- Email: [email protected]
Susceptibility of mosquito and lepidopteran cell lines to the mosquito iridescent virus (IIV-3) from Aedes taeniorhynchus
Journal of Invertebrate Pathology 108 (2011) 40–45
Contents lists available at ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip
Susceptibility of mosquito and lepidopteran cell lines to the mosquito iridescent virus (IIV-3) from Aedes taeniorhynchus James J. Becnel a,⇑, Julia W. Pridgeon b a b
US Department of Agriculture, Agriculture Research Service, Center for Medical, Agricultural and Veterinary Entomology, Gainesville, FL 32608, USA US Department of Agriculture, Agriculture Research Service, Aquatic Animal Health Research Unit, Auburn, AL 36832, USA
a r t i c l e
i n f o
Article history: Received 22 February 2011 Accepted 20 June 2011 Available online 29 June 2011 Keywords: Aedes taeniorhynchus Chloriridovirus Mosquito iridescent virus Mosquito Tissue culture Ultrastructure
a b s t r a c t Mosquito iridescent viruses (MIV) are members of the genus Chloriridovirus that currently contains only the type IIV-3 from Aedes taeniorhynchus. The complete genome of invertebrate iridescent virus -3 (IIV-3) has been sequenced and the availability of a tissue culture system would facilitate functional genomic studies. This investigation, using quantitative PCR and electron microscopy, has determined that the mosquito cell lines Aedes aegypti (Aag2), Aedes albopictus (C6/36) and Anopheles gambiae (4a3A) as well as the lepidopteran cell line from Spodoptera frugiperda (SF9) are permissive to IIV-3 infection. However, IIV-3 infection remained longer in Aag2 and C6/36 cells. Virus produced in C6/36 cell line was infectious to larvae of A. taeniorhynchus by injection and per os. Ultrastructural examination of 4a3A and SF9 cells infected with IIV-3 revealed an unusual feature, where virions were localized to mitochondria. It is speculated that containment with mitochondria may play a role in the lack of persistence in these cell lines. Published by Elsevier Inc.
1. Introduction Invertebrate iridescent virus type 3 (IIV-3) isolated from the mosquito Aedes taeniorhynchus, is the type species of the monotypic genus Chloriridovirus, one of five genera within the Iridoviridae. All other invertebrate iridescent viruses (IIVs) are assigned to the genus Iridovirus whose type species is Invertebrate iridescent virus 6 (IIV-6) from the dipteran host Tipula paludosa (Williams, 2008). Williams and Corey (1994) and Williams (1994) were the first to recognize that IIV-3 was distinctive from all other IIV’s and analysis of the complete genome of IIV-3 has confirmed this status (Delhon et al., 2006). The genome is composed of a single molecule of linear double-stranded DNA of about 190 kbp in size and comparison with IIV sequences indicate that diversity within IIV may be greater than originally recognized (Delhon et al., 2006). The ability of IIV-3 to infect mosquito cell lines was first demonstrated in a series of studies from 1974–1976. Two cell lines derived from Aedes aegypti were found to be susceptible to IIV-3 based on cytopathogenic effects (CPE) first observed at 2.5 days post-exposure (PE) in cells grown at 31 °C and 35 °C but not 21 °C or 25 °C (Webb et al., 1974). Infections in both cell lines were confirmed by electron microscopy. Additional cell lines were evaluated for IIV-3 susceptibility, and it was found that 31 °C was the most sensitive and reliable condition permissive to IIV-3 in Peleg’s ⇑ Corresponding author. Fax: +1 352 374 5966. E-mail address: [email protected] (J.J. Becnel). 0022-2011/$ - see front matter Published by Elsevier Inc. doi:10.1016/j.jip.2011.06.008
A. aegypti cell line (Webb et al., 1975). However, virus propagated in cell culture was not infectious for A. taeniorhynchus larvae or to cell lines, possibly due to the observation that virions acquire an additional outer envelope when released from cells. The examined pathology of IIV-3 in cell culture has demonstrated attachment, viropexis, maturation and release of virions into the media (Webb et al., 1976), which was the last study on IIV-3 in cell culture. Now that the complete genome of IIV-3 has been sequenced (Delhon et al., 2006), there is a need for a reliable tissue culture system to conduct functional genomic studies on IIV-3. In this study, we investigated the susceptibility of three mosquito cell lines and one lepidopteran cell line to IIV-3 at 27 °C and 31 °C using quantitative PCR to measure replication of the late capsid gene as an indicator of virus replication. In addition, we examined the ultrastructural characteristics of the infections in permissive cells and conducted transmission studies with IIV-3 produced in C6/ 36 cells to A. taeniorhynchus larvae.
2. Materials and methods 2.1. Mosquitoes A. taeniorhynchus (Orlando, Florida strain, maintained since 1952) were reared in the insectary of the Mosquito and Fly Research Unit at the Center for Medical, Agricultural, and Veterinary Entomology, USDA-ARS, Gainesville, FL. Standard rearing protocols described by Gerberg et al. (1994) were used.
41
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
2.2. IIV-3 culture The isolate of the mosquito iridescent virus (MIV) used in this study was originally isolated from A. taeniorhynchus in Louisiana (Chapman et al., 1966) and has been maintained in the laboratory by passage in A. taeniorhynchus larvae. A stock of IIV-3 was produced by exposing groups (n = 150) of 24 h old larvae in 10 ml of 0.5% NaCl in deionized (DI) water in 50-mm petri dishes. Each group was exposed to virions, as purified below, from 5 infected 4th-instar larvae plus a small amount of powdered alfalfa pellets for 24 h. Larvae were transferred to 18 28-cm enamel pans containing 500 ml of the saline solution and fed 3-ml of a 20% (wt./ vol.) alfalfa suspension. Additional food was added every other day until larvae reached 4th-instar and infected larvae could be identified. Infection levels averaged about 5% which is in line with previous reports (Undeen and Fukuda, 1994). Infected larvae were either used immediately while still alive or frozen in sterile water and stored at 80 °C. 2.3. Cell lines Three mosquito cell lines and one lepidopteran cell line were used to determine susceptibility to IIV-3 challenge. The three mosquito cell lines were A. aegypti (Aag2) obtained from Dr. Que Lan (University of Wisconsin Department of Entomology), Aedes albopictus (C6/36) obtained from Dr. Lei Zhou (University of Florida School of Medicine), Anopheles gambiae (4a3A) obtained from Dr. Liangbiao Zheng (Yale University School of Medicine), and a lepidopteran cell line SF9 from Spodoptera frugiperda (Lepidoptera: Noctuidae) purchased from Invitrogen (San Diego, CA). All mosquito cells were maintained in Schneider’s insect media (Sigma Aldrich, St. Louis, MO) supplemented with 10% fetal bovine serum (FBS) (Invitrogen, San Diego, CA). SF9 cells were maintained in GIBCO Grace’s insect media (Invitrogen, San Diego, CA) supplemented with 10% FBS. 2.4. Susceptibility of mosquito cell lines to IIV-3 infection Infection experiments with IIV-3 were conducted in 60 mm cell culture dishes for each of the cell lines. Cells were incubated at 26 ± 0.5 °C until they reached 90% confluency (approximately 24 h). Spent medium was removed and replaced with 1.5 ml of fresh Schneider’s medium containing 10% FBS. Virions were obtained by homogenizing 100 IIV-3 infected A. taeniorhynchus larvae in 10 ml of sterile DI water and large particulate material removed by low speed centrifugation. The supernatant was filtered through a 0.45 micron filter and 100 ll was added to each culture and returned to the incubator, one group at 27 °C and the other at 31 °C. Cell samples were removed at 0, 8, 24 and 48 h post IIV-3 exposure. An additional exposure was made with C6/36 cells at 27 °C for 7 days and cell samples were collected each day (every 24 h). All experiments were run in duplicate. Control cultures were
held under identical conditions without addition of IIV-3. All cell samples were collected by centrifugation (3000 rpm for 10 min). Cell pellets were resuspended in PBS and collected by centrifugation. The resuspension and centrifugation were repeated three times and the cell pellets were flash frozen in liquid nitrogen and then stored at 80 °C until RNA extraction. 2.5. RNA extraction, cDNA synthesis, and quantitative PCR Total RNA instead of genomic DNA was used as a measure of active infection for IIV-3 in insect cell lines. Total RNA was isolated from cells infected with or without IIV-3 using Trizol Reagent (Invitrogen, Carlsbad, CA). All RNAs were quantified on a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Rockland, DE). Total RNA was DNase treated with DNA-free (Ambion, Austin, TX) and 2 lg of total RNA was used for cDNA synthesis. The first strand cDNA used for quantitative PCR (qPCR) was synthesized using AMV reverse transcriptase (Invitrogen, Carlsbad, CA). Briefly, a 2-lg aliquot of total RNA was reverse transcribed in 20-ll reaction volume using Clone AMV first strand cDNA Synthesis kit (Invitrogen, Carlsbad, CA). The reaction was terminated by heat inactivation at 95 °C for 5 min. The cDNA was then diluted with 80 ll water and 1 ll of diluted cDNA was used in qPCR. The major capsid protein transcriptional level was selected as an indicator of IIV-3 replication, and b-actin was used as an internal control to normalize the variation in the amount of cDNA template used in the quantitative PCR. Primers used in qPCR were listed in Table 1. To determine the specificities of the primers, PCR was performed using cDNAs from IIV-3 infected cell cultures as the template and PCR products were subjected to sequencing at the University of Florida Sequencing Facility. Sequences were analyzed using the National Center for Biotechnology Information (NCBI) BLAST program to search for sequence homologies. All primers were confirmed to be specific through sequence analysis. PCR efficiency was calculated from ten-fold serial dilutions of cDNA for each primer pair in triplicate. All qPCR was performed on an Applied Biosystems 7500 Real-Time PCR System (ABI, Foster City, CA) using PlatinumÒ SYBRÒ Green qPCR SuperMix-UDG with ROX (Invitrogen, Carlsbad, CA) in a total volume of 12.5 ll. The qPCR mixture consisted of 1 ll of cDNA, 0.5 ll of 5 lM gene-specific forward primer, 0.5 ll of 5 lM gene-specific reverese primer and 10.5 ll of 1 SYBR Green SuperMix. The qPCR thermal cycling parameters were 50 °C for 2 min, 95 °C for 10 min followed by 40 cycle of 95 °C for 15 s and 60 °C for 1 min. All qPCR was run in duplicate for each cDNA sample and three samples at each time point were used for qPCR. 2.6. Data analysis The relative transcriptional level of the IIV-3 MCP gene was determined by subtracting the cycle threshold (Ct) of the sample by that of the actin, the calibrator or internal control, as per the
Table 1 Primers used in quantitative PCR analysis of IIV3 major capsid protein (MCP) gene expression in four insect cell lines. Gene name (accession no.)
Primer name
Primer sequence (50 –30 )
Annealing temp. (°C)
Product size (base pairs)
IIV3 MCP (AF025775) A. aegypti actin (AAU20287) A. albopictus actin (DQ657949) A. gambiae actin (U02964) S. frugiperda actin (AF548015)
MCP-F MCP-R Aae-actin-F Aae-actin-R Aal-actin-F Aal-actin-R Aga-actin-F Aga-actin-R Sfr-actin-F Sfr-actin-R
CGGCTGCATTACCCTACAAT CACAACCCATCCTTCTTCGT TTCGACGCTCAGTTGTTGAC TTGGGGTACTTCAGGGTGAG AGAGCACCCAGTTCTCCTGA CAGGGCATAACCCTCGTAGA AGCCTGGGGTAAAAGGAGAA GTACATGAGGGCACAACACG CCAAGGCCAACAGAGAGAAG GGCGTAGCCCTCGTAGATG
59.98 59.97 60.03 59.96 59.99 60.09 60.07 60.03 59.98 60.77
219 199 217 211 176
42
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
formula: DCt = Ct (sample) Ct (calibrator). Relative increased expression level (fold) of MCP at a specific time point X compared to that at time 0 was then calculated by the formula 2DDCt, where DDCt = DCt (X) DCt (0) as described previously (Pridgeon et al., 2008). 2.7. Electron microscopy
27 °C for 7 days to understand the daily expression level of the MCP gene in C6/36 cells compared to the expression level in C6/ 36 on the first day. Quantitative PCR results (Fig. 1) indicated a continuous increase in MCP gene expression throughout this period. 3.2. Electron microscopy
Previously described protocols (Becnel, 1997) were used with the following modifications. Exposed and control cell lines (48 h post-exposure) were harvested, rinsed three times and re-suspended in 2.5% glutaraldehyde for 2 h at room temperature. Cells were rinsed three times in PBS and embedded in 1% agar and cut into small blocks for each group. Standard procedures were followed thereafter and sections examined with a Hitach H-600 EM at 75 kv.
IIV-3 virions were observed in cells of each of the three mosquito cell lines as well as the lepidopteran cell line but not in the control groups. At 48 h post-exposure in the C6/36 and Aag2 cells, virus was observed to replicate within viroplasm that were surrounded by mitochondria (Fig. 2). IIV-3 virions were icosahedral in shape and dispersed throughout the cytoplasm (Fig. 3A). Virions
2.8. Transmission of IIV-3 derived from cell culture to Aedes taeniorhynchus IIV-3 produced in C6/36 cells (A. albopictus) was used to expose larvae of A. teniorhynchus. Cells were harvested 7 days post exposure, rinsed three times with PBS and lysed in cell lysis buffer (50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 1% Igepal CA-630). Cell lysate from one culture flask containing virus was used to feed 150 larvae. A control mosquito group was fed cell lysate from culture flask that was not exposed to virus. In addition, five 72 h old larvae were microinjected (using a modified procedure as described by Handler, 2000) with a drawn capillary tube (0.1 ll/larva) via the anal papillae with virus from the same culture used for the per os transmission experiment. Patent infections were determined in 4th-instar larvae for each group. 3. Results 3.1. Susceptibility of mosquito cell lines to IIV-3 infection Primer efficiency experiments revealed that all primers used had similar qPCR efficiencies, ranging from 95% to 100%. Using IIV-3 major capsid protein gene-specific primers as an indicator for virus replication, qPCR results revealed that all four cell lines were susceptible to IIV-3 infection at both 27 °C and 31 °C (Table 2). The relative expression level of the MCP gene in A. albopictus (C6/36) and A. aegypti (Aag2) cells showed an increasing trend during the 48 h post-exposure, with a 75-fold increase at 48 h post exposure in A. albopictus (C6/36) cells (Table 2). However, MCP gene expression decreased 48 h post-exposure after an initial increase at 8 h and 24 h post-exposure in S. frugiperda (SF9) cells and A. gambiae (4a3A) cells, respectively (Table 2). Based on these results, C6/36 cells were re-inoculated with IIV-3 and incubated at
Fig. 1. Relative expression level of IIV-3 major capsid protein in Aedes albopictus (C6/36) cell line at different days post exposure to IIV-3. The relative transcriptional level of IIV-3 MCP was determined by subtracting the cycle threshold (Ct) of the sample by that of the actin, the calibrator or internal control, as per the formula: DCt = Ct (sample) Ct (calibrator). Relative increased expression level (fold) of MCP at a specific time point X compared to that at day 1 was then calculated by the formula 2DDCt, where DDCt = DCt (Day X) DCt (Day 1). Data are presented as mean ± S.D. from two replicates.
Table 2 Relative expression level of IIV-3 major capsid protein in four insect cell lines at different time point after exposure to IIV-3. Temp
Time
Relative MCP expression level compared to time 0 (fold ± S.D.)
(°C)
(h)
Aag2
C6/36
4a3A
SF9
27 27 27 27
0 8 24 48
– 23 ± 1.1 46 ± 0.9 55 ± 1.6
– 1 ± 0.1 26 ± 1.6 75 ± 2.9
– 33 ± 4.8 65 ± 0.6 24 ± 0.2
– 84 ± 2.1 51 ± 6.6 30 ± 3.2
31 31 31 31
0 8 24 48
– 25 ± 0.6 35 ± 1.9 42 ± 0.4
– 1 ± 0.1 16 ± 0.1 36 ± 1.1
– 2 ± 0.1 4 ± 0.1 1 ± 0.1
– 46 ± 2.3 44 ± 2.2 31 ± 0.6
Fig. 2. Foci of infection (viroplasm) in an Aedes albopictus C6/36 cell infected with IIV-3. Viroplasm is surrounded by an accumulation of mitochondria.
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
43
Fig. 3. Aedes albopictus (C6/36) cells infected with IIV-3. (A) Infected cell demonstrating virions in the cytoplasm and accumulating at the plasma membrane. (B) Virion initiating budding. C. Virions released from an infected cell.
that accumulated along the plasma membrane were commonly released from cells by budding (Fig. 3B and C). In contrast, there was less accumulation of virions in the 4a3A and SF9 cells and many of the virions were localized to mitochondria (Figs. 4 and 5). Some virions formed within the cisternae of mitochondria of 4a3A cells appeared to have the normal icosahedral form characteristic for IIV-3 (Fig. 4B) while those formed in mitochondria of SF9 cells were less uniform and distorted in appearance (Fig. 5B). Virions were not observed to accumulate within the cytoplasm and were not released from cells of 4a3A or SF9. 3.3. Transmission of IIV-3 derived from cell culture to Aedes taeniorhynchus IIV-3 grown in C6/36 cells was infectious per os to A. taeniorhychus larvae with an infection rate of 5% by feeding. The resulting infected larvae exhibited the characteristic fat body infection and iridescence observed in IIV-3. When C6/36 cell culture supernatant
from IIV-3 cultures was injected into larvae of A. taeniorhynchus, 4/ 5 larvae became patently infected. 4. Discussion Replication of IIV-3 in A. aegypti (Aag2), A. albopictus (C6/36), An. gambiae (4a3A) and S. frugiperda (SF9) cell lines was detected by qPCR analysis using MCP gene-specific primers as an indicator of viral replication. The replication of IIV-3 in the four insect cell lines was verified by electron microscopy. Both qPCR and electron microscopy indicated that C6/36 and Aag2 were both highly permissive to IIV-3 replication with 27 °C the better temperature. However, IIV-3 infections in A. gambiae (4a3A) and S. frugiperda (SF9) cell lines were weak and short lived in that virus did not appear to be able to escape infected cells and spread to uninfected cells. Webb et al. (1975) tested three A. aegypti cell lines (Singh’s, Peleg’s, Mos-20A), one A. albopictus cell line and one lepidopteran cell line from Antheracea eucalypti (Lepidoptera: Saturniidae) for
44
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
Fig. 4. Anopheles gambiae (4a3A) cell infected with IIV-3. (A) Lightly infected cell. (B) Localization of normally appearing IIV-3 virions to several mitochondria.
Fig. 5. Spodoptera frugiperda (SF9) cell infected with IIV-3. (A) Cell infected with numerous IIV-3 particles localized to mitochondria. (B) Mitochondria with IIV-3 particles that appear distorted in shape and form.
susceptibility to IIV-3. Singh’s and Pelag’s cell lines exhibited CPE at 31 °C and 35 °C but not at 21 °C or 25 °C. The other cell lines failed to exhibit CPE at any of the temperatures tested. Infection and pathology of IIV-3 in Singh’s and Pelag’s cell lines was verified and defined in a subsequent study using electron microscopy (Webb et al., 1976). Our findings have confirmed the previous studies by Webb et al. (1974, 1975) that A. aegypti cell lines are susceptible to infection by IIV-3 at temperatures > 25 °C. In addition we observed that the A. albopictus (C6/36), A. gambiae (4a3A) and S. frugiperda (SF9) cell lines support replication of IIV-3. Webb et al. (1975) clearly stated that failure of A. albopictus, Mos-20A and A. eucalypi cell lines to exhibit CPE did not rule out their capacity to support IIV-3 replication. qPCR is a very accurate and sensitive method to detect gene expression level, which enabled us to detect virus replication that could not be determined by CPE. There is no indication that cell lines other than Singh’s and Pelag’s were examined ultrastructurally for IIV-3 infection which may have permitted IIV-3 replication at low levels in the studies performed by Webb et al. (1976). Observation on the pathology of IIV-3 in C6/36 and Aag2 cells lines was consistent with earlier observations (Webb et al., 1976). IIV-3 did not accumulate and form paracrystalline arrays
in the cytoplasm as occurs in the fat body of A. taenirhynchus larvae (Becnel and White, 2007). Rather, virions migrated to the plasma membrane and were released via budding from the cells (Fig. 3). Virions released from the cells acquired an envelope from the plasma membrane, but it was unclear whether this newly acquired membrane was persistent. Webb et al. (1975) suggested that this membrane may have played a role in the inability of cell culture derived IIV-3 to infect A. taeniorhynchus larvae or be used to infect cell lines. Evidence presented here demonstrated that IIV-3 derived from C6/36 cells was infectious to A. taeniorhynchus larvae per os and by injection. This discrepancy between this study and the previous study might be due to different detergents used to lyse cells. However, infection levels with IIV-3 are generally low, even when using host derived virions. The ability to infect mosquitoes with cell derived IIV-3 particles is critical for functional studies that require the ability to re-infect the natural host. IIV-3 replication and virion assembly was lower in 4a3A and SF9 than that in C6/36 and Aag2 cell lines based on EM observations. Furthermore, virions formed in 4a3A and SF9 cells did not accumulate in the cytoplasm or migrate to the plasma membrane nor were they observed being released from cells via budding as observed in C6/36 and Aag2 cells. Rather, IIV-3 virions were
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
observed to localize within mitochondria (Figs. 4 and 5). IIV-3 is similar to other members of the Iridoviridae in that virus genome replication occurs in the nucleus with assembly occurring in the cytoplasm (Becnel, 2002; Williams, 2008). Mitochondria have been reported to accumulate around the viroplasm of iridoviruses which was reportedly not as a result of increased biogenesis but due to mass migration (Novoa et al., 2005). Changes in the ultrastructure of these mitochondria have also been noted and characterized by a condensed ultrastructure and a marked condensation of cristae (Novoa et al., 2005). Viroplasm with an accumulation of mitochondria was observed in C6/36 cells in this study (Fig. 2). The type of localization of virions within mitochondria has not been reported for iridoviruses. To our knowledge, this is the first report of virions of iridovirus localized within mitochondria. In fact, the specific localization of virions within mitochondria has not been reported for any other virus group (Novoa et al., 2005). Assembly of virions within the cisternae of mitochondria may have prevented migration of virions to the cell plasma membrane. However, the mechanisms that promote virion targeting and assembly within the mitochondria are unknown but of potential interest. In summary, IIV-3 can be produced readily in C6/36 and Aag2 cells and the resulting virions are infectious to A. taeniorhynchus larvae by both injection and per os. The availability of a vigorous cell culture system is crucial for conducting functional genomic studies on IIV-3. This study has also demonstrated that qPCR is one method that can be used to determine virus replication in permissive cell lines. Acknowledgments We thank Dr. Steve Valles (Agricultural Research Service, Gainesville, FL) and Dr. James Maruniak (University of Florida, Gainesville, FL) for critical reviews of the manuscript. We also thank William Reid and Neil Sanscrainte (USDA-ARS) for technical support. The use of trade, firm, or corporate names in this publication is for the information and convenience of the reader. Such use
45
does not constitute an official endorsement or approval by the United States Department of Agriculture or the Agricultural Research Service of any product or service to the exclusion of others that may be suitable. References Becnel, J.J., 1997. Complementary techniques: preparations of entomopathogens and diseased specimens for more detailed study using microscopy. In: Lacey, L.A. (Ed.), Manual of Techniques in Insect Pathology. Academic Press, pp. 337– 353. Becnel, J.J., 2002. Chloriridovirus; iridoviridae. In: Tidona, C.A., Darai, G. (Eds.), The Springer Index of Viruses. Springer-Verlag, Heidelberg, Germany, pp. 472–474. Becnel, J.J., White, S.E., 2007. Mosquito pathogenic viruses – the last 20 years. Bull Am. Mosq. Control Assoc. 7, 36–49. Delhon, G., Lu, Z., Afonso, C.L., Tulman, E.R., Becnel, J.J., Moser, B.A., Kutish, G.F., Rock, D.L., 2006. Genome of Invertebrate iridescent virus type 3 (mosquito iridescent virus). J. Virol. 80, 8439–8449. Gerberg, E.J., Barnard, D.R., Ward, R.A., 1994. Manual for mosquito rearing and experimental techniques. Am. Mosq. Control Assoc. Bull. No. 5. Handler, A.M., 2000. An introduction to the history and methodology of insect gene transfer. In: Handler, A.M., James, A.A. (Eds.), Insect Transgenesis: Methods and Applications. CRC Press, Boca Raton, FL, pp. 3–26. Novoa, R.R., Calderita, G., Arranz, R., Fontana, J., Granzow, H., Risco, C., 2005. Virus factories: association of cell organelles for viral replication and morphogenesis. Biol. Cell 97, 147–172. Pridgeon, J.W., Becnel, J.J., Clark, G.G., Linthicum, K.J., 2008. Developmental and environmental regulation of AaeIAP1 transcript in Aedes aegypti. J. Med. Entomol. 45, 1071–1079. Webb, S.R., Paschke, J.D., Wagner, G.W., Campbell, W.R., 1974. Infection of Aedes aegypti cells with mosquito iridescent virus. J. Invertebr. Pathol. 23, 255–258. Webb, S.R., Paschke, J.D., Wagner, G.W., Campbell, W.R., 1975. Bioassay of mosquito iridescent virus of Aedes taeniorhynchus in cell cultures of Aedes aegypti. J. Invertebr. Pathol. 26, 205–212. Webb, S.R., Paschke, J.D., Wagner, G.W., Campbell, W.R., 1976. Pathology of mosquito iridescent virus of Aedes taeniorhynchus in cell cultures of Aedes aegypti. J. Invertebr. Pathol. 27, 27–40. Williams, T., 2008. Iridoviruses of Invertebrates. In: Mahy, B.W.J., Van Regenmotel, M.H.V. (Eds.), Encyclopedia of Virology, third ed. Elsevier, Oxford, UK, pp. 161– 167. Williams, T., Corey, J.S., 1994. Proposal for a new classification of iridescent viruses. J. Gen. Virol. 75, 1291–1301. Williams, T., 1994. Comparative studies of iridoviruses: further support for a new classification. Virus Res. 33, 99–121.
Contents lists available at ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip
Susceptibility of mosquito and lepidopteran cell lines to the mosquito iridescent virus (IIV-3) from Aedes taeniorhynchus James J. Becnel a,⇑, Julia W. Pridgeon b a b
US Department of Agriculture, Agriculture Research Service, Center for Medical, Agricultural and Veterinary Entomology, Gainesville, FL 32608, USA US Department of Agriculture, Agriculture Research Service, Aquatic Animal Health Research Unit, Auburn, AL 36832, USA
a r t i c l e
i n f o
Article history: Received 22 February 2011 Accepted 20 June 2011 Available online 29 June 2011 Keywords: Aedes taeniorhynchus Chloriridovirus Mosquito iridescent virus Mosquito Tissue culture Ultrastructure
a b s t r a c t Mosquito iridescent viruses (MIV) are members of the genus Chloriridovirus that currently contains only the type IIV-3 from Aedes taeniorhynchus. The complete genome of invertebrate iridescent virus -3 (IIV-3) has been sequenced and the availability of a tissue culture system would facilitate functional genomic studies. This investigation, using quantitative PCR and electron microscopy, has determined that the mosquito cell lines Aedes aegypti (Aag2), Aedes albopictus (C6/36) and Anopheles gambiae (4a3A) as well as the lepidopteran cell line from Spodoptera frugiperda (SF9) are permissive to IIV-3 infection. However, IIV-3 infection remained longer in Aag2 and C6/36 cells. Virus produced in C6/36 cell line was infectious to larvae of A. taeniorhynchus by injection and per os. Ultrastructural examination of 4a3A and SF9 cells infected with IIV-3 revealed an unusual feature, where virions were localized to mitochondria. It is speculated that containment with mitochondria may play a role in the lack of persistence in these cell lines. Published by Elsevier Inc.
1. Introduction Invertebrate iridescent virus type 3 (IIV-3) isolated from the mosquito Aedes taeniorhynchus, is the type species of the monotypic genus Chloriridovirus, one of five genera within the Iridoviridae. All other invertebrate iridescent viruses (IIVs) are assigned to the genus Iridovirus whose type species is Invertebrate iridescent virus 6 (IIV-6) from the dipteran host Tipula paludosa (Williams, 2008). Williams and Corey (1994) and Williams (1994) were the first to recognize that IIV-3 was distinctive from all other IIV’s and analysis of the complete genome of IIV-3 has confirmed this status (Delhon et al., 2006). The genome is composed of a single molecule of linear double-stranded DNA of about 190 kbp in size and comparison with IIV sequences indicate that diversity within IIV may be greater than originally recognized (Delhon et al., 2006). The ability of IIV-3 to infect mosquito cell lines was first demonstrated in a series of studies from 1974–1976. Two cell lines derived from Aedes aegypti were found to be susceptible to IIV-3 based on cytopathogenic effects (CPE) first observed at 2.5 days post-exposure (PE) in cells grown at 31 °C and 35 °C but not 21 °C or 25 °C (Webb et al., 1974). Infections in both cell lines were confirmed by electron microscopy. Additional cell lines were evaluated for IIV-3 susceptibility, and it was found that 31 °C was the most sensitive and reliable condition permissive to IIV-3 in Peleg’s ⇑ Corresponding author. Fax: +1 352 374 5966. E-mail address: [email protected] (J.J. Becnel). 0022-2011/$ - see front matter Published by Elsevier Inc. doi:10.1016/j.jip.2011.06.008
A. aegypti cell line (Webb et al., 1975). However, virus propagated in cell culture was not infectious for A. taeniorhynchus larvae or to cell lines, possibly due to the observation that virions acquire an additional outer envelope when released from cells. The examined pathology of IIV-3 in cell culture has demonstrated attachment, viropexis, maturation and release of virions into the media (Webb et al., 1976), which was the last study on IIV-3 in cell culture. Now that the complete genome of IIV-3 has been sequenced (Delhon et al., 2006), there is a need for a reliable tissue culture system to conduct functional genomic studies on IIV-3. In this study, we investigated the susceptibility of three mosquito cell lines and one lepidopteran cell line to IIV-3 at 27 °C and 31 °C using quantitative PCR to measure replication of the late capsid gene as an indicator of virus replication. In addition, we examined the ultrastructural characteristics of the infections in permissive cells and conducted transmission studies with IIV-3 produced in C6/ 36 cells to A. taeniorhynchus larvae.
2. Materials and methods 2.1. Mosquitoes A. taeniorhynchus (Orlando, Florida strain, maintained since 1952) were reared in the insectary of the Mosquito and Fly Research Unit at the Center for Medical, Agricultural, and Veterinary Entomology, USDA-ARS, Gainesville, FL. Standard rearing protocols described by Gerberg et al. (1994) were used.
41
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
2.2. IIV-3 culture The isolate of the mosquito iridescent virus (MIV) used in this study was originally isolated from A. taeniorhynchus in Louisiana (Chapman et al., 1966) and has been maintained in the laboratory by passage in A. taeniorhynchus larvae. A stock of IIV-3 was produced by exposing groups (n = 150) of 24 h old larvae in 10 ml of 0.5% NaCl in deionized (DI) water in 50-mm petri dishes. Each group was exposed to virions, as purified below, from 5 infected 4th-instar larvae plus a small amount of powdered alfalfa pellets for 24 h. Larvae were transferred to 18 28-cm enamel pans containing 500 ml of the saline solution and fed 3-ml of a 20% (wt./ vol.) alfalfa suspension. Additional food was added every other day until larvae reached 4th-instar and infected larvae could be identified. Infection levels averaged about 5% which is in line with previous reports (Undeen and Fukuda, 1994). Infected larvae were either used immediately while still alive or frozen in sterile water and stored at 80 °C. 2.3. Cell lines Three mosquito cell lines and one lepidopteran cell line were used to determine susceptibility to IIV-3 challenge. The three mosquito cell lines were A. aegypti (Aag2) obtained from Dr. Que Lan (University of Wisconsin Department of Entomology), Aedes albopictus (C6/36) obtained from Dr. Lei Zhou (University of Florida School of Medicine), Anopheles gambiae (4a3A) obtained from Dr. Liangbiao Zheng (Yale University School of Medicine), and a lepidopteran cell line SF9 from Spodoptera frugiperda (Lepidoptera: Noctuidae) purchased from Invitrogen (San Diego, CA). All mosquito cells were maintained in Schneider’s insect media (Sigma Aldrich, St. Louis, MO) supplemented with 10% fetal bovine serum (FBS) (Invitrogen, San Diego, CA). SF9 cells were maintained in GIBCO Grace’s insect media (Invitrogen, San Diego, CA) supplemented with 10% FBS. 2.4. Susceptibility of mosquito cell lines to IIV-3 infection Infection experiments with IIV-3 were conducted in 60 mm cell culture dishes for each of the cell lines. Cells were incubated at 26 ± 0.5 °C until they reached 90% confluency (approximately 24 h). Spent medium was removed and replaced with 1.5 ml of fresh Schneider’s medium containing 10% FBS. Virions were obtained by homogenizing 100 IIV-3 infected A. taeniorhynchus larvae in 10 ml of sterile DI water and large particulate material removed by low speed centrifugation. The supernatant was filtered through a 0.45 micron filter and 100 ll was added to each culture and returned to the incubator, one group at 27 °C and the other at 31 °C. Cell samples were removed at 0, 8, 24 and 48 h post IIV-3 exposure. An additional exposure was made with C6/36 cells at 27 °C for 7 days and cell samples were collected each day (every 24 h). All experiments were run in duplicate. Control cultures were
held under identical conditions without addition of IIV-3. All cell samples were collected by centrifugation (3000 rpm for 10 min). Cell pellets were resuspended in PBS and collected by centrifugation. The resuspension and centrifugation were repeated three times and the cell pellets were flash frozen in liquid nitrogen and then stored at 80 °C until RNA extraction. 2.5. RNA extraction, cDNA synthesis, and quantitative PCR Total RNA instead of genomic DNA was used as a measure of active infection for IIV-3 in insect cell lines. Total RNA was isolated from cells infected with or without IIV-3 using Trizol Reagent (Invitrogen, Carlsbad, CA). All RNAs were quantified on a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Rockland, DE). Total RNA was DNase treated with DNA-free (Ambion, Austin, TX) and 2 lg of total RNA was used for cDNA synthesis. The first strand cDNA used for quantitative PCR (qPCR) was synthesized using AMV reverse transcriptase (Invitrogen, Carlsbad, CA). Briefly, a 2-lg aliquot of total RNA was reverse transcribed in 20-ll reaction volume using Clone AMV first strand cDNA Synthesis kit (Invitrogen, Carlsbad, CA). The reaction was terminated by heat inactivation at 95 °C for 5 min. The cDNA was then diluted with 80 ll water and 1 ll of diluted cDNA was used in qPCR. The major capsid protein transcriptional level was selected as an indicator of IIV-3 replication, and b-actin was used as an internal control to normalize the variation in the amount of cDNA template used in the quantitative PCR. Primers used in qPCR were listed in Table 1. To determine the specificities of the primers, PCR was performed using cDNAs from IIV-3 infected cell cultures as the template and PCR products were subjected to sequencing at the University of Florida Sequencing Facility. Sequences were analyzed using the National Center for Biotechnology Information (NCBI) BLAST program to search for sequence homologies. All primers were confirmed to be specific through sequence analysis. PCR efficiency was calculated from ten-fold serial dilutions of cDNA for each primer pair in triplicate. All qPCR was performed on an Applied Biosystems 7500 Real-Time PCR System (ABI, Foster City, CA) using PlatinumÒ SYBRÒ Green qPCR SuperMix-UDG with ROX (Invitrogen, Carlsbad, CA) in a total volume of 12.5 ll. The qPCR mixture consisted of 1 ll of cDNA, 0.5 ll of 5 lM gene-specific forward primer, 0.5 ll of 5 lM gene-specific reverese primer and 10.5 ll of 1 SYBR Green SuperMix. The qPCR thermal cycling parameters were 50 °C for 2 min, 95 °C for 10 min followed by 40 cycle of 95 °C for 15 s and 60 °C for 1 min. All qPCR was run in duplicate for each cDNA sample and three samples at each time point were used for qPCR. 2.6. Data analysis The relative transcriptional level of the IIV-3 MCP gene was determined by subtracting the cycle threshold (Ct) of the sample by that of the actin, the calibrator or internal control, as per the
Table 1 Primers used in quantitative PCR analysis of IIV3 major capsid protein (MCP) gene expression in four insect cell lines. Gene name (accession no.)
Primer name
Primer sequence (50 –30 )
Annealing temp. (°C)
Product size (base pairs)
IIV3 MCP (AF025775) A. aegypti actin (AAU20287) A. albopictus actin (DQ657949) A. gambiae actin (U02964) S. frugiperda actin (AF548015)
MCP-F MCP-R Aae-actin-F Aae-actin-R Aal-actin-F Aal-actin-R Aga-actin-F Aga-actin-R Sfr-actin-F Sfr-actin-R
CGGCTGCATTACCCTACAAT CACAACCCATCCTTCTTCGT TTCGACGCTCAGTTGTTGAC TTGGGGTACTTCAGGGTGAG AGAGCACCCAGTTCTCCTGA CAGGGCATAACCCTCGTAGA AGCCTGGGGTAAAAGGAGAA GTACATGAGGGCACAACACG CCAAGGCCAACAGAGAGAAG GGCGTAGCCCTCGTAGATG
59.98 59.97 60.03 59.96 59.99 60.09 60.07 60.03 59.98 60.77
219 199 217 211 176
42
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
formula: DCt = Ct (sample) Ct (calibrator). Relative increased expression level (fold) of MCP at a specific time point X compared to that at time 0 was then calculated by the formula 2DDCt, where DDCt = DCt (X) DCt (0) as described previously (Pridgeon et al., 2008). 2.7. Electron microscopy
27 °C for 7 days to understand the daily expression level of the MCP gene in C6/36 cells compared to the expression level in C6/ 36 on the first day. Quantitative PCR results (Fig. 1) indicated a continuous increase in MCP gene expression throughout this period. 3.2. Electron microscopy
Previously described protocols (Becnel, 1997) were used with the following modifications. Exposed and control cell lines (48 h post-exposure) were harvested, rinsed three times and re-suspended in 2.5% glutaraldehyde for 2 h at room temperature. Cells were rinsed three times in PBS and embedded in 1% agar and cut into small blocks for each group. Standard procedures were followed thereafter and sections examined with a Hitach H-600 EM at 75 kv.
IIV-3 virions were observed in cells of each of the three mosquito cell lines as well as the lepidopteran cell line but not in the control groups. At 48 h post-exposure in the C6/36 and Aag2 cells, virus was observed to replicate within viroplasm that were surrounded by mitochondria (Fig. 2). IIV-3 virions were icosahedral in shape and dispersed throughout the cytoplasm (Fig. 3A). Virions
2.8. Transmission of IIV-3 derived from cell culture to Aedes taeniorhynchus IIV-3 produced in C6/36 cells (A. albopictus) was used to expose larvae of A. teniorhynchus. Cells were harvested 7 days post exposure, rinsed three times with PBS and lysed in cell lysis buffer (50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 1% Igepal CA-630). Cell lysate from one culture flask containing virus was used to feed 150 larvae. A control mosquito group was fed cell lysate from culture flask that was not exposed to virus. In addition, five 72 h old larvae were microinjected (using a modified procedure as described by Handler, 2000) with a drawn capillary tube (0.1 ll/larva) via the anal papillae with virus from the same culture used for the per os transmission experiment. Patent infections were determined in 4th-instar larvae for each group. 3. Results 3.1. Susceptibility of mosquito cell lines to IIV-3 infection Primer efficiency experiments revealed that all primers used had similar qPCR efficiencies, ranging from 95% to 100%. Using IIV-3 major capsid protein gene-specific primers as an indicator for virus replication, qPCR results revealed that all four cell lines were susceptible to IIV-3 infection at both 27 °C and 31 °C (Table 2). The relative expression level of the MCP gene in A. albopictus (C6/36) and A. aegypti (Aag2) cells showed an increasing trend during the 48 h post-exposure, with a 75-fold increase at 48 h post exposure in A. albopictus (C6/36) cells (Table 2). However, MCP gene expression decreased 48 h post-exposure after an initial increase at 8 h and 24 h post-exposure in S. frugiperda (SF9) cells and A. gambiae (4a3A) cells, respectively (Table 2). Based on these results, C6/36 cells were re-inoculated with IIV-3 and incubated at
Fig. 1. Relative expression level of IIV-3 major capsid protein in Aedes albopictus (C6/36) cell line at different days post exposure to IIV-3. The relative transcriptional level of IIV-3 MCP was determined by subtracting the cycle threshold (Ct) of the sample by that of the actin, the calibrator or internal control, as per the formula: DCt = Ct (sample) Ct (calibrator). Relative increased expression level (fold) of MCP at a specific time point X compared to that at day 1 was then calculated by the formula 2DDCt, where DDCt = DCt (Day X) DCt (Day 1). Data are presented as mean ± S.D. from two replicates.
Table 2 Relative expression level of IIV-3 major capsid protein in four insect cell lines at different time point after exposure to IIV-3. Temp
Time
Relative MCP expression level compared to time 0 (fold ± S.D.)
(°C)
(h)
Aag2
C6/36
4a3A
SF9
27 27 27 27
0 8 24 48
– 23 ± 1.1 46 ± 0.9 55 ± 1.6
– 1 ± 0.1 26 ± 1.6 75 ± 2.9
– 33 ± 4.8 65 ± 0.6 24 ± 0.2
– 84 ± 2.1 51 ± 6.6 30 ± 3.2
31 31 31 31
0 8 24 48
– 25 ± 0.6 35 ± 1.9 42 ± 0.4
– 1 ± 0.1 16 ± 0.1 36 ± 1.1
– 2 ± 0.1 4 ± 0.1 1 ± 0.1
– 46 ± 2.3 44 ± 2.2 31 ± 0.6
Fig. 2. Foci of infection (viroplasm) in an Aedes albopictus C6/36 cell infected with IIV-3. Viroplasm is surrounded by an accumulation of mitochondria.
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
43
Fig. 3. Aedes albopictus (C6/36) cells infected with IIV-3. (A) Infected cell demonstrating virions in the cytoplasm and accumulating at the plasma membrane. (B) Virion initiating budding. C. Virions released from an infected cell.
that accumulated along the plasma membrane were commonly released from cells by budding (Fig. 3B and C). In contrast, there was less accumulation of virions in the 4a3A and SF9 cells and many of the virions were localized to mitochondria (Figs. 4 and 5). Some virions formed within the cisternae of mitochondria of 4a3A cells appeared to have the normal icosahedral form characteristic for IIV-3 (Fig. 4B) while those formed in mitochondria of SF9 cells were less uniform and distorted in appearance (Fig. 5B). Virions were not observed to accumulate within the cytoplasm and were not released from cells of 4a3A or SF9. 3.3. Transmission of IIV-3 derived from cell culture to Aedes taeniorhynchus IIV-3 grown in C6/36 cells was infectious per os to A. taeniorhychus larvae with an infection rate of 5% by feeding. The resulting infected larvae exhibited the characteristic fat body infection and iridescence observed in IIV-3. When C6/36 cell culture supernatant
from IIV-3 cultures was injected into larvae of A. taeniorhynchus, 4/ 5 larvae became patently infected. 4. Discussion Replication of IIV-3 in A. aegypti (Aag2), A. albopictus (C6/36), An. gambiae (4a3A) and S. frugiperda (SF9) cell lines was detected by qPCR analysis using MCP gene-specific primers as an indicator of viral replication. The replication of IIV-3 in the four insect cell lines was verified by electron microscopy. Both qPCR and electron microscopy indicated that C6/36 and Aag2 were both highly permissive to IIV-3 replication with 27 °C the better temperature. However, IIV-3 infections in A. gambiae (4a3A) and S. frugiperda (SF9) cell lines were weak and short lived in that virus did not appear to be able to escape infected cells and spread to uninfected cells. Webb et al. (1975) tested three A. aegypti cell lines (Singh’s, Peleg’s, Mos-20A), one A. albopictus cell line and one lepidopteran cell line from Antheracea eucalypti (Lepidoptera: Saturniidae) for
44
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
Fig. 4. Anopheles gambiae (4a3A) cell infected with IIV-3. (A) Lightly infected cell. (B) Localization of normally appearing IIV-3 virions to several mitochondria.
Fig. 5. Spodoptera frugiperda (SF9) cell infected with IIV-3. (A) Cell infected with numerous IIV-3 particles localized to mitochondria. (B) Mitochondria with IIV-3 particles that appear distorted in shape and form.
susceptibility to IIV-3. Singh’s and Pelag’s cell lines exhibited CPE at 31 °C and 35 °C but not at 21 °C or 25 °C. The other cell lines failed to exhibit CPE at any of the temperatures tested. Infection and pathology of IIV-3 in Singh’s and Pelag’s cell lines was verified and defined in a subsequent study using electron microscopy (Webb et al., 1976). Our findings have confirmed the previous studies by Webb et al. (1974, 1975) that A. aegypti cell lines are susceptible to infection by IIV-3 at temperatures > 25 °C. In addition we observed that the A. albopictus (C6/36), A. gambiae (4a3A) and S. frugiperda (SF9) cell lines support replication of IIV-3. Webb et al. (1975) clearly stated that failure of A. albopictus, Mos-20A and A. eucalypi cell lines to exhibit CPE did not rule out their capacity to support IIV-3 replication. qPCR is a very accurate and sensitive method to detect gene expression level, which enabled us to detect virus replication that could not be determined by CPE. There is no indication that cell lines other than Singh’s and Pelag’s were examined ultrastructurally for IIV-3 infection which may have permitted IIV-3 replication at low levels in the studies performed by Webb et al. (1976). Observation on the pathology of IIV-3 in C6/36 and Aag2 cells lines was consistent with earlier observations (Webb et al., 1976). IIV-3 did not accumulate and form paracrystalline arrays
in the cytoplasm as occurs in the fat body of A. taenirhynchus larvae (Becnel and White, 2007). Rather, virions migrated to the plasma membrane and were released via budding from the cells (Fig. 3). Virions released from the cells acquired an envelope from the plasma membrane, but it was unclear whether this newly acquired membrane was persistent. Webb et al. (1975) suggested that this membrane may have played a role in the inability of cell culture derived IIV-3 to infect A. taeniorhynchus larvae or be used to infect cell lines. Evidence presented here demonstrated that IIV-3 derived from C6/36 cells was infectious to A. taeniorhynchus larvae per os and by injection. This discrepancy between this study and the previous study might be due to different detergents used to lyse cells. However, infection levels with IIV-3 are generally low, even when using host derived virions. The ability to infect mosquitoes with cell derived IIV-3 particles is critical for functional studies that require the ability to re-infect the natural host. IIV-3 replication and virion assembly was lower in 4a3A and SF9 than that in C6/36 and Aag2 cell lines based on EM observations. Furthermore, virions formed in 4a3A and SF9 cells did not accumulate in the cytoplasm or migrate to the plasma membrane nor were they observed being released from cells via budding as observed in C6/36 and Aag2 cells. Rather, IIV-3 virions were
J.J. Becnel, J.W. Pridgeon / Journal of Invertebrate Pathology 108 (2011) 40–45
observed to localize within mitochondria (Figs. 4 and 5). IIV-3 is similar to other members of the Iridoviridae in that virus genome replication occurs in the nucleus with assembly occurring in the cytoplasm (Becnel, 2002; Williams, 2008). Mitochondria have been reported to accumulate around the viroplasm of iridoviruses which was reportedly not as a result of increased biogenesis but due to mass migration (Novoa et al., 2005). Changes in the ultrastructure of these mitochondria have also been noted and characterized by a condensed ultrastructure and a marked condensation of cristae (Novoa et al., 2005). Viroplasm with an accumulation of mitochondria was observed in C6/36 cells in this study (Fig. 2). The type of localization of virions within mitochondria has not been reported for iridoviruses. To our knowledge, this is the first report of virions of iridovirus localized within mitochondria. In fact, the specific localization of virions within mitochondria has not been reported for any other virus group (Novoa et al., 2005). Assembly of virions within the cisternae of mitochondria may have prevented migration of virions to the cell plasma membrane. However, the mechanisms that promote virion targeting and assembly within the mitochondria are unknown but of potential interest. In summary, IIV-3 can be produced readily in C6/36 and Aag2 cells and the resulting virions are infectious to A. taeniorhynchus larvae by both injection and per os. The availability of a vigorous cell culture system is crucial for conducting functional genomic studies on IIV-3. This study has also demonstrated that qPCR is one method that can be used to determine virus replication in permissive cell lines. Acknowledgments We thank Dr. Steve Valles (Agricultural Research Service, Gainesville, FL) and Dr. James Maruniak (University of Florida, Gainesville, FL) for critical reviews of the manuscript. We also thank William Reid and Neil Sanscrainte (USDA-ARS) for technical support. The use of trade, firm, or corporate names in this publication is for the information and convenience of the reader. Such use
45
does not constitute an official endorsement or approval by the United States Department of Agriculture or the Agricultural Research Service of any product or service to the exclusion of others that may be suitable. References Becnel, J.J., 1997. Complementary techniques: preparations of entomopathogens and diseased specimens for more detailed study using microscopy. In: Lacey, L.A. (Ed.), Manual of Techniques in Insect Pathology. Academic Press, pp. 337– 353. Becnel, J.J., 2002. Chloriridovirus; iridoviridae. In: Tidona, C.A., Darai, G. (Eds.), The Springer Index of Viruses. Springer-Verlag, Heidelberg, Germany, pp. 472–474. Becnel, J.J., White, S.E., 2007. Mosquito pathogenic viruses – the last 20 years. Bull Am. Mosq. Control Assoc. 7, 36–49. Delhon, G., Lu, Z., Afonso, C.L., Tulman, E.R., Becnel, J.J., Moser, B.A., Kutish, G.F., Rock, D.L., 2006. Genome of Invertebrate iridescent virus type 3 (mosquito iridescent virus). J. Virol. 80, 8439–8449. Gerberg, E.J., Barnard, D.R., Ward, R.A., 1994. Manual for mosquito rearing and experimental techniques. Am. Mosq. Control Assoc. Bull. No. 5. Handler, A.M., 2000. An introduction to the history and methodology of insect gene transfer. In: Handler, A.M., James, A.A. (Eds.), Insect Transgenesis: Methods and Applications. CRC Press, Boca Raton, FL, pp. 3–26. Novoa, R.R., Calderita, G., Arranz, R., Fontana, J., Granzow, H., Risco, C., 2005. Virus factories: association of cell organelles for viral replication and morphogenesis. Biol. Cell 97, 147–172. Pridgeon, J.W., Becnel, J.J., Clark, G.G., Linthicum, K.J., 2008. Developmental and environmental regulation of AaeIAP1 transcript in Aedes aegypti. J. Med. Entomol. 45, 1071–1079. Webb, S.R., Paschke, J.D., Wagner, G.W., Campbell, W.R., 1974. Infection of Aedes aegypti cells with mosquito iridescent virus. J. Invertebr. Pathol. 23, 255–258. Webb, S.R., Paschke, J.D., Wagner, G.W., Campbell, W.R., 1975. Bioassay of mosquito iridescent virus of Aedes taeniorhynchus in cell cultures of Aedes aegypti. J. Invertebr. Pathol. 26, 205–212. Webb, S.R., Paschke, J.D., Wagner, G.W., Campbell, W.R., 1976. Pathology of mosquito iridescent virus of Aedes taeniorhynchus in cell cultures of Aedes aegypti. J. Invertebr. Pathol. 27, 27–40. Williams, T., 2008. Iridoviruses of Invertebrates. In: Mahy, B.W.J., Van Regenmotel, M.H.V. (Eds.), Encyclopedia of Virology, third ed. Elsevier, Oxford, UK, pp. 161– 167. Williams, T., Corey, J.S., 1994. Proposal for a new classification of iridescent viruses. J. Gen. Virol. 75, 1291–1301. Williams, T., 1994. Comparative studies of iridoviruses: further support for a new classification. Virus Res. 33, 99–121.