- Email: [email protected]
Suppression of Fe deficiency gene expression by jasmonate
Plant Physiology and Biochemistry 49 (2011) 530e536
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Suppression of Fe deficiency gene expression by jasmonate Felix Maurer, Sabine Müller, Petra Bauer* Dept. Biosciences-Plant Biology, Saarland University, Campus A2.4, D-66123 Saarbrücken, Germany
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 October 2010 Accepted 26 January 2011 Available online 3 February 2011
Fe deficiency genes are regulated in response to external supply of Fe as well as internal plant signals. Internal plant signals include plant hormones and systemic signals which coordinate shoot physiological requirements for Fe with local availability of Fe in roots. Induction of IRT1 and FRO2 gene expression can be used to monitor the Fe deficiency status of plant roots. Here, we investigated the role of jasmonate in the regulation of Fe deficiency responses and in the split root system. We found that jasmonate suppressed expression levels of IRT1 and FRO2 but not their inducibility in response to Fe deficiency. Analysis of the jasmonate-resistant mutant jar1-1 and pharmacological application of the lipoxygenase inhibitor ibuprofene supported an inhibitory effect of this plant hormone. Inhibition of IRT1 and FRO2 gene expression by jasmonate did not require the functional regulator FIT. By performing split root analyses we found that systemic down-regulation of Fe deficiency responses by Fe sufficiency of the shoot was not compromised by ibuprofene and in the jasmonate-insensitive mutant coi1-1. Therefore, we conclude that jasmonate acts as an inhibitor in fine-tuning Fe deficiency responses but that it is not involved in the systemic down-regulation of Fe deficiency responses in the root. Ó 2011 Elsevier Masson SAS. All rights reserved.
Keywords: Jasmonate Iron uptake IRT1 FRO2 FIT Split root
1. Introduction Plant roots are nearly constantly exposed to nutrient salts in their environment. Yet, the uptake profiles for nutrients vary diurnally and in response to various physiological and developmental stimuli. Regulation of nutrient uptake is necessary not only to ensure minimum uptake of the essential nutrients but also to avoid excessive uptake followed by potentially toxic effects. Plants sense the availability of nutrients in their local environment and their physiological diurnal and developmental needs for these nutrients [1]. Uptake of Fe can be used as a model system to study the role of plant internal signals related to nutrient regulation to investigate the underlying regulatory mechanisms. The Fe status of a wild type plant is reflected by the expression levels of marker genes. For example, increased expression of IRT1 and FRO2 in the root compared to a control condition indicates Fe deficiency [2e4]. Mutant studies showed that these two genes encode structural core components for Fe acquisition from the soil following the Fe reduction-based strategy I. FRO2 encodes the root plasmamembrane-bound ferric chelate reductase [3], while IRT1 codes for the divalent metal transporter for Fe uptake [5e7]. FRO2 and IRT1 were
* Corresponding author. Tel.: þ49 681 302 58160; fax: þ49 681 302 4235. E-mail address: [email protected] (P. Bauer). 0981-9428/$ e see front matter Ó 2011 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.plaphy.2011.01.025
often found co-regulated [8]. Their expression is controlled by a bHLH transcription factor named FIT [9]. In the absence of a functional FIT protein the expression of FRO2 and IRT1 is far lower than in wild type and if not supplemented with Fe fit mutants develop a lethal leaf chlorosis [10e12]. Ethylene and nitric oxide positively affect expression of IRT1 and FRO2 suggesting that these two signals increase the sensitivity of plants for Fe uptake [13e16]. Cytokinins on the other hand cause a down-regulation of the two genes [17]. Hormonal influence on Fe acquisition gene expression may serve to coordinate physiology and stress responses with necessary adaptations for altered root growth and uptake of Fe [18e21]. Systemic signals controlling Fe uptake have been physiologically identified but their nature is not known. For instance, grafting of constitutive mutant Fe-deficient shoots to wild type roots can override any local Fe sufficiency sensing in the root and promote constitutive induction of Fe acquisition responses [22,23]. On the other hand, Fe-sufficient shoots may block Fe uptake in Fedeficient parts of split roots [4,8,18,19]. Jasmonates are oxylipin-based plant hormones originating from poly-unsaturated fatty acids that act in response to developmental or environmental stimuli [24]. Environmental cues for activating the jasmonate signalling pathway include wounding, insect attack or UV light and as such jasmonate belongs to the so-called stress hormones. Jasmonate has an interesting property in that it is a systemically acting mobile plant hormone [25]. Progress has been made in identifying the jasmonate signalling pathway by thorough
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
531
analysis of JA resistant and insensitive mutants [26]. Jasmonates are perceived intracellularly by a jasmonate receptor belonging to the F-box protein family that upon binding to the plant hormone targets a repressor of the jasmonate response pathway for degradation [27e29]. The activated jasmonate form most efficiently bound by the jasmonate receptor was found to be an Ile-conjugated derivative of jasmonic acid (JA-Ile, namely (þ)-7-iso-JA-Ile) [30,31]. Isoleucine conjugation to jasmonate is catalyzed by an enzyme encoded by the JAR1 gene [32,33]. Here, we tested whether the plant hormone jasmonate had any effect on the regulation of Fe uptake responses, and whether jasmonate might be a candidate for a systemic signal involved in Fe deficiency regulation.
2. Results 2.1. Gene expression analysis of Fe deficiency genes in response to jasmonate treatment In search for mobile plant signalling compounds that influence the regulation of Fe acquisition and may represent candidates as systemic signals we tested the effect of jasmonate on the regulation of the IRT1 promoter using transgenic pIRT1::GUS plants [7]. We exposed two week-old Arabidopsis seedlings for 3 days to þ or Fe in the presence of 0 or 100 mM jasmonate, respectively. We found that in the absence of jasmonate GUS activity was induced four times in the root upon Fe treatment (Fig. 1). Upon jasmonate treatment absolute GUS activity levels were lower at both þ and Fe conditions compared to the non-jasmonate- treated controls (Fig. 1). However, despite of generally lower GUS activity levels the IRT1 promoter was still induced by Fe in the presence of jasmonate (Fig. 1). In a further experiment we confirmed these results by reverse transcription-qPCR gene expression analysis. We exposed 6 day-old wild type Arabidopsis seedlings grown at þ or Fe for 6 h to 0 or 100 mM methyl-jasmonate, respectively, and analyzed the expression of the Fe acquisition genes. We found that FIT was induced about 2.5fold in the root under Fe conditions compared to the þ Fe control (Fig. 2B), while FRO2 and IRT1 were up-regulated sevenand eightfold (Fig. 2A). Upon methyl-jasmonate treatment, absolute expression levels of FIT, IRT1 and FRO2 were reduced to 40% at Fe, respectively, compared to the untreated controls (Fig. 2A, B). However, FIT, FRO2 and IRT1 were still up-regulated by Fe in the presence of methyl-jasmonate. As a control for successful methyl-jasmonate action, expression of the jasmonate response gene PDF1.2 [34,35] was analyzed and found to be markedly
Fig. 1. IRT1 promoter regulation in response to jasmonate. Regulation of pIRT1 was determined by quantitative GUS activity measurements. Two week-old pIRT1::GUS plants were exposed for three days to þ (50 Fe) and Fe (0 Fe), in the presence of 100 mM jasmonate (JA) or its absence (control); roots were harvested for analysis.
Fig. 2. Analysis of gene expression in response to Fe supply, methyl jasmonate and ibuprofene. A, FRO2 and IRT1 expression; B, FIT expression; reverse transcription-qPCR analysis in six day-old seedlings grown under þ or Fe and exposed for 6 h to 100 mM methyl-jasmonate (MeJA), 10 mM ibuprofene (IBU) or none of them (control); n ¼ 2, SD were calculated for two biological replicates.
induced in the methyl-jasmonate-treated samples compared to the controls (data not shown). Therefore, jasmonate treatment was effective in our experiments. In conclusion, our results demonstrate that external supply of methyl-jasmonate suppressed absolute expression levels of Fe deficiency marker genes in the root but did not inhibit inducibility of these genes by Fe. To obtain further confirmation for the inhibitory effect of jasmonate on Fe deficiency gene expression, plants were treated with 10 mM ibuprofene. Ibuprofene is a known inhibitor of lipoxygenase activity, and such an enzymatic activity is needed during jasmonate biosynthesis. For this reason, ibuprofene is commonly used to assess jasmonate function in plants [36,37]. We found that application of ibuprofene at Fe resulted in comparable expression levels of FIT (Fig. 2B), but 1.5 and 1.9fold increased expression levels of FRO2 and IRT1, respectively, compared to the untreated controls. Thus, the ibuprofene results supported an inhibitory action of jasmonate.
2.2. Gene expression analysis of Fe deficiency marker genes in the jasmonate-resistant mutant jar1-1 JAR1 encodes the jasmonate-amino acid conjugate synthase that transforms jasmonate into the active jasmonate-Ile form
532
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
[32,33]. jar1 mutants are not able to produce jasmonate-Ile conjugates and are resistant to jasmonate treatment [38]. The jar11 mutant is frequently used to assess jasmonate-dependent responses in plants [26]. We analyzed Fe deficiency gene expression in the roots of jar1-1 compared to wild type plants (Fig. 3). As shown above, wild type plants reacted to Fe deficiency, namely IRT1 and FRO2 were induced by Fe compared to þ Fe in the root (Fig. 3A). In jar1-1 mutant roots the absolute expression levels of FRO2 and IRT1 were induced 1.4 and 1.9fold compared to wild type roots at Fe (Fig. 3A, p-values 0.006 and 0.08). At þ Fe FRO2 and IRT1 expression levels were comparable between wild type and jar1-1 mutants (Fig. 3A). FIT was regulated in a similar manner in jar1-1 and wild type plants at þ and Fe (Fig. 3B). Taken together, analysis of the jar1-1 mutant reconfirmed an inhibitory action of jasmonate on the induction of FRO2 and IRT1, but not on the induction of FIT. A defective jasmonate response did not interfere with the general capacity of the plants to suppress Fe acquisition responses at þ Fe. 2.3. Analysis of jasmonate effects in the fit mutant FIT is a central regulator for FRO2 and IRT1 [9e12]. The above results showed that FIT gene expression was negatively affected by jasmonate application in wild type but no influence on FIT gene
Fig. 3. Analysis of gene expression in jar1-1 mutants. A, FRO2 and IRT1 expression; B, FIT expression; reverse transcription-qPCR analysis in six day-old jar1-1 and wild type seedlings grown under þ or Fe; n ¼ 2, SD were calculated for two biological replicates.
expression was noted in the jar1-1 mutant. These results suggested that FIT gene expression might have been overall less affected by jasmonate than expression of FRO2 and IRT1. To further corroborate this finding we investigated whether repression of FRO2 and IRT1 by jasmonate was dependent on the FIT protein itself. Towards this end, we treated wild type and fit mutant plants with or without methyl-jasmonate. We observed that in the fit mutant FRO2 and IRT1 expression levels were reduced compared to wild type at þ and Fe. However, an approximately threefold induction of the two genes at Fe still took place (Fig. 4). This was as expected from previous reports [10,11]. Upon jasmonate treatment, expression of FRO2 and IRT1 was reduced to a very low level and induction was no longer apparent (Fig. 4). Hence, we deduce from these results that jasmonate inhibited FRO2 and IRT1 gene expression independent of the FIT protein. Perhaps jasmonate repressed the yet unknown mechanism that maintains the residual induction of FRO2 and IRT1 in the fit mutant. These results confirm that jasmonate affected FRO2 and IRT1 more than FIT.
2.4. Analysis of ibuprofene effects in the split root system It was previously found that in a split root system the induction of IRT1 and FRO2 was suppressed on the Fe root half (compared to non-split Fe control roots) [4,8]. These observations had suggested that the Fe deficiency responses could be systemically repressed. Here, we tested the possibility whether jasmonate may have mediated the inhibitory systemic effect on the Fe root half in the split root system. Jasmonate is known as a systemically acting plant hormone in response to wounding. We grew plants for 4 weeks using the split root experimental system previously described [4] and exposed split roots to 100 mM Fe (þ Fe) or 0 mM Fe (Fe) (þ/) for 3 days in the absence or presence of ibuprofene. First, we analyzed the split root control situations in the absence of ibuprofene to reconfirm earlier results [4]. In the þ/ split root plants IRT1 and FRO2 expression was induced 2.5- and twofold on the þ Fe root half (split 100) (Fig. 5) compared to the þ/þ Fe control. In the split Fe root half, IRT1 and FRO2 expression was repressed compared to the / Fe control by a factor of four and 14, respectively. Expression levels of IRT1 and FRO2 were twofold
Fig. 4. Analysis of gene expression in fit mutants in response to Fe supply and methyl jasmonate. Reverse transcription-qPCR analysis in six day-old fit and wild type seedlings grown under þ or Fe and where indicated exposed for 6 h to 100 mM methyljasmonate (MeJA); n ¼ 2, SD were calculated for two biological replicates.
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
533
root þ/ Fe situations were not changed significantly. Hence, ibuprofene treatment did not affect Fe deficiency response gene activation or repression in the split root system. This indicates that ibuprofene did not counteract a systemic signal in this assay. 2.5. Analysis of the jasmonate-insensitive mutant coi1-1 grown in the split-root system
Fig. 5. Analysis of gene expression in split roots in response to Fe supply and ibuprofene. A, IRT1 expression; B, FRO2 expression; reverse transcription-qPCR analysis in split roots exposed for 3 days to 100 mM or 0 mM Fe; 100/100 Fe (þ/þ Fe control), 0/0 Fe (/ Fe control), split 100 (þ Fe root half of þ/ split roots), split 0 ( Fe root half of þ/ split roots), in the presence of 10 mM ibuprofene (Ibu) or its absence (control); n ¼ 2, SD were calculated for two biological replicates.
increased in the Fe split root half compared to the þ Fe split root half (Fig. 5). Therefore, IRT1 and FRO2 expression was induced in the split root situation in the þ and Fe side compared to the þ/þ Fe control, respectively, while expression was repressed compared to the / Fe control, respectively. These findings confirmed our previous results [4]. We could reconfirm that IRT1 and FRO2 were systemically suppressed on the Fe split root half, while they were systemically induced on the þ Fe split root half, compared to the respective controls. Next, we analyzed the responses of split roots in the presence of ibuprofene. In the presence of ibuprofene in the split / Fe (0/0) control plants the absolute expression levels of IRT1 and FRO2 were increased 1.4 and ca. twofold compared to the non-ibuprofene controls, while they were increased 1.4- and 2.3fold in the þ/þ Fe (100/100) control situation (Fig. 5) with respect to the untreated controls. Thus, ibuprofene-mediated increases of IRT1 and FRO2 expression described above were reconfirmed. In the þ/ split root plants IRT1 and FRO2 expression was induced 1.6 and fivefold in the Fe root half (split 0), while it was induced two- and fourfold in the þ Fe root half (split 100) compared to the non-ibuprofene controls (Fig. 5). In the split Fe side IRT1 and FRO2 expression was repressed compared to the / Fe control by a factor of 3.7 and six, respectively. IRT1 repression on the Fe split root half versus the / Fe control occurred to the same level upon ibuprofene (- 3.7fold) as in the nonibuprofene-treated samples (- fourfold). Hence, ibuprofene did not inhibit a systemic þ Fe signal. FRO2 repression on the Fe split root half versus / Fe controls was reduced upon ibuprofene treatment (- sixfold) compared to the non-ibuprofene treatment (-14fold). However, due to the standard deviation this 2.3fold difference (14fold divided by 6fold) was not significant suggesting that ibuprofene did not inhibit a þ Fe systemic signal for FRO2 expression, either. Taken together, ibuprofene resulted in a general increase of expression levels of IRT1 and FRO2. However, the general induction/ suppression factors in response to þ/ Fe or in response to the split
To collect further evidence that indeed jasmonate was not involved as a systemic Fe sufficiency signal in the down-regulation of Fe deficiency responses in Fe split root halves we tested whether the above findings could be confirmed when using a jasmonate-insensitive mutant. If indeed jasmonate was not a systemic suppression signal we expected that in the Fe split root halves of the jasmonate-insensitive mutant the expression of FRO2 and IRT1 was not augmented to the high level of / Fe control roots. We used coi1-1 because this mutant is fully jasmonate-insensitive due to a knockout in the jasmonate receptor protein COI1 [27e31]. From the analysis of control þ/þ Fe (100/100) versus / Fe (0/0) plants we found that FRO2 and IRT1 were augmented 2.5 and 2.8 times more strongly in response to Fe in roots of coi1-1 than in roots of wild type (Fig. 6). This control experiment again confirms that jasmonate exerts a negative effect on FRO2 and IRT1 gene expression. In the split þ/ roots we did not observe any increased induction in the Fe root halves of coi1-1 compared to Fe root
Fig. 6. Analysis of gene expression in split roots in the coi1-1 mutant.A, IRT1 expression; B, FRO2 expression; reverse transcription-qPCR analysis in split roots exposed for 3 days to 100 mM or 0 mM Fe; 100/100 Fe (þ/þ Fe control), 0/0 Fe (/ Fe control), split 100 (þ Fe root half of þ/ split roots), split 0 ( Fe root half of þ/ split roots), in wild type or in coi1-1; n ¼ 2, SD were calculated for two biological replicates.
534
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
halves of wild type (Fig. 6). Therefore, we can clearly conclude that the systemic Fe sufficiency signal is still active in the coi1-1 mutant. 3. Discussion Here, we demonstrated that the mobile plant hormone jasmonate affected Fe deficiency gene expression. FRO2 and IRT1 were negatively regulated by jasmonate in a manner that was dependent on jasmonate-Ile signalling. Negative regulation of FRO2 and IRT1 by jasmonate did not require the FIT protein which is a central regulator of Fe deficiency responses although the FIT gene was partially found repressed by jasmonate. The role of jasmonate was not found to be related to systemic signalling of Fe sufficiency responses. 3.1. Jasmonate as inhibitor for Fe deficiency gene expression We suggest from three independent assays that jasmonate has a negative effect on FRO2 and IRT1 gene expression. First, application of jasmonate to plants caused down-regulation of the IRT1 promoter and of FRO2 and IRT1 gene expression levels in roots. Second, application of the lipoxygenase inhibitor ibuprofene caused an up-regulation of FRO2 and IRT1 gene expression. Third, in the background of the jar1-1 mutant that was not able to transform jasmonate into the active jasmonate-Ile and of coi1-1 defective in jasmonate signalling the expression levels of IRT1 and FRO2 were higher than in wild type upon Fe. Taken these three evidences together, we can conclude that jasmonate acts as an inhibitor of Fe deficiency responses. Since the FIT protein is a regulator for promoting IRT1 and FRO2 expression [10,11], it would have been a possibility that the FIT gene itself was under the control of jasmonate. However, we found that this was only partially the case. While we found down-regulation of FIT transcript levels upon jasmonate treatment, we did not observe different FIT expression levels in response to application of ibuprofene or in the background of the jar1-1 mutant. Therefore, the FIT gene only responded to external application of jasmonate however it was not responsive to internal jasmonate as was the case for FRO2 and IRT1. This different responsiveness of FIT to internal and external jasmonate could be due to a concentration effect or a different downstream signalling mechanism after jasmonate perception. A further explanation for the narrow jasmonate effect on the regulator gene FIT could be that internal jasmonate may act on posttranscriptional level to control the activity and abundance of FIT protein. Inhibition of FRO2 and IRT1 was physiologically relevant upon þ Fe. Therefore, it could have been postulated that the adequate Fe uptake as achieved through regulation by functional FIT was a precondition for the inhibitory action of jasmonate. However, we found that the fit mutant reacted to jasmonate so that FRO2 and IRT1 were repressed almost fully. This observation was surprising since the fit mutant was highly Fe-deficient so that we would have expected that in the fit background jasmonate-mediated inhibition of Fe deficiency genes was prevented. This result showed that jasmonate-mediated inhibition of FRO2 and IRT1 was neither dependent on FIT nor on adequate Fe supply. Therefore, we suggest that jasmonate affected an additional mechanism for FRO2 and IRT1 induction upon Fe that is not further known. Interestingly, the lower IRT1 and FRO2 expression levels in the presence of jasmonate did not result in a feedback regulation on the FIT gene. Presumably, the meaning of the inhibitory effect conferred by jasmonate is very subtle. 3.2. Ibuprofene and the coi1-1 mutation did not block a systemic Fe sufficiency signal A negative effect on Fe deficiency gene expression was attributed to systemic Fe sufficiency signals that are thought to be emitted
from Fe-sufficient shoots to down-regulate Fe acquisition responses in root parts with low local Fe availability [4,8]. The chemical nature of systemic signals involved in Fe regulation is not known. We have investigated whether ibuprofene or the coi1-1 mutation might repress a candidate signal requiring for its production lipoxygenase activity. Jasmonate synthesis is dependent on lipoxygenase enzymes and produces a mobile signal known to act systemically in wound responses. coi1-1 is insensitive to jasmonate. If jasmonate was a systemic Fe sufficiency signal we hypothesized that supply of ibuprofene in the split root assay or a coi1-1 background should have resulted in an up-regulation of IRT1 and FRO2 in the Fe split root halves to a level comparable of that in / Fe controls. Although ibuprofene resulted in a general increase of FRO2 and IRT1 gene expression in all the samples the difference between the Fe split root and / Fe control root remained apparent. A final proof was obtained from the genetic experiment using the coi1-1 mutation. This mutant responded normally to the split root situation and showed repression of IRT1 and FRO2 in the Fe root half. Our results therefore showed that the Fe sufficiency signal was still active in the presence of ibuprofene as well as in the jasmonate-insensitive mutant in the Fe root half in the split root assay. Therefore, we can conclude that in split roots jasmonate was not produced as Fe sufficiency signal to inhibit IRT1 and FRO2 on the Fe root half. 3.3. Potential functions of jasmonate-mediated inhibition of Fe acquisition Since we did not find any indication for jasmonate as systemic signal the question arises which function the jasmonate-mediated inhibition of Fe acquisition responses could have in plants. Since jasmonate belongs to the stress hormones that play prominent roles in stress defense situations it could be a possibility that the inhibition of Fe acquisition responses by jasmonate might reflect an adaptation to specific stress responses. For example, jasmonates confer tolerance to insect herbivores and necrotroph pathogens [39e41]. It is conceivable that reducing Fe uptake may help to reduce cell death since necrosis requires Fe-dependent enzymes. Interestingly, ethylene and nitric oxide are known to promote Fe acquisition (for example [13]). Moreover, it has been reported that both signalling compounds can act as potential antagonists of jasmonate responses [42,43]. Hence, Fe acquisition might be under control of a complex interplay of stress hormone pathways. 4. Materials and methods 4.1. Plant material The Arabidopsis thaliana accession used was Col-0. fit-3 loss of function mutant (hereafter named fit mutant) was verified due to the strong leaf chlorosis [9,11]. The jar1-1 and coi1-1 mutants were obtained from the European Arabidopsis Stock Center, and the phenotype was verified by an in vitro jasmonate response root growth assay [32]. pIRT1::GUS plants were obtained from C. Curie [7]. 4.2. Plant growth conditions Arabidopsis seeds were surface-sterilized with 6% NaOCl, 0.1% Triton-X for 10 min, and washed 5 times with distilled water. Seeds were stratified for 2 days in 0.1% plant agar in the dark at 4 C. For the 6-day growth assay seeds were placed on Hoagland agar medium containing 50 mM FeNaEDTA (þ Fe) or 0 mM FeNaEDTA ( Fe), respectively, germinated and grown for 6 d (for Hoagland medium see [11]). On day 6, seedlings were treated pharmacologically for the indicated times, harvested, and deep-frozen until further processing.
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
For the 2-week growth assay, seeds were germinated and seedlings grown for 14 d on Hoagland agar medium containing 50 mM FeNaEDTA, then transferred for 3 days to fresh medium containing either 0 mM FeNaEDTA, 50 mM ferrozine ( Fe) or 50 mM FeNaEDTA (þ Fe), respectively. Then, leaves and roots were harvested separately for RNA or GUS activity analysis. For split root assays according to [4], two week-old plants germinated on 100 mM Fe-containing Hoagland agar medium were root-capitated 2 cm below the hypocotyl. Two weeks later plants were transferred to three-chambered Petri dishes with lateral roots bent to either side of two chambers filled with either 0 Fe/50 mM ferrozine ( Fe) or 100 mM Fe (þ Fe)-containing Hoagland agar medium, respectively. Plants were analyzed three days later. If indicated in the text 100 mM jasmonate, 100 mM methyljasmonate or 10 mM ibuprofene (all SigmaeAldrich, USA), respectively, were added to the growth medium. 100 mM jasmonate, 100 mM methyl-jasmonate and 10 mM ibuprofene were reported to successfully induce or block jasmonate responses [37,38,44]. 4.3. Reverse transcription-qPCR The detailed protocol of the reverse transcription-qPCR procedure was described [45]. Briefly, plant material was ground in liquid nitrogen to a fine powder. Total RNA extraction was performed using the Spectrum plant total RNA kit (SigmaeAldrich, USA) according to the manufacturer’s protocol. 1 mg total RNA was used per cDNA synthesis reaction. RNA was first treated with DNase I (Fermentas, Canada) to eliminate DNA contaminations. mRNAs were then converted into cDNAs using M-MLV reverse transcriptase (Fermentas) with an oligo(dT)18 primer. cDNA was diluted 1:100 and 10 ml cDNA were used in a 20 ml qPCR reaction. Quantitative real-time PCR was performed using the MyIQ real-time detection system and analyzed using the IQ5 software (Bio-Rad, USA). Gene-specific primers for FIT, IRT1 and FRO2 were described [4]. For PDF1.2 (AT5G44420) amplification we used the primer pair 50 CCATCATCACCCTTATCTTC 30 and 50 TGTCCCACTTGGCTTCT 30 . For quantification and calculation of absolute expression values, selfmade quantity standards were utilised with predefined template amounts. 10 ml 2 PreMix ExTaq (Takara, Japan) plus SYBR Green was used for a 20 ml qPCR reaction. The PCR program was 1 cycle (95 C 4 min), 40 cycles (95 C 10 s, 58 C 18 s, 72 C 18 s), 1 cycle (72 C 5 min) followed by a melting curve program (55e90 C in increasing steps of 1 C). Two biological repetitions with three technical repetitions each were performed. Normalization of absolute expression values was achieved using UBP and EF1a amplification as constitutive controls. Standard deviations were calculated for the two biological replicates. 4.4. Analysis of GUS activity Fluorimetric GUS activity tests were performed on protein extracts using 2 mM 4-methylumbeliferyl-b-D-glucuronide as substrate as described by [11]. Acknowledgements Funding by the Deutsche Forschungsgemeinschaft is greatly acknowledged. We thank Angelika Anna for assistance in plant growth. References [1] A. Gojon, P. Nacry, J.C. Davidian, Root uptake regulation: a central process for NPS homeostasis in plants, Curr. Opin. Plant Biol. 12 (2009) 328e338.
535
[2] D. Eide, M. Broderius, J. Fett, M.L. Guerinot, A novel iron-regulated metal transporter from plants identified by functional expression in yeast, Proc. Natl. Acad. Sci. U S A 93 (1996) 5624e5628. [3] N.J. Robinson, C.M. Procter, E.L. Connolly, M.L. Guerinot, A ferric-chelate reductase for iron uptake from soils, Nature 397 (1999) 694e697. [4] H.Y. Wang, M. Klatte, M. Jakoby, H. Baumlein, B. Weisshaar, P. Bauer, Iron deficiency-mediated stress regulation of four subgroup Ib BHLH genes in Arabidopsis thaliana, Planta 226 (2007) 897e908. [5] R. Henriques, J. Jásik, M. Klein, E. Martinoia, U. Feller, J. Schell, M.S. Pais, C. Koncz, Knock-out of Arabidopsis metal transporter gene IRT1 results in iron deficiency accompanied by cell differentiation defects, Plant. Mol. Biol. 50 (2002) 587e597. [6] C. Varotto, D. Maiwald, P. Pesaresi, P. Jahns, F. Salamini, D. Leister, The metal ion transporter IRT1 is necessary for iron homeostasis and efficient photosynthesis in Arabidopsis thaliana, Plant J. 31 (2002) 589e599. [7] G. Vert, N. Grotz, F. Dedaldechamp, F. Gaymard, M.L. Guerinot, J.F. Briat, C. Curie, IRT1, an Arabidopsis transporter essential for iron uptake from the soil and for plant growth, Plant Cell 14 (2002) 1223e1233. [8] G.A. Vert, J.F. Briat, C. Curie, Dual regulation of the Arabidopsis high-affinity root iron uptake system by local and long-distance signals, Plant Physiol. 132 (2003) 796e804. [9] P. Bauer, H.Q. Ling, M.L. Guerinot, FIT, the FER-LIKE IRON DEFICIENCY INDUCED TRANSCRIPTION FACTOR in Arabidopsis, Plant. Physiol. Biochem. 45 (2007) 260e261. [10] E.P. Colangelo, M.L. Guerinot, The essential basic helix-loop-helix protein FIT1 is required for the iron deficiency response, Plant Cell 16 (2004) 3400e3412. [11] M. Jakoby, H.Y. Wang, W. Reidt, B. Weisshaar, P. Bauer, FRU (BHLH029) is required for induction of iron mobilization genes in Arabidopsis thaliana, FEBS Lett. 577 (2004) 528e534. [12] Y.X. Yuan, J. Zhang, D.W. Wang, H.Q. Ling, AtbHLH29 of Arabidopsis thaliana is a functional ortholog of tomato FER involved in controlling iron acquisition in strategy I plants, Cell Res. 15 (2005) 613e621. [13] M.J. García, C. Lucena, F.J. Romera, E. Alcántara, R. Pérez-Vicente, Ethylene and nitric oxide involvement in the up-regulation of key genes related to iron acquisition and homeostasis in Arabidopsis, J. Exp. Bot. 61 (2010) 3885e3899. [14] M. Graziano, L. Lamattina, Nitric oxide accumulation is required for molecular and physiological responses to iron deficiency in tomato roots, Plant J. 52 (2007) 949e960. [15] C. Lucena, B.M. Waters, F.J. Romera, M.J. García, M. Morales, E. Alcántara, R. Pérez-Vicente, Ethylene could influence ferric reductase, iron transporter, and Hþ-ATPase gene expression by affecting FER (or FER-like) gene activity, J. Exp. Bot. 57 (2006) 4145e4154. [16] B.M. Waters, C. Lucena, F.J. Romera, G.G. Jester, A.N. Wynn, C.L. Rojas, E. Alcántara, R. Pérez-Vicente, Ethylene involvement in the regulation of the H (þ)-ATPase CsHA1 gene and of the new isolated ferric reductase CsFRO1 and iron transporter CsIRT1 genes in cucumber plants, Plant. Physiol. Biochem. 45 (2007) 293e301. [17] M. Séguéla, J.F. Briat, G. Vert, C. Curie, Cytokinins negatively regulate the root iron uptake machinery in Arabidopsis through a growth-dependent pathway, Plant J. 55 (2008) 289e300. [18] A. Schikora, W. Schmidt, Acclimative changes in root epidermal cell fate in response to Fe and P deficiency: a specific role for auxin? Protoplasma 218 (2001) 67e75. [19] A. Schikora, W. Schmidt, Iron stress-induced changes in root epidermal cell fate are regulated independently from physiological responses to low iron availability, Plant Physiol. 125 (2001) 1679e1687. [20] W. Schmidt, Mechanisms and regulation of reduction-based iron uptake in plants, New Phytol. 141 (1999) 1e26. [21] W. Schmidt, J. Tittel, A. Schikora, Role of hormones in the induction of iron deficiency responses in Arabidopsis roots, Plant Physiol. 122 (2000) 1109e1118. [22] L.S. Green, E.E. Rogers, FRD3 controls iron localization in Arabidopsis, Plant Physiol. 136 (2004) 2523e2531. [23] M.A. Grusak, S. Pezeshgi, Shoot-to-Root signal Transmission regulates root Fe (III) reductase activity in the dgl mutant of Pea, Plant Physiol. 110 (1996) 329e334. [24] C. Wasternack, E. Kombrink, Jasmonates: structural requirements for lipidderived signals active in plant stress responses and development, ACS. Chem. Biol. 5 (2010) 63e77. [25] J. Shah, Plants under attack: systemic signals in defence, Curr. Opin. Plant Biol. 12 (2009) 459e464. [26] J. Browse, The power of mutants for investigating jasmonate biosynthesis and signaling, Phytochemistry 70 (2009) 1539e1546. [27] A. Chini, S. Fonseca, G. Fernández, B. Adie, J.M. Chico, O. Lorenzo, G. GarcíaCasado, I. López-Vidriero, F.M. Lozano, M.R. Ponce, et al., The JAZ family of repressors is the missing link in jasmonate signalling, Nature 448 (2007) 666e671. [28] B. Thines, L. Katsir, M. Melotto, Y. Niu, A. Mandaokar, G.H. Liu, K. Nomura, S.Y. He, G.A. Howe, J. Browse, JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling, Nat. Biotechnol. 448 (2007) 661e665. [29] H.S. Chung, Y. Niu, J. Browse, G.A. Howe, Top hits in contemporary JAZ: an update on jasmonate signaling, Phytochemistry 70 (2009) 1547e1559. [30] S. Fonseca, A. Chini, M. Hamberg, B. Adie, A. Porzel, R. Kramell, O. Miersch, C. Wasternack, R. Solano, (þ)-7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate, Nat. Chem. Biol. 5 (2009) 344e350.
536
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
[31] J. Yan, C. Zhang, M. Gu, Z. Bai, W. Zhang, T. Qi, Z. Cheng, W. Peng, H. Luo, F. Nan, et al., The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor, Plant Cell Environ. 21 (2009) 2220e2236. [32] P.E. Staswick, I. Tiryaki, M.L. Rowe, Jasmonate response locus JAR1 and several related Arabidopsis genes encode enzymes of the firefly luciferase superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in an assay for adenylation, Plant Cell 14 (2002) 1405e1415. [33] P.E. Staswick, I. Tiryaki, The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis, Plant Cell 16 (2004) 2117e2127. [34] P. Epple, K. Apel, H. Bohlmann, ESTs reveal a multigene family for plant defensins in Arabidopsis thaliana, FEBS Lett. 400 (1997) 168e172. [35] J. Memelink, Regulation of gene expression by jasmonate hormones, Phytochemistry 70 (2009) 1560e1570. [36] P.E. Staswick, J.F. Huang, Y. Rhee, Nitrogen and methyl jasmonate induction of soybean vegetative storage protein genes, Plant Physiol. 96 (1991) 130e136. [37] C. Zhu, L. Gan, Z. Shen, K. Xia, Interactions between jasmonates and ethylene in the regulation of root hair development in Arabidopsis, J. Exp. Bot. 57 (2006) 1299e1308.
[38] P.E. Staswick, W. Su, S.H. Howell, Methyl jasmonate inhibition of root growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant, Proc. Natl. Acad. Sci. U S A 89 (1992) 6837e6840. [39] I.T. Baldwin, Jasmonate-induced responses are costly but benefit plants under attack in native populations, Proc. Natl. Acad. Sci. U S A 95 (1998) 8113e8118. [40] G.J. Beckers, S.H. Spoel, Fine-Tuning plant defence signalling: salicylate versus jasmonate, Plant Biol. 8 (2006) 1e10. [41] J. Glazebrook, Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens, Annu. Rev. Phytopathol. 43 (2005) 205e227. [42] E. Adams, J. Turner, COI1, a jasmonate receptor, is involved in ethyleneinduced inhibition of Arabidopsis root growth in the light, J. Exp. Bot. 61 (2010) 4373e4386. [43] M.L. Orozco-Cárdenas, C.A. Ryan, Nitric oxide negatively modulates wound signaling in tomato plants, Plant Physiol. 130 (2002) 487e493. [44] L.A. Mur, P. Kenton, R. Atzorn, O. Miersch, C. Wasternack, The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death, Plant Physiol. 140 (2006) 249e262. [45] M. Klatte, P. Bauer, Accurate real-time reverse transcription quantitative PCR, Methods Mol. Biol. 479 (2009) 61e77.
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Suppression of Fe deficiency gene expression by jasmonate Felix Maurer, Sabine Müller, Petra Bauer* Dept. Biosciences-Plant Biology, Saarland University, Campus A2.4, D-66123 Saarbrücken, Germany
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 October 2010 Accepted 26 January 2011 Available online 3 February 2011
Fe deficiency genes are regulated in response to external supply of Fe as well as internal plant signals. Internal plant signals include plant hormones and systemic signals which coordinate shoot physiological requirements for Fe with local availability of Fe in roots. Induction of IRT1 and FRO2 gene expression can be used to monitor the Fe deficiency status of plant roots. Here, we investigated the role of jasmonate in the regulation of Fe deficiency responses and in the split root system. We found that jasmonate suppressed expression levels of IRT1 and FRO2 but not their inducibility in response to Fe deficiency. Analysis of the jasmonate-resistant mutant jar1-1 and pharmacological application of the lipoxygenase inhibitor ibuprofene supported an inhibitory effect of this plant hormone. Inhibition of IRT1 and FRO2 gene expression by jasmonate did not require the functional regulator FIT. By performing split root analyses we found that systemic down-regulation of Fe deficiency responses by Fe sufficiency of the shoot was not compromised by ibuprofene and in the jasmonate-insensitive mutant coi1-1. Therefore, we conclude that jasmonate acts as an inhibitor in fine-tuning Fe deficiency responses but that it is not involved in the systemic down-regulation of Fe deficiency responses in the root. Ó 2011 Elsevier Masson SAS. All rights reserved.
Keywords: Jasmonate Iron uptake IRT1 FRO2 FIT Split root
1. Introduction Plant roots are nearly constantly exposed to nutrient salts in their environment. Yet, the uptake profiles for nutrients vary diurnally and in response to various physiological and developmental stimuli. Regulation of nutrient uptake is necessary not only to ensure minimum uptake of the essential nutrients but also to avoid excessive uptake followed by potentially toxic effects. Plants sense the availability of nutrients in their local environment and their physiological diurnal and developmental needs for these nutrients [1]. Uptake of Fe can be used as a model system to study the role of plant internal signals related to nutrient regulation to investigate the underlying regulatory mechanisms. The Fe status of a wild type plant is reflected by the expression levels of marker genes. For example, increased expression of IRT1 and FRO2 in the root compared to a control condition indicates Fe deficiency [2e4]. Mutant studies showed that these two genes encode structural core components for Fe acquisition from the soil following the Fe reduction-based strategy I. FRO2 encodes the root plasmamembrane-bound ferric chelate reductase [3], while IRT1 codes for the divalent metal transporter for Fe uptake [5e7]. FRO2 and IRT1 were
* Corresponding author. Tel.: þ49 681 302 58160; fax: þ49 681 302 4235. E-mail address: [email protected] (P. Bauer). 0981-9428/$ e see front matter Ó 2011 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.plaphy.2011.01.025
often found co-regulated [8]. Their expression is controlled by a bHLH transcription factor named FIT [9]. In the absence of a functional FIT protein the expression of FRO2 and IRT1 is far lower than in wild type and if not supplemented with Fe fit mutants develop a lethal leaf chlorosis [10e12]. Ethylene and nitric oxide positively affect expression of IRT1 and FRO2 suggesting that these two signals increase the sensitivity of plants for Fe uptake [13e16]. Cytokinins on the other hand cause a down-regulation of the two genes [17]. Hormonal influence on Fe acquisition gene expression may serve to coordinate physiology and stress responses with necessary adaptations for altered root growth and uptake of Fe [18e21]. Systemic signals controlling Fe uptake have been physiologically identified but their nature is not known. For instance, grafting of constitutive mutant Fe-deficient shoots to wild type roots can override any local Fe sufficiency sensing in the root and promote constitutive induction of Fe acquisition responses [22,23]. On the other hand, Fe-sufficient shoots may block Fe uptake in Fedeficient parts of split roots [4,8,18,19]. Jasmonates are oxylipin-based plant hormones originating from poly-unsaturated fatty acids that act in response to developmental or environmental stimuli [24]. Environmental cues for activating the jasmonate signalling pathway include wounding, insect attack or UV light and as such jasmonate belongs to the so-called stress hormones. Jasmonate has an interesting property in that it is a systemically acting mobile plant hormone [25]. Progress has been made in identifying the jasmonate signalling pathway by thorough
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
531
analysis of JA resistant and insensitive mutants [26]. Jasmonates are perceived intracellularly by a jasmonate receptor belonging to the F-box protein family that upon binding to the plant hormone targets a repressor of the jasmonate response pathway for degradation [27e29]. The activated jasmonate form most efficiently bound by the jasmonate receptor was found to be an Ile-conjugated derivative of jasmonic acid (JA-Ile, namely (þ)-7-iso-JA-Ile) [30,31]. Isoleucine conjugation to jasmonate is catalyzed by an enzyme encoded by the JAR1 gene [32,33]. Here, we tested whether the plant hormone jasmonate had any effect on the regulation of Fe uptake responses, and whether jasmonate might be a candidate for a systemic signal involved in Fe deficiency regulation.
2. Results 2.1. Gene expression analysis of Fe deficiency genes in response to jasmonate treatment In search for mobile plant signalling compounds that influence the regulation of Fe acquisition and may represent candidates as systemic signals we tested the effect of jasmonate on the regulation of the IRT1 promoter using transgenic pIRT1::GUS plants [7]. We exposed two week-old Arabidopsis seedlings for 3 days to þ or Fe in the presence of 0 or 100 mM jasmonate, respectively. We found that in the absence of jasmonate GUS activity was induced four times in the root upon Fe treatment (Fig. 1). Upon jasmonate treatment absolute GUS activity levels were lower at both þ and Fe conditions compared to the non-jasmonate- treated controls (Fig. 1). However, despite of generally lower GUS activity levels the IRT1 promoter was still induced by Fe in the presence of jasmonate (Fig. 1). In a further experiment we confirmed these results by reverse transcription-qPCR gene expression analysis. We exposed 6 day-old wild type Arabidopsis seedlings grown at þ or Fe for 6 h to 0 or 100 mM methyl-jasmonate, respectively, and analyzed the expression of the Fe acquisition genes. We found that FIT was induced about 2.5fold in the root under Fe conditions compared to the þ Fe control (Fig. 2B), while FRO2 and IRT1 were up-regulated sevenand eightfold (Fig. 2A). Upon methyl-jasmonate treatment, absolute expression levels of FIT, IRT1 and FRO2 were reduced to 40% at Fe, respectively, compared to the untreated controls (Fig. 2A, B). However, FIT, FRO2 and IRT1 were still up-regulated by Fe in the presence of methyl-jasmonate. As a control for successful methyl-jasmonate action, expression of the jasmonate response gene PDF1.2 [34,35] was analyzed and found to be markedly
Fig. 1. IRT1 promoter regulation in response to jasmonate. Regulation of pIRT1 was determined by quantitative GUS activity measurements. Two week-old pIRT1::GUS plants were exposed for three days to þ (50 Fe) and Fe (0 Fe), in the presence of 100 mM jasmonate (JA) or its absence (control); roots were harvested for analysis.
Fig. 2. Analysis of gene expression in response to Fe supply, methyl jasmonate and ibuprofene. A, FRO2 and IRT1 expression; B, FIT expression; reverse transcription-qPCR analysis in six day-old seedlings grown under þ or Fe and exposed for 6 h to 100 mM methyl-jasmonate (MeJA), 10 mM ibuprofene (IBU) or none of them (control); n ¼ 2, SD were calculated for two biological replicates.
induced in the methyl-jasmonate-treated samples compared to the controls (data not shown). Therefore, jasmonate treatment was effective in our experiments. In conclusion, our results demonstrate that external supply of methyl-jasmonate suppressed absolute expression levels of Fe deficiency marker genes in the root but did not inhibit inducibility of these genes by Fe. To obtain further confirmation for the inhibitory effect of jasmonate on Fe deficiency gene expression, plants were treated with 10 mM ibuprofene. Ibuprofene is a known inhibitor of lipoxygenase activity, and such an enzymatic activity is needed during jasmonate biosynthesis. For this reason, ibuprofene is commonly used to assess jasmonate function in plants [36,37]. We found that application of ibuprofene at Fe resulted in comparable expression levels of FIT (Fig. 2B), but 1.5 and 1.9fold increased expression levels of FRO2 and IRT1, respectively, compared to the untreated controls. Thus, the ibuprofene results supported an inhibitory action of jasmonate.
2.2. Gene expression analysis of Fe deficiency marker genes in the jasmonate-resistant mutant jar1-1 JAR1 encodes the jasmonate-amino acid conjugate synthase that transforms jasmonate into the active jasmonate-Ile form
532
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
[32,33]. jar1 mutants are not able to produce jasmonate-Ile conjugates and are resistant to jasmonate treatment [38]. The jar11 mutant is frequently used to assess jasmonate-dependent responses in plants [26]. We analyzed Fe deficiency gene expression in the roots of jar1-1 compared to wild type plants (Fig. 3). As shown above, wild type plants reacted to Fe deficiency, namely IRT1 and FRO2 were induced by Fe compared to þ Fe in the root (Fig. 3A). In jar1-1 mutant roots the absolute expression levels of FRO2 and IRT1 were induced 1.4 and 1.9fold compared to wild type roots at Fe (Fig. 3A, p-values 0.006 and 0.08). At þ Fe FRO2 and IRT1 expression levels were comparable between wild type and jar1-1 mutants (Fig. 3A). FIT was regulated in a similar manner in jar1-1 and wild type plants at þ and Fe (Fig. 3B). Taken together, analysis of the jar1-1 mutant reconfirmed an inhibitory action of jasmonate on the induction of FRO2 and IRT1, but not on the induction of FIT. A defective jasmonate response did not interfere with the general capacity of the plants to suppress Fe acquisition responses at þ Fe. 2.3. Analysis of jasmonate effects in the fit mutant FIT is a central regulator for FRO2 and IRT1 [9e12]. The above results showed that FIT gene expression was negatively affected by jasmonate application in wild type but no influence on FIT gene
Fig. 3. Analysis of gene expression in jar1-1 mutants. A, FRO2 and IRT1 expression; B, FIT expression; reverse transcription-qPCR analysis in six day-old jar1-1 and wild type seedlings grown under þ or Fe; n ¼ 2, SD were calculated for two biological replicates.
expression was noted in the jar1-1 mutant. These results suggested that FIT gene expression might have been overall less affected by jasmonate than expression of FRO2 and IRT1. To further corroborate this finding we investigated whether repression of FRO2 and IRT1 by jasmonate was dependent on the FIT protein itself. Towards this end, we treated wild type and fit mutant plants with or without methyl-jasmonate. We observed that in the fit mutant FRO2 and IRT1 expression levels were reduced compared to wild type at þ and Fe. However, an approximately threefold induction of the two genes at Fe still took place (Fig. 4). This was as expected from previous reports [10,11]. Upon jasmonate treatment, expression of FRO2 and IRT1 was reduced to a very low level and induction was no longer apparent (Fig. 4). Hence, we deduce from these results that jasmonate inhibited FRO2 and IRT1 gene expression independent of the FIT protein. Perhaps jasmonate repressed the yet unknown mechanism that maintains the residual induction of FRO2 and IRT1 in the fit mutant. These results confirm that jasmonate affected FRO2 and IRT1 more than FIT.
2.4. Analysis of ibuprofene effects in the split root system It was previously found that in a split root system the induction of IRT1 and FRO2 was suppressed on the Fe root half (compared to non-split Fe control roots) [4,8]. These observations had suggested that the Fe deficiency responses could be systemically repressed. Here, we tested the possibility whether jasmonate may have mediated the inhibitory systemic effect on the Fe root half in the split root system. Jasmonate is known as a systemically acting plant hormone in response to wounding. We grew plants for 4 weeks using the split root experimental system previously described [4] and exposed split roots to 100 mM Fe (þ Fe) or 0 mM Fe (Fe) (þ/) for 3 days in the absence or presence of ibuprofene. First, we analyzed the split root control situations in the absence of ibuprofene to reconfirm earlier results [4]. In the þ/ split root plants IRT1 and FRO2 expression was induced 2.5- and twofold on the þ Fe root half (split 100) (Fig. 5) compared to the þ/þ Fe control. In the split Fe root half, IRT1 and FRO2 expression was repressed compared to the / Fe control by a factor of four and 14, respectively. Expression levels of IRT1 and FRO2 were twofold
Fig. 4. Analysis of gene expression in fit mutants in response to Fe supply and methyl jasmonate. Reverse transcription-qPCR analysis in six day-old fit and wild type seedlings grown under þ or Fe and where indicated exposed for 6 h to 100 mM methyljasmonate (MeJA); n ¼ 2, SD were calculated for two biological replicates.
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
533
root þ/ Fe situations were not changed significantly. Hence, ibuprofene treatment did not affect Fe deficiency response gene activation or repression in the split root system. This indicates that ibuprofene did not counteract a systemic signal in this assay. 2.5. Analysis of the jasmonate-insensitive mutant coi1-1 grown in the split-root system
Fig. 5. Analysis of gene expression in split roots in response to Fe supply and ibuprofene. A, IRT1 expression; B, FRO2 expression; reverse transcription-qPCR analysis in split roots exposed for 3 days to 100 mM or 0 mM Fe; 100/100 Fe (þ/þ Fe control), 0/0 Fe (/ Fe control), split 100 (þ Fe root half of þ/ split roots), split 0 ( Fe root half of þ/ split roots), in the presence of 10 mM ibuprofene (Ibu) or its absence (control); n ¼ 2, SD were calculated for two biological replicates.
increased in the Fe split root half compared to the þ Fe split root half (Fig. 5). Therefore, IRT1 and FRO2 expression was induced in the split root situation in the þ and Fe side compared to the þ/þ Fe control, respectively, while expression was repressed compared to the / Fe control, respectively. These findings confirmed our previous results [4]. We could reconfirm that IRT1 and FRO2 were systemically suppressed on the Fe split root half, while they were systemically induced on the þ Fe split root half, compared to the respective controls. Next, we analyzed the responses of split roots in the presence of ibuprofene. In the presence of ibuprofene in the split / Fe (0/0) control plants the absolute expression levels of IRT1 and FRO2 were increased 1.4 and ca. twofold compared to the non-ibuprofene controls, while they were increased 1.4- and 2.3fold in the þ/þ Fe (100/100) control situation (Fig. 5) with respect to the untreated controls. Thus, ibuprofene-mediated increases of IRT1 and FRO2 expression described above were reconfirmed. In the þ/ split root plants IRT1 and FRO2 expression was induced 1.6 and fivefold in the Fe root half (split 0), while it was induced two- and fourfold in the þ Fe root half (split 100) compared to the non-ibuprofene controls (Fig. 5). In the split Fe side IRT1 and FRO2 expression was repressed compared to the / Fe control by a factor of 3.7 and six, respectively. IRT1 repression on the Fe split root half versus the / Fe control occurred to the same level upon ibuprofene (- 3.7fold) as in the nonibuprofene-treated samples (- fourfold). Hence, ibuprofene did not inhibit a systemic þ Fe signal. FRO2 repression on the Fe split root half versus / Fe controls was reduced upon ibuprofene treatment (- sixfold) compared to the non-ibuprofene treatment (-14fold). However, due to the standard deviation this 2.3fold difference (14fold divided by 6fold) was not significant suggesting that ibuprofene did not inhibit a þ Fe systemic signal for FRO2 expression, either. Taken together, ibuprofene resulted in a general increase of expression levels of IRT1 and FRO2. However, the general induction/ suppression factors in response to þ/ Fe or in response to the split
To collect further evidence that indeed jasmonate was not involved as a systemic Fe sufficiency signal in the down-regulation of Fe deficiency responses in Fe split root halves we tested whether the above findings could be confirmed when using a jasmonate-insensitive mutant. If indeed jasmonate was not a systemic suppression signal we expected that in the Fe split root halves of the jasmonate-insensitive mutant the expression of FRO2 and IRT1 was not augmented to the high level of / Fe control roots. We used coi1-1 because this mutant is fully jasmonate-insensitive due to a knockout in the jasmonate receptor protein COI1 [27e31]. From the analysis of control þ/þ Fe (100/100) versus / Fe (0/0) plants we found that FRO2 and IRT1 were augmented 2.5 and 2.8 times more strongly in response to Fe in roots of coi1-1 than in roots of wild type (Fig. 6). This control experiment again confirms that jasmonate exerts a negative effect on FRO2 and IRT1 gene expression. In the split þ/ roots we did not observe any increased induction in the Fe root halves of coi1-1 compared to Fe root
Fig. 6. Analysis of gene expression in split roots in the coi1-1 mutant.A, IRT1 expression; B, FRO2 expression; reverse transcription-qPCR analysis in split roots exposed for 3 days to 100 mM or 0 mM Fe; 100/100 Fe (þ/þ Fe control), 0/0 Fe (/ Fe control), split 100 (þ Fe root half of þ/ split roots), split 0 ( Fe root half of þ/ split roots), in wild type or in coi1-1; n ¼ 2, SD were calculated for two biological replicates.
534
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
halves of wild type (Fig. 6). Therefore, we can clearly conclude that the systemic Fe sufficiency signal is still active in the coi1-1 mutant. 3. Discussion Here, we demonstrated that the mobile plant hormone jasmonate affected Fe deficiency gene expression. FRO2 and IRT1 were negatively regulated by jasmonate in a manner that was dependent on jasmonate-Ile signalling. Negative regulation of FRO2 and IRT1 by jasmonate did not require the FIT protein which is a central regulator of Fe deficiency responses although the FIT gene was partially found repressed by jasmonate. The role of jasmonate was not found to be related to systemic signalling of Fe sufficiency responses. 3.1. Jasmonate as inhibitor for Fe deficiency gene expression We suggest from three independent assays that jasmonate has a negative effect on FRO2 and IRT1 gene expression. First, application of jasmonate to plants caused down-regulation of the IRT1 promoter and of FRO2 and IRT1 gene expression levels in roots. Second, application of the lipoxygenase inhibitor ibuprofene caused an up-regulation of FRO2 and IRT1 gene expression. Third, in the background of the jar1-1 mutant that was not able to transform jasmonate into the active jasmonate-Ile and of coi1-1 defective in jasmonate signalling the expression levels of IRT1 and FRO2 were higher than in wild type upon Fe. Taken these three evidences together, we can conclude that jasmonate acts as an inhibitor of Fe deficiency responses. Since the FIT protein is a regulator for promoting IRT1 and FRO2 expression [10,11], it would have been a possibility that the FIT gene itself was under the control of jasmonate. However, we found that this was only partially the case. While we found down-regulation of FIT transcript levels upon jasmonate treatment, we did not observe different FIT expression levels in response to application of ibuprofene or in the background of the jar1-1 mutant. Therefore, the FIT gene only responded to external application of jasmonate however it was not responsive to internal jasmonate as was the case for FRO2 and IRT1. This different responsiveness of FIT to internal and external jasmonate could be due to a concentration effect or a different downstream signalling mechanism after jasmonate perception. A further explanation for the narrow jasmonate effect on the regulator gene FIT could be that internal jasmonate may act on posttranscriptional level to control the activity and abundance of FIT protein. Inhibition of FRO2 and IRT1 was physiologically relevant upon þ Fe. Therefore, it could have been postulated that the adequate Fe uptake as achieved through regulation by functional FIT was a precondition for the inhibitory action of jasmonate. However, we found that the fit mutant reacted to jasmonate so that FRO2 and IRT1 were repressed almost fully. This observation was surprising since the fit mutant was highly Fe-deficient so that we would have expected that in the fit background jasmonate-mediated inhibition of Fe deficiency genes was prevented. This result showed that jasmonate-mediated inhibition of FRO2 and IRT1 was neither dependent on FIT nor on adequate Fe supply. Therefore, we suggest that jasmonate affected an additional mechanism for FRO2 and IRT1 induction upon Fe that is not further known. Interestingly, the lower IRT1 and FRO2 expression levels in the presence of jasmonate did not result in a feedback regulation on the FIT gene. Presumably, the meaning of the inhibitory effect conferred by jasmonate is very subtle. 3.2. Ibuprofene and the coi1-1 mutation did not block a systemic Fe sufficiency signal A negative effect on Fe deficiency gene expression was attributed to systemic Fe sufficiency signals that are thought to be emitted
from Fe-sufficient shoots to down-regulate Fe acquisition responses in root parts with low local Fe availability [4,8]. The chemical nature of systemic signals involved in Fe regulation is not known. We have investigated whether ibuprofene or the coi1-1 mutation might repress a candidate signal requiring for its production lipoxygenase activity. Jasmonate synthesis is dependent on lipoxygenase enzymes and produces a mobile signal known to act systemically in wound responses. coi1-1 is insensitive to jasmonate. If jasmonate was a systemic Fe sufficiency signal we hypothesized that supply of ibuprofene in the split root assay or a coi1-1 background should have resulted in an up-regulation of IRT1 and FRO2 in the Fe split root halves to a level comparable of that in / Fe controls. Although ibuprofene resulted in a general increase of FRO2 and IRT1 gene expression in all the samples the difference between the Fe split root and / Fe control root remained apparent. A final proof was obtained from the genetic experiment using the coi1-1 mutation. This mutant responded normally to the split root situation and showed repression of IRT1 and FRO2 in the Fe root half. Our results therefore showed that the Fe sufficiency signal was still active in the presence of ibuprofene as well as in the jasmonate-insensitive mutant in the Fe root half in the split root assay. Therefore, we can conclude that in split roots jasmonate was not produced as Fe sufficiency signal to inhibit IRT1 and FRO2 on the Fe root half. 3.3. Potential functions of jasmonate-mediated inhibition of Fe acquisition Since we did not find any indication for jasmonate as systemic signal the question arises which function the jasmonate-mediated inhibition of Fe acquisition responses could have in plants. Since jasmonate belongs to the stress hormones that play prominent roles in stress defense situations it could be a possibility that the inhibition of Fe acquisition responses by jasmonate might reflect an adaptation to specific stress responses. For example, jasmonates confer tolerance to insect herbivores and necrotroph pathogens [39e41]. It is conceivable that reducing Fe uptake may help to reduce cell death since necrosis requires Fe-dependent enzymes. Interestingly, ethylene and nitric oxide are known to promote Fe acquisition (for example [13]). Moreover, it has been reported that both signalling compounds can act as potential antagonists of jasmonate responses [42,43]. Hence, Fe acquisition might be under control of a complex interplay of stress hormone pathways. 4. Materials and methods 4.1. Plant material The Arabidopsis thaliana accession used was Col-0. fit-3 loss of function mutant (hereafter named fit mutant) was verified due to the strong leaf chlorosis [9,11]. The jar1-1 and coi1-1 mutants were obtained from the European Arabidopsis Stock Center, and the phenotype was verified by an in vitro jasmonate response root growth assay [32]. pIRT1::GUS plants were obtained from C. Curie [7]. 4.2. Plant growth conditions Arabidopsis seeds were surface-sterilized with 6% NaOCl, 0.1% Triton-X for 10 min, and washed 5 times with distilled water. Seeds were stratified for 2 days in 0.1% plant agar in the dark at 4 C. For the 6-day growth assay seeds were placed on Hoagland agar medium containing 50 mM FeNaEDTA (þ Fe) or 0 mM FeNaEDTA ( Fe), respectively, germinated and grown for 6 d (for Hoagland medium see [11]). On day 6, seedlings were treated pharmacologically for the indicated times, harvested, and deep-frozen until further processing.
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
For the 2-week growth assay, seeds were germinated and seedlings grown for 14 d on Hoagland agar medium containing 50 mM FeNaEDTA, then transferred for 3 days to fresh medium containing either 0 mM FeNaEDTA, 50 mM ferrozine ( Fe) or 50 mM FeNaEDTA (þ Fe), respectively. Then, leaves and roots were harvested separately for RNA or GUS activity analysis. For split root assays according to [4], two week-old plants germinated on 100 mM Fe-containing Hoagland agar medium were root-capitated 2 cm below the hypocotyl. Two weeks later plants were transferred to three-chambered Petri dishes with lateral roots bent to either side of two chambers filled with either 0 Fe/50 mM ferrozine ( Fe) or 100 mM Fe (þ Fe)-containing Hoagland agar medium, respectively. Plants were analyzed three days later. If indicated in the text 100 mM jasmonate, 100 mM methyljasmonate or 10 mM ibuprofene (all SigmaeAldrich, USA), respectively, were added to the growth medium. 100 mM jasmonate, 100 mM methyl-jasmonate and 10 mM ibuprofene were reported to successfully induce or block jasmonate responses [37,38,44]. 4.3. Reverse transcription-qPCR The detailed protocol of the reverse transcription-qPCR procedure was described [45]. Briefly, plant material was ground in liquid nitrogen to a fine powder. Total RNA extraction was performed using the Spectrum plant total RNA kit (SigmaeAldrich, USA) according to the manufacturer’s protocol. 1 mg total RNA was used per cDNA synthesis reaction. RNA was first treated with DNase I (Fermentas, Canada) to eliminate DNA contaminations. mRNAs were then converted into cDNAs using M-MLV reverse transcriptase (Fermentas) with an oligo(dT)18 primer. cDNA was diluted 1:100 and 10 ml cDNA were used in a 20 ml qPCR reaction. Quantitative real-time PCR was performed using the MyIQ real-time detection system and analyzed using the IQ5 software (Bio-Rad, USA). Gene-specific primers for FIT, IRT1 and FRO2 were described [4]. For PDF1.2 (AT5G44420) amplification we used the primer pair 50 CCATCATCACCCTTATCTTC 30 and 50 TGTCCCACTTGGCTTCT 30 . For quantification and calculation of absolute expression values, selfmade quantity standards were utilised with predefined template amounts. 10 ml 2 PreMix ExTaq (Takara, Japan) plus SYBR Green was used for a 20 ml qPCR reaction. The PCR program was 1 cycle (95 C 4 min), 40 cycles (95 C 10 s, 58 C 18 s, 72 C 18 s), 1 cycle (72 C 5 min) followed by a melting curve program (55e90 C in increasing steps of 1 C). Two biological repetitions with three technical repetitions each were performed. Normalization of absolute expression values was achieved using UBP and EF1a amplification as constitutive controls. Standard deviations were calculated for the two biological replicates. 4.4. Analysis of GUS activity Fluorimetric GUS activity tests were performed on protein extracts using 2 mM 4-methylumbeliferyl-b-D-glucuronide as substrate as described by [11]. Acknowledgements Funding by the Deutsche Forschungsgemeinschaft is greatly acknowledged. We thank Angelika Anna for assistance in plant growth. References [1] A. Gojon, P. Nacry, J.C. Davidian, Root uptake regulation: a central process for NPS homeostasis in plants, Curr. Opin. Plant Biol. 12 (2009) 328e338.
535
[2] D. Eide, M. Broderius, J. Fett, M.L. Guerinot, A novel iron-regulated metal transporter from plants identified by functional expression in yeast, Proc. Natl. Acad. Sci. U S A 93 (1996) 5624e5628. [3] N.J. Robinson, C.M. Procter, E.L. Connolly, M.L. Guerinot, A ferric-chelate reductase for iron uptake from soils, Nature 397 (1999) 694e697. [4] H.Y. Wang, M. Klatte, M. Jakoby, H. Baumlein, B. Weisshaar, P. Bauer, Iron deficiency-mediated stress regulation of four subgroup Ib BHLH genes in Arabidopsis thaliana, Planta 226 (2007) 897e908. [5] R. Henriques, J. Jásik, M. Klein, E. Martinoia, U. Feller, J. Schell, M.S. Pais, C. Koncz, Knock-out of Arabidopsis metal transporter gene IRT1 results in iron deficiency accompanied by cell differentiation defects, Plant. Mol. Biol. 50 (2002) 587e597. [6] C. Varotto, D. Maiwald, P. Pesaresi, P. Jahns, F. Salamini, D. Leister, The metal ion transporter IRT1 is necessary for iron homeostasis and efficient photosynthesis in Arabidopsis thaliana, Plant J. 31 (2002) 589e599. [7] G. Vert, N. Grotz, F. Dedaldechamp, F. Gaymard, M.L. Guerinot, J.F. Briat, C. Curie, IRT1, an Arabidopsis transporter essential for iron uptake from the soil and for plant growth, Plant Cell 14 (2002) 1223e1233. [8] G.A. Vert, J.F. Briat, C. Curie, Dual regulation of the Arabidopsis high-affinity root iron uptake system by local and long-distance signals, Plant Physiol. 132 (2003) 796e804. [9] P. Bauer, H.Q. Ling, M.L. Guerinot, FIT, the FER-LIKE IRON DEFICIENCY INDUCED TRANSCRIPTION FACTOR in Arabidopsis, Plant. Physiol. Biochem. 45 (2007) 260e261. [10] E.P. Colangelo, M.L. Guerinot, The essential basic helix-loop-helix protein FIT1 is required for the iron deficiency response, Plant Cell 16 (2004) 3400e3412. [11] M. Jakoby, H.Y. Wang, W. Reidt, B. Weisshaar, P. Bauer, FRU (BHLH029) is required for induction of iron mobilization genes in Arabidopsis thaliana, FEBS Lett. 577 (2004) 528e534. [12] Y.X. Yuan, J. Zhang, D.W. Wang, H.Q. Ling, AtbHLH29 of Arabidopsis thaliana is a functional ortholog of tomato FER involved in controlling iron acquisition in strategy I plants, Cell Res. 15 (2005) 613e621. [13] M.J. García, C. Lucena, F.J. Romera, E. Alcántara, R. Pérez-Vicente, Ethylene and nitric oxide involvement in the up-regulation of key genes related to iron acquisition and homeostasis in Arabidopsis, J. Exp. Bot. 61 (2010) 3885e3899. [14] M. Graziano, L. Lamattina, Nitric oxide accumulation is required for molecular and physiological responses to iron deficiency in tomato roots, Plant J. 52 (2007) 949e960. [15] C. Lucena, B.M. Waters, F.J. Romera, M.J. García, M. Morales, E. Alcántara, R. Pérez-Vicente, Ethylene could influence ferric reductase, iron transporter, and Hþ-ATPase gene expression by affecting FER (or FER-like) gene activity, J. Exp. Bot. 57 (2006) 4145e4154. [16] B.M. Waters, C. Lucena, F.J. Romera, G.G. Jester, A.N. Wynn, C.L. Rojas, E. Alcántara, R. Pérez-Vicente, Ethylene involvement in the regulation of the H (þ)-ATPase CsHA1 gene and of the new isolated ferric reductase CsFRO1 and iron transporter CsIRT1 genes in cucumber plants, Plant. Physiol. Biochem. 45 (2007) 293e301. [17] M. Séguéla, J.F. Briat, G. Vert, C. Curie, Cytokinins negatively regulate the root iron uptake machinery in Arabidopsis through a growth-dependent pathway, Plant J. 55 (2008) 289e300. [18] A. Schikora, W. Schmidt, Acclimative changes in root epidermal cell fate in response to Fe and P deficiency: a specific role for auxin? Protoplasma 218 (2001) 67e75. [19] A. Schikora, W. Schmidt, Iron stress-induced changes in root epidermal cell fate are regulated independently from physiological responses to low iron availability, Plant Physiol. 125 (2001) 1679e1687. [20] W. Schmidt, Mechanisms and regulation of reduction-based iron uptake in plants, New Phytol. 141 (1999) 1e26. [21] W. Schmidt, J. Tittel, A. Schikora, Role of hormones in the induction of iron deficiency responses in Arabidopsis roots, Plant Physiol. 122 (2000) 1109e1118. [22] L.S. Green, E.E. Rogers, FRD3 controls iron localization in Arabidopsis, Plant Physiol. 136 (2004) 2523e2531. [23] M.A. Grusak, S. Pezeshgi, Shoot-to-Root signal Transmission regulates root Fe (III) reductase activity in the dgl mutant of Pea, Plant Physiol. 110 (1996) 329e334. [24] C. Wasternack, E. Kombrink, Jasmonates: structural requirements for lipidderived signals active in plant stress responses and development, ACS. Chem. Biol. 5 (2010) 63e77. [25] J. Shah, Plants under attack: systemic signals in defence, Curr. Opin. Plant Biol. 12 (2009) 459e464. [26] J. Browse, The power of mutants for investigating jasmonate biosynthesis and signaling, Phytochemistry 70 (2009) 1539e1546. [27] A. Chini, S. Fonseca, G. Fernández, B. Adie, J.M. Chico, O. Lorenzo, G. GarcíaCasado, I. López-Vidriero, F.M. Lozano, M.R. Ponce, et al., The JAZ family of repressors is the missing link in jasmonate signalling, Nature 448 (2007) 666e671. [28] B. Thines, L. Katsir, M. Melotto, Y. Niu, A. Mandaokar, G.H. Liu, K. Nomura, S.Y. He, G.A. Howe, J. Browse, JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling, Nat. Biotechnol. 448 (2007) 661e665. [29] H.S. Chung, Y. Niu, J. Browse, G.A. Howe, Top hits in contemporary JAZ: an update on jasmonate signaling, Phytochemistry 70 (2009) 1547e1559. [30] S. Fonseca, A. Chini, M. Hamberg, B. Adie, A. Porzel, R. Kramell, O. Miersch, C. Wasternack, R. Solano, (þ)-7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate, Nat. Chem. Biol. 5 (2009) 344e350.
536
F. Maurer et al. / Plant Physiology and Biochemistry 49 (2011) 530e536
[31] J. Yan, C. Zhang, M. Gu, Z. Bai, W. Zhang, T. Qi, Z. Cheng, W. Peng, H. Luo, F. Nan, et al., The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor, Plant Cell Environ. 21 (2009) 2220e2236. [32] P.E. Staswick, I. Tiryaki, M.L. Rowe, Jasmonate response locus JAR1 and several related Arabidopsis genes encode enzymes of the firefly luciferase superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in an assay for adenylation, Plant Cell 14 (2002) 1405e1415. [33] P.E. Staswick, I. Tiryaki, The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis, Plant Cell 16 (2004) 2117e2127. [34] P. Epple, K. Apel, H. Bohlmann, ESTs reveal a multigene family for plant defensins in Arabidopsis thaliana, FEBS Lett. 400 (1997) 168e172. [35] J. Memelink, Regulation of gene expression by jasmonate hormones, Phytochemistry 70 (2009) 1560e1570. [36] P.E. Staswick, J.F. Huang, Y. Rhee, Nitrogen and methyl jasmonate induction of soybean vegetative storage protein genes, Plant Physiol. 96 (1991) 130e136. [37] C. Zhu, L. Gan, Z. Shen, K. Xia, Interactions between jasmonates and ethylene in the regulation of root hair development in Arabidopsis, J. Exp. Bot. 57 (2006) 1299e1308.
[38] P.E. Staswick, W. Su, S.H. Howell, Methyl jasmonate inhibition of root growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant, Proc. Natl. Acad. Sci. U S A 89 (1992) 6837e6840. [39] I.T. Baldwin, Jasmonate-induced responses are costly but benefit plants under attack in native populations, Proc. Natl. Acad. Sci. U S A 95 (1998) 8113e8118. [40] G.J. Beckers, S.H. Spoel, Fine-Tuning plant defence signalling: salicylate versus jasmonate, Plant Biol. 8 (2006) 1e10. [41] J. Glazebrook, Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens, Annu. Rev. Phytopathol. 43 (2005) 205e227. [42] E. Adams, J. Turner, COI1, a jasmonate receptor, is involved in ethyleneinduced inhibition of Arabidopsis root growth in the light, J. Exp. Bot. 61 (2010) 4373e4386. [43] M.L. Orozco-Cárdenas, C.A. Ryan, Nitric oxide negatively modulates wound signaling in tomato plants, Plant Physiol. 130 (2002) 487e493. [44] L.A. Mur, P. Kenton, R. Atzorn, O. Miersch, C. Wasternack, The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death, Plant Physiol. 140 (2006) 249e262. [45] M. Klatte, P. Bauer, Accurate real-time reverse transcription quantitative PCR, Methods Mol. Biol. 479 (2009) 61e77.