Suppression processes of anionic pollutants released from fly ash by various Ca additives

Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. 2019, 67, 11035−11043

Cloning and Functional Analysis of Two Ca2+-Binding Proteins (CaBPs) in Response to Cyantraniliprole Exposure in Bemisia tabaci (Hemiptera: Aleyrodidae) Lei Guo,*,† Changyou Li,† Pei Liang,‡ and Dong Chu*,† †

Downloaded via UNIV OF CALIFORNIA SAN FRANCISCO on October 22, 2019 at 19:04:52 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Key Lab of Integrated Crop Pest Management of Shandong Province, College of Plant Health and Medicine, Qingdao Agricultural University, Qingdao 266109, P. R. China ‡ Department of Entomology, College of Plant Protection, China Agricultural University, Beijing 100193, P. R. China S Supporting Information *

ABSTRACT: Ca2+-binding proteins (CaBPs) are widely distributed as Ca2+ sensor relay proteins that regulate various cellular processes, including Ca2+ homeostasis. Diamide insecticides such as cyantraniliprole kill insects by disrupting the Ca2+ homeostasis in muscle cells. However, less attention has been paid to the roles of CaBPs in response to insecticides. In this study, two CaBP genes (BtCaBP1 and BtCaBP2) were identified in the whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), and their functions in response to cyantraniliprole were investigated. After expression of BtCaBP1 and BtCaBP2 in vitro, the results of Ca2+ imaging and cytotoxicity assay revealed that the overexpression of each of the BtCaBPs stabilized Ca2+ concentration in the cytoplasm after exposure to cyantraniliprole and decreased the toxicity of cyantraniliprole against Sf 9 cells. However, the knockdown of BtCaBP1 or BtCaBP2 in vivo significantly increased the toxicity of cyantraniliprole to B. tabaci. Taken together, these results provide evidence that BtCaBP1 and BtCaBP2 play a role in response to cyantraniliprole exposure through stabilization of Ca2+ concentration in whiteflies. KEYWORDS: Ca2+-binding proteins, Bemisia tabaci, cyantraniliprole, Ca2+ homeostasis, toxicity, tolerance “EF-hand” motif.14 Because of their key roles in Ca2+ homeostasis, large numbers of CaBPs have been characterized in both plants and animals. 15−17 However, after Ca 2+ homeostasis was disrupted by diamide insecticides, few studies on the role of CaBPs following exposure to the insecticide have been reported in insects. Based on the conserved sequence of EF-hand and transcriptome information (SRA experiment accession number: SRP056464), we screened two CaBP genes in B. tabaci that exhibited significantly induced overexpression after 12 and 24 h of exposure to cyantraniliprole (Figure S1). To further investigate their possible role in response to exposure to diamide insecticides, the full-length cDNA of the two CaBP genes (BtCaBP1 and BtCaBP2) were cloned and characterized in the present study. Their roles in response to cyantraniliprole exposure were determined using a set of techniques including expression in vitro, calcium imaging, cytotoxicity assays, and RNA interference. The results of this study will provide additional knowledge to enable further understanding of the functions of CaBPs and the roles they play in insects’ tolerance to diamide insecticides.

1. INTRODUCTION The sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a serious pest responsible for tremendous economic damages through transmission in excess of 200 plant viruses and is a threat to sustainable agricultural production worldwide.1,2 Chemical insecticides including neonicotinoids have, historically, served as the primary strategy for controlling the pest. However, B. tabaci has developed a high degree of resistance to most insecticides under extensive insecticide pressure from many years of applications.3−6 Diamide insecticides, such as flubendiamide, chlorantraniliprole, and cyantraniliprole, are a class of insecticides that act as agonists, selectively targeting ryanodine receptors (RyRs) and stimulating the release of Ca2+ from internal stores in muscle cells, causing impairment of muscle regulation and subsequent death of the targeted insects.7−10 Cyantraniliprole is the only one of these insecticides that has been shown to be effective on sucking pest insects. Due to its novel mode of action and absence of cross-resistance to other classes of insecticides that have failed to control B. tabaci, cyantraniliprole could become a viable alternative insecticide in the insecticide resistance management.11,12 Ca2+-binding proteins (CaBPs) are widely distributed within cells in numerous organisms and play crucial roles in stabilizing Ca2+ concentration in the cytoplasm by reversibly binding Ca2+ ions.13 The proteins usually contain conserved Ca2+-binding motifs consisting of two helices that flank a “loop” of 12 contiguous residues. Because the motif can be likened to an index finger (E-helix), a curled second finger (the loop), and a thumb (F-helix) of a right hand, it is also referred to as the © 2019 American Chemical Society

2. MATERIALS AND METHODS 2.1. Insects. The B. tabaci used in this study were initially fieldcollected in Ji’nan, Shandong Province, China, in 2012 and the Received: Revised: Accepted: Published: 11035

June 28, 2019 September 7, 2019 September 13, 2019 September 13, 2019 DOI: 10.1021/acs.jafc.9b04028 J. Agric. Food Chem. 2019, 67, 11035−11043

Article

Journal of Agricultural and Food Chemistry Table 1. Primers Used in This Studya primer name

primer sequence

GSP1-CaBP1 GSP2-CaBP2 GSP3-CaBP1 GSP4-CaBP2 Full-CaBP1

TCGTGATGCTCCCATCTCCATCTTTGTC CCGTCCTCGTCCTTGTCGAAGAGCATGA CATCCGTCCGGGAACCACTCTCCAAAGC ACGTCTCGCTACGATGTTCGCACAGTCT TCAGCCAAATCCGTAACTT TGTGGTCTCCGTATAAGAAC GAAATTGGCACGCATGTC GTCCATAAGGAAGGCTCTC F: AAGGTACCATTATGgCTCGAAACGACCTGC R: CGACGCGTGTTGAGACTGAGGTTGGT F:AAGGTACCATTATGgCGTCAGTGCGAAAGAAA R: CGACGCGTTTTTTTCGACGTCAAAATCGTGA F: CCAGAACCAGTCCAGTCTCA R: CCCAACTCCTCCTTCGTGAT F: GATGACAAACCTCGGCGAAA R: ACCATTCCGTCACCGTCTAA F: GCGACTGATTCTTCTCCTGC R: TGGTGCCAACAGATTAGGTGC F: taatacgactcactatagggGACTCGAAACGACCTGCAAT R: taatacgactcactatagggTGAAGTAACCGTCACCATCG F: taatacgactcactatagggTCGTCAGTGCGAAAGAAAGA R: taatacgactcactatagggTCTTCGCAATCTGCTCCTTT F: taatacgactcactatagggCAGTGCTTCAGCCGCTAC R: taatacgactcactatagggGTTCACCTTGATGCCGTTC

Full-CaBP2 Exp-CaBP1 Exp-CaBP2 q-CaBP1 q-CaBP2 q-SDHA ds-CaBP1 ds-CaBP2 dsEGFP

amplicon (bp)

remarks

779

5′ RACE 5′ RACE 3′RACE 3′RACE full-length

592

full-length

732

expression

558

expression

136

qRT-PCR

84

qRT-PCR

141

qRT-PCR

398

RNAi

353

RNAi

288

RNAi

a

Underlined sequences: restriction site. 2.4. Construction of Recombinant Vector, Insect Cell Line Transfection, and Screening. The insect cell line Sf 9 of Spodoptera frugiperda was kindly provided by Dr. Robert Granados from the Boyce Thompson Institute at Cornell University. Sf 9 cells were cultured at 27 °C in TNM-FH medium (Invitrogen, Carlsbad, NM) supplemented with 10% fetal bovine serum (Biological Industries, Beit HaEmek, Israel). BtCaBP1 and BtCaBP2 were first amplified with a forward primer incorporating an Acc65I restriction site and a Kozak consensus sequence into the start codon and a reverse primer adding an MluI restriction site to the end of the open reading frame (Table 1). The PCR product and plasmid pIZ/V5-His were digested with Acc65I and MluI (NEB, Beijing, China). The digested DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany), ligated together, and transformed into Escherichia coli Trans 10 competent cells to obtain the recombinant vectors pIZ− BtCaBP1 and pIZ−BtCaBP2. The correct insertion was confirmed by DNA sequencing. The constructed vectors pIZ−BtCaBP1 and pIZ−BtCaBP2 and empty vector pIZ/V5-His (as control) were each transfected into Sf 9 cells using Cellfectin II liposomal transfection reagent following the protocol provided by the manufacturer (Invirogen, Carlsbad, NM). The cells were then cultured in TNM-FH medium containing 400 μg/mL of zeocin following the protocol for the InsectSelect system (Invirogen, Carlsbad, NM). The transgenic cell lines Sf9−BtCaBP1, Sf9−BtCaBP2, and Sf9−PIZ were obtained and subcultured. 2.5. PCR, Western Blot, and Immunofluorescence Detection of Transgenic Cells. The genomic DNAs of cell lines Sf9−BtCaBP1, Sf9−BtCaBP2, and Sf9−PIZ were extracted using a genomic DNA purification kit (Tiangen, Beijing, China). A set of BtCaBP1 (qCaBP1) and BtCaBP2 (q-CaBP2) primers (Table 1) was used for PCR amplification in a 25 μL system containing 2 μL of DNA template, 1.0 μL of each primer, 2.5 μL of Ex Taq buffer, 2.0 μL of 2.5 mM dNTPs, and 0.25 μL of Ex Taq DNA polymerase under the following conditions: 2 min denaturing at 94 °C, followed by 30 cycles of 30 s at 94 °C, 30 s at 60 °C, and 30 s at 72 °C and a final extension at 72 °C for 5 min. The products of the amplification (136

population was identified as Mediterranean species (MED, also known as Q biotype) according to the molecular method.18 They have been maintained on cotton plants (Gossypium hirsutum L. var. ‘Lumian 28’) in climate chambers set at 27 ± 1 °C, 60 ± 5% relative humidity, and a photoperiod of 16:8 (L:D) h for 6 years without exposure to insecticides. 2.2. Rapid Amplification of cDNA Ends (RACE) and FullLength cDNA Amplification of CaBPs. Total RNA was extracted from 50 mg of flash-frozen B. tabaci adults using a TRIzol kit (Invitrogen, Carlsbad, NM) according to the manufacturer’s instructions. The 5′ and 3′ RACE procedures were used as described by Clontech in their SMARTer RACE cDNA Amplification Kit. Two gene-specific primers (GSPs) were designed to amplify the 5′ and 3′ ends of the cDNA according to the sequence of CaBPs fragments from the B. tabaci transcriptome data (Table 1). The first-strand cDNA was then synthesized using PrimeScript II 1st Strand cDNA Synthesis kit (Takara Biotechnology, Dalian, Liaoning, China), and two pairs of primers (full-CaBP1 and full-CaBP2) were designed according to the sequences of the RACE product to amplify the fulllength cDNA of the BtCaBP1 and BtCaBP2 (Table 1). Using Takara Ex Taq polymerase, the thermal cycling for the polymerase chain reaction (PCR) was: initial denaturing at 94 °C for 2 min, 35 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, with an additional polymerization step at 72 °C for 7 min. All of the PCR products were cloned and sequenced using pMD-18T Vector (Takara Biotechnology, Dalian, Liaoning, China). 2.3. Sequence and Phylogenetic Analysis. The predictions of molecular weight and protein length and amino acid alignment among BtCaBP1, BtCaBP2, and BtCaM were conducted using DNAMAN v.6.03 (Lynnon Corporation). After amino acid sequence-similarity analyses were performed with the BLAST tool, 30 complete amino acid sequences of insect CaBPs from GenBank (http://www.ncbi. nlm.nih.gov/) were used to construct the phylogenetic tree by using the software Clustal W and MEGA 5 software.19,20 Phylogenetic analysis was performed using maximum likelihood. The sampling variance of the distance values was estimated from 1000 bootstrap replicates of the alignment columns, and branches with bootstrap values above 50% are indicated. 11036

DOI: 10.1021/acs.jafc.9b04028 J. Agric. Food Chem. 2019, 67, 11035−11043

Article

Journal of Agricultural and Food Chemistry

fresh medium containing 18.75, 37.5, 75, 150, 300, or 600 μg/mL cyantraniliprole. Medium containing 0.1% DMSO was used as control. After 48 h, 20 μL of MTT (5 mg/mL) was added to each well and incubated for 4 h at 27 °C. The supernatants of the culture media were then aspirated, and 150 μL of DMSO was added to each well to dissolve the formazan crystals. Optical density (OD) was measured with double wavelengths at 492 and 630 nm in an MRXII Microplate Reader (Dynex Technologies, Chantilly, VA). Percent cell viabilities relative to the control were calculated using the formula: cell viability (%) = (OD of treatment/OD of control) × 100. According to the concentration of cyantraniliprole and the cell inhibition ratio, we obtained the dose−response curve and calculated two cyantraniliprole concentrations to inhibit approximately 40 and 60% Sf9−PIZ cell viability. The concentrations were used as diagnostic doses to incubate the Sf9−BtCaBP1 and Sf9−BtCaBP2 cells based on the above description. Cell viability was also determined using the MTT assays after 48 h. 2.8. Functional Analysis of the CaBPs Gene in B. tabaci by RNAi. To investigate the role of BtCaBPs in response to cyantraniliprole exposure, RNAi assay and bioassay were conducted.25,26 The fragments of the BtCaBP1, BtCaBP2, and enhanced green fluorescent protein (EGFP) genes were amplified by reversetranscription PCR (RT-PCR) using specific primers conjugated with 20 bases of the T7 RNA polymerase promoter (Table 1). The PCR products of BtCaBP1 (398 bp), BtCaBP2 (353 bp), and EGFP (288 bp) were used as templates for double-stranded RNA (dsRNA) synthesis using the TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific, Logan, UT). After synthesis, the dsRNA was ethano-precipitated, resuspended in nuclease-free water, quantified with a NanoPhotometer N50 (Implen, Munich, Germany), and stored at −20 °C until use. Approximately 250 whitefly adults were collected and placed into a 50 mL tube (2.5 cm in diameter, 5.5 cm in height) with the upper end blocked with a cap and the other end blocked with a layer of gauze to allow ventilation. Two milliliters of a 25% sucrose solution containing 500 ng/μL of dsRNA was sealed into the cap with a layer of poly(tetrafluoroethylene) film as a food source. The tubes were then placed in climate chambers (27 °C ± 1 °C, 60 ± 5% relative humidity). The control group containing 250 whitefly adults was fed with an equivalent concentration of dsEGFP. After being continuously fed on a diet containing dsBtCaBP1, dsBtCaBP2, or dsEGFP for 3 days, about 180 normally lived whitefly adults in each treatment were randomly collected and divided into two groups. One group of whiteflies including about 90 adults (30 adults in each of the three replicates) was used for total RNA extraction and quantitative real-time PCR (qRT-PCR) to determine the effect of RNAi. The qRT-PCRs were performed in a 20 μL mixture containing 1 μL of cDNA, 10 μL of 2× SYBR Premix Ex Taq II (Takara Biotechnology, Dalian, Liaoning, China), 1 μL of each primer (Table 1), and 7 μL of H2O. All samples, including the “notemplate” negative controls, were performed in triplicate. The qRTPCR program used was as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. After the cycling protocol, melting curves were obtained by increasing the temperature from 60 to 95 °C to denature the double-stranded DNA. The expression of succinate dehydrogenase complex subunit A (SDHA) was chosen as endogenous reference for normalization of gene expression. The relative expression of BtCaBP1 and BtCaBP2 was calculated by the 2−ΔΔCt method.27 Another group of 90 whitefly adults (30 adults in each of the three replicates), after being continuously fed on a dsRNA-containing diet for 3 days, was exposed to 4.0 mg L−1 of cyantraniliprole, which was expected to kill 50% of the B. tabaci adults according to the preliminary experiment (LC50 of cyantraniliprole was 4.27 mg L−1 with a 95% confidence interval of 3.51−5.35 mg L−1) using the leaf dip method.28 Briefly, the formulated cyantraniliprole prepared in DMSO was diluted with distilled water (containing 0.5‰ Triton X100). Cotton leaf disks (diameter, 2.5 cm) were cut and immersed for 10 s in cyantraniliprole or in distilled water as a control. The leaf disks were placed abaxial side down on a bed of agar (1%) within the plugsealed cap. A total of 30 adult whiteflies were placed into each tube,

bps for BtCaBP1 and 84 bps for BtCaBP2) determined the presence of the genes in the transgenic cell lines. Approximately 106 cells of the transgenic insect cell lines in the logarithmic growth phase were collected and lysed using sodium dodecyl sulfate (SDS) sample buffer as the total cellular proteins. The protein samples were subjected to SDS−polyacrylamide gel electrophoresis and transferred onto poly(vinylidene fluoride) (PVDF) membranes. The PVDF membranes were then immersed in the antiHis tag rabbit polyclonal antibody and anti-β-actin mouse monoclonal antibody solution, respectively, and incubated at 4 °C overnight. After washing with phosphate-buffered saline (PBS), the membranes were immersed in alkaline phosphatase (AP)-conjugated goat anti-rabbit lgG antibody and AP-conjugated goat anti-mouse IgG antibody, respectively, and incubated for 1 h on a vertical shaker. Detection of antibody recognition was performed using the BCIP/NBT color development substrate (Thermo Scientific, Logan, UT) in the dark. One microliter of 2 × 105 cells/mL transgenic insect cell lines in the logarithmic growth phase was inoculated in 15 mm glass-bottom cell culture dishes for laser confocal microscopy (Nest Biotechnology, Wuxi, Jiangsu, China). After incubation at 27 °C for 3 days, cells were stained with anti-His tag rabbit polyclonal antibody and Cy3conjugated goat anti-rabbit IgG for 1 h, respectively, and 1 mL (1 g/mL) of 4′,6-diamidino-2-phenylindole (DAPI) for 5 min, and washed twice with PBS. Afterward, they were observed and photographed under a confocal laser scanning microscope. 2.6. Calcium Imaging. Calcium imaging was accomplished using Fluo 4-AM dye (Invitrogen, Carlsbad, NM) according to the instructions. First, 200 μL of 1 × 105 cells/mL Sf 9 cells in the logarithmic growth phase were inoculated in a 15 mm glass-bottom cell culture dish designed for laser confocal microscopes (Nest Biotechnology, Wuxi, Jiangsu, China). After incubation at 27 °C for 2−3 days, the cells were first washed with an extracellular solution (150 mM NaCl, 5 mM KCl, 2 mM MgCl2, 10 mM HEPES−NaOH (PH 7.4), 4 g/L glucose) three times and loaded in 5 μM Fluo 4-AM with the addition of 0.02% pluronic F127 (Solarbio, Beijing, China) for 45 min at 27 °C. The cells were then washed with the extracellular solution three times, followed by adding 550 μL of the extracellular solution and then placing the solution in the dark for 30 min at 27 °C. The cell culture dish was placed on the stage of a confocal laser scanning microscope equipped with a Leica TCS SP5 (Leica, Mannheim, Germany). The roles of BtCaBPs in Ca2+ homeostasis regulation were investigated after cyantraniliprole was directly applied to the cells. Preliminary experiments established that treatment with 75 mg/L of cyantraniliprole could significantly elevate the Ca2+ concentration; therefore, an equal volume of cyantraniliprole (technical grade 94%, DuPont Agriculture, Shanghai, China) stock solution (150 mg/mL, dissolved in extracellular solution containing 0.2% dimethyl sulfoxide, DMSO) was added to the extracellular solution at a final concentration of 75 mg/L. The cells exposed to cyantraniliprole were then directly illuminated at 488 nm, and Fluo-4AM fluorescence was detected at 520 nm every 60 s for 6 h. All imaging was conducted using an HC PLAPO CS 10/0.4× lens. Images were captured with LASAF software (Leica, Mannheim, Germany) and stored for subsequent analysis using Image-Pro Plus software v. 7.0 (Media Cybernetics, Bethesda, MD). A semiquantitative measurement was used for the quantitative analysis of Ca2+ release, as previously described.21,22 Measurements of changes in the intracellular Ca2+ concentrations were made by obtaining the average Fluo-4 fluorescence intensity of individual cell bodies. Changes in the fluorescence of Ca2+ concentrations in each cell were represented by changes in the relative Fluo-4AM fluorescence (F/F0), where F is the fluorescence at time t and F0 is the average fluorescence reading during the first 5 min. 2.7. Cyantraniliprole Exposure and Cell Viability Assay. The effect of cyantraniliprole on the viability of Sf 9 cell lines was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) bioassay.23,24 The Sf9−PIZ cell suspensions (1 × 105 cells/mL) were seeded onto 96-well plates (100 μL/well) and incubated for 24 h. The medium was then removed and replaced with 11037

DOI: 10.1021/acs.jafc.9b04028 J. Agric. Food Chem. 2019, 67, 11035−11043

Article

Journal of Agricultural and Food Chemistry

Figure 1. (A) Amino acid sequence comparison of BtCaBP1 (GenBank accession NO. MK204650) and BtCaBP2 (MK204651) to the evolutionarily conserved BtCaM (MH733824). Identical amino acids (equal to 100%) are framed by solid black, identical amino acids (greater than or equal to 75%) are framed by solid dark gray and identical amino acids (greater than or equal to 50%) are framed by light gray. Alignment gaps are indicated by dashes. The four predicted EF-hand motifs in BtCaM and CaBPs are shown in open boxes. Sequences were aligned using DNAMAN v.6.03 (Lynnon Corporation, Quebec, Canada). (B) The consensus sequence of the EF-hand Ca2+-binding loop of 12 amino acids. “X”, “Y”, “Z”, “-X”, “-Y”, and “-Z”, designate the key equivalent structural positions within all EF-hand domains, as numbered in Marsden et al. (1990).29 At position 8, Ile is the most common residue. At positions X and -Z, Asp and Glu are generally present, respectively; “.” denotes an amino acid. Amino acids at positions 1, 3, 5, 6, 8, and 12 are the most highly conserved residues, in particular, those shaded in gray. and the tubes were capped. The tubes were kept in a climatic chamber at 27 ± 1 °C with a 16:8 (light:dark) photoperiod. Mortality was recorded at 48 h after treatment, with three replicates conducted for each treatment. 2.9. Statistical Analysis. The data were used to calculate means ± standard deviation (SD) and were analyzed by one-way analysis of variance (ANOVA) using InStat v.3.0 software (GraphPad Software, San Diego). All two-mean comparisons (i.e., cell viability, gene expression, and mortality) were subjected to Student’s t-test.

calmodulin (BtCaM) (GenBank accession no. MH733824), although they both showed a high similarity to BtCaM in the conserved EF-hand motifs. There were four putative functional EF-hands (EF-hand 1−4) in BtCaBP2, but only three in BtCaBP1, with EF-hand 3 being absent (Figure 1A), according to the consensus sequence of the EF-hand motif (Figure 1B). Amino acid substitutions within the EF-hand 3 motif (His at position 3 instead of Asp/Asn/Glu, Arg at position 5 instead of an oxygen-containing amino acid, a flexible −Gly−Gly− sequence, and Asp at position 12 instead of Glu) may not allow Ca2+ coordination to this loop. In addition, these proteins were characterized by a relatively high content of acidic residues. For example, a number of conserved hydrophobic amino acids were present in both proteins, but neither contained a tryptophan. Although there was no signal peptide sequence and myristoylation at the N-terminus, both BtCaBPs had a longer N-terminal extension that preceded the first EF-hand motif than that of BtCaM (BtCaM, 6 residues; BtCaBP1, 75 residues; BtCaBP2, 41 residues). According to the phylogenetic tree, the CaBPs from 30 insects formed two cluster and BtCaBP1 and BtCaBP2 were well divided into two clusters, which was similar to some CaBPs isoforms of Anoplophora glabripennis, Camponotus floridanus, Frankliniella occidentalis, and Onthophagus taurus. BtCaBP1 together with most CaBPs from Hemiptera insects were grouped together. BtCaBP2 and a CaBP sequence from

3. RESULTS 3.1. cDNA Cloning and Analysis of the two BtCaBP Genes. The full-length cDNA of BtCaBP1 contained a 377 bps 5′-untranslated region (UTR), followed by an open reading frame (ORF) of 732 bps, and a 1386 bps 3′-UTR, including a poly A tail. The cDNA encoded for a protein composed of 243 amino acids with a molecular mass of 27.1 kDa and a predicted pI of 3.98. The full-length cDNA of BtCaBP2 contained a 567 bps 5′- UTR, followed by an ORF of 558 bps, and a 2623 bps 3′ -UTR, including a poly-A tail. The cDNA was encoded for a protein containing 185 amino acids with a molecular mass of 21.2 kDa and a predicted pI of 4.4. The two cDNA sequences have been submitted to the GenBank with accession nos. MK204650 and MK204651, respectively. The amino acid sequence of BtCaBP2 shares a higher identity (57.30%) than BtCaBP1 (32.10%) with B. tabaci 11038

DOI: 10.1021/acs.jafc.9b04028 J. Agric. Food Chem. 2019, 67, 11035−11043

Article

Journal of Agricultural and Food Chemistry

Figure 2. Phylogenetic relationships among BtCaBP1, BtCaBP2, and other insect CaBPs. The phylogram was constructed using the maximum likelihood method in MEGA 5, and bootstrap values were calculated based on 1000 replicates with a cutoff of <50%.

Figure 3. (A) Identification of transgenic cell lines by PCR. (B) Western blot analysis of transgenic cell lines. (C) Subcellular localization of Histagged fluorescent proteins.

Cimex lectularius (only two CaBPs from Hemiptera insects) were grouped together in another cluster (Figure 2). 3.2. Detection of BtCaBPs in the Transgenic Cell Lines. Genomic DNAs of Sf9−BtCaBP1, Sf9−BtCaBP2, and Sf9−PIZ cells were amplified by PCR. A 136 bps product specific for BtCaBP1 and an 84 bps product specific for BtCaBP2 were detected in the Sf9−BtCaBP1 and Sf9− BtCaBP2 cell lines, respectively (Figure 3A). No PCR products were amplified in the Sf9−PIZ cell line. These results suggest that BtCaBP1 and BtCaBP2 were successfully

transferred into the Sf9−BtCaBP1 and Sf9−BtCaBP2 cell lines, respectively. The total protein of the transgenic cell lines was extracted and analyzed by western blot, with results showing that a solitary band of approximately 26 kDa was detected in protein samples from the Sf9−BtCaBP1 cell line and a specific band less than 26 kDa was present in the Sf9−BtCaBP2 line, which are similar to the theoretical molecular weights of BtCaBP1 (27.1 kDa) and BtCaBP2 (21.2 kDa), respectively (Figure 3B). 11039

DOI: 10.1021/acs.jafc.9b04028 J. Agric. Food Chem. 2019, 67, 11035−11043

Article

Journal of Agricultural and Food Chemistry

Figure 4. Plot of fluorescence intensity (mean ± SD) of Sf 9 cells expressing different CaBPs after exposure to cyantraniliprole. (A) Sf9−PIZ cells (control group) (n = 7). (B) Sf9−CaBP1 cells (n = 8). (C) Sf9−CaBP2 cells (n = 10).

Immunofluorescence staining results showed that the majority of cells expressing BtCaBP1 and BtCaBP2 proteins displayed identical localization patterns and that an extensive distribution signal occurred in the entire cytoplasmic region (Figure 3C). As observed in all cells, the fluorescence intensities of the tagged proteins were similar, demonstrating that the expressed proteins were evenly distributed in the subcellular regions. 3.3. Effect of BtCaBPs on Ca2+ Homeostasis. After exposing Sf9−BtCaBP1, Sf9−BtCaBP2, and Sf9−PIZ cells to the minimal Ca2+ saline extracellular solution containing 75 μg/mL of cyantraniliprole, the change of Ca2+ concentration in the cytoplasm was measured by confocal microscopy using Fluo-4AM as the free Ca2+ indicator. There was a significant increase of Ca2+ concentration in the Sf9−PIZ cells from 151 to 173 min after exposure of the cells to cyantraniliprole. The Ca2+ concentration remained at a high level afterward, reaching its peak (F/F0 = 17.29 ± 2.27) during the next 36 min. Eventually, the Ca2+ concentration slowly reverted to its base level after ca. 2.5 h (Figure 4A). In the Sf9−BtCaBP1 cells, the Ca2+ concentration in the cytoplasm increased, but very slowly (Figure 4B). During the entire duration of the experiment (360 min), the highest Ca2+ concentration (F/F0) only reached 4.23 ± 0.23, which was only 24.47% of the level reached in the Sf9− PIZ cells. Similar results were observed in the Sf9−BtCaBP2 cells, where the highest Ca2+ concentration was only 6.03 ± 0.65 and then declined by 65.12%, compared to the Sf9−PIZ cells (Figure 4C). 3.4. Overexpression of BtCaBPs Decreased the Cytotoxicity of Cyantraniliprole. Based on the dose− response curve of cyantraniliprole’s effect on the Sf9−PIZ cells (Figure 5), two diagnostic doses (75 and 150 μg/mL) (which inhibited approximately 40 and 60% of Sf9−PIZ cell viability) were selected to treat the two other transgenic cell lines: Sf9− BtCaBP1 and Sf9−BtCaBP2. After treatment with 150 μg/mL of cyantraniliprole for 48 h, the viability of the Sf9−PIZ cells was 44.7 ± 3.1%, while the viabilities of the Sf9−BtCaBP1 and Sf9−BtCaBP2 cells were 62.7 ± 1.1% and 59.4 ± 2.2%, respectively. These percentages were 1.40- and 1.33-fold higher than that of the Sf9−PIZ cells. When 75 μg/mL of cyantraniliprole was applied, similar results were obtained. The cell viabilities of the Sf9−BtCaBP1 and Sf9−BtCaBP2 cell lines were 71.1 ± 0.6 and 68.2 ± 1.8%, respectively, which were 1.21- and 1.16-fold higher than that of the Sf9−PIZ cells (58.8 ± 1.2%) (Figure 5). 3.5. Knockdown of BtCaBPs Expression Increased the Tolerance of B. tabaci to Cyantraniliprole. Compared to the control group fed on dsEGFP, 3 days of continuous

Figure 5. Viability of different Sf 9 cell lines after exposure to cyantraniliprole for 48 h. The graph at the top left corner is the log (dose)−probit curves of cyantraniliprole to the Sf9−PIZ cell line. Data in the column figure are presented as the mean ± SD of three independent replicates. The asterisks represent a significant difference between the Sf 9 cells expressed CaBPs and the corresponding control (Sf9−PIZ cell) by Student’s t test (P < 0.05).

ingestion of dsBtCaBP1 significantly reduced the relative expression of BtCaBP1 by 63.1%, but showed no effect on the expression of BtCaBP2 (Figure 6A). Similarly, ingestion of dsBtCaBP2 suppressed the relative expression of BtCaBP2 by 58.8% but had no influence on the relative expression of BtCaBP1 (Figure 6B). After the B. tabaci adults fed on dsRNAs for 3 days, no other obvious morphological changes occurred in the dsBtCaBP1 and dsBtCaBP2 groups. The 48 h natural mortality in the dsBtCaBP1 group (15.64 ± 5.56%) was higher than that of the dsEGFP group (5.10 ± 5.21%), although the difference was not statistically significant. The natural mortality in the dsBtCaBP2 group (3.51 ± 6.08%) was similar to that in the dsEGFP group. In other words, the RNAi of BtCaBPs did not cause obvious mortalities of B. tabaci. When dsRNA-treated whiteflies were exposed to an LC50 dosage of cyantraniliprole, the 48 h corrected mortalities in the dsBtCaBP1 and dsBtCaBP2 groups were 85.94 ± 9.63 and 76.57 ± 3.50%, respectively. These figures were significantly 11040

DOI: 10.1021/acs.jafc.9b04028 J. Agric. Food Chem. 2019, 67, 11035−11043

Article

Journal of Agricultural and Food Chemistry

Figure 6. Relative expressions of BtCaBP1 and BtCaBP2 in B. tabaci adults after feeding on dsBtCaBP1 (A) or dsBtCaBP2 (B) for 3 days, and the 48 h mortalities of B. tabaci adults, which were fed on dsBtCaBP1 or dsBtCaBP2 for 3 days and then treated with LC50 dosages of cyantraniliprole (C). The data are presented as the mean ± SD of three independent replicates. The asterisks indicate significant differences between the treatment and the corresponding control (Student’s t test, P < 0.05).

concentrations of cyantraniliprole were needed in the study. And the mode of action of cyantraniliprole in the original Sf 9 cells was needed to further confirm, although endogenous RyR is marginally expressed in Sf9 cells.30 Since the increase of Ca2+ may be a secondary effect from the cytotoxic action, the results of Ca2+ imaging and cell viability assay revealed that CaBPs participate in the regulation of Ca2+ concentration after exposed to cyantraniliprole. RNAi assays were used in the loss-of-function experiments to identify the role CaBPs play in tolerance to cyantraniliprole. Results from the RNAi assays showed that mortalities in the dsBtCaBP1 and dsBtCaBP2 groups were obviously higher than that in the dsEGFP group. This result was similar to that found in the knockdown of CaM, one of the most conserved Ca2+binding proteins in organisms (unpublished data). Our results strongly suggest that CaBPs, including CaM, play an important role in the rapid and adaptive response to cyantraniliprole and are involved in decreasing the toxicity of the insecticides in B. tabaci. However, mutations in RyR34−36 and overexpression of detoxifying enzymes37,38 have been thought to be the major mechanisms involved in resistance to diamide insecticides, and no other resistance mechanisms have been reported to date regarding diamide resistance. Their functions in resistance to diamide insecticides should be further confirmed in additional

higher than the mortality of the control group fed on dsEGFP (51.64 ± 9.15%) by 66.42 and 48.28%, respectively (Figure 6C). This suggested that the knockdown of the BtCaBPs expression dramatically increased the susceptibility of B. tabaci to cyantraniliprole.

4. DISCUSSION In the gain-of-function experiments, the obvious Ca 2+ concentration peaks were only present in the Sf9 cells but not in the Sf9−BtCaBPs cells after the cells were exposed to 75 mg/L cyantraniliprole, confirming that the two CaBPs could stabilize Ca2+ concentration. It should be noted that the concentration used in the present study was considerably higher than that in some other studies in which cyantraniliprole exhibited extremely high activity against the Sf 9 cells (the EC50 of cyantraniliprole was approximately 42.63−118.43 μg/L), with the calcium signals being induced by micromolar diamide insecticide concentrations.30−32 We believe that this difference may be due to the methods that whether expressed RyR in the Sf 9 cells or not. It has been shown in other cases that prior to the heterologous expression of RyR, the Sf 9 cells showed a high degree of tolerance to diamide insecticides (EC50 of chlorantraniliprole for Sf 9 cells was over 20 mg/L).33 Because we did not coexpress the RyR in the Sf 9 cells, high 11041

DOI: 10.1021/acs.jafc.9b04028 J. Agric. Food Chem. 2019, 67, 11035−11043

Journal of Agricultural and Food Chemistry

■

species that have developed resistance to the compounds, as well as in resistant B. tabaci strains that are known to overexpress CaBPs and CaM. In subsequent studies, the binding parameters of the CaBPs should be further studied to distinguish the type of CaBPs (EFhand-containing CaBPs are conventionally divided into Ca2+ sensors and Ca2+ buffers), although both are essential components of Ca2+ homeostasis through exertion of their specific functions.39,40 For example, some CaBPs can function as Ca2+ sensors to modulate the activity of Ca2+ channel targets by binding to those particular channels.41−43 In other cases, CaBPs can act as Ca2+ buffers to rapidly control the spatiotemporal aspects of the intracellular Ca2+ concentration in very short durations, ranging from a few to hundreds of milliseconds.44,45 In addition, to clear the modulating character of the two CaBPs after exposure to diamide insecticides and their function in resistance to diamide insecticides, downstream target proteins such as RyR will need to be coexpressed, with subsequent physiological and pharmacological studies necessary to determine their binding parameters. In summary, we identified and characterized two CaBPs in B. tabaci. Transgenic expression of both BtCaBPs in vitro stabilized the Ca2+ concentration in the cytoplasm and reduced cytotoxicity after exposure to cyantraniliprole, while the knockdown of these two genes in vivo increased the tolerance of B. tabaci to the insecticide. These results demonstrated that BtCaBP1 and BtCaBP2 participate in the response to cyantraniliprole via stabilization of Ca2+ concentration, which may provide new insight into the functions of CaBPs in insects.

■

REFERENCES

(1) De Barro, P. J.; Liu, S.; Boykin, L. M.; Dinsdale, A. B. Bemisia tabaci: a statement of species status. Annu. Rev. Entomol. 2011, 56, 1− 19. (2) Navas-Castillo, J.; López-Moya, J. J.; Aranda, M. A. Whiteflytransmitted RNA viruses that affect intensive vegetable production. Ann. Appl. Biol. 2014, 165, 155−171. (3) Elbert, A.; Nauen, R. Resistance of Bemisia tabaci (Homoptera: Aleyrodidae) to insecticides in southern Spain with special reference to neonicotinoids. Pest Manage. Sci. 2000, 56, 60−64. (4) Meng, X.; Zhu, C.; Feng, Y.; Li, W.; Shao, X.; Xu, Z.; Cheng, J.; Li, Z. Computational insights into the different resistance mechanism of imidacloprid versus dinotefuran in Bemisia tabaci. J. Agric. Food Chem. 2016, 64, 1231−1238. (5) Nauen, R.; Denholm, I. Resistance of insect pests to neonicotinoid insecticides: current status and future prospects. Arch. Insect Biochem. Physiol. 2005, 58, 200−215. (6) Wang, Z.; Yan, H.; Yang, Y.; Wu, Y. Biotype and insecticide resistance status of the whitefly Bemisia tabaci, from China. Pest Manage. Sci. 2010, 66, 1360−1366. (7) Jeanguenat, A. The story of a new insecticidal chemistry class: the diamides. Pest Manage. Sci. 2013, 69, 7−14. (8) Lahm, G. P.; Selby, T. P.; Freudenberger, J. H.; Stevenson, T. M.; Myers, B. J.; Seburyamo, G.; Smith, B. K.; Flexner, L.; Clark, C. E.; Cordova, D. Insecticidal anthranilic diamides: a new class of potent ryanodine receptor activators. Bioorg. Med. Chem. Lett. 2005, 15, 4898−4906. (9) Qi, S.; Lümmen, P.; Nauen, R.; Casida, J. E. Diamide insecticide target site specificity in the Heliothis and Musca ryanodine receptors relative to toxicity. J. Agric. Food Chem. 2014, 62, 4077−4082. (10) Sattelle, D. B.; Cordova, D.; Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebr. Neurosci. 2008, 8, 107−119. (11) Barry, J. D.; Portillo, H. E.; Annan, I. B.; Cameron, R. A.; Clagg, D. G.; Dietrich, R. F.; Watson, L. J.; Leighty, R. M.; Ryan, D. L.; McMillan, J. A.; Swain, R. S.; Kaczmarczyk, R. A. Movement of cyantraniliprole in plants after foliar applications and its impact on the control of sucking and chewing insects. Pest Manage. Sci. 2015, 71, 395−403. (12) Moreno, I.; Belando, A.; Grávalos, C.; Bielza, P. Baseline susceptibility of Mediterranean strains of Trialeurodes vaporariorum (Westwood) to cyantraniliprole. Pest Manage. Sci. 2018, 74, 1552− 1557. (13) Bagur, R.; Hajnóczky, G. Intracellular Ca2+ sensing: its role in calcium homeostasis and signaling. Mol. Cell 2017, 66, 780−788. (14) Vyas, N. K.; Vyas, M. N.; Quiocho, F. A. A novel calcium binding site in the galactose-binding protein of bacterial transport and chemotaxis. Nature 1987, 327, 635−638. (15) Burgoyne, R. D. Neuronal calcium sensor proteins: generating diversity in neuronal Ca2+ signalling. Nat. Rev. Neurosci. 2007, 8, 182− 193. (16) DeFalco, T. A.; Bender, K. W.; Snedden, W. A. Breaking the code: Ca2+ sensors in plant signalling. Biochem. J. 2010, 425, 27−40. (17) Mikhaylova, M.; Hradsky, J.; Kreutz, M. R. Between promiscuity and specificity: novel roles of EF-hand calcium sensors in neuronal Ca2+ signalling. J. Neurochem. 2011, 118, 695−713. (18) Khasdan, V.; Levin, I.; Rosner, A.; Morin, S.; Kontsedalov, S.; Maslenin, L.; Horowitz, A. R. DNA markers for identifying biotypes B and Q of Bemisia tabaci (Hemiptera: Aleyrodidae) and studying population dynamics. Bull. Entomol. Res. 2005, 95, 605−613. (19) Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731−2739. (20) Thompson, J. D.; Higgins, D. G.; Gibson, T. J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673−4680.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.9b04028.

■

Article

BtCaBP1 and BtCaBP2 expression in B. tabaci after treatment with LC50 doses of cyantraniliprole and imidacloprid for different time periods (Figure S1); data are the mean ± SD for three independent replicates; bars with different lowercase letters are significantly different according to one-way ANOVA, followed by Tukey’s multiple comparison test (P < 0.05) (PDF)

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (L.G.). *E-mail: [email protected] (D.C.). ORCID

Lei Guo: 0000-0003-3042-1423 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by grants from the National Natural Science Foundation of China (31601659), the Natural Science Foundation of Shandong Province (ZR2016CQ08), the National Science & Technology Fundamental Resources Investigation Program of China (2018FY10100), and the Taishan Scholar Foundation of Shandong Province (tsqn20161040). 11042

DOI: 10.1021/acs.jafc.9b04028 J. Agric. Food Chem. 2019, 67, 11035−11043

Article

Journal of Agricultural and Food Chemistry (21) Lohr, C. Monitoring neuronal calcium signalling using a new method for ratiometric confocal calcium imaging. Cell Calcium 2003, 34, 295−303. (22) Lohr, C.; Heil, J. E.; Deitmer, J. W. Blockage of voltage-gated calcium signaling impairs migration of glial cells in vivo. Glia 2005, 50, 198−211. (23) Stockert, J. C.; Blázquez-Castro, A.; Cañete, M.; Horobin, R. W.; Villanueva, A. MTT assay for cell viability: intracellular localization of the formazan product is in lipid droplets. Acta Histochem. 2012, 114, 785−796. (24) van Meerloo, J.; Kaspers, G. J.; Cloos, J. Cell sensitivity assays: the MTT assay. Methods Mol. Biol. 2011, 731, 237−245. (25) Li, J.; Li, X.; Bai, R.; Shi, Y.; Yan, F.; et al. RNA interference of P450 CYP6CM1 gene has different efficacy in B and Q biotypes of Bemisia tabaci. Pest Manag. Sci. 2015, 71, 1175−1181. (26) Yang, X.; He, C.; Xie, W.; Liu, Y.; Xia, J.; Yang, Z.; Guo, L.; Wen, Y.; Wang, S.; Wu, Q.; Yang, F.; Zhou, X.; Zhang, Y. Glutathione S-transferases are involved in thiamethoxam resistance in the field whitefly Bemisia tabaci Q (Hemiptera: Aleyrodidae). Pestic. Biochem. Phys. 2016, 134, 73−78. (27) Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, No. e45. (28) Liang, P.; Tian, Y. A.; Biondi, A.; Desneux, N.; Gao, X. W. Short-term and transgenerational effects of the neonicotinoid nitenpyram on susceptibility to insecticides in two whitefly species. Ecotoxicology 2012, 21, 1889−1898. (29) Marsden, B. J.; Shaw, G. S.; Sykes, B. D. Calcium binding proteins. Elucidating the contributions to calcium affinity from an analysis of species variants and peptide fragments. Biochem. Cell Biol. 1990, 68, 587−601. (30) Cordova, D.; Benner, E. A.; Sacher, M. D.; Rauh, J. J.; Sopa, J. S.; Lahm, G. P.; Selby, T. P.; Stevenson, T. M.; Flexner, L.; Gutteridge, S.; Rhoades, D. F.; Wu, L.; Smith, R. M.; Tao, Y. Anthranilic diamides: a new class of insecticides with a novel mode of action, ryanodine receptor activation. Pestic. Biochem. Phys. 2006, 84, 196−214. (31) Selby, T. P.; Lahm, G. P.; Stevenson, T. M.; Hughes, K. A.; Cordova, D.; Annan, I. B.; Barry, J. D.; Benner, E. A.; Currie, M. J.; Pahutski, T. F. Discovery of cyantraniliprole, a potent and selective anthranilic diamide ryanodine receptor activator with cross-spectrum insecticidal activity. Bioorg. Med. Chem. Lett. 2013, 23, 6341−6345. (32) Troczka, B. J.; Williams, A. J.; Williamson, M. S.; Field, L. M.; Lüemmen, P.; Davies, T. G. E. Stable expression and functional characterisation of the diamondback moth ryanodine receptor G4946E variant conferring resistance to diamide insecticides. Sci. Rep. 2015, 5, No. 14680. (33) Yun, X.; Huang, Q.; Rao, W.; Xiao, C.; Zhang, T.; Mao, Z.; Wan, Z. A comparative assessment of cytotoxicity of commonly used agricultural insecticides to human and insect cells. Ecotoxicol. Environ. Saf. 2017, 137, 179−185. (34) Troczka, B.; Zimmer, C. T.; Elias, J.; Schorn, C.; Bass, C.; Davies, T. G. E.; Field, L. M.; Williamson, M. S.; Slater, R.; Nauen, R. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochem. Mol. Biol. 2012, 42, 873−880. (35) Guo, L.; Liang, P.; Zhou, X.; Gao, X. Novel mutations and mutation combinations of ryanodine receptor in a chlorantraniliprole resistant population of Plutella xylostella (L.). Sci. Rep. 2015, 4, No. 6924. (36) Guo, L.; Wang, Y.; Zhou, X.; Li, Z.; Liu, S.; Liang, P.; Gao, X. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Manage. Sci. 2014, 70, 1083−1089. (37) Li, X.; Zhu, B.; Gao, X.; Liang, P. Over-expression of UDPglycosyltransferase gene UGT2B17 is involved in chlorantraniliprole resistance in Plutella xylostella (L.). Pest Manage. Sci. 2017, 73, 1402− 1409.

(38) Li, X.; Li, R.; Zhu, B.; Gao, X.; Liang, P. Overexpression of cytochrome P450 CYP6BG1 may contribute to chlorantraniliprole resistance in Plutella xylostella (L.). Pest Manage. Sci. 2018, 74, 1386− 1393. (39) Gifford, J. L.; Walsh, M. P.; Vogel, H. J. Structure and metalion-binding properties of the Ca2+-binding helix-loop-helix EF-hand motifs. Biochem. J. 2007, 405, 199−221. (40) Ikura, M.; Ames, J. B. Genetic polymorphism and protein conformational plasticity in the calmodulin superfamily: two ways to promote multifunctionality. Proc. Natl. Acad. Sci. U.S.A. 2006, 103, 1159−1164. (41) Alseikhan, B. A.; DeMaria, C. D.; Colecraft, H. M.; Yue, D. T. Engineered calmodulins reveal the unexpected eminence of Ca2+ channel inactivation in controlling heart excitation. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 17185−17190. (42) Wingard, J. N.; Chan, J.; Bosanac, I.; Haeseleer, F.; Palczewski, K.; Ikura, M.; Ames, J. B. Structural analysis of Mg2+ and Ca2+ binding to CaBP1, a neuron-specific regulator of calcium channels. J. Biol. Chem. 2005, 280, 37461−37470. (43) Ben Johny, M.; Yang, P. S.; Bazzazi, H. X.; Yue, D. T. Dynamic switching of calmodulin interactions underlies Ca2+ regulation of CaV1.3 channels. Nat. Commun. 2013, 4, No. 1717. (44) Augustine, G. J.; Santamaria, F.; Tanaka, K. Local calcium signaling in neurons. Neuron 2003, 40, 331−346. (45) Niggli, E.; Shirokova, N. A guide to sparkology: The taxonomy of elementary cellular Ca2+ signaling events. Cell Calcium 2007, 42, 379−387.

11043

DOI: 10.1021/acs.jafc.9b04028 J. Agric. Food Chem. 2019, 67, 11035−11043