- Email: [email protected]
Suppression in the expression of a male-specific cytochrome P450, P450-male: Difference in the effect of chemical inducers on P450-male mRNA and protein in rat livers
ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS Vol. 270, No. 2, May 1, pp. 578~587,1989
Suppression in the Expression of a Male-Specific Cytochrome P450, P450-Male: Difference in the Effect of Chemical Inducers on P450-Male mRNA and Protein in Rat Livers MIKI
SHIMADA,’ NORIE MURAYAMA, KIYOMI YAMAUCHI, YASUSHI YAMAZOE, AND RYUICHI KATO
Department of Pharmmokgy, School of Medicine, Keio University, Shinjuku-ku, Tokyo 160, Japan
$5 Shinawmachi,
Received September 30,1988, and in revised form December 28,1988
Hypophysectomy of male adult rats caused a 70% decrease in the hepatic level of mRNA hybridized to two specific oligonucleotide probes for the sequence of coding and 3’-noncoding regions of P450(M-1) (H. Yoshioka et aL, (1987) J. Biol. Chm 262, 17061711), which corresponds to P450-male. Treatment of hypophysectomized male and female rats with subcutaneous injection of human growth hormone twice a day for 7 days increased the mRNA to a level similar to that of normal male rats. In contrast, the mRNA was decreased by treatment with continuous infusion. These results correlated well with those on the amounts of P450-male protein, indicating that growth hormone regulates the hepatic level of P450-male protein mainly by acting at the pretranslational step. Treatment of adult male rats with phenobarbital (PB), dexamethasone (Dex), or 3methylcholanthrene (MC) decreased the content of P450-male protein by 68,36, and 46%) respectively. The content of P450-male protein was also decreased to 65% in Dex-treated hypophysectomized male rats, but was not changed by treatment of hypophysectomized male rats with PB or MC, suggesting that PB and MC decrease P450-male protein through a pituitary growth hormone-mediated process. However, the level of mRNA hybridizable to the P450-male oligonucleotide probe was not decreased, but rather it increased in PB- or Dex-treated hypophysectomized male rats. A similar inconsistent change in protein and mRNA was also observed in PB-treated normal rats. These results indicate that PB and Dex have an additional effect of increasing the hepatic level of the specific mRNA of P450-male/(M-1) or a closely related form. Noncoordinate changes in the level of P450-male protein and mRNA also suggest that the hepatic level of P450male protein is regulated by plural mechanisms: pretranslational and translational regulation in which pituitary growth hormone and/or other endocrine factors are o 1989 Academic PRSS. IX involved.
nism for the expression of cytochrome P450, we and other investigators have shown that endocrine hormones such as testosterone, estradiol, insulin, and growth hormone participate in the regulation of constitutive forms of cytochrome P450 (6-16). In rats, the secretory pattern of growth hormone is known to be sex related (17). The basal level of serum growth hormone is higher in female than in male rats, but surges in the serum level are ob-
Cytochrome P450 in livers plays a major role in the oxidation of a wide variety of exogenous and endogenous compounds. The presence of multiple forms of cytochrome P450 has been demonstrated in livers of mammals (l-3), and their levels are also known to be influenced by several factors including age, sex, and treatment with drugs (4, 5). On the regulational mecha’ To whom correspondence
should be addressed.
0003-9861189 $3.00 Copyright All rights
0 1989 by Academic Press. Inc. of reproduction in any form reserved.
578
NONCOORDINATE
CHANGE IN P450-MALE mRNA AND PROTEIN
served in male rats by means of episodic releases. A male-specific cytochrome P450, P450male, is decreased by hypophysectomy in male rats, while a female-specific cytochrome P450, P450-female, disappears and P450-male appears in hypophysectomized female rats (18). The results from peptide mapping/Western blot with anti-P450male IgG indicate that the same protein, P450-male, is expressed in livers of adult normal male and hypophysectomized rats (18). Thus the difference in the secretory pattern of growth hormone is considered to be responsible mainly for the expression of P450-male and P450-female proteins. During the past decade, the mechanisms of induction of cytochrome P450 have been studied extensively (19). The mechanisms of degradation or inactivation by exogenous chemicals have also been investigated (20), but the details on the drug-induced decrease in cytochrome P450 remain unclear in many aspects. The content of P450-male protein is reported to be decreased by treatment of adult male rats with exogenous chemicals (21-23); the mechanism of the decrease is, however, unknown. The current study was undertaken to investigate whether the suppression of P450male by certain xenobiotics is the result of a direct effect on the liver or an influence on the pituitary growth hormone-mediated system. The present study demonstrates that (i) PB’ and MC decrease the hepatic content of P450-male protein mainly through the hypothalamus-pituitary growth hormonemediated system and (ii) the expression of P450-male is regulated by both the pretranslational and transcriptional steps of the expression. EXPERIMENTAL
PROCEDURES
Animal treatment Male Sprague-Dawley rate were purchased from Clea Japan, Tokyo, and g-week-old ‘Abbreviations used: PB, phenobarbital; MC, 3methylcholanthrene; Dex, dexamethasone; PCN, pregnenolone 16cu-carbonitrile; hGH, human growth hormone; SDS, sodium dodecyl sulfate; TEAA, triethylamineacetate; SSC, standard sodium citrate.
579
rats were used. Some animals, which were hypophysectomized at ‘7 weeks of age, were left to recover at least a week and then were given a subcutaneous injection (0.2 IU/lOO g body wt) twice a day or osmotic infusion (0.01 IU/h) of hGH (Kabi Vitrum, Stockholm, Sweden) for 7 days. For the infusion, an osmotic minipump (Alzet 2001, Alza Corp., Palo Alto, CA) was implanted on the back of the hypophysectomized rate as described previously (7, 8). Untreated or hypophysectomized &week-old male rats were treated intraperitoneally with PB (in saline, 80 mg/ kg, daily for 3 days), MC (in corn oil, 40 mg/kg, daily for 3 days), Dex (in corn oil, 100 mg/kg, daily for 4 days), or PCN (in corn oil, 75 mg/kg, daily for 3 days). The animals were sacrificed approximately 24 h after the last injection. Microsomes were prepared as previously reported (7) and stored at -80°C until use. PUrlfiCation Of P.45lhnuk and antibody. P450-male was purified from liver microsomes of untreated male rats as described previously (6). From the spectral and catalytic properties and N-terminal amino acid sequence, P450-male probably corresponds to P450h (24). P4502c/UTA (20), P450RLM5 (W), and P45016,, (26). This form belongs to the P45OIIC subfamily according to the recommended nomenclature of the cytochrome P450 gene (27). Monospecific antibody against P450-male was prepared as described previously (6). To remove cross-reacting components other than P450-male, the anti-P450-male IgG fraction was immunoadsorbed on a column of Eupergit C (RShm Pharma GmbH, Darmstadt, West Germany) on which liver microsomes from female rats had been covalently linked and treated according to the procedure described previously (15). Preparation of total RNA from rat livers. Total RNA was prepared from rat livers by the method of Chirgwin et al (28). The specific content of RNA was determined by the absorbance at 260 nm using a spectrophotometer (Beckman Du-65). Immunochemical quantitation of P&O-male. SDSpolyacrylamide gel electrophoresis was performed according to the method of Laemmli (29), using 7.5% gels for analysis of microsomal P450. Microsomal proteins were electrophoretically transferred to nitrocellulose paper (Western blot) and probed with anti-P450-male IgG as previously described (30, 31). Anti-P450-male IgG was used at 20 rg/ml. Peroxidase activity on the immunoblots was quantified with Quick Scan R&D (Helena Laboratories, Beaumont, TX). Synthesis and pur$catim of oligwr~tcleofirle. The nucleotide sequence of a cytochrome P450 identical to P450-male was reported (32). Two specific oligonucleotides corresponding to the nucleotide sequence of the anticoding strand (5’-GATATGTGAGTTAAAGCTACTATAGTTACC-3’) (noncoding probe) and (5’ATCCACGTGTTTCAGCAGCAGCAGGAGTCC - 3’) (coding probe) for parts of the respective 3’-noncoding (1540-1568) and coding (925-954) nucleotide se-
580
SHIMADA
quences of P45O(M-1) mRNA (32) were synthesized for the detection of P450-male mRNA using an Applied Biosystems 331A DNA synthesizer. The sequence of the coding oligonucleotide is the same as that used by Yoshioka et al (32). Using GenBank (Micro Genie, Beckman), P450-male/(M-1) coding and noncoding probes were compared with nucleic acid sequences of reported proteins and were found to share less than 50% nucleotide similarity with 16 rat P450 sequences. In addition, the specific oligonucleotide corresponding to the nucleotide sequence of the anticoding strand (5’-‘ITGCTGATCCACATCTGCTGGAAGGTGGAC-3’) for a part of the 3051-3030th nucleotide sequence of rat cytoplasmic @-actin gene was synthesized and used as a internal standard (33). The oligonucleotides, coding and noncoding probes, were purified by HPLC. A Nucleosil &is column (4 X 150 mm) preceded by a Nucleosil &is column (4.6 X 30 mm) was used with a mobile phase of 95% 0.1 M TEAA (pH 7.5)/5% acetonitrile and a linear gradient of 70% 0.1 M TEAA (pH 7.5)/30% acetonitrile for 20 min and then isocratically with 70% 0.1 M TEAA (pH 7.5)/30% acetonitrile for a further 5 min at a flow rate of 1.2 ml/min. Using a Waters 440 absorbance detector (254 nm), the main peak eluting at about 15 min was fractionated, and the solvent evaporated and then dissolved in 0.1 M Tris-HCl (pH 7.5) containing 10 mM EDTA (TE buffer). The specific content of DNA was determined by the absorbance at 260 nm. spP-hbeling of oligonucleotide. The incubation mixture (0.2 ml) consisted of 75 pmol of 5’-end dephosphorylated oligonucleotide, 50 mM Tris-HCl buffer (pH 8.0), 10 mM magnesium chloride, 250 &i [T-~P~ATP (-3000 Ci/mmol, Amersham), and 80 units of polynucleotide T( kinase (Pharmacia P-L Biochemicals). The reaction was started by the addition of polynucleotide T4 kinase and terminated by immersing the mixture on ice after an incubation at 37°C for 1 h. @‘P-labeled oligonucleotide was purified with a NACS column (Bethesda Res. Lab.). The specific activity was >5 X lo6 cpm/pmol. Estimation of mRNA level. For Northern blotting, 20 pg of total RNA was fractionated in a 1.2% formaldehyde-agarose gel (34) and transferred to nylon paper (Gene Screen, NEN). The filter was baked at 80°C for 2 h and then hybridized with the q-synthetic probe in 0.5 M sodium phosphate (pH 7.2) containing 7% SDS, 1% bovine serum albumin, and 1 mM EDTA at 52°C overnight after prehybridization with 0.1X SSC (15 mM sodium chloride/l.5 mM sodium citrate, pH 7.0) containing 0.5% SDS. The filter was washed with 0.2 M sodium phosphate (pH 7.2), 1% SDS, 1 mM EDTA at 52°C for 30 min twice, essentially following the method of Church and Gilbert (35). After being washed, the filter was exposed at -80°C. For slot blotting (Minifold II, Schleicher & Schull, Inc.), 10 Fg of total RNA was blotted according to the procedure recommended by Schleicher & Schull and performed following the procedure as described for
ET AL. Northern blotting. After the exposure to X-ray film, the radioactivity was spot counted using a liquid scintillation counter. Quantification was carried out using the level of @-actin mRNA as internal standard. Other assay methodsMicrosomal testosterone oxidation was measured as described previously (15), except that a Chemcosorb ODS-5H column (6 X 150 mm) preceded by a precolumn (4.6 X 30 mm) containing the same packing material was used to improve the separation between l- and 16@-hydroxytestosterones, and between &-hydroxytestosterone and an unidentified metabolite, which probably corresponds to 13 hydroxytestosterone as recently reported (36). Microsomal protein was determined by the method of Lowry et al (37). Cytochrome P450 content was measured from the CO reduced difference spectrum (33), except that 20% glycerol and 0.2% Emulgen 913 (Kao-Atalas, Ltd., Tokyo) were included.
RESULTS
Regulation of P&O-Male Protein and mRNA bg Growth Hormone As already reported (7, 8, lo), a malespecific P450-male protein in rat livers is regulated by the secretory pattern of growth hormone. To further understand the regulating mechanism of P450-male by growth hormone, the effects of growth hormone on the level of hepatic P450-male mRNA were examined. In Northern blots with a specific 29-mer oligonucleotide (noncoding probe), a hybridizable band (P450-male/(M-1) mRNA) was detected at about 19 s in the RNA prepared from untreated male rats. As shown in Fig. 1, hypophysectomy significantly decreased the level of P450-male/(M-1) mRNA in male rats. Treatment of hypophyseetomized rats with intermittent injection of hGH, which mimicked the secretory pattern of pituitary growth hormone in adult male rats, restored the mRNA to a level similar to that observed in adult male rats. However, P450-male/(M-1) mRNA was almost abolished in hypophysectomized male rats after infusion of hGH, which mimicked the secretory pattern of pituitary growth hormone in adult female rats. On the other hand, the P450-male/(M-1) mRNA was not detected in total hepatic RNA obtained from female rats but was detectable in hypophysectomized female rats. In addition, the level of P450-male/
NONCOORDINATE
C
H
H
CHANGE
HCHHH
&i
G+H
G+H iii
(s)
(iI
(s)
6
IN P450-MALE
(iI
Q
FIG. 1. Northern blot analysis of P450-male mRNA in livers of hypophysectomized and hGH-treated male and female rats. Twenty micrograms of the total RNA preparation was fractionated by electrophoresis in a 1.2% agarose gel containing 2.2 M formaldehyde, blotted to a nylon filter, and hybridized with noncoding probe. 8, Male rats; 9, female rats; C, untreated rats, H, hypophysectomized rats; GH(s), rats treated intermittently with hGH, GH(i), hGH-infused rats.
(M-l) mRNA in hypophysectomized female rats was increased to that of adult male rats by intermittent administration of hGH. A faint extra band was observed in hGH-treated hypophysectomized female rats but was undetectable when the Northern analysis was performed under more stringent conditions. In contrast, the level of P450-male/(M-1) mRNA was decreased to that of adult female rats by infusion of hypophysectomized female rats with hGH. To further ascertain the change in the level of P450 mRNA, another 30-mer oligonucleotide (coding probe) was used. Essentially the same results were obtained in Northern blots using the oligonucleotide probe (data not shown). The change in the level of P450-male/ (M-l) mRNA was quantified by slot-blot hybridization. In an experiment using the coding probe, the level of P450-male/(M-1) mRNA was decreased to about 30% of the normal male level by hypophysectomy (Fig. 2A). P450-male/(M-1) mRNA was restored to a level similar to that in normal male rats by intermittent treatment of hypophyseetomized male rats with hGH. However, the mRNA was decreased to less
mRNA
AND
PROTEIN
581
than 5% of the level of normal male rats by infusion of hGH to hypophysectomized male rats. Similar results were also obtained using the noncoding probe for P450male mRNA (Fig. 2B). These results were largely consistent with the data reported recently (39). In immunoblots, the specific content of P450-male was 0.28 nmol/mg microsomal protein in male rat livers. Hypophysectomy decreased the content of P450-male by 50%, but the content was restored to that of normal rats by intermittent administration of hGH. In contrast, P450-male was decreased to less than 15% that of the normal male by infusion with hGH (Fig. 2C). Therefore, the content of P450-male/ (M-l) mRNA correlates largely with the amounts of P450-male protein in livers of rats with different levels of growth hormone, indicating that the expression of P450-male is mainly regulated at the pretranslational step in normal rats. Effects of PB, Dex, and MC on the Content of P&&Male in Neal and Hypophysectmnized Male Rats Treatment of normal male rats with PB, Dex, or MC decreased the specific content of P450-male protein by 68, 35, and 50%, respectively (Table I). These results confirmed previous data on the effects of PB and MC on the content of P450-male (21,23). As described above, P450-male protein is known to be regulated by pituitary growth hormone. Thus, PB, Dex, or MC can possibly act at either the liver or the hypothalamuspituitary for decreasing the content of P450male protein. To verify these possibilities, the effects of these chemicals on hypophysectomized male rats were examined. Hypophysectomy decreased the specific content of P450-male protein by 50% in normal male rats, although the content of total cytochrome P450 was not affected (data not shown). Treatment of hypophysectomized rats with Dex decreased the content of P450-male protein by 65% as compared to that of nontreated hypophysectomized rats. But the amounts of P450male protein were not changed in PB- or MC-treated hypophysectomized male rats.
SHIMADA
582 Relative (coding
mRNA
ET AL. Protein
levels (46)
probe)
0
(noncoding probe) E-0 loo
bmolhg 0
.l
protein) a
a
FIG. 2. Effects of hypophysectomy and hGH treatment on the levels of P450-male mRNA and protein in male rat livers. Columns and bars indicate the means + SD of the data obtained from three to four individual animals. C, Untreated rats; H, hypophysectomized rats; GH(s), rats treated intermittently with hGH, GH(i), hGH-infused rats. “Values are significantly different from those of the corresponding control rats (P < 0.05). bValues are significantly different from those of the corresponding hypophysectomized rats (P c: 0.05). Other experimental details are described under Experimental Procedures.
Testosterone ti- and 16@hydroxylations are reported to be catalyzed selectively by P450-male (8, 40) and PB-inducible cytochrome P450, P450b/e respectively (41). To ascertain the effect of PB treatment on the
contents of P450-male and P45Ob/e protein in hypophysectomized male rats, microsomal testosterone 2a- and 16/3-hydroxylations were quantified as shown in Fig. 3. (nmobmg protein/min)
TABLE I
0
1
2
3
EFFECTS OF PB, DEX, OR MC ON HEPATIC CONTENT OF P450-MALE IN NORMAL AND HYPOPHYSECTOMIZED MALE RATS
Treatment
P450-male (nmol/mg protein)
Normal +PB +Dex +MC
(n = 4) (n=3) (n = 3) (n = 3)
0.23 f 0.03
Hypox +PB +Dex +MC
(n = 4) (n= 3) (n= 6) (n= 3)
0.15 f O.Ola 0.17 rt 0.01” 0.10 * 0.04=*6 0.14 + 0.05n
0.19 * 0.05’ 0.10 + 0.01” 0.13 + 0.03&
Relative amount (%) 100” 67.9
PB H H+PB
rb
35.7 46.4
60.7
100d 113.2
35.7
66.6
50.0
93.3
53.6
Note. The means f standard deviations of the data obtained from the numbers of the animals indicated in parentheses are shown in this table. @Values are significantly different from those of the corresponding normal rats (P < 0.05). bValues are significantly different from those of the corresponding hypophysectomized (Hypox) rats (P < 0.05). crdThe relative amounts of P450-male to the respective amounts of normal and hypophysectomized rats are presented.
FIG. 3. Effects of treatment with phenobarbital on hepatic testosterone 2a- and 16j3-hydroxylations in normal and hypophysectomized male rats. Columns and bars indicate the means + SD of the data obtained from three to four individual animals. C, Untreated rats; PB, phenobarbital-treated rats; H, hypophysectomized rats; H + PB, phenobarbitaltreated hypophysectomized rats. “Values are significantly different from those of the corresponding control (C) rats (P < 0.05). bValues are significantly different from those of the corresponding hypophysectomized (H) rats (P < 0.05). Other experimental details are described under Experimental Procedures.
NONCOORDINATE
CHANGE IN P450-MALE mRNA AND PROTEIN
583
FIG. 4. Northern blot analysis of P450-male mRNA in livers of exogenous chemical-treated male and female rats. The data obtained using the coding and noncoding probes are shown in A and B, respectively. 8, Male rats; P, female rats; C, untreated rats; PB, phenobarbital-treated rats; Dex, dexamethasone-treated rats; PCN, pregnenolone 16a-carbonitrile-treated rats; MC, 3-methylcholanthrene-treated rats. Other experimental details are described under Experimental Procedures.
The formation of 16/3-hydroxytestosterone was increased 45-fold in PB-treated male rats. Testosterone 16@-hydroxylation was also increased more than 2-fold in male rats by hypophysectomy. A further increase in testosterone 16B-hydroxylation was observed in PB-treated hypophysectomized rats. The rate of formation of Ba-hydroxytestosterone was reduced to 37% in PBtreated male rats. Hypophysectomy also reduced the rate of the formation of a-hydroxytestosterone to 50% of that in normal rata. However, the rate of formation of ~XXhydroxytestosterone did not differ between hypophysectomized and PB-treated hypophysectomized male rats. These results are in good agreement with the data obtained from immunoblot analyses of P450-male protein (Table I), confirming that P450-male protein in hypophysectomized rats is not affected by treatment with PB and exists mainly in the functionally active form. Effects of PB, Dex, and MC on the Hepatic Level of P.&W-Male mRNA in Normal and Hgpophgsectomixed Male Rats To further understand the regulational mechanism of P450-male, the levels of P450-male mRNA in PB-, Dex-, or MCtreated rats were quantitated as shown in Fig. 4. In Northern blot analyses with the coding probe, only a single band at about 19 s was detected in livers of rats treated with these chemicals, except that a weak
hybridizing additional band was observed in Dex-treated male rats. P450-male/(M1) mRNA had a tendency to be decreased by the treatment with Dex, PCN, or MC. In contrast, the specific mRNA was not decreased but rather increased slightly by the treatment of normal rats with PB. Similar results were also obtained with the noncoding probe (Fig. 4B). In addition, P450-male/(M-1) mRNA was not detected in livers of PB-, Dex-, PCN-, or MC-treated female rats, which is consistent with the reports on P450-male protein (21). The levels of P450-male/(M-1) mRNA in PB-, Dex-, or MC-treated hypophysectomized male rats are shown in Fig. 5. In Northern analyses with the noncoding probe, only a faint band was detected at about 19 s in livers of hypophysectomized male rats. A marked increase in the level of P450-male/(M-1) mRNA was observed in livers of PB- or Dex-treated hypophysectomized male rats. However, the level of P450-male/(M-1) mRNA was not changed or slightly increased in livers of MCtreated hypophysectomized male rats. To compare the effects of PB, Dex, and MC on the level of P450-male protein and mRNA in normal (GH-nondeficient) and hypophysectomized (GH-deficient) male rats, relative changes in the level of P450male protein and mRNA are examined as shown in Figs. 6 and 7, respectively. A large individual difference was observed in
SHIMADA
584
-r
H
H+PB
H+Dex
H+MC
FIG. 5. Northern blot analysis of P450-male mRNA in PB-, Dex-, or MC-treated hypophysectomized male rats. H, Hypophysectomized rata; H + PB, phenobarbital-treated hypophysectomized rats; H + Dex, dexamethasone-treated hypophysectomized rats; H + MC, 3-methylcholanthrene-treated hypophysectomized rats. The results obtained from three to four different rats are shown. Other experimental details are described under Experimental Procedures.
the level of P450-male/(M-1) mRNA in Dex-treated normal male rats. But the mean level was not significantly different from the normal level. Despite a clear decrease in the amount of P450-male protein, the level of P450-male/(M-1) mRNA was not changed in MC-treated normal male rats (Fig. 6). The highest level of P450male/(M-1) mRNA was obtained after administration for 3 days during the time course of PB administration for 1,3,5, or 7 consecutive days. The level of P450-male/(M-1) mRNA was decreased by hypophysectomy by 30%) but treatment of hypophysectomized male rats with PB increased the mRNA about 5-fold, which was nearly the same as that observed in PB-treated normal rats (Fig. 7). Treatment with Dex also increased the level of P450-male/(M-1) mRNA 2.3-fold in hypophysectomized male rats, which was in contrast with that obtained from the results in Dex-treated normal rats (Fig. 6). However, the change in the level of mRNA was largely coordinated with the amount of P450-male protein in MC-treated hypophysectomized male rats. To assess the identity of the mRNA obtained from PBtreated hypophysectomized male rats, the temperature dependency during hybridization with the noncoding probe for P450male/(M-1) mRNA was examined between the RNAs from normal and PB-treated hypophysectomized male rats. Slot-blot hybridization was carried out and filters were washed at 42,47, or 52°C. After exposure
ET AL.
to X-ray film, the radioactive spot was cut out and counted. The level of hybridizable mRNA with the specific probe for P450male/(M-1) mRNA was changed in parallel in normal and PB-treated hypophysectomized male rats under the different hybridizing temperatures. These results suggest that P450-male/(M-1) mRNA is increased in PB-treated hypophysectomized male rats. DISCUSSION
We have recently reported that P450male is regulated mainly by growth hormone in rats (7, 8). To investigate the mechanism for regulation of P450-male by growth hormone, the levels of specific mRNA have been examined in this study. As shown in Fig. 2, changes in P450-male mRNA in livers of normal, hypophysectomized, and hGH-treated hypophysectomized rats, as measured by the use of two specific oligonucleotide probes corresponding to the sequence of coding and 3’-noncoding regions of P450-male/(M-1) mRNA,
Relative
levels
(9
c
PB
DI3X
FIG. 6. Relative changes in the level of P450-male protein and mRNA in PB-, Dex-, or MC-treated normal male rats. C, Untreated rats; PB, phenobarbitaltreated rats; Dex, dexamethasone-treated rats; MC, 3-methylcholanthrene-treated rats. Essentially the same results were obtained with the slot-blot hybridization using both coding and noncoding probes. Thus, the means of both are shown. Columns and bars indicate the means + SD of the relative levels obtained with three to four individual animals. Other experimental details are described under Experimental Procedures.
NONCOORDINATE
I
CHANGE IN P450-MALE mRNA AND PROTEIN
I
H
H + PB
H + Des
H+MC
cl
PWtein UIRNA
FIG. 7. Relative changes in the level of P450-male protein and mRNA in PB-, Dex-, or MC-treated hypophysectomized male rats. H, Hypophysectomized rats, H + PB, phenobarbital-treated hypophysectomized rats; H + Dex, dexamethasone-treated hypophysectomized rats; H + MC, 3-methylcholanthrene-treated hypophysectomized rats. Columns and bars indicate the means + SD of the relative levels obtained with three to four individual animals. Other experimental details are the same as described in Fig. 6.
were in good agreement with each other, and were also consistent with results of immunoblots of P450-male protein. These results indicate that growth hormone modulates the hepatic content of P450male protein mainly at the pretranslational step. Rampersaud et a& using two-dimensional electrophoresis (42), reported that P450h/2c, which corresponds to P450male, was characterized by at least three allelomorphic variants. However, Morishima et aZ.,using genomic Southern blot analysis (43), have recently reported that the P450(M-1) gene is transcribed from a single locus. The results obtained in this study suggest that P450-male protein is likely to be regulated mainly by the pretranslational step, irrespective of the possible existence of plural forms. In the present study, the mechanism of P450-male protein suppression by treatment with PB, Dex, or MC was also examined. These treatments decreased the content of P450-male protein in adult male rats (Table 1 and (19-21)). However, the specific content of P450-male protein was not changed in PB-treated hypophysecto-
585
mized male rats. Similarly, the content of P450-male protein was also not affected by treatment of hypophysectomized male rats with MC, although treatment with Dex decreased the content of P450-male to 65% of that in hypophysectomized male rats. These results indicate that PB and MC reduced the hepatic content of P450male, mainly through the pituitary growth hormone-mediated system. However, the decrease in the content of P450-male in Dex-treated hypophysectomized rats indicates that Dex decreases the content of P450-male not only through the growth hormone-mediated system but also directly by acting, probably, at the hepatic level. In RNA blot analyses using the oligonucleotide probes, the level of P450-male mRNA had a tendency to be decreased in Dex-treated normal male rats, but not significantly from the normal group. The level of P450-male mRNA was also not affected by treatment with MC (Figs. 4 and 6). These results suggest that the decrease in the amount of P450-male protein was not accounted for only by the decrease in the level of its mRNA. Yeowell et aL, using an in vitro translation system (44), reported that translatable amounts of P4502c, which corresponds to P450-male, were decreased to about 50% of the normal levels in MC-treated adult male rats. The reason for the differences in the extent of decrease is unclear, but may be because of the differences in the methods used for quantitation of the mRNA level. In contrast to MC- or Dex-treated rats, the mRNA was not decreased but rather increased about twofold in PB-treated normal rats, although a significant decrease in the content of P450-male protein was observed (Fig. 6). In addition, treatment of hypophysectomized male rats with PB and Dex also increased the level of P450-male mRNA by five- and two-fold, respectively (Fig. 7). In this experiment, no hybridization with two specific oligonucleotide probes was detected in PB- and Dextreated female rats in Northern analyses (Fig. 3). In addition, P450-male/(M-1) mRNA was also not detectable in livers of untreated immature and PB-treated immature male rats (data not shown). These
SHIMADA
586
ET AL.
results suggest that PB and Dex enhance Japan and by a grant-in-aid for new drug developthe hepatic level of P450-male mRNA in ment from the Ministry of Health and Welfare, Jahypophysectomized male rats rather than pan. The authors thank Drs. Kiyoshi Nagata and Toexpressing an uncharacterized mRNA hy- shio Yasumori of our laboratory for their advice on bridizable to the oligonucleotide probes, RNAb1otanalysis. although the possibility of the induction of REFERENCES minor uncharacterized cytochrome P450 1. BLACK, S. D., AND COON, M. J. (1985) in CytomRNA by PB and Dex is not excluded in chrome P-450: Structure, Mechanism, and Biothis study. chemistry (Ortiz de Montellano, P. R., Ed.), pp. The current evidence suggests that the 161-216, Plenum, New York/London. rate of transcription is the major factor in 2. WHITELOCK, J. P., JR. (1986) Annu Rev. Pharmacontrolling expression of most hepatic cyml Tcnkol26,333-369. tochrome P450 genes. However, recent 3. ADESNIK, M., AND ATCHISON, M. (1986) Crit. Rev. studies have shown that hepatic cytoB&hem 19,247-305. 4. KATO, R. (1977) X&&u 7,12-92. chrome P450 is also controlled by post5. KATO, R., AND KAMATAKI, T. (1982) Xe&&x%xz transcriptional mechanisms (45-47). Dex 12,787-800. was also reported to stabilize NADPH-cy6. KAMATAKI, T., MAEDA, K., YAMAZOE, Y., NAGAI, tochrome P450 oxidoreductase mRNA and T., AND KATO, R. (1983) Arch Biochem Biocytochrome P450b homologous mRNA phys 225,758-770. (48). Thus, the increased level of P450-male 7. YAMAZOE, Y., SHIMADA, M., KAMATAKI, T., AND mRNA in Dex-treated GH-deficient rats KATO, R. (1986) Japan J. Phurm.ad 42,371might be due in part to the stabilizing 382. effect of Dex. 8. KATO, R., YAMAZOE, Y., SHIMADA, M., MURARecently Emi and Omura, using an in viYAMA, N., AND KAMATAKI, T. (1986) J. Biochem. 100,895-902. tro translation system, have reported that the hepatic level of P450(M-1) mRNA is de- 9. DANNAN, G. A., GUENGERICH, F. P., AND WAXMAN, D. J. (1986) J. Bid Chem. 261, 10728creased transiently by a single dose of PB 10735. or MC administration, and that the level is 10. MORGAN, E. T., MACGEOCH, C., AND GUSTAFSSON, restored to normal at 24 h after the drug J.-A. (1985) J. Bid Chem 260,11,895-11,898. injection (49). In the present study, rats 11. FAVREAU, L. V., AND SCHENKMAN, J. B. (1987) Biowere treated with PB or MC for 3 consecuthem. Biophys Res. Commun 142,623-630. tive days. The difference in mode of admin- 12. YAMAZOE, Y., SHIMADA, M., MURAYAMA, N., NAistration may cause the apparent differGATA, K., AND KATO, R. (1989) in Xenobiotic ence in P450-male/(M-1) mRNA levels. Metabolism and Disposition (Kato, R,. Estabrook, R. W., and Cayen, M. N., Eds.), pp. 37In conclusion, the noncoordinate change 44, Taylor & Francis, London-New Yorkin the level of P450-male protein and Philadelphia. mRNA in PB- or Dex-treated rats indicates that chemical-induced suppression 13. MACGEOCH, C., MORGAN,E. T., AND GUSTAFSSON, J.-A. (1985) Endocri?wlogy 117,2085-2092. of P450-male protein occurs by dual mech14. YAMAZOE, Y., SHIMADA, M., MURAYAMA, N., KAanisms directly through action on livers WANO, S., AND KATO, R. (1986) J. Biochem. 100, and indirectly through action on the 1095-1097. growth hormone-mediated process in rats. 15. YAMAZOE, Y., SHIMADA, M., MURAYAMA, N., AND In addition, differences in P450-male proKATO, R., (1987) J. BioL Chem 262,7423-7428. tein and mRNA in PB- or Dex-treated hy- 16. YAMAZOE, Y., MURAYAMA, N., SHIMADA, M., YAMAUCHI, K., NAGATA, K., IMAOKA, S., FUNAE, pophysectomized rats suggest that P450Y., AND KATO, R. (1988) J. B&hem 104,730male protein is regulated by plural steps, 734. pretranslational and translational mechanisms, in which growth hormone or other 17. EDEN, S. (1979) En&wrin@v 105.555-560. 18. KAMATAKI, T., SHIMADA, M., MAEDA, K., AND endocrine factors exert the effect. KATO, R. (1985) Biochem Biophys. Res. Gnn-
ACKNOWLEDGMENTS This work was supported in part by a grant-in-aid from the Ministry of Education, Science and Culture,
mun 130,1247-1253. 19. NEBERT, D. W., AND GONZALEZ, F. J. (1987) Annu. Rev. Biochem. 56,945-993. 20. ORTIZ DE MONTELLANO, P. R., AND REICH, N. 0. (1986) in Cytochrome P-450: Structure, Mecha-
NONCOORDINATE
21. 22. 23.
24.
CHANGE
IN P450-MALE
nism, and Biochemistry (Ortiz de Montellano, P. R., Ed.), pp. 273-314, Plenum, New York/ London. KAMATAKI, T., MAEDA, K., SHIMADA, M., AND KATO, R. (1986) J. Biochem 99,841-845. WAXMAN, D. J., DANNAN, G. A., AND GUENGERICH, F. P. (1985) Biochemistry 24.4409-4417. GUENGERICH, F. P., DANNAN, G. A., WRIGHT, S. T., MARTIN, M. V., AND KAMINSKY, L. S. (1982) Biochemistry 21,6019-6030. RYAN, D. E., IIDA, S., WOOD, A. W., THOMAS, P. E., LIEBER, C. S., AND LEVIN, W. (1984) J.
Bid Chmn 259,1239-X50. 25. CHENG, K.-C., AND SCHENKMAN, J. B. (1982) J.
Bid Chen 257,23’78-2385. 26. MORGAN, E. T., MACGEOCH, C., AND GUSTAFSSON, J.-A. (1985) MoL PharmumL 27,471-479. 27. NEBERT, D. W., ADESNIK, M., COON, M. J., ESTABROOK, R. W., GONZALEZ, F. J., GUENGERICH, F. P., G~NSALUS, I. C., JOHNSON, E. F., KEMPER, B., LEVIN, W., PHILLIPS, I. R., SATO, R., AND WATERMAN, M. R. (1987) DNA 6,1-11. 28. CHIRGWIN, J. M., PRZYBYLA, A. E., MACDONALD, R. J., AND RULER, W. J. (1979) Biochemistrg 18.5249-5299. 29. LAEMMLI, U. K. (1970) Nature (London) 227,680685. 30. TOWBIN, H., STAEHELIN, T., AND GORDON, J. (1979) Proc NatL Acad Sci USA 76,4350-4354. 31. GUENGERICH, F. P., WANG, P., AND DAVIDSON, N. K. (1982) Biochaistry 21,1698-1706. 32. YOSHIOKA, H., MOROHASHI, K., SOGAWA, K., MIYATA, T., KAWAJIRI, K., HIROSE, T., INAYAMA, S., FUJII-KURIYAMA, Y., AND OMURA, T. (1987) J. Bid Chem 262,1706-1711. 33. NUDEL, U., ZAKUT, R., NEUMAN, S., LEW, Z., AND YAFFE, D. (1983) Nucleic Acids Res. 11,17591771. 34. LEHRACH, H. D., DIAMOND, D., WOZNEY, J. M., AND BOEDTKER, H. (1977) Biochemistry 16, 4743-4751.
mRNA
AND
PROTEIN
587
35. CHURCH, G. M., AND GILBERT, W. (1984) Proc NatL Acad Sci USA 81,1991-1995. 36. SONDERFAN, A. J., ARLO~O, M. P., DUTTON, D. R., MCMILLEN, S. K., AND PARKINSON, A. (1987)
Arch Biochem. Biophys. 255,27-41. 37. LOWRY, 0. H., ROSEBROUGH, N. J., FARR, A. L., AND RANDAU, R. J. (1951) J. Bid Chem 193, 265-275. 38. OMURA, T., AND SATO, R. (1964) J. BioL Chem 239, 2370-2378. 39. ZAPHIROPOULOS, P. G., MODE, A., STROM, A., MOLLER, C., FERNANDEZ, C., AND GUSTAFSSON, J.-A. (1988) Proc. NatL Acad Sci USA 85,42144217. 40. RYAN, D. E., IIDA, S., WOOD, A. W., THOMAS, P. E., LIEBAR, C. S., AND LEVIN, W. (1984) J.
BioL Chem 259,1239-1250. 41. WOOD, A. W., RYAN, D. E., THOMAS, P. E., AND LEVIN, W. (1983) J. Bid Chem. 258,8839-8847. 42. RAMPERSAUD, A., WAXMAN, D. J., RYAN, D. E., LEVIN, W., AND WALZ, F. G., JR. (1985) Arch.
Biochem Biophys. 243.174-183. 43. MORISHIMA, N., YOSHIOKA, H., HIGASHI, Y., SoGAWA, K., AND FUJII-KURIYAMA, Y. (1987) Bio-
chemistry 26,8279-8285. 44. YEOWELL, H. N., WAXMAN, D. J., WADHERA, A., AND GOLDSTEIN, J. A. (1987) MoL PhamL 32,340-347. 45. SONG, B. J., MATSUNAGA, T., HARDWICK, J. P., PARK, S. S., VEECH, R. L., YANG, C. S., GELBOIN, H. V., AND GONZALEZ, F. J. (1987) MoL En&m-i-
rwL 546,542-547. 46. KIMURA, S., GONZALEZ, F. J., AND NEBERT, D. W. (1986) MoL CeU BioL 6,1471-1477. 47. PASCO, D. S., BOYUM, K. W., MERCHANT, S. N., CHALBERG, S. C., AND FAGAN, J. B. (1988) J. Bid Chem 263,8671-8676. 48. SIMMONS, D. L., MCQUIDDY, P., AND KASPER, C. B. (1987) J. BioL Chem 262,326-332. 49. EMI, Y., AND OMURA, T. (1988) J. Biochem 104,4043.
Suppression in the Expression of a Male-Specific Cytochrome P450, P450-Male: Difference in the Effect of Chemical Inducers on P450-Male mRNA and Protein in Rat Livers MIKI
SHIMADA,’ NORIE MURAYAMA, KIYOMI YAMAUCHI, YASUSHI YAMAZOE, AND RYUICHI KATO
Department of Pharmmokgy, School of Medicine, Keio University, Shinjuku-ku, Tokyo 160, Japan
$5 Shinawmachi,
Received September 30,1988, and in revised form December 28,1988
Hypophysectomy of male adult rats caused a 70% decrease in the hepatic level of mRNA hybridized to two specific oligonucleotide probes for the sequence of coding and 3’-noncoding regions of P450(M-1) (H. Yoshioka et aL, (1987) J. Biol. Chm 262, 17061711), which corresponds to P450-male. Treatment of hypophysectomized male and female rats with subcutaneous injection of human growth hormone twice a day for 7 days increased the mRNA to a level similar to that of normal male rats. In contrast, the mRNA was decreased by treatment with continuous infusion. These results correlated well with those on the amounts of P450-male protein, indicating that growth hormone regulates the hepatic level of P450-male protein mainly by acting at the pretranslational step. Treatment of adult male rats with phenobarbital (PB), dexamethasone (Dex), or 3methylcholanthrene (MC) decreased the content of P450-male protein by 68,36, and 46%) respectively. The content of P450-male protein was also decreased to 65% in Dex-treated hypophysectomized male rats, but was not changed by treatment of hypophysectomized male rats with PB or MC, suggesting that PB and MC decrease P450-male protein through a pituitary growth hormone-mediated process. However, the level of mRNA hybridizable to the P450-male oligonucleotide probe was not decreased, but rather it increased in PB- or Dex-treated hypophysectomized male rats. A similar inconsistent change in protein and mRNA was also observed in PB-treated normal rats. These results indicate that PB and Dex have an additional effect of increasing the hepatic level of the specific mRNA of P450-male/(M-1) or a closely related form. Noncoordinate changes in the level of P450-male protein and mRNA also suggest that the hepatic level of P450male protein is regulated by plural mechanisms: pretranslational and translational regulation in which pituitary growth hormone and/or other endocrine factors are o 1989 Academic PRSS. IX involved.
nism for the expression of cytochrome P450, we and other investigators have shown that endocrine hormones such as testosterone, estradiol, insulin, and growth hormone participate in the regulation of constitutive forms of cytochrome P450 (6-16). In rats, the secretory pattern of growth hormone is known to be sex related (17). The basal level of serum growth hormone is higher in female than in male rats, but surges in the serum level are ob-
Cytochrome P450 in livers plays a major role in the oxidation of a wide variety of exogenous and endogenous compounds. The presence of multiple forms of cytochrome P450 has been demonstrated in livers of mammals (l-3), and their levels are also known to be influenced by several factors including age, sex, and treatment with drugs (4, 5). On the regulational mecha’ To whom correspondence
should be addressed.
0003-9861189 $3.00 Copyright All rights
0 1989 by Academic Press. Inc. of reproduction in any form reserved.
578
NONCOORDINATE
CHANGE IN P450-MALE mRNA AND PROTEIN
served in male rats by means of episodic releases. A male-specific cytochrome P450, P450male, is decreased by hypophysectomy in male rats, while a female-specific cytochrome P450, P450-female, disappears and P450-male appears in hypophysectomized female rats (18). The results from peptide mapping/Western blot with anti-P450male IgG indicate that the same protein, P450-male, is expressed in livers of adult normal male and hypophysectomized rats (18). Thus the difference in the secretory pattern of growth hormone is considered to be responsible mainly for the expression of P450-male and P450-female proteins. During the past decade, the mechanisms of induction of cytochrome P450 have been studied extensively (19). The mechanisms of degradation or inactivation by exogenous chemicals have also been investigated (20), but the details on the drug-induced decrease in cytochrome P450 remain unclear in many aspects. The content of P450-male protein is reported to be decreased by treatment of adult male rats with exogenous chemicals (21-23); the mechanism of the decrease is, however, unknown. The current study was undertaken to investigate whether the suppression of P450male by certain xenobiotics is the result of a direct effect on the liver or an influence on the pituitary growth hormone-mediated system. The present study demonstrates that (i) PB’ and MC decrease the hepatic content of P450-male protein mainly through the hypothalamus-pituitary growth hormonemediated system and (ii) the expression of P450-male is regulated by both the pretranslational and transcriptional steps of the expression. EXPERIMENTAL
PROCEDURES
Animal treatment Male Sprague-Dawley rate were purchased from Clea Japan, Tokyo, and g-week-old ‘Abbreviations used: PB, phenobarbital; MC, 3methylcholanthrene; Dex, dexamethasone; PCN, pregnenolone 16cu-carbonitrile; hGH, human growth hormone; SDS, sodium dodecyl sulfate; TEAA, triethylamineacetate; SSC, standard sodium citrate.
579
rats were used. Some animals, which were hypophysectomized at ‘7 weeks of age, were left to recover at least a week and then were given a subcutaneous injection (0.2 IU/lOO g body wt) twice a day or osmotic infusion (0.01 IU/h) of hGH (Kabi Vitrum, Stockholm, Sweden) for 7 days. For the infusion, an osmotic minipump (Alzet 2001, Alza Corp., Palo Alto, CA) was implanted on the back of the hypophysectomized rate as described previously (7, 8). Untreated or hypophysectomized &week-old male rats were treated intraperitoneally with PB (in saline, 80 mg/ kg, daily for 3 days), MC (in corn oil, 40 mg/kg, daily for 3 days), Dex (in corn oil, 100 mg/kg, daily for 4 days), or PCN (in corn oil, 75 mg/kg, daily for 3 days). The animals were sacrificed approximately 24 h after the last injection. Microsomes were prepared as previously reported (7) and stored at -80°C until use. PUrlfiCation Of P.45lhnuk and antibody. P450-male was purified from liver microsomes of untreated male rats as described previously (6). From the spectral and catalytic properties and N-terminal amino acid sequence, P450-male probably corresponds to P450h (24). P4502c/UTA (20), P450RLM5 (W), and P45016,, (26). This form belongs to the P45OIIC subfamily according to the recommended nomenclature of the cytochrome P450 gene (27). Monospecific antibody against P450-male was prepared as described previously (6). To remove cross-reacting components other than P450-male, the anti-P450-male IgG fraction was immunoadsorbed on a column of Eupergit C (RShm Pharma GmbH, Darmstadt, West Germany) on which liver microsomes from female rats had been covalently linked and treated according to the procedure described previously (15). Preparation of total RNA from rat livers. Total RNA was prepared from rat livers by the method of Chirgwin et al (28). The specific content of RNA was determined by the absorbance at 260 nm using a spectrophotometer (Beckman Du-65). Immunochemical quantitation of P&O-male. SDSpolyacrylamide gel electrophoresis was performed according to the method of Laemmli (29), using 7.5% gels for analysis of microsomal P450. Microsomal proteins were electrophoretically transferred to nitrocellulose paper (Western blot) and probed with anti-P450-male IgG as previously described (30, 31). Anti-P450-male IgG was used at 20 rg/ml. Peroxidase activity on the immunoblots was quantified with Quick Scan R&D (Helena Laboratories, Beaumont, TX). Synthesis and pur$catim of oligwr~tcleofirle. The nucleotide sequence of a cytochrome P450 identical to P450-male was reported (32). Two specific oligonucleotides corresponding to the nucleotide sequence of the anticoding strand (5’-GATATGTGAGTTAAAGCTACTATAGTTACC-3’) (noncoding probe) and (5’ATCCACGTGTTTCAGCAGCAGCAGGAGTCC - 3’) (coding probe) for parts of the respective 3’-noncoding (1540-1568) and coding (925-954) nucleotide se-
580
SHIMADA
quences of P45O(M-1) mRNA (32) were synthesized for the detection of P450-male mRNA using an Applied Biosystems 331A DNA synthesizer. The sequence of the coding oligonucleotide is the same as that used by Yoshioka et al (32). Using GenBank (Micro Genie, Beckman), P450-male/(M-1) coding and noncoding probes were compared with nucleic acid sequences of reported proteins and were found to share less than 50% nucleotide similarity with 16 rat P450 sequences. In addition, the specific oligonucleotide corresponding to the nucleotide sequence of the anticoding strand (5’-‘ITGCTGATCCACATCTGCTGGAAGGTGGAC-3’) for a part of the 3051-3030th nucleotide sequence of rat cytoplasmic @-actin gene was synthesized and used as a internal standard (33). The oligonucleotides, coding and noncoding probes, were purified by HPLC. A Nucleosil &is column (4 X 150 mm) preceded by a Nucleosil &is column (4.6 X 30 mm) was used with a mobile phase of 95% 0.1 M TEAA (pH 7.5)/5% acetonitrile and a linear gradient of 70% 0.1 M TEAA (pH 7.5)/30% acetonitrile for 20 min and then isocratically with 70% 0.1 M TEAA (pH 7.5)/30% acetonitrile for a further 5 min at a flow rate of 1.2 ml/min. Using a Waters 440 absorbance detector (254 nm), the main peak eluting at about 15 min was fractionated, and the solvent evaporated and then dissolved in 0.1 M Tris-HCl (pH 7.5) containing 10 mM EDTA (TE buffer). The specific content of DNA was determined by the absorbance at 260 nm. spP-hbeling of oligonucleotide. The incubation mixture (0.2 ml) consisted of 75 pmol of 5’-end dephosphorylated oligonucleotide, 50 mM Tris-HCl buffer (pH 8.0), 10 mM magnesium chloride, 250 &i [T-~P~ATP (-3000 Ci/mmol, Amersham), and 80 units of polynucleotide T( kinase (Pharmacia P-L Biochemicals). The reaction was started by the addition of polynucleotide T4 kinase and terminated by immersing the mixture on ice after an incubation at 37°C for 1 h. @‘P-labeled oligonucleotide was purified with a NACS column (Bethesda Res. Lab.). The specific activity was >5 X lo6 cpm/pmol. Estimation of mRNA level. For Northern blotting, 20 pg of total RNA was fractionated in a 1.2% formaldehyde-agarose gel (34) and transferred to nylon paper (Gene Screen, NEN). The filter was baked at 80°C for 2 h and then hybridized with the q-synthetic probe in 0.5 M sodium phosphate (pH 7.2) containing 7% SDS, 1% bovine serum albumin, and 1 mM EDTA at 52°C overnight after prehybridization with 0.1X SSC (15 mM sodium chloride/l.5 mM sodium citrate, pH 7.0) containing 0.5% SDS. The filter was washed with 0.2 M sodium phosphate (pH 7.2), 1% SDS, 1 mM EDTA at 52°C for 30 min twice, essentially following the method of Church and Gilbert (35). After being washed, the filter was exposed at -80°C. For slot blotting (Minifold II, Schleicher & Schull, Inc.), 10 Fg of total RNA was blotted according to the procedure recommended by Schleicher & Schull and performed following the procedure as described for
ET AL. Northern blotting. After the exposure to X-ray film, the radioactivity was spot counted using a liquid scintillation counter. Quantification was carried out using the level of @-actin mRNA as internal standard. Other assay methodsMicrosomal testosterone oxidation was measured as described previously (15), except that a Chemcosorb ODS-5H column (6 X 150 mm) preceded by a precolumn (4.6 X 30 mm) containing the same packing material was used to improve the separation between l- and 16@-hydroxytestosterones, and between &-hydroxytestosterone and an unidentified metabolite, which probably corresponds to 13 hydroxytestosterone as recently reported (36). Microsomal protein was determined by the method of Lowry et al (37). Cytochrome P450 content was measured from the CO reduced difference spectrum (33), except that 20% glycerol and 0.2% Emulgen 913 (Kao-Atalas, Ltd., Tokyo) were included.
RESULTS
Regulation of P&O-Male Protein and mRNA bg Growth Hormone As already reported (7, 8, lo), a malespecific P450-male protein in rat livers is regulated by the secretory pattern of growth hormone. To further understand the regulating mechanism of P450-male by growth hormone, the effects of growth hormone on the level of hepatic P450-male mRNA were examined. In Northern blots with a specific 29-mer oligonucleotide (noncoding probe), a hybridizable band (P450-male/(M-1) mRNA) was detected at about 19 s in the RNA prepared from untreated male rats. As shown in Fig. 1, hypophysectomy significantly decreased the level of P450-male/(M-1) mRNA in male rats. Treatment of hypophyseetomized rats with intermittent injection of hGH, which mimicked the secretory pattern of pituitary growth hormone in adult male rats, restored the mRNA to a level similar to that observed in adult male rats. However, P450-male/(M-1) mRNA was almost abolished in hypophysectomized male rats after infusion of hGH, which mimicked the secretory pattern of pituitary growth hormone in adult female rats. On the other hand, the P450-male/(M-1) mRNA was not detected in total hepatic RNA obtained from female rats but was detectable in hypophysectomized female rats. In addition, the level of P450-male/
NONCOORDINATE
C
H
H
CHANGE
HCHHH
&i
G+H
G+H iii
(s)
(iI
(s)
6
IN P450-MALE
(iI
Q
FIG. 1. Northern blot analysis of P450-male mRNA in livers of hypophysectomized and hGH-treated male and female rats. Twenty micrograms of the total RNA preparation was fractionated by electrophoresis in a 1.2% agarose gel containing 2.2 M formaldehyde, blotted to a nylon filter, and hybridized with noncoding probe. 8, Male rats; 9, female rats; C, untreated rats, H, hypophysectomized rats; GH(s), rats treated intermittently with hGH, GH(i), hGH-infused rats.
(M-l) mRNA in hypophysectomized female rats was increased to that of adult male rats by intermittent administration of hGH. A faint extra band was observed in hGH-treated hypophysectomized female rats but was undetectable when the Northern analysis was performed under more stringent conditions. In contrast, the level of P450-male/(M-1) mRNA was decreased to that of adult female rats by infusion of hypophysectomized female rats with hGH. To further ascertain the change in the level of P450 mRNA, another 30-mer oligonucleotide (coding probe) was used. Essentially the same results were obtained in Northern blots using the oligonucleotide probe (data not shown). The change in the level of P450-male/ (M-l) mRNA was quantified by slot-blot hybridization. In an experiment using the coding probe, the level of P450-male/(M-1) mRNA was decreased to about 30% of the normal male level by hypophysectomy (Fig. 2A). P450-male/(M-1) mRNA was restored to a level similar to that in normal male rats by intermittent treatment of hypophyseetomized male rats with hGH. However, the mRNA was decreased to less
mRNA
AND
PROTEIN
581
than 5% of the level of normal male rats by infusion of hGH to hypophysectomized male rats. Similar results were also obtained using the noncoding probe for P450male mRNA (Fig. 2B). These results were largely consistent with the data reported recently (39). In immunoblots, the specific content of P450-male was 0.28 nmol/mg microsomal protein in male rat livers. Hypophysectomy decreased the content of P450-male by 50%, but the content was restored to that of normal rats by intermittent administration of hGH. In contrast, P450-male was decreased to less than 15% that of the normal male by infusion with hGH (Fig. 2C). Therefore, the content of P450-male/ (M-l) mRNA correlates largely with the amounts of P450-male protein in livers of rats with different levels of growth hormone, indicating that the expression of P450-male is mainly regulated at the pretranslational step in normal rats. Effects of PB, Dex, and MC on the Content of P&&Male in Neal and Hypophysectmnized Male Rats Treatment of normal male rats with PB, Dex, or MC decreased the specific content of P450-male protein by 68, 35, and 50%, respectively (Table I). These results confirmed previous data on the effects of PB and MC on the content of P450-male (21,23). As described above, P450-male protein is known to be regulated by pituitary growth hormone. Thus, PB, Dex, or MC can possibly act at either the liver or the hypothalamuspituitary for decreasing the content of P450male protein. To verify these possibilities, the effects of these chemicals on hypophysectomized male rats were examined. Hypophysectomy decreased the specific content of P450-male protein by 50% in normal male rats, although the content of total cytochrome P450 was not affected (data not shown). Treatment of hypophysectomized rats with Dex decreased the content of P450-male protein by 65% as compared to that of nontreated hypophysectomized rats. But the amounts of P450male protein were not changed in PB- or MC-treated hypophysectomized male rats.
SHIMADA
582 Relative (coding
mRNA
ET AL. Protein
levels (46)
probe)
0
(noncoding probe) E-0 loo
bmolhg 0
.l
protein) a
a
FIG. 2. Effects of hypophysectomy and hGH treatment on the levels of P450-male mRNA and protein in male rat livers. Columns and bars indicate the means + SD of the data obtained from three to four individual animals. C, Untreated rats; H, hypophysectomized rats; GH(s), rats treated intermittently with hGH, GH(i), hGH-infused rats. “Values are significantly different from those of the corresponding control rats (P < 0.05). bValues are significantly different from those of the corresponding hypophysectomized rats (P c: 0.05). Other experimental details are described under Experimental Procedures.
Testosterone ti- and 16@hydroxylations are reported to be catalyzed selectively by P450-male (8, 40) and PB-inducible cytochrome P450, P450b/e respectively (41). To ascertain the effect of PB treatment on the
contents of P450-male and P45Ob/e protein in hypophysectomized male rats, microsomal testosterone 2a- and 16/3-hydroxylations were quantified as shown in Fig. 3. (nmobmg protein/min)
TABLE I
0
1
2
3
EFFECTS OF PB, DEX, OR MC ON HEPATIC CONTENT OF P450-MALE IN NORMAL AND HYPOPHYSECTOMIZED MALE RATS
Treatment
P450-male (nmol/mg protein)
Normal +PB +Dex +MC
(n = 4) (n=3) (n = 3) (n = 3)
0.23 f 0.03
Hypox +PB +Dex +MC
(n = 4) (n= 3) (n= 6) (n= 3)
0.15 f O.Ola 0.17 rt 0.01” 0.10 * 0.04=*6 0.14 + 0.05n
0.19 * 0.05’ 0.10 + 0.01” 0.13 + 0.03&
Relative amount (%) 100” 67.9
PB H H+PB
rb
35.7 46.4
60.7
100d 113.2
35.7
66.6
50.0
93.3
53.6
Note. The means f standard deviations of the data obtained from the numbers of the animals indicated in parentheses are shown in this table. @Values are significantly different from those of the corresponding normal rats (P < 0.05). bValues are significantly different from those of the corresponding hypophysectomized (Hypox) rats (P < 0.05). crdThe relative amounts of P450-male to the respective amounts of normal and hypophysectomized rats are presented.
FIG. 3. Effects of treatment with phenobarbital on hepatic testosterone 2a- and 16j3-hydroxylations in normal and hypophysectomized male rats. Columns and bars indicate the means + SD of the data obtained from three to four individual animals. C, Untreated rats; PB, phenobarbital-treated rats; H, hypophysectomized rats; H + PB, phenobarbitaltreated hypophysectomized rats. “Values are significantly different from those of the corresponding control (C) rats (P < 0.05). bValues are significantly different from those of the corresponding hypophysectomized (H) rats (P < 0.05). Other experimental details are described under Experimental Procedures.
NONCOORDINATE
CHANGE IN P450-MALE mRNA AND PROTEIN
583
FIG. 4. Northern blot analysis of P450-male mRNA in livers of exogenous chemical-treated male and female rats. The data obtained using the coding and noncoding probes are shown in A and B, respectively. 8, Male rats; P, female rats; C, untreated rats; PB, phenobarbital-treated rats; Dex, dexamethasone-treated rats; PCN, pregnenolone 16a-carbonitrile-treated rats; MC, 3-methylcholanthrene-treated rats. Other experimental details are described under Experimental Procedures.
The formation of 16/3-hydroxytestosterone was increased 45-fold in PB-treated male rats. Testosterone 16@-hydroxylation was also increased more than 2-fold in male rats by hypophysectomy. A further increase in testosterone 16B-hydroxylation was observed in PB-treated hypophysectomized rats. The rate of formation of Ba-hydroxytestosterone was reduced to 37% in PBtreated male rats. Hypophysectomy also reduced the rate of the formation of a-hydroxytestosterone to 50% of that in normal rata. However, the rate of formation of ~XXhydroxytestosterone did not differ between hypophysectomized and PB-treated hypophysectomized male rats. These results are in good agreement with the data obtained from immunoblot analyses of P450-male protein (Table I), confirming that P450-male protein in hypophysectomized rats is not affected by treatment with PB and exists mainly in the functionally active form. Effects of PB, Dex, and MC on the Hepatic Level of P.&W-Male mRNA in Normal and Hgpophgsectomixed Male Rats To further understand the regulational mechanism of P450-male, the levels of P450-male mRNA in PB-, Dex-, or MCtreated rats were quantitated as shown in Fig. 4. In Northern blot analyses with the coding probe, only a single band at about 19 s was detected in livers of rats treated with these chemicals, except that a weak
hybridizing additional band was observed in Dex-treated male rats. P450-male/(M1) mRNA had a tendency to be decreased by the treatment with Dex, PCN, or MC. In contrast, the specific mRNA was not decreased but rather increased slightly by the treatment of normal rats with PB. Similar results were also obtained with the noncoding probe (Fig. 4B). In addition, P450-male/(M-1) mRNA was not detected in livers of PB-, Dex-, PCN-, or MC-treated female rats, which is consistent with the reports on P450-male protein (21). The levels of P450-male/(M-1) mRNA in PB-, Dex-, or MC-treated hypophysectomized male rats are shown in Fig. 5. In Northern analyses with the noncoding probe, only a faint band was detected at about 19 s in livers of hypophysectomized male rats. A marked increase in the level of P450-male/(M-1) mRNA was observed in livers of PB- or Dex-treated hypophysectomized male rats. However, the level of P450-male/(M-1) mRNA was not changed or slightly increased in livers of MCtreated hypophysectomized male rats. To compare the effects of PB, Dex, and MC on the level of P450-male protein and mRNA in normal (GH-nondeficient) and hypophysectomized (GH-deficient) male rats, relative changes in the level of P450male protein and mRNA are examined as shown in Figs. 6 and 7, respectively. A large individual difference was observed in
SHIMADA
584
-r
H
H+PB
H+Dex
H+MC
FIG. 5. Northern blot analysis of P450-male mRNA in PB-, Dex-, or MC-treated hypophysectomized male rats. H, Hypophysectomized rata; H + PB, phenobarbital-treated hypophysectomized rats; H + Dex, dexamethasone-treated hypophysectomized rats; H + MC, 3-methylcholanthrene-treated hypophysectomized rats. The results obtained from three to four different rats are shown. Other experimental details are described under Experimental Procedures.
the level of P450-male/(M-1) mRNA in Dex-treated normal male rats. But the mean level was not significantly different from the normal level. Despite a clear decrease in the amount of P450-male protein, the level of P450-male/(M-1) mRNA was not changed in MC-treated normal male rats (Fig. 6). The highest level of P450male/(M-1) mRNA was obtained after administration for 3 days during the time course of PB administration for 1,3,5, or 7 consecutive days. The level of P450-male/(M-1) mRNA was decreased by hypophysectomy by 30%) but treatment of hypophysectomized male rats with PB increased the mRNA about 5-fold, which was nearly the same as that observed in PB-treated normal rats (Fig. 7). Treatment with Dex also increased the level of P450-male/(M-1) mRNA 2.3-fold in hypophysectomized male rats, which was in contrast with that obtained from the results in Dex-treated normal rats (Fig. 6). However, the change in the level of mRNA was largely coordinated with the amount of P450-male protein in MC-treated hypophysectomized male rats. To assess the identity of the mRNA obtained from PBtreated hypophysectomized male rats, the temperature dependency during hybridization with the noncoding probe for P450male/(M-1) mRNA was examined between the RNAs from normal and PB-treated hypophysectomized male rats. Slot-blot hybridization was carried out and filters were washed at 42,47, or 52°C. After exposure
ET AL.
to X-ray film, the radioactive spot was cut out and counted. The level of hybridizable mRNA with the specific probe for P450male/(M-1) mRNA was changed in parallel in normal and PB-treated hypophysectomized male rats under the different hybridizing temperatures. These results suggest that P450-male/(M-1) mRNA is increased in PB-treated hypophysectomized male rats. DISCUSSION
We have recently reported that P450male is regulated mainly by growth hormone in rats (7, 8). To investigate the mechanism for regulation of P450-male by growth hormone, the levels of specific mRNA have been examined in this study. As shown in Fig. 2, changes in P450-male mRNA in livers of normal, hypophysectomized, and hGH-treated hypophysectomized rats, as measured by the use of two specific oligonucleotide probes corresponding to the sequence of coding and 3’-noncoding regions of P450-male/(M-1) mRNA,
Relative
levels
(9
c
PB
DI3X
FIG. 6. Relative changes in the level of P450-male protein and mRNA in PB-, Dex-, or MC-treated normal male rats. C, Untreated rats; PB, phenobarbitaltreated rats; Dex, dexamethasone-treated rats; MC, 3-methylcholanthrene-treated rats. Essentially the same results were obtained with the slot-blot hybridization using both coding and noncoding probes. Thus, the means of both are shown. Columns and bars indicate the means + SD of the relative levels obtained with three to four individual animals. Other experimental details are described under Experimental Procedures.
NONCOORDINATE
I
CHANGE IN P450-MALE mRNA AND PROTEIN
I
H
H + PB
H + Des
H+MC
cl
PWtein UIRNA
FIG. 7. Relative changes in the level of P450-male protein and mRNA in PB-, Dex-, or MC-treated hypophysectomized male rats. H, Hypophysectomized rats, H + PB, phenobarbital-treated hypophysectomized rats; H + Dex, dexamethasone-treated hypophysectomized rats; H + MC, 3-methylcholanthrene-treated hypophysectomized rats. Columns and bars indicate the means + SD of the relative levels obtained with three to four individual animals. Other experimental details are the same as described in Fig. 6.
were in good agreement with each other, and were also consistent with results of immunoblots of P450-male protein. These results indicate that growth hormone modulates the hepatic content of P450male protein mainly at the pretranslational step. Rampersaud et a& using two-dimensional electrophoresis (42), reported that P450h/2c, which corresponds to P450male, was characterized by at least three allelomorphic variants. However, Morishima et aZ.,using genomic Southern blot analysis (43), have recently reported that the P450(M-1) gene is transcribed from a single locus. The results obtained in this study suggest that P450-male protein is likely to be regulated mainly by the pretranslational step, irrespective of the possible existence of plural forms. In the present study, the mechanism of P450-male protein suppression by treatment with PB, Dex, or MC was also examined. These treatments decreased the content of P450-male protein in adult male rats (Table 1 and (19-21)). However, the specific content of P450-male protein was not changed in PB-treated hypophysecto-
585
mized male rats. Similarly, the content of P450-male protein was also not affected by treatment of hypophysectomized male rats with MC, although treatment with Dex decreased the content of P450-male to 65% of that in hypophysectomized male rats. These results indicate that PB and MC reduced the hepatic content of P450male, mainly through the pituitary growth hormone-mediated system. However, the decrease in the content of P450-male in Dex-treated hypophysectomized rats indicates that Dex decreases the content of P450-male not only through the growth hormone-mediated system but also directly by acting, probably, at the hepatic level. In RNA blot analyses using the oligonucleotide probes, the level of P450-male mRNA had a tendency to be decreased in Dex-treated normal male rats, but not significantly from the normal group. The level of P450-male mRNA was also not affected by treatment with MC (Figs. 4 and 6). These results suggest that the decrease in the amount of P450-male protein was not accounted for only by the decrease in the level of its mRNA. Yeowell et aL, using an in vitro translation system (44), reported that translatable amounts of P4502c, which corresponds to P450-male, were decreased to about 50% of the normal levels in MC-treated adult male rats. The reason for the differences in the extent of decrease is unclear, but may be because of the differences in the methods used for quantitation of the mRNA level. In contrast to MC- or Dex-treated rats, the mRNA was not decreased but rather increased about twofold in PB-treated normal rats, although a significant decrease in the content of P450-male protein was observed (Fig. 6). In addition, treatment of hypophysectomized male rats with PB and Dex also increased the level of P450-male mRNA by five- and two-fold, respectively (Fig. 7). In this experiment, no hybridization with two specific oligonucleotide probes was detected in PB- and Dextreated female rats in Northern analyses (Fig. 3). In addition, P450-male/(M-1) mRNA was also not detectable in livers of untreated immature and PB-treated immature male rats (data not shown). These
SHIMADA
586
ET AL.
results suggest that PB and Dex enhance Japan and by a grant-in-aid for new drug developthe hepatic level of P450-male mRNA in ment from the Ministry of Health and Welfare, Jahypophysectomized male rats rather than pan. The authors thank Drs. Kiyoshi Nagata and Toexpressing an uncharacterized mRNA hy- shio Yasumori of our laboratory for their advice on bridizable to the oligonucleotide probes, RNAb1otanalysis. although the possibility of the induction of REFERENCES minor uncharacterized cytochrome P450 1. BLACK, S. D., AND COON, M. J. (1985) in CytomRNA by PB and Dex is not excluded in chrome P-450: Structure, Mechanism, and Biothis study. chemistry (Ortiz de Montellano, P. R., Ed.), pp. The current evidence suggests that the 161-216, Plenum, New York/London. rate of transcription is the major factor in 2. WHITELOCK, J. P., JR. (1986) Annu Rev. Pharmacontrolling expression of most hepatic cyml Tcnkol26,333-369. tochrome P450 genes. However, recent 3. ADESNIK, M., AND ATCHISON, M. (1986) Crit. Rev. studies have shown that hepatic cytoB&hem 19,247-305. 4. KATO, R. (1977) X&&u 7,12-92. chrome P450 is also controlled by post5. KATO, R., AND KAMATAKI, T. (1982) Xe&&x%xz transcriptional mechanisms (45-47). Dex 12,787-800. was also reported to stabilize NADPH-cy6. KAMATAKI, T., MAEDA, K., YAMAZOE, Y., NAGAI, tochrome P450 oxidoreductase mRNA and T., AND KATO, R. (1983) Arch Biochem Biocytochrome P450b homologous mRNA phys 225,758-770. (48). Thus, the increased level of P450-male 7. YAMAZOE, Y., SHIMADA, M., KAMATAKI, T., AND mRNA in Dex-treated GH-deficient rats KATO, R. (1986) Japan J. Phurm.ad 42,371might be due in part to the stabilizing 382. effect of Dex. 8. KATO, R., YAMAZOE, Y., SHIMADA, M., MURARecently Emi and Omura, using an in viYAMA, N., AND KAMATAKI, T. (1986) J. Biochem. 100,895-902. tro translation system, have reported that the hepatic level of P450(M-1) mRNA is de- 9. DANNAN, G. A., GUENGERICH, F. P., AND WAXMAN, D. J. (1986) J. Bid Chem. 261, 10728creased transiently by a single dose of PB 10735. or MC administration, and that the level is 10. MORGAN, E. T., MACGEOCH, C., AND GUSTAFSSON, restored to normal at 24 h after the drug J.-A. (1985) J. Bid Chem 260,11,895-11,898. injection (49). In the present study, rats 11. FAVREAU, L. V., AND SCHENKMAN, J. B. (1987) Biowere treated with PB or MC for 3 consecuthem. Biophys Res. Commun 142,623-630. tive days. The difference in mode of admin- 12. YAMAZOE, Y., SHIMADA, M., MURAYAMA, N., NAistration may cause the apparent differGATA, K., AND KATO, R. (1989) in Xenobiotic ence in P450-male/(M-1) mRNA levels. Metabolism and Disposition (Kato, R,. Estabrook, R. W., and Cayen, M. N., Eds.), pp. 37In conclusion, the noncoordinate change 44, Taylor & Francis, London-New Yorkin the level of P450-male protein and Philadelphia. mRNA in PB- or Dex-treated rats indicates that chemical-induced suppression 13. MACGEOCH, C., MORGAN,E. T., AND GUSTAFSSON, J.-A. (1985) Endocri?wlogy 117,2085-2092. of P450-male protein occurs by dual mech14. YAMAZOE, Y., SHIMADA, M., MURAYAMA, N., KAanisms directly through action on livers WANO, S., AND KATO, R. (1986) J. Biochem. 100, and indirectly through action on the 1095-1097. growth hormone-mediated process in rats. 15. YAMAZOE, Y., SHIMADA, M., MURAYAMA, N., AND In addition, differences in P450-male proKATO, R., (1987) J. BioL Chem 262,7423-7428. tein and mRNA in PB- or Dex-treated hy- 16. YAMAZOE, Y., MURAYAMA, N., SHIMADA, M., YAMAUCHI, K., NAGATA, K., IMAOKA, S., FUNAE, pophysectomized rats suggest that P450Y., AND KATO, R. (1988) J. B&hem 104,730male protein is regulated by plural steps, 734. pretranslational and translational mechanisms, in which growth hormone or other 17. EDEN, S. (1979) En&wrin@v 105.555-560. 18. KAMATAKI, T., SHIMADA, M., MAEDA, K., AND endocrine factors exert the effect. KATO, R. (1985) Biochem Biophys. Res. Gnn-
ACKNOWLEDGMENTS This work was supported in part by a grant-in-aid from the Ministry of Education, Science and Culture,
mun 130,1247-1253. 19. NEBERT, D. W., AND GONZALEZ, F. J. (1987) Annu. Rev. Biochem. 56,945-993. 20. ORTIZ DE MONTELLANO, P. R., AND REICH, N. 0. (1986) in Cytochrome P-450: Structure, Mecha-
NONCOORDINATE
21. 22. 23.
24.
CHANGE
IN P450-MALE
nism, and Biochemistry (Ortiz de Montellano, P. R., Ed.), pp. 273-314, Plenum, New York/ London. KAMATAKI, T., MAEDA, K., SHIMADA, M., AND KATO, R. (1986) J. Biochem 99,841-845. WAXMAN, D. J., DANNAN, G. A., AND GUENGERICH, F. P. (1985) Biochemistry 24.4409-4417. GUENGERICH, F. P., DANNAN, G. A., WRIGHT, S. T., MARTIN, M. V., AND KAMINSKY, L. S. (1982) Biochemistry 21,6019-6030. RYAN, D. E., IIDA, S., WOOD, A. W., THOMAS, P. E., LIEBER, C. S., AND LEVIN, W. (1984) J.
Bid Chmn 259,1239-X50. 25. CHENG, K.-C., AND SCHENKMAN, J. B. (1982) J.
Bid Chen 257,23’78-2385. 26. MORGAN, E. T., MACGEOCH, C., AND GUSTAFSSON, J.-A. (1985) MoL PharmumL 27,471-479. 27. NEBERT, D. W., ADESNIK, M., COON, M. J., ESTABROOK, R. W., GONZALEZ, F. J., GUENGERICH, F. P., G~NSALUS, I. C., JOHNSON, E. F., KEMPER, B., LEVIN, W., PHILLIPS, I. R., SATO, R., AND WATERMAN, M. R. (1987) DNA 6,1-11. 28. CHIRGWIN, J. M., PRZYBYLA, A. E., MACDONALD, R. J., AND RULER, W. J. (1979) Biochemistrg 18.5249-5299. 29. LAEMMLI, U. K. (1970) Nature (London) 227,680685. 30. TOWBIN, H., STAEHELIN, T., AND GORDON, J. (1979) Proc NatL Acad Sci USA 76,4350-4354. 31. GUENGERICH, F. P., WANG, P., AND DAVIDSON, N. K. (1982) Biochaistry 21,1698-1706. 32. YOSHIOKA, H., MOROHASHI, K., SOGAWA, K., MIYATA, T., KAWAJIRI, K., HIROSE, T., INAYAMA, S., FUJII-KURIYAMA, Y., AND OMURA, T. (1987) J. Bid Chem 262,1706-1711. 33. NUDEL, U., ZAKUT, R., NEUMAN, S., LEW, Z., AND YAFFE, D. (1983) Nucleic Acids Res. 11,17591771. 34. LEHRACH, H. D., DIAMOND, D., WOZNEY, J. M., AND BOEDTKER, H. (1977) Biochemistry 16, 4743-4751.
mRNA
AND
PROTEIN
587
35. CHURCH, G. M., AND GILBERT, W. (1984) Proc NatL Acad Sci USA 81,1991-1995. 36. SONDERFAN, A. J., ARLO~O, M. P., DUTTON, D. R., MCMILLEN, S. K., AND PARKINSON, A. (1987)
Arch Biochem. Biophys. 255,27-41. 37. LOWRY, 0. H., ROSEBROUGH, N. J., FARR, A. L., AND RANDAU, R. J. (1951) J. Bid Chem 193, 265-275. 38. OMURA, T., AND SATO, R. (1964) J. BioL Chem 239, 2370-2378. 39. ZAPHIROPOULOS, P. G., MODE, A., STROM, A., MOLLER, C., FERNANDEZ, C., AND GUSTAFSSON, J.-A. (1988) Proc. NatL Acad Sci USA 85,42144217. 40. RYAN, D. E., IIDA, S., WOOD, A. W., THOMAS, P. E., LIEBAR, C. S., AND LEVIN, W. (1984) J.
BioL Chem 259,1239-1250. 41. WOOD, A. W., RYAN, D. E., THOMAS, P. E., AND LEVIN, W. (1983) J. Bid Chem. 258,8839-8847. 42. RAMPERSAUD, A., WAXMAN, D. J., RYAN, D. E., LEVIN, W., AND WALZ, F. G., JR. (1985) Arch.
Biochem Biophys. 243.174-183. 43. MORISHIMA, N., YOSHIOKA, H., HIGASHI, Y., SoGAWA, K., AND FUJII-KURIYAMA, Y. (1987) Bio-
chemistry 26,8279-8285. 44. YEOWELL, H. N., WAXMAN, D. J., WADHERA, A., AND GOLDSTEIN, J. A. (1987) MoL PhamL 32,340-347. 45. SONG, B. J., MATSUNAGA, T., HARDWICK, J. P., PARK, S. S., VEECH, R. L., YANG, C. S., GELBOIN, H. V., AND GONZALEZ, F. J. (1987) MoL En&m-i-
rwL 546,542-547. 46. KIMURA, S., GONZALEZ, F. J., AND NEBERT, D. W. (1986) MoL CeU BioL 6,1471-1477. 47. PASCO, D. S., BOYUM, K. W., MERCHANT, S. N., CHALBERG, S. C., AND FAGAN, J. B. (1988) J. Bid Chem 263,8671-8676. 48. SIMMONS, D. L., MCQUIDDY, P., AND KASPER, C. B. (1987) J. BioL Chem 262,326-332. 49. EMI, Y., AND OMURA, T. (1988) J. Biochem 104,4043.