SDH (succinate dehydrogenase; 23.2%), FH (fumarate hydratase; 12.4%), and MS (malate synthase; 41.2%) and found to be upregulated in seedlings inoculated independently with P. aeruginosa and B. gladioli. The results provide insights into the role of micro-organisms in alleviating Cd-induced physiological damage by altering levels of different metabolites. © 2019 Elsevier Ltd. All rights reserved.

Handling Editor: T Cutright Keywords: Solanum lycopersicum Cd toxicity Micro-organisms Phenolic compounds Osmolytes Organic acids qRT-PCR

* Corresponding authors. Department of Botany and Microbiology, King Saud University, Riyadh, Saudi Arabia. E-mail addresses: [email protected] (P. Ahmad), [email protected] (R. Bhardwaj), [email protected] (S.G. Gandhi). https://doi.org/10.1016/j.chemosphere.2019.05.072 0045-6535/© 2019 Elsevier Ltd. All rights reserved.

K. Khanna et al. / Chemosphere 230 (2019) 628e639

1. Introduction Cadmium is an extremely carcinogenic and neurotoxic contaminant that is highly water-soluble. It has been persistently entering the environment through different anthropogenic sources and can be readily absorbed by the plants to enter the food chain, and poison the entire populations (Zhang et al., 2015). Moreover, it can cause chlorosis, necrosis, nutrient imbalance, stunted plant growth oxidation of biomolecules (proteins, lipids, and nucleic acids) and disruption of electron transport chain and membrane bound enzymes such as NADPH oxidases, along with attenuating glutathione pools (Heyno et al., 2008; Ahmad et al., 2016). Plants contain abundant mechanisms to manage heavy metal induced toxicities. Initially, they resist metal toxicities by avoiding their uptake (Hossain et al., 2012; Peng et al., 2018). Secondly, they try to detoxify metals through chelation by metabolites such as amino acids, antioxidants, organic acids, peptides, and phenolic compounds (Hossain et al., 2012; Song et al., 2014). Furthermore, heavy metals hinder the osmotic balance of different osmolytes and secondary metabolites such as organic acids (Dhir et al., 2012). The osmoprotectants provide protection from different abiotic stresses through osmoregulation, membrane stabilization, protein maintenance, changes in enzymatic structures, and ROS detoxification (Dhir et al., 2012; Hussain et al., 2019). Many strategies are being adopted to enhance the growth and yield of plants under adverse environmental situations. One promising approach is the use of beneficial micro-organisms to increase tolerance to abiotic stresses. A wide range of bacterial genera such as Azotobacter, Burkholderia, Chromobacterium, Erwinia, Micrococcus, Pseudomonas, Streptomyces etc. (Rai et al., 2014; Singh et al., 2019) reside symbiotically in the rhizosphere, providing them immunity against different environmental stresses (Glick, 2012; Mathur et al., 2018). PGPR allow plants to resist extreme heavy metal concentrations through mobilization and solubilization of metals via complex formation, biotransformation, extrusion and exclusion mechanisms (Glick, 2012). They are involved in regulating plant physiological processes through synthesizing phytohormones, siderophores and enhancing phosphate uptake (Rajkumar et al., 2012; Song et al., 2014; Kumar Mishra, 2017; Sytar et al., 2018). They also regulate growth and metabolism of the plants by increasing plant growth, defense and antioxidant mechanisms (Wasi et al., 2013). Additionally, different plant metabolites, such as low molecular weight organic acids exuded by microbes, enable nutrient uptake and solubilization of different rhizosphere metals (Rajkumar et al., 2012). The synthesis and accumulation of organic acids such as citric, formic, succinic, oxalic, tartaric, and malic acid are elevated by microbes in response to metals to reduce their toxicity levels (Li et al., 2016). Studies have characterized the role of different phenolic compounds such as phenols, anthocyanins, flavonoids, phenylpropanoids, polyphenols and phenolic acids in heavy metal detoxification (Gill and Tuteja, 2010). PGPR modulate the biosynthesis of phenolic compounds and phenylalanine ammonia lyase (PAL) enzyme activity in plants following metal exposure (Mollavali et al., 2016). For instance, PGPR enhanced phenol levels in Zea mays L. under Cr stress; signifying the role of phenols as natural chelators and contributing towards the overall health of plants (Islam et al., 2016). Further, studies have found the significance of flavonoids as a signaling metabolite during symbiosis between Rhizobium meliloti and alfalfa roots, which shows the chemotactic action of microbes towards luteolin 40 ,7dihydroxyflavone and chalcone 4,40 -dihydrochalcone (Mierziak et al., 2014). Inoculation of microbial strains with salicylic acid tended to elevate the levels of flavonoids in Cr stressed Zea mays L. plants (Song et al., 2014; Islam et al., 2016). The presence of microbes alter secondary metabolites that

629

functions as osmoprotectants during stress conditions (Rajkumar et al., 2012). Bianco and Defez (2009) found that Medicago trunclata under stressed conditions increased proline content following Sinorhizobium meliloti inoculation. Furthermore, free amino acid levels were elevated in T. hamatium inoculated cacao plants under abiotic stress conditions (Bae et al., 2009). Secondary metabolites maintain the physiological and metabolic responses in plants via cytoplasmic osmotic adjustments and membrane stabilization of cell organelles, ROS scavenging, and maintaining the redox homeostasis of plant under stress conditions (Ashraf and Foolad, 2007). Consequently, the potential of PGPR for increasing survival of plants under metal toxicities make them appropriate organisms to study for plant stress tolerance. Globally, Solanum lycopersicum is the most consumed and widely cultivated crop. It contains minerals, antioxidants, and vitamins (Seid et al., 2015). Heavy metals have been adversely affecting the growth and yield of this crop, causing a worldwide loss. PGPR are well known for reducing heavy metal toxicities and enhancing plant growth and yield of tomato plants. The present study was therefore conducted to assess the potential of microbial strains Pseudomonas aeruginosa and Burkholderia gladioli in 10-days old seedlings of S. lycopersicum under Cd exposure. The role of these microbes in the modulation of different secondary metabolites such as phenolic compounds (total phenols, anthocyanins, flavonoids and, osmolytes (total osmolytes, total carbohydrates, reducing sugars, trehalose, proline, glycine betaine and free amino acids), and organic acids (fumaric acid, succinic acid, malic acid and citric acid) was assessed during Cd toxicity. Moreover, the gene expression profiling of genes associated with phenol and organic acid biosynthesis (PAL, CHS, CS, FH, SDH, SUCLG1 and MS) was also performed using qRT-PCR.

2. Material and methods 2.1. Inoculation of bacterial strains Microbial strains; P. aeruginosa (MTCC7195) and B. gladioli (MTCC10242) were ordered from IMTECH, Mohali, Punjab (India). These strains were grown independently using 50mLautoclaved nutrient broth (NB) medium, prepared by dissolving 0.65 g of NB in distilled water (at concentration of 13 gL-1) in a BOD incubator (Caltan, Deluxe Automatic, New Delhi, India)under aseptic conditions (28  C) for 24e48 h. For inoculations, 1 mL of these strains were grown in 50 ml NB in BOD incubator at 28  C for 24e48 h. The NB was spun in a centrifuge at 8000g, at 4  C for 20 min to separate the pellet. The pellet was washed and resuspended in distilled water (109 cellsmL-1).

2.2. Plant material and treatments Validated seeds of S. lycopersicum (Pusa Ruby variety, validated by IARI, New Delhi, India) were sterilized using 0.01% HgCl2 solution. The seeds were dipped into HgCl2solution for 1 min, followed by a thoroughly rinsing with distilled water. Autoclaved petriplates were covered with Whatman grade 1 filter papers that were soaked in Cd solution (0.4 mM CdCl2) that was selected based on the IC50 value. Thirty seeds of S. lycopersicum raised within the microbial concentrations (109 cellsmL-1) were added to petriplates. The petri-plates were placed in seed germinator under aseptic controlled conditions for 10-days and experiment was performed in triplicates. The seed germinator used a 16-h photoperiod, white light intensity of 175 mmol m2 s1, humidity of 85e90%, and temperature between 23 and 26  C.

630

K. Khanna et al. / Chemosphere 230 (2019) 628e639

2.3. Estimation of phenolic compounds 2.3.1. Total phenols Total phenols were measured according to Singleton and Rossi (1965). A dried sample (500 mg) was extracted in 40 mL of 60% ethanol, followed by heating at 65  C for 15 min. The extractant was then filtered and re-extracted from the residue. Total volume of 100 mL was made by adding 60% ethanol. Two mL of extractant was mixed with 10 mL of FolineCiocalteu reagent plus 8 mL of Na2CO3. The sample was incubated for 2 h and absorbance was noted at 765 nm. Gallic acid was used as standard for determination of total phenols. 2.3.2. Flavonoid content The flavonoid levels were analyzed according to Zhishen et al. (1999). 100 mg dried sample was crushed in 3 mL absolute alcohol. A 1 mL sample of the extract was mixed with 4 mL double distilled water, 3 ml of 5% NaNO2, and 3 ml of 10% AlCl3. The mixture was mixed with 2 mL of NaOH and 2.4 mL distilled water and incubated for 10 min. Absorbance was noted at 510 nm. Rutin was used as standard for flavonoid estimation. 2.3.3. Anthocyanin content Anthocyanin content was estimated using the method proposed by Macinelli (1984).1 g sample was crushed in 3 mL of acidified methanol prepared by mixing methanol, water and HCl in a ratio of 79:20:1. The solution was then incubated overnight at 4  C, followed by being spun in centrifuge at 12,000 rpm for 15 min at 4  C. The absorbance was taken at 530 and 657 nm. 2.3.4. Polyphenol content Polyphenol profiling was done by ultra-performance liquid chromatography (UPLC) (Shimadzu UPLC, Nexera System, Shimadzu USA). Sample preparation was done by homogenizing 500 mg of sample in 4 mL 80% methanol. The sample was then spun in a centrifuge at 12,000 g for 20 min at 4  C. The supernatant was filtered through 0.22mmmicropore filter. Eleven polyphenol standards were used to detect compounds in the sample (ShimadzuLab solutions). A photodiode array detector was connected to the UPLC with the following specifications: column size 150  4.6 mm, column pore size 5 mm, flow rate 1 mLmin-1, and temperature of 25  C at 280 nm. 2.4. Estimation of osmoprotectants 2.4.1. Total osmolytes Estimation of total osmolytes was done using vapor pressure osmometer (Vapro 5600).

prepared by adding phenol crystals (200 mg) to Na2SO3 (50 mg). 1 g sample of DNSA was mixed in 100 ml of 1% NaOH and kept at 4  C. This was followed by adding 40% potassium sodium tartrate and measuring the optical density at 510 nm. 2.4.4. Trehalose content Trehalose content was estimated following Trevelyan and Harrison (1956).500 mg dried sample was extracted in 80% ethanol. It was then centrifuged at 5000g, at 4  C for 15 min. A 100mlsample of the supernatant was combined with 4 ml of Anthrone reagent and 2.0 ml of TCA. Absorbance was taken at 620 nm. A standard curve was plotted using glucose. 2.4.5. Glycine betaine content Glycine betaine (GB) content was measured following Grieve and Grattan (1983).500 mg dried sample was homogenized in an extractant that was prepared by mixing 5 ml of distilled water and 0.05% toluene for 24 h. The reaction mixture was filtered using 0.2 mm micropore filters.0.5 ml sample of this extract was thoroughly mixed with 1 ml of HCl (2 N) and 0.1 ml of KI. The mixture was kept in ice for 2 h and vigorously shaken. This extract was gently mixed with 2 ml of ice-cold water along with 10 ml of 1,2Dichloroethane. Two layers were formed and upper aqueous layer was removed. Optical density of the bottom pink colored layer was recorded at 365 nm. GB content was estimated by plotting a standard curve using betaine hydrochloride. 2.4.6. Proline content Proline levels were determined following Bates et al. (1973).500 mg sample of seedlings were ground in 10 ml of 3% sulfosalicylic acid. This was centrifuged at 13,000 rpm for 15 min To2ml sample of the supernatant, 2 ml of ninhydrin and 2 ml glacial acetic acid were added and boiled at 100  C. Test tubes were then immediately transferred to an ice bath to stop the reaction. 4.0 ml sample of toluene was added to reaction mixture and vortexed for 1 min. Aqueous layer was discarded and absorbance of the red colored toluene layer was taken at 520 nm. L-Proline was used to prepare standard curve. 2.4.7. Free amino acid content Free amino acid determination was done following Lee and Takahashi (1966).100 mg dried sample was homogenized in 80% alcohol and warmed in water bath for 15 min. The extract was centrifuged for 20 min at 2000 rpm.0.2 ml sample of reaction mixture was combined with 3.8 ml of ninhydrin reagent and boiled in water bath. Reaction mixture was then cooled till purplish blue color formed. Absorbance was read at 570 nm. 2.5. Organic acid content

2.4.2. Total carbohydrates Total carbohydrates were estimated following Hedge et al. (1962). 100 mg seedling sample was heated in 5 ml HCl (2.5 M) and boiled for 3.5 h. After the mixture was allowed to cool at room temperature, Na2CO3 was added to neutralize the reaction mixture. A final volume of 25 ml was prepared using distilled water. A mixture of 0.5 ml extract and 2 ml of Anthrone reagent was heated for 10 min. After the mixture was allowed to cool, the absorbance was noted at 630 nm. Total carbohydrates were estimated using Dglucose as a standard in mg g1 dry weight. 2.4.3. Reducing sugars Reducing sugar content was measured according to Miller (1959). A 100 mg dried seedling sample was crushed in 80% ethanol. Three ml of 3,5- dinitrosalicylic acid (DNSA) was mixed with 3 ml of the homogenized plant extract. The DNSA was

Organic acid content was measured following Chen et al. (2001). Seedlings were oven dried and ground to powder.0.05 g sample of the powder was mixed with 0.5 mL absolute methanol and 0.5 mL HCl. The mixture was shaken vigorously for 4 h and centrifuged at 12,000 rpm for 15 min at 4  C. The supernatant was separated and dissolved in 300 mL methanol and 100 mL of 50% H2SO4. The reaction mixture was left overnight in 65  C water bath. It was then cooled to 25  C and mixed with 800 mL of chloroform along with 400 mL of water. Following continuous vortexing, two layers formed. The lower chloroform layer was separated for the measurement of organic acids through gas chromatography (GC)emass spectrometry (MS). A 2 ml sample was injected in the system (Shimadzu GCMS-Q2010Plus, Japan) for the quantification of organic acids. Standard conditions used in the GC were: helium as carrier gas; gas flow into the column (1.7 mLmin-1); analytical column (ID

K. Khanna et al. / Chemosphere 230 (2019) 628e639

0.025 mm, DB-5ms, length 30 m); and temperature of the column (50  C hold for 1 min and elevated by 25 Cmin-1 up to 125  C). It was further increased at 10  C/min up to 300  C and held for 15 min. The standard conditions maintained for MS were: ion source temperature 200  C; where interface temperature was 280  C; solvent cut time 3 min and detection mode was relative. Organic acids were estimated by comparing mass spectra with National Institute of Standard and Technology and Wiley 7 Library (Sharma et al., 2016). 2.6. Gene expression analysis RNA extraction was performed in 10-days old S. lycopersicum seedlings using the Trizol method (Invitrogen, Life Technologies, USA). It was analyzed quantitatively using a Nano Drop spectrophotometer (Thermo Scientific, USA), and qualitatively through agarose gel electrophoresis (2%). After RNA isolation, DNase treatment was given (DNA-free TM kit; Ambion TURBO DNA-freeTM, Life Technologies, USA) to protect it from DNA contamination. Later, cDNA was synthesized using ImProm-IITM Reverse Transcription System (Promega, Madison, USA).1 mg sample of DNase treated RNA was used as a template along with oligodT12 primer (First Choice RLM-RACE Kit, Ambion, Life Technologies, Carlsbad, USA) for synthesis (Awasthi et al., 2016). The primers used in this part of the study are listed in Table 1. 2.6.1. Expression profiling using qRT-PCR Gene expression profiling ofS. lycopersicum seedlings under different treatments was conducted using the primers mentioned in Table 1 through qRT-PCR (Rather et al., 2015). cDNA was synthesized using the IM-Prom-IITM Reverse Transcription System (Promega, USA). Primer designing was completed using Primer 3 software (Untergasser et al., 2012). A Light Cycler 96 Real Time PCR System was used for the expression profiling (Hoffmann-La Roche, Switzerland). A reaction mixture of 20 mL was prepared by mixing cDNA (diluted form), 1XLight Cycler 480 SYBR Green I Master (Hoffmann-La Roche, Switzerland) and 1 mM primers (Integrated DNA Technologies, USA, primer sequences listed in Table 1). The qRT-PCR used an incubation period of 10e15 min; 95  C. This was followed by 45 cycles of three step amplification (95  C for 10s, 60 Cfor 15s, and 72  C for 25s). Data were interpreted by the dissociation curved obtained after heating up to 95  C for 10s under normal conditions, and cooling to 65  C for60s. Temperatures reached up to 97  C for 1s, with a ramping rate of 0.2 Cs1to allow for the monitoring of the reaction rate. A non-template, negative control reaction was also included. To normalize the reaction, Ubq (Ubiquitin)gene was utilized as a house-keeping gene (control). The

631

data were assessed using the threshold cycle (Ct) of the amplification curve. The relative gene expression level was assessed using the 2 DD_ct (Awasthi et al., 2015); where Ct ¼(Ct, target Ct, Ubiquitin)time x (Ct, target Ct, Ubiquitin) time 0.

2.7. Statistical analysis Results were statistically analyzed in Microsoft Excel using a two-way analysis of variance (ANOVA) and Tukey's multiple comparison test to find the HSD (Honestly Significant Difference) among means. Data was assessed in triplicates and expressed as means ± standard deviation (S.D). Significant differences were examined at p  0.05 and 0.01.

3. Results 3.1. Phenolic compounds 3.1.1. Effect of microbial strains on total phenols, flavonoids, and anthocyanins in seedlings under Cd toxicity Total phenols, flavonoids, and anthocyanin content were enhanced in the seedlings treated with Cd toxicity by 30.23, 92.72 and 59.51%. However, supplementation with P. aeruginosa (M1) further enhanced the levels of total phenols, flavonoids, and anthocyanin by 60.11, 28.33 and 56.4% in Cd stressed seedlings. The supplementation of B. gladioli (M2) also elevated the levels of total phenols, flavonoids, and anthocyanins in Cd treated seedlings by 111.7, 13.04 and 34% respectively (Fig. 1AeC).

3.1.2. Effect of microbial supplementation on polyphenols content in seedlings under Cd stress The effects of Cd, P. aeruginosa and B. gladioli treatments on polyphenol content are shown in Table 3. Our results showed an induction in the levels of different polyphenols such as catechin, caffeic acid, chlorogenic acid, umbelliferone, rutin, ellagic acid, gallic acid, quercetin, coumaric acid, epicatechin, and kaempferol. Catechin, rutin, gallic acid, kaempferol, caffeic acid, umbelliferone, ellagic acid, and coumaric acid were detected in all the seedlings treated with Cd, P. aeruginosa and B. gladioli. Total polyphenols showed a remarkable increase of 368.7% in the seedlings subjected to Cd stress when compared to a control. This was further enhanced with the supplementation of P. aeruginosa (105.1%)and B. gladioli (52.3%) in seedlings treated with Cd respectively. (Table 2).

Table 1 Nucleotide sequences used in experiment. Primers

Primer code

Primer Sequences

Tm ($C)

Succinate dehydrogenase (SH) (LOC100736507)

NM_001.3F14 NM_001.3R14 NM_001.2F17 NM_001.2R17 XM_004.3F18 XM_004.3R18 XM_004.2F19 XM_004.2R19 XM_004.3F20 XM_004.3R20 M9.1F43 M9.1R43 HQ.1F44 HQ.1R44

Forward primer, TAAGGATCTGGTGGTGGATATGA Reverse primer, GCAAGCACATAGAATACATTCG Forward primer, ATCAAGAACTCGGCTGATT Reverse primer, AAGGCCAACAGCAGTAG Forward primer, GGTGGTAATGTCAGTGCTC Reverse primer, CCCACATTCTTCTACAACAGAT Forward primer, TATCAAGATTGGGCGAACC Reverse primer, CCCTTTCTTTGTATTCAATCCTG Forward primer, TTTCAGATGAATGAAATCTTGTATGAAC Reverse primer, AAGTCGGAGTAACTCCTCATAAA Forward primer, TTTGGATGGAAGCTCTTATGTC Reverse primer, ATCTCTCTCTCAATCATCTTTGT Forward primer, TCGAGTTCTTGTTGTTTGCT Reverse primer, GGCCTTTCAACTTCTGGTAA

59.8 60.4 60.4 60.5 60.3 60.3 59.5 59.5 60.0 60.0 60.0 59.8 60.0 60.2

Succinyl-CoA ligase alpha 1 (SUCL1) Citrate synthase, mitochondrial (CS) (LOC101249011) Fumarate hydratase 1, mitochondrial (FH) (LOC101265278) Malate synthase, glyoxysomal (MS) (LOC101267395) Phenylalanine ammonia-lyase (PAL5) gene Chalconesynthase (CHS2)

632

K. Khanna et al. / Chemosphere 230 (2019) 628e639

Fig. 1. Effect of Cd (0.4 mM), M1 (109 cells/ml) and M2 (109 cells/ml) and their combinations on phenolic compounds (A) total phenols (B) total flavonoids (C) total anthocyanins in 10-day old L. esculentum seedlings under Cd metal stress. Data is presented as means of 3 replicates ± S. D (standard deviation) and HSD values. F ratio values, * indicates significance at P  0.05 and ** indicates significance at P  0.01). Different letters on the table indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey's multiple comparison test (CN-Control, Cd-Cadmium, M1-Pseudomonas aeruginosa, M2- Burkholderia gladioli.

3.2. Osmoprotectants 3.2.1. Effect of microbial inoculations on total osmolytes, carbohydrates, and reducing sugars in seedlings under Cd toxicity Cd stress resulted in increasing levels of total osmolytes, carbohydrates and reducing sugars by 10.34, 94.05, and 64.5%, respectively when compared to control plants. Total osmolytes were increased by 19.4% and 39% following the treatment with P. aeruginosa (M1) and B. gladioli (M2) in Cd stressed seedlings. Similarly, total carbohydrate and reducing sugar content was enhanced following the P. aeruginosa (M1) and B. gladioli (M2) treatments by 79.8, 54.7%, (total carbohydrate content)131.5, and 94.8% (reducing sugar content) respectively in Cd treated seedlings (Fig. 2AeC). Effect of micro-organisms on trehalose, glycine betaine, proline and free amino acid content in seedlings under Cd toxicity. Cd led to an increase in the levels of trehalose, glycine betaine and proline by 112.5, 59 and 54.8%, respectively when compared to control plants. However, free amino acid content was decreased by 63% in Cd treated seedlings when compared to control. Trehalose, glycine betaine, and proline content was also found to be elevated

upon supplementation with P. aeruginosa (M1) by 104.3, 13, and 51.3%, respectively. Similar increase in the levels of trehalose, glycine betaine and proline were observed upon application of B. gladioli (M2) by 134.9, 15, and 83.6%, respectively. Also, free amino acid content was elevated by 273.3% and 244% on supplementation of P. aeruginosa (M1) and B. gladioli (M2) in Cd stressed seedlings. (Fig. 2DeG). 3.2.2. Influence of microbial inoculations on endogenous organic acid levels in Cd exposed S. lycopersicum seedlings The levels of fumaric (9.48%), succinic (3.19%), malic (201.3%), and citric acid (30.45%) were upregulated in seedlings exposed to 0.4 mM Cd when compared to control plants. Tremendous increase in the content of fumaric (59.7%), succinic (50.3%), malic (125%), and citric acid (23.96%) was also observed following inoculation with P. aeruginosa (M1) in the Cd exposed seedlings. Similar increase in the content of organic acids was observed upon B. gladioli (M2) inoculation in seedlings grown under Cd treatment. The content of fumaric acid increased by 40%, succinic acid by 29.3%, malic acid by 93.7%, and citric acid by 17.06% in Cd treated seedlings inoculated with B. gladioli (M2) (Table 3).

633

27.35 ± 1.9742e 128.2 ± 5.182c 47.67 ± 2.784d 263.056 ± 5.519a 57.56 ± 2.994d 195.313 ± 4.491b e e 0.998 ± 0.0245 1.62 ± 0.0400 1.07 ± 0.1048 2.05 ± 0.0633 1.86 ± 0.2951 2.826 ± 0.5366 1.883 ± 0.2203 3.336 ± 0.4687 2.12 ± 0.1652 3.88 ± 0.2930

9.24 ± 0.2871 15.34 ± 0.6208 10.22 ± 0.4104 17.59 ± 0.7251 10.25 ± 0.6006 14.35 ± 0.6744

0.048 ± 0.0286 0.485 ± 0.037 e 0.372 ± 0.052 e 0.257 ± 0.0277

The gene expression of key enzymes involved in the phenol and organic acid metabolism was also studied to examine the role of P. aeruginosa (M1) and B. gladioli (M2) in Cd-stressed S. lycopersicum seedlings. Gene expression of PAL and CHS was upregulated by 206.7 and 138.4% respectively in Cd exposed seedlings as compared to control plants. However, treatment of Cd exposed seedlings with P. aeruginosa (M1) further enhanced the expression of these genes by 6.8% and 70.5%. B. gladioli (M2) also led to enhanced expression levels of these genes by 43.2% and 37.3%, respectively. When compared to control seedlings the expression of CS and FH were enhanced by 61.3% and 12.4%in 0.4 mM Cd treated seedlings. In addition, other genes such as SUCLG1, SDH, and MS were upregulated by 33.64, 23.26, 41.26%, respectively in the seedlings raised under metal stressed conditions. However, inoculation with P. aeruginosa (M1) strain caused further enhancement in the expression levels of CS (77.2%), SUCLG1 (83.7%), FH (339.8%), SDH (98.2%) and MS (254.1%) in response to Cd. Moreover, it was revealed that supplementation of B. gladioli (M2) to Cd treated seedlings also resulted in the increase in the expression of CS (79.5%), SUCLG1 (107.2%), FH (47.04%), SDH (190.3), and MS (76.3%). Fig. 3 A-G. 4. Discussion

T x D: 314.87** HSD: 11.386. 2,12)

D: 507.19** F- ratio(df 2,12)

T: 5943.02** F- ratio(df F- ratio(df

CN Cd M1 M1þCd M2 M2þCd

1,12)

2.946 ± 0.3212 50.06 ± 1.6724 15.78 ± 1.0808 121.6 ± 1.435 21.696 ± 1.034 138.3 ± 3.4731

1.953 ± 0.0737 22.84 ± 1.1066 e 65.73 ± 1.2595 11.29 ± 1.1074 e

2.26 ± 0.42 15.44 ± 0.7881 8.27 ± 0.6618 19.25 ± 0.454 e 2.03 ± 0.2783

e 5.43 ± 0.2891 3.45 ± 0.5153 8.66 ± 0.5352 2.36 ± 0.4035 10.14 ± 0.2914

6.73 ± 0.440 10.41 ± 0.5934 7.06 ± 0.555 18.19 ± 0.545 5.25 ± 0.715 13.43 ± 0.69

1.71 ± 0.3601 5.33 ± 0.555 e 6.59 ± 0.6265 3.49 ± 0.6251 10.3 ± 0.5126

0.598 ± 0.0575 e e e e e

Epicatechin (Mean ± SD) Chlorogenic acid (Mean ± SD)

Caffeic acid (Mean ± SD)

Umbelliferone (Mean ± SD)

Rutin (Mean ± SD)

Ellagic acid (Mean ± SD)

Quercetin (Mean ± SD)

Gallic acid (Mean ± SD)

Kaemferol (Mean ± SD)

Coumeric acid (Mean ± SD)

Total Polyphenol content (Mean ± SD)

3.3. Gene expression profiling

Treatments Catechin (Mean ± SD)

Table 2 Effect of Cd (0.4 mM), M1 (109 cells/ml) and M2 (109 cells/ml) and their combinations on different Polyphenols in 10-day old S. lycopersicum seedlings under Cd metal stress. Data is presented as means of 3 replicates ± S.D (standard deviation) and HSD values. F ratio values, * indicates significance at P  0.05 and ** indicates significance at P  0.01). Different letters on the table indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey's multiple comparison test (CN-Control, Cd-Cadmium, M1-Pseudomonas aeruginosa, M2- Burkholderia gladioli).

K. Khanna et al. / Chemosphere 230 (2019) 628e639

Cd toxicity have been known to cause a deleterious effect on plants by disturbing the overall physiological mechanisms of plants (Ahmad et al., 2016). In defense, plants possess a number of mechanisms against Cd stress of which, release of different metabolites such as phenolic compounds, osmoprotectants and organic acids is most commonly observed that act as antioxidants during stressed conditions (Song et al., 2014; Dhir et al., 2012). It has been observed that Cd stress stimulated different phenolic compounds such as benzoic acids and cinnamic acid derivatives in Matricaria chamomilla plants (Kovacik et al., 2009). According to their revelation, Cd affected the shikimate dehydrogenase, cinnamyl alcohol dehydrogenase, polyphenol oxidase and ascorbate peroxidase activities in plants (Kovacik et al., 2009). The induction in the phenol metabolism was also observed by Chen et al. (2019) in Kandelia obovata under Cd stress through upregulating in the phenol metabolising enzymes that lead to accumulation of phenolic levels in plant tissues. In the present study, Cd enhanced the levels of phenolic compounds such as total phenols, flavonoids, anthocyanins, and polyphenols. Our studies are in accordance with earlier studies conducted by Díaz et al. (2001) and Sakihama and Yamasaki, 2002. They found that benzoic acids, isoflavones, phenylpropanoids, and flavonoids accumulated in plants through enhanced phenylpropanoid metabolism under Cu and Al stress and formed protective barriers around cells when affected by toxic metal actions. It was further revealed that Ni exposed Fagopyrum esculentum raised phenolic acids and other phenolic compounds such as p-anisic, chlorogenic, p-hydroxybenzoic, hesperetic and caffeic acids that acted as antioxidants and reduced Ni toxicity from plants (Sytar et al., 2013). Moreover, a study conducted with Phaseolus vulgaris under Cd exposure showed an increase in the synthesis of soluble and insoluble forms of phenolics (Smeets et al., 2005). According to Parry et al. (1994), accumulation of phenolics is due to increased enzyme activity involved with phenol metabolism during metal induced conditions. Apart from this, there is an evidence indicating that enhanced synthesis of flavonoids occurs during conjugate hydrolysis (Parry et al., 1994). A study conducted of Lupinus albus L. roots under Cu toxicity showed an elevation in phenols along with an enhanced peroxidase activity (Jung et al., 2003). They speculated

634

K. Khanna et al. / Chemosphere 230 (2019) 628e639

Table 3 Effect of Cd (0.4 mM), M1 (109 cells/ml) and M2 (109 cells/ml) and their combinations on organic acid contents (Citric acid, Fumaric acid, Succinic acid, Malic acid) in 10-day old S. lycopersicum seedlings under Cd metal stress. Data is presented as means of 3 replicates ± S.D (standard deviation) and HSD values. F ratio values, * indicates significance at P  0.05 and ** indicates significance at P  0.01). Different letters on the table indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey's multiple comparison test (CN-Control, Cd-Cadmium, M1-Pseudomonas aeruginosa, M2-Burkholderia gladioli). Citric acid (Mean ± SD)

Treatments CN Cd M1 M1þCd M2 M2þCd F- ratio(df F- ratio(df F- ratio(df HSD

e

1,12) 2,12) 2,12)

T D TxD

3.477 ± 0.1213 4.536 ± 0.2155cd 4.798 ± 0.1555bc 5.623 ± 0.0917a 5.098 ± 0.1719b 5.311 ± 0.0917ab 76.37** 100.29** 9.963* 0.4602

Fumaric acid (Mean ± SD) e

0.381 ± 0.0618 0.417 ± 0.0127d 0.5206 ± 0.0142c 0.667 ± 0.0114a 0.532 ± 0.0110c 0.585 ± 0.0113b 220.5** 515.62** 44.14** 0.0302

that antioxidant property of phenols results in the chelation of metals; mainly through carboxyl and hydroxyl groups within phenols that bind metal ions. Moreover, plants under stressed conditions exude higher amount of phenolic compounds that not only bind or chelate the heavy metal ions, but also suppresses the ROS generated via Fenton reaction (Jung et al., 2003). The chelating action of phenols is directly related to higher nucleophilic behavior of aromatic rings in the molecule (Moran et al., 1997). The results of the present study showed that inoculations of P. aeruginosa and B. gladioli in Cd exposed tomato seedlings led to marked alleviation of Cd toxicity, as assessed through enhanced phenolic compounds both quantitatively and qualitatively. Many studies have showed enhanced flavonoid levels under metal stressed conditions; such as, Withania somnifera under Cu stress (Khatun et al., 2008), Brassica napus under Cd stress (Oloumi, 2005), and Vinca rosea under Ni stress (Khan et al., 2017). Our results were similar to the results of Zaets et al. (2010), who reported that supplementation with different micro-organisms in soybean plants under Cd treatment resulted in increasing levels of phenols, suggesting role in plant protection. Furthermore, studies with enhanced level of phenols in plants under Cd metal stress were reported in Solanum lycopersicum (Hashem et al., 2016), Salvia officinalis (Nell et al., 2009) and Erica andevalensis (Marquez-Garcia et al., 2012). An increase in total phenols, flavonoids, and polyphenols in rice treated with bacterial consortium due to higher antioxidant activities has been observed through DPPH and FRAP assays (Nasarudin et al., 2018). Similarly, PGPR enhanced Pb tolerance in Lathyrus sativus by elevating the biosynthesis of phenolic compounds (Abdelkrim et al., 2018). An increase in the accumulation of polyphenols was found in microbe inoculated wheat plants (Pazoki, 2015), Medicago sativa exposed to Pb (Sima et al., 2012), and Glycine max exposed to Zn and Cu (Ibiang et al., 2017). Similar results have been shown where PGPR (P. aeruginosa, Bacillus subtilis) increased the synthesis of phenolic compounds such as flavonoids, phenols, shikimic acid, kaempferol, gallic acid, quercetin, tannic acid, p-coumaric acid, and syringic acid (Jain et al., 2015). Pseudomonas has been found to alleviate Cr toxicity by modulating the levels of phenols and acting as active mediators in ROS scavenging (Varsha and Kumudini, 2018; Singh et al., 2019). Our studies also corroborated the findings of Khan et al. (2018) who reported an enhancement in phenols and flavonoids in B. cepacia inoculated C. roseus under Cd stress. Mollavali et al. (2016) reported an elevation in the flavonols, total phenols, pyruvic acid, quercetin-40 O-monoglucoside and isorhamnetin-40 -O- monoglucoside in Diversispora versiformis inoculated Alium cepa L. plants. Anthocyanins have a very active role in protecting plants under metal stress as they have high antioxidative properties, reducing powers, ROS

Succinic acid (Mean ± SD) d

0.777 ± 0.0190 0.8018 ± 0.0208d 0.8596 ± 0.0171c 1.205 ± 0.0217a 0.8804 ± 0.0150c 1.092 ± 0.0222b 512.3** 212.3** 75.41** 0.05345

Malic acid (Mean ± SD) 1.716 ± 0.0915e 5.170 ± 0.2028d 9.577 ± 0.12515b 11.659 ± 0.2877a 8.4733 ± 0.1845c 10.016 ± 0.4314b 408.12** 1417.3** 23.73** 0.6795

scavenging and chelation abilities (Gülçin et al., 2005). Therefore, it has been implicated that PGPR mediated synthesis of polyphenols and stimulation of PAL enzyme activity that further upregulates the levels of phenolic compounds in order to cope against Cd stress. The involvement of PGPR in phosphate solubilization also enhanced the levels of secondary metabolites such as flavonoids, phenols anthocyanins, polyphenols etc. through activating phenylpropanoid pathway as a defense response. Osmolytes are considered the most important class of defensive molecules that act during wide variety of stresses (Dhir et al., 2012). A significant increase in the levels of different osmolytes with Cd was observed in the present study. The reason behind elevated levels of proline is correlated to synthesis and accumulation of free amino acids under metal stressed conditions (Parmar et al., 2013). Osmolytes act as stress markers thereby playing a vital role in their mitigation. Z. mays L. plants exposed to Cu and Pb had enhanced levels of proline to safeguard them from an oxidative burst generated under heavy metal stress, and to stabilize cell structures (Rizvi and Khan, 2018). The present study revealed a tremendous increase in osmoprotectants upon microbial inoculations. Our results are in agreement with studies of Pennisetum purpureum exposed to Pb (Das and Osborne, 2018), Vigna mungo exposed to Cd (Dutta et al., 2018), T. aestivum under Cd stress (Ghassemi and Mostajeran, 2018), and Solanum tuberosum under Zn stress (Gururani et al., 2013). Garg and Singh (2018) reported an elevation in proline content in R. irregularis inoculated with Cajanus cajan L. They speculated that this was mainly due to the upregulation of proline biosynthesis through modulation of proline dehydrogenase, glutamate dehydrogenase, and pyrroline-5-carboxylate activities. The most suitable reason for enhanced proline levels by PGPR is attributed to proline synthesizing enzymes and downregulation of catabolizing enzymes. Accumulation of different sugars and carbohydrates during metal stressed conditions in the present work are in agreement with the studies of Nada et al. (2007) in almond, and Verma and Dubey (2001) in Oryza sativa. The aggregation of carbohydrates under stressed conditions is due to translocation through the phloem being hindered, resulting in growth inhibition (Baccouch et al., 1998). The present study found the application of microbes also led to increase sugar metabolism in Cd exposed S. lycopersicum seedlings. Sugars play an essential role in maintaining different physiological processes such as carbohydrate metabolism, secondary metabolism, and other activities including osmotic balance under stressed conditions (Stobrawa and LorencPlucinska, 2007). An increase in heavy metal tolerance was observed by Al-Garni (2006) in Rhizobium inoculated V. sinensis through enhanced total carbohydrates. Moreover, when sugars such as sorbitol and mannitol have accumulated, cells tend to

Fig. 2. Effect of Cd (0.4 mM), M1 (109 cells/ml) and M2 (109 cells/ml) and their combinations on different osmoprotectants (A) total osmolytes (B) total carbohydrates, (C) total reducing sugars (D) trehalose content (E) glycine betaine content (F) proline content (G) Free amino acid content in 10-day old L. esculentum seedlings under Cd metal stress. Data is presented as means of 3 replicates ± S. D (standard deviation) and HSD values. F ratio values, * indicates significance at P  0.05 and ** indicates significance at P  0.01). Different letters on the table indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey's multiple comparison test (CN-Control, Cd-Cadmium, M1Pseudomonas aeruginosa, M2- Burkholderia gladioli.

636

K. Khanna et al. / Chemosphere 230 (2019) 628e639

Fig. 3. Effect of Cd (0.4 mM), M1 (10 9 cells/ml) and M2 (10 9 cells/ml) and their combinations on gene expression of several genes: (A) CS gene (B) SH gene (C) MS gene (D) SUCLG1 gene (E) FH gene (F) PAL gene (G) CHS gene in 10-day old tomato seedlings under Cd metal stress. Data is presented as means of 3 replicates ± S. D (standard deviation) and HSD values. F ratio values, * indicates significance at P  0.05 and ** indicates significance at P  0.01). Different letters on the graphs indicate that mean values of treatments are significantly different at p < 0.5 according to Tukey's multiple comparison test (CN- Control, Cd- Cadmium, M1- Pseudomonas aeruginosa, M2- Burkholderia gladioli.

K. Khanna et al. / Chemosphere 230 (2019) 628e639

regulate the osmotic potential through ROS scavenging and protecting the cell membranes (Shen et al., 1997). Furthermore, PGPR also enhanced soluble sugars in L. sativus under Pb exposure to reduce levels of ROS (Abdelkrim et al., 2018). Accumulation of sugars in the present study by micro-organisms is primarily due to enhanced photosynthesis process in plants under stressed conditions that further led to enhanced sugar synthesis. Garg and Singh (2018) suggested that R. irregularis accumulated large amount of trehalose in the pigeon pea plants and that this is linked directly to the overexpression of Tregene responsible for trehalose biosynthesis. A similar enhancement of different osmolytes such as proline, glycine betaine, and soluble sugars have also been observed in spinach plants treated with microbes under metal treatments (Malook et al., 2017). PGPR such as Enterobacter asburiae KE17 increased the synthesis of free amino acids, including tyrosine, aspartic acid, leucine, isoleucine, threonine, serine, and lysine in soybean plants under Zn and Cd toxicity (Kang et al., 2015). The most possible mechanism behind enhanced levels of free amino acids by PGPR in present study might be due to strong capacity of microbes for osmotic adjustment by modulating amino acids through nitrogen assimilation. Moreover, microbes tend to release nitrogen in amino acid form for plants under stressful conditions that gets accumulated within them and act as a powerful osmoprotectant. In present work, microbe mitigated Cd toxicity, which might be due to accumulation of low molecular weight organic acids. The levels of organic acids were elevated tremendously with Cd as well as with the application of micro-organisms. The results of our study
jcik et al. (2006) and Dresler were positively correlated with Wo et al. (2014), who reported an enhanced production of organic acids in Thlaspi caerulescens and Zea mays under Cd exposure. The accumulation of organic acids in cell compartments results in sequestration of metals in plant tissues (Boominathan and Doran, 2003). Further, it was studied that accumulation of citric acid through microbes helps in the distribution of Cd in xylem tissues (Clemens, 2001). Citric acid synthesized by P. lilacinus also strengthens the antioxidative defense system of Solanum nigrum L. (Gao et al., 2012). Similarly, P. aeruginosa was reported to solubilize Zn through the production of organic acids (Fasim et al., 2002). Succinic acid has been found raised upon inoculation with Sedum alfredii in Cd contaminated soils (Li et al., 2007). P. fluorescens and Microbacterium enhanced the organic acid secretions that caused Pb accumulation in Brassica napus (Sheng et al., 2008). Han et al. (2006) found malic acid enhanced Cd uptake in maize by forming Cd-organic acid-complexes at root surfaces. The organic acid production by PGPR as a stress ameliorative agent in the current study might be the result of microbial metabolites adhered to root surfaces which limits the metal ions to affect the plants. It is well known that the synthesis of citrate is catalyzed by citrate synthase, succinate by succinylcoA ligase, fumarate by fumarate hydratase, and malate by malate synthase (Lehninger et al., 2008). We studied how microbial supplementation in plants mediated the regulation of genes encoding enzymes of organic acid metabolism (CS, SUCLG1, SDH, FH, MS)and phenol metabolism (PAL, CS). We found that higher expression levels of the genes encoding enzyme synthesis could be the most probable reason for the organic acid accumulation within plants exposed to Cd and microbial treatments. Our studies corroborate with the studies conducted by Kaur et al. (2018) and Kaur et al. (2017) who found up regulation in the expression levels of organic acid and phenol metabolising genes in Brassica juncea in response to Cd toxicity. Moreover, the overexpression of the genes associated with secondary metabolism might be due to the higher protein transcript levels formed in plants during metal toxicity.

637

5. Conclusion The present study found Cd stress altered physiological and metabolic processes in S. lycopersicum seedlings. Supplementation with micro-organisms in Cd exposed seedlings resulted in reducing toxicity levels by upregulating antioxidative defense responses by increasing the levels of different secondary metabolites such as phenolic compounds and osmolytes. The transcriptomic analysis revealed the upregulation of genes associated with secondary metabolism that led to accumulation of different metabolites. The metabolites produced in plants under stress conditions were elevated by microbes; presumably as a strategy to cope with these stresses. The present study therefore, established grounds on the beneficial role of microbes in ameliorating metal toxicity in S. lycopersicum seedlings. Therefore, the application of PGPR can prove to be a positive approach to increasing the growth and yield of plants under heavy metal stresses. However, further research is needed to examine the suitable mechanisms involved in plant abiotic stress tolerance. Conflicts of interest The authors declare that no conflict of interest exits. Acknowledgments The authors are grateful to the Deanship of Scientific Research, King Saud University for funding through Vice Deanship of Scientific Research Chairs. References Abdelkrim, S., Jebara, S.H., Saadani, O., Jebara, M., 2018. Potentialities of efficient and resistant Plant Growth Promoting Rhizobacteria in Pb uptake and defensive system stimulation of Lathyrussativus under lead stress. Plant Biol. 20 (5), 857e869. Ahmad, P., Abdel Latef, A.A., Abd_Allah, E.F., Hashem, A., Sarwat, M., Anjum, N.A., Gucel, S., 2016. Calcium and potassium supplementation enhanced growth, osmolyte secondary metabolite production, and enzymatic antioxidant machinery in cadmium-exposed chickpea (Cicer arietinum L.). Front. Plant Sci. 7, 513. Al-Garni, S.M.S., 2006. Increased heavy metal tolerance of cowpea plants by dual inoculation of an arbuscular mycorrhizal fungi and nitrogen-fixer Rhizobium bacterium. Afr. J. Biotechnol. 5 (2), 133e142. Ashraf, M.F.M.R., Foolad, M., 2007. Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ. Exp. Bot. 59 (2), 206e216. Awasthi, P., Mahajan, V., Jamwal, V.L., Kapoor, N., Rasool, S., Bedi, Y.S., Gandhi, S.G., 2016. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii. J. Genet. https://doi.org/10.1007/s12041-016-0680-8. Awasthi, P., Mahajan, V., Rather, I.A., Gupta, A.P., Rasool, S., Bedi, Y.S., Vishwakarma, R.A., Gandhi, S.G., 2015. Plant omics: isolation, identification, and expression analysis of cytochrome P450 gene sequences from Coleus forskohlii. OMICS 19 (12), 782e792. Baccouch, S., Chaoui, A., El Ferjani, E., 1998. Nickel-induced oxidative damage and antioxidant responses in Zea mays shoots. Plant Physiol. Biochem. 36 (9), 689e694. Bae, H., Sicher, R.C., Kim, M.S., Kim, S.H., Strem, M.D., Melnick, R.L., Bailey, B.A., 2009. The beneficial endophyte Trichoderma hamatum isolate DIS 219b promotes growth and delays the onset of the drought response in Theobroma cacao. J. Exp. Bot. 60 (11), 3279e3295. Bates, S., Waldre, R.P., Teare, I.D., 1973. Rapid determination of the free proline in water stress studies. Plant Soil 39, 205e208. Bianco, C., Defez, R., 2009. Medicago truncatula improves salt tolerance when nodulated by an indole-3-acetic acid-overproducing Sinorhizobium meliloti strain. J. Exp. Bot. 60 (11), 3097e3107. Boominathan, R., Doran, P.M., 2003. Organic acid complexation, heavy metal distribution and the effect of ATPase inhibition in hairy roots of hyperaccumulator plant species. J. Biotechnol. 101 (2), 131e146. Chen, M.C., Wang, M.K., Chiu, C.Y., Huang, P.M., King, H.B., 2001. Determination of low molecular weight dicarboxylic acids and organic functional groups in rhizosphere and bulk soils of Tsuga and Yushania in a temperate rain forest. Plant Soil 231, 37e44. Chen, S., Wang, Q., Lu, H., Li, J., Yang, D., Liu, J., Yan, C., 2019. Phenolic metabolism and related heavy metal tolerance mechanism in Kandelia Obovata under Cd and Zn stress. Ecotoxicol. Environ. Saf. 169, 134e143.

638

K. Khanna et al. / Chemosphere 230 (2019) 628e639

Clemens, S., 2001. Molecular mechanisms of plant metal tolerance and homeostasis. Planta 212, 475e486. Das, A., Osborne, J.W., 2018. Monitoring the stress resistance of Pennisetum purpureum in Pb (II) contaminated soil bioaugmented with Enterobacter cloacae as defence strategy. Chemosphere 210, 495e502. Dhir, B., Nasim, S.A., Samantary, S., Srivastava, S., 2012. Assessment of osmolyte accumulation in heavy metal exposed Salvinia natans. Int. J. Bot. 8, 153e158. Díaz, J., Bernal, A., Pomar, F., Merino, F., 2001. Induction of shikimate dehydrogenase and peroxidase in pepper (Capsicum annuum L.) seedlings in response to copper stress and its relation to lignification. Plant Sci. 161, 179e188. Dresler, S., Hanaka, A., Bednarek, W., Maksymiec, W., 2014. Accumulation of lowmolecular-weight organic acids in roots and leaf segments of Zea mays plants treated with cadmium and copper. Acta Physiol. Plant. 36 (6), 1565e1575. Dutta, P., Karmakar, A., Majumdar, S., Roy, S., 2018. Klebsiella pneumoniae (HR1) assisted alleviation of Cd (II) toxicity in Vigna mungo: a case study of biosorption of heavy metal by an endophytic bacterium coupled with plant growth promotion. Euro-Mediterr. J. Environ. Int. 3 (1), 27. Fasim, F., Ahmed, N., Parsons, R., Gadd, G.M., 2002. Solubilization of zinc salts by bacterium isolated by the air environment of tannery. FEMS Microbiol. Lett. 213, 1e6. Gao, Y., Miao, C., Xia, J., Luo, C., Mao, L., Zhou, P., Shi, W., 2012. Effect of citric acid on phytoextraction and antioxidative defense in Solanum nigrum L. as a hyperaccumulator under Cd and Pb combined pollution. Environ. Earth Sci. 65 (7), 1923e1932. Garg, N., Singh, S., 2018. Mycorrhizal inoculations and silicon fortifications improve rhizobial symbiosis, antioxidant defense, trehalose turnover in pigeon pea genotypes under cadmium and zinc stress. Plant Growth Regul. 86, 1e15. Ghassemi, H.R., Mostajeran, A., 2018. TASOS1andTATM20genes expression and nutrient uptake in wheat seedlings may be altered via excess cadmium exposure and inoculation with Azospirillum brasilense SP7 under saline condition. Appl. Ecol. Environ. Res. 16 (2), 1797e1817. Gill, S.S., Tuteja, N., 2010. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 48 (12), 909e930. Glick, B.R., 2012. Plant growth-promoting bacteria: mechanisms and applications. Scientifica 1e15, 2012. Grieve, C.M., Grattan, S.R., 1983. Rapid assay for determination of water soluble quaternary ammonium compounds. Plant Soil 70, 303e307. _ Berashvili, D., Gepdiremen, A., 2005. Antiradical and antioxidant activity Gülçin, I., of total anthocyanins from Perilla pankinensis decne. J. Ethnopharmacol. 101 (1e3), 287e293. Gururani, M.A., Upadhyaya, C.P., Baskar, V., Venkatesh, J., Nookaraju, A., Park, S.W., 2013. Plant growth-promoting rhizobacteria enhance abiotic stress tolerance in Solanum tuberosum through inducing changes in the expression of ROSscavenging enzymes and improved photosynthetic performance. J. Plant Growth Regul. 32 (2), 245e258. Han, F., Shan, X., Zhang, S., Wen, B., Owens, G., 2006. Enhanced cadmium accumulation in maize roots-the Food chemistry of organic acids. Plant Soil 289 (1e2), 355e368. Hashem, A., Abd_Allah, E.F., Alqarawi, A.A., Al Huqail, A.A., Egamberdieva, D., Wirth, S., 2016. Alleviation of cadmium stress in Solanum lycopersicum L. by arbuscular mycorrhizal fungi via induction of acquired systemic tolerance. Saudi J. Biol. Sci. 23 (2), 272e281. Hedge, J.E., Hofreiter, B.T., Whistler, R.L., 1962. Carbohydrate Chemistry. Academic Press, New York, p. 17. Heyno, E., Klose, C., Krieger-Liszkay, A., 2008. Origin of cadmium-induced reactive oxygen species production: mitochondrial electron transfer versus plasma membrane NADPH oxidase. New Phytol. 179 (3), 687e699. Hossain, M.A., Piyatida, P., da Silva, J.A.T., Fujita, M., 2012. Molecular mechanism of heavy metal toxicity and tolerance in plants: central role of glutathione in detoxification of reactive oxygen species and methylglyoxal and in heavy metal chelation. J. Bot., Le 1e37, 2012. Hussain, S., Iqbal, N., Brestic, M., Raza, M.A., Pang, T., Langham, D.R., Safdar, M.E., Ahmed, S., Wen, B., Gao, Y., Liu, W., 2019. Changes in morphology, chlorophyll fluorescence performance and Rubisco activity of soybean in response to foliar application of ionic titanium under normal light and shade environment. Sci. Totl. Environ. 658, 626e637. Ibiang, Y.B., Mitsumoto, H., Sakamoto, K., 2017. Bradyrhizobia and arbuscular mycorrhizal fungi modulate manganese, iron, phosphorus, and polyphenols in soybean (Glycine max (L.) Merr.) under excess zinc. Environ. Exp. Bot. 137, 1e13. Islam, F., Yasmeen, T., Arif, M.S., Riaz, M., Shahzad, S.M., Imran, Q., Ali, I., 2016. Combined ability of chromium (Cr) tolerant plant growth promoting bacteria (PGPB) and salicylic acid (SA) in attenuation of chromium stress in maize plants. Plant Physiol. Biochem. 108, 456e467. Jain, A., Singh, A., Singh, S., Singh, H.B., 2015. Biological management of Sclerotinia sclerotiorum in pea using plant growth promoting microbial consortium. J. Basic Microbiol. 55 (8), 961e972. Jung, C., Maeder, V., Funk, F., Frey, B., Sticher, H., Frossard, E., 2003. Release of phenols from Lupinus albus L. roots exposed to Cu and their possible role in Cu detoxification. Plant Soil 252 (2), 301e312. Kang, S.M., Radhakrishnan, R., You, Y.H., Khan, A.L., Lee, K.E., Lee, J.D., Lee, I.J., 2015. Enterobacter asburiae KE 17 association regulates physiological changes and mitigates the toxic effects of heavy metals in soybean. Plant Biol. 17 (5), 1013e1022. Kaur, R., Yadav, P., Sharma, A., Thukral, A.K., Kumar, V., Kohli, S.K., Bhardwaj, R., 2017. Castasterone and citric acid treatment restores photosynthetic attributes in

Brassica juncea L. under Cd (II) toxicity. Ecotoxicol. Environ. Saf. 145, 466e475. Kaur, P., Bali, S., Sharma, A., Vig, A.P., Bhardwaj, R., 2018. Role of earthworms in phytoremediation of cadmium (Cd) by modulating the antioxidative potential of Brassica juncea L. Appl. Soil Ecol. 124, 306e316. Khan, W.U., Ahmad, S.R., Yasin, N.A., Ali, A., Ahmad, A., Akram, W., 2017. Application of Bacillus megaterium MCR-8 improved phytoextraction and stress alleviation of nickel in Vincarosea. Int. J. Phytoremediation 19 (9), 813e824. Khan, W.U., Yasin, N.A., Ahmad, S.R., Ali, A., Ahmad, A., Akram, W., Faisal, M., 2018. Role of Burkholderia cepacia CS8 in Cd-stress alleviation and phytoremediation by Catharanthus roseus. Int. J. Phytoremediation 20 (6), 581e592. Khatun, S., Ali, M.B., Hahn, E.J., Paek, K.Y., 2008. Copper toxicity in Withania somnifera: growth and antioxidant enzymes responses of in vitro grown plants. Environ. Exp. Bot. 64 (3), 279e285. Kovacik, J., Klejdus, B., Hedbavny, J., Stork, F., Ba ckor, M., 2009. Comparison of cadmium and copper effect on phenolic metabolism, mineral nutrients and stress-related parameters in Matricaria chamomilla plants. Plant Soil 320 (1e2), 231. Kumar Mishra, G., 2017. Microbes in heavy metal remediation: a review on current trends and patents. Recent Pat. Biotechnol. 11 (3), 188e196. Lee, Y.P., Takahashi, T., 1966. An improved colorimetric determination of amino acids with the use of ninhydrin. Anal. Biochem. 14 (1), 71e77. Lehninger, A.L., Nelson, D.L., Cox, M.M., 2008. Principles of Biochemistry, fifth ed. (New York). Li, Z., Bai, T., Dai, L., Wang, F., Tao, J., Meng, S., Hu, Y., Wang, S., Hu, S., 2016. A study of organic acid production in contrasts between two phosphate solubilizing fungi: Penicillium oxalicum and Aspergillus niger. Sci. Rep. 6, 25313. Li, W.C., Ye, Z.H., Wong, M.H., 2007. Effects of bacteria on enhanced metal uptake of the Cd/Zn-hyperaccumulating plant, Sedum alfredii. J. Exp. Bot. 58, 4173e4182. Malook, I., Rehman, S.U., Khan, M.D., El-Hendawy, S.E., Al-Suhaibani, N.A., Aslam, M.M., Jamil, M., 2017. Heavy metals induced lipid peroxidation in spinach mediated with microbes. Pakistan J. Bot. 49 (6), 2301e2308. Mancinelli, A.L., 1984. Photoregulation of anthocyanin synthesis: VIII. Effect of light pretreatments. Plant Physiol. 75 (2), 447e453. Marquez-Garcia, B., Fernandez-Recamales, M., Cordoba, F., 2012. Effects of cadmium on phenolic composition and antioxidant activities of Erica andevalensis. J. Bot., Le 1e6, 2012. Mathur, S., Sharma, M.P., Jajoo, A., 2018. Improved photosynthetic efficacy of maize (Zea mays) plants with arbuscular mycorrhizal fungi (AMF) under high temperature stress. J. Photochem. Photobiol. B Biol. 180, 149e154. Mierziak, J., Kostyn, K., Kulma, A., 2014. Flavonoids as important molecules of plant interactions with the environment. Molecules 19 (10), 16240e16265. Miller, G.L., 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31 (3), 426e428. Mollavali, M., Bolandnazar, S.A., Schwarz, D., Rohn, S., Riehle, P., ZaareNahandi, F., 2016. Flavonol glucoside and antioxidant enzyme biosynthesis affected by mycorrhizal fungi in various cultivars of onion (Allium cepa L.). J. Agric. Food Chem. 64 (1), 71e77. Moran, J.F., Klucas, R.V., Grayer, R.J., Abian, J., Becana, M., 1997. Complexes of iron with phenolic compounds from soybean nodules and other legume tissues: prooxidant and antioxidant properties. Free Radical Biol. Med. 22 (5), 861e870. Nada, E., Ferjani, B.A., Ali, R., Bechir, B.R., Imed, M., Makki, B., 2007. Cadmiuminduced growth inhibition and alteration of biochemical parameters in almond seedlings grown in solution culture. Acta Physiol. Plant. 29 (1), 57e62. Nasarudin, N.A., Mohamad, J., Ismail, S., Mispan, M.S., 2018. Effect of nitrogen, phosphorus and potassium (NPK) and bacterial bio-fertilizer on the antioxidant activity and chlorophyll content of aerobic rice. Molecules 23, 55. Nell, M., Voetsch, M., Vierheilig, H., Steinkellner, S., Zitterl-Eglseer, K., Franz, C., Novak, J., 2009. Effect of phosphorus uptake on growth and secondary metabolites of garden sage (Salvia officinalis L.). J. Sci. Food Agric. 89 (6), 1090e1096. Oloumi, H., 2005. Study the effects of CdCl2 on lipid peroxidation and antioxidant compounds content in Brassica napus. Iran. J. Sci. Technol. 29 (1), 201e208. Parmar, P., Kumari, N., Sharma, V., 2013. Structural and functional alterations in photosynthetic apparatus of plants under cadmium stress. Bot. Stud. 54 (1), 45. Parry, A.D., Tiller, S.A., Edwards, R., 1994. The effects of heavy metals and root immersion on isoflavonoid metabolism in alfalfa (Medicago sativa L.). Plant Physiol. 106 (1), 195e202. Pazoki, A., 2015. Evaluation of flavonoids and phenols content of wheat under different lead, PGPR and Mycorrhiza levels. Biol. Forum 7 (1), 309. Research Trend. Peng, W., Li, X., Song, J., Jiang, W., Liu, Y., Fan, W., 2018. Bioremediation of cadmiumand zinc-contaminated soil using Rhodobacter sphaeroides. Chemosphere 197, 33e41. Rai, M., Rathod, D., Agarkar, G., Dar, M., Brestic, M., Pastore, G.M., Junior, M.R.M., 2014. Fungal growth promotor endophytes: a pragmatic approach towards sustainable food and agriculture. Symbiosis 62 (2), 63e79. Rajkumar, M., Sandhya, S., Prasad, M.N.V., Freitas, H., 2012. Perspectives of plantassociated microbes in heavy metal phytoremediation. Biotechnol. Adv. 30 (6), 1562e1574. Rather, I.A., Awasthi, P., Mahajan, V., Bedi, Y.S., Vishwakarma, R.A., Gandhi, S.G., 2015. Molecular cloning and functional characterization of an antifungal PR-5 protein from Ocimum basilicum. Gene 558, 143e151. Rizvi, A., Khan, M.S., 2018. Heavy metal induced oxidative damage and root morphology alterations of maize (Zea mays L.) plants and stress mitigation by metal tolerant nitrogen fixing Azotobacter chroococcum. Ecotoxicol. Environ. Saf.

K. Khanna et al. / Chemosphere 230 (2019) 628e639 157, 9e20. Sakihama, Y., Yamasaki, H., 2002. Lipid peroxidation induced by phenolics in conjunction with aluminum ions. Biol. Plant. 45 (2), 249e254. Seid, A., Fininsa, C., Mekete, T., Decraemer, W., Wesemael, W.M., 2015. Tomato (Solanum lycopersicum) and root-knot nematodes (Meloidogyne spp.)ea century-old battle. Nematology 17 (9), 995e1009. Sharma, A., Thakur, S., Kumar, V., Kanwar, M.K., Kesavan, A.K., Thukral, A.K., Bhardwaj, R., Alam, P., Ahmad, P., 2016. Pre-sowing seed treatment with 24epibrassinolide ameliorates pesticide stress in Brassica juncea L. through the modulation of stress markers. Front. Plant Sci. 7, 1569. Shen, B., Jensen, R.G., Bohnert, H.J., 1997. Mannitol protects against oxidation by hydroxyl radicals. Plant Physiol. 115 (2), 527e532. Sheng, X.F., Xia, J.J., Jiang, C.Y., He, L.Y., Qian, M., 2008. Characterization of heavy metal-resistant endophytic bacteria from rape (Brassica napus) roots and their potential in promoting the growth and lead accumulation of rape. Environ. Pollut. 156 (3), 1164e1170. Singh, S.K., Singh, P.P., Gupta, A., Singh, A.K., Keshri, J., 2019. Tolerance of heavy metal toxicity using pgpr strains of Pseudomonas species. In: PGPR Amelioration in Sustainable Agriculture. Woodhead Publishing, pp. 239e252. Sima, G., Fatemeh, Z., Vahid, N., 2012. Determination of peroxidase activity, total phenolic and flavonoid compounds due to lead toxicity in Medicago sativa L. Adv. Environ. Biol. 2357e2365. Singleton, V.L., Rossi, J.A., 1965. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. Am. J. Enol. Vitic. 16 (3), 144e158. Smeets, K., Cuypers, A., Lambrechts, A., Semane, B., Hoet, P., Van Laere, A., Vangronsveld, J., 2005. Induction of oxidative stress and antioxidative mechanisms in Phaseolus vulgaris after Cd application. Plant Physiol. Biochem. 43 (5), 437e444. Song, W.Y., Yang, H.C., Shao, H.B., Zheng, A.Z., Brestic, M., 2014. The alleviative effects of salicylic acid on the activities of catalase and superoxide dismutase in malting barley (Hordeum vulgare L.) seedling leaves stressed by heavy metals. Clean. - Soil, Air, Water 42 (1), 88e97.
ska, G., 2007. Changes in antioxidant enzyme activity in Stobrawa, K., Lorenc-Plucin

639

the fine roots of black poplar (Populus nigra L.) and cottonwood (Populus deltoids Bartr. ex Marsch) in a heavy-metal-polluted environment. Plant Soil 298 (1e2), 57e68. Sytar, O., Kumari, P., Yadav, S., Brestic, M., Rastogi, A., 2018. Phytohormone priming: regulator for heavy metal stress in plants. J. Plant Growth Regul. 1e14. Sytar, O., Cai, Z., Brestic, M., Kumar, A., Prasad, M.N.V., Taran, N., Smetanska, I., 2013. Foliar applied nickel on buckwheat (Fagopyrum esculentum) induced phenolic compounds as potential antioxidants. Clean. - Soil, Air, Water 41 (11), 1129e1137. Trevelyan, W.E., Harrison, J., 1956. Studies on yeast metabolism. 5. The trehalose content of baker's yeast during anaerobic fermentation. Biochem. J. 62 (2), 177e182. Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M., Rosen, S.G., 2012. Primer 3dnew capabilities and interfaces. Nucleic Acids Res. 40, e115. Varsha, T., Kumudini, B.S., 2018. Fluorescent Pseudomonas mediated alleviation of trivalent chromium toxicity in ragi through enhanced antioxidant activities. Proc. Natl. Acad. Sci. India B Biol. Sci. 88 (2), 779e787. Verma, S., Dubey, R.S., 2001. Effect of cadmium on soluble sugars and enzymes of their metabolism in rice. Biol. Plant. 44 (1), 117e123. Wasi, S., Tabrez, S., Ahmad, M., 2013. Use of Pseudomonas spp. for the bioremediation of environmental pollutants: a review. Environ. Monit. Assess. 185 (10), 8147e8155.
jcik, M., Sko
rzyn
ska-Polit, E., Tukiendorf, A., 2006. Organic acids accumulation Wo and antioxidant enzyme activities in Thlaspica erulescens under Zn and Cd stress. Plant Growth Regul. 48 (2), 145e155. Zaets, I., Kramarev, S., Kozyrovska, N., 2010. Inoculation with a bacterial consortium alleviates the effect of cadmium overdose in soybean plants. Open Life Sci. 5 (4), 481e490. Zhang, X., Zhong, T., Liu, L., Ouyang, X., 2015. Impact of soil heavy metal pollution on food safety in China. PLoS One 10 (8), e0135182. Zhishen, J., Mengcheng, T., Jianming, W., 1999. The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals. Food Chem. 64 (4), 555e559.