SWAP-70-like Adapter of T Cells, an Adapter Protein that Regulates Early TCR-Initiated Signaling in Th2 Lineage Cells

Immunity, Vol. 18, 403–414, March, 2003, Copyright 2003 by Cell Press

SWAP-70-like Adapter of T Cells, an Adapter Protein that Regulates Early TCR-Initiated Signaling in Th2 Lineage Cells Yoshihiko Tanaka, Kun Bi, Rika Kitamura, Sooji Hong, Yoav Altman, Akira Matsumoto, Hiroki Tabata, Svetlana Lebedeva, Paul J. Bushway, and Amnon Altman* Division of Cell Biology La Jolla Institute for Allergy and Immunology 10355 Science Center Drive San Diego, California 92121

Summary We describe the isolation of a protein, SWAP-70-like adapter of T cells (SLAT), which is expressed at high levels in thymocytes and differentiated Th2 cells. SLAT expression was upregulated in differentiating Th2 cells and downregulated in Th1 cells. Ectopic SLAT expression exerted positive or negative effects on IL-4 versus IFN␥ induction, respectively. TCR signaling induced translocation of SLAT to the immunological synapse and its association with ZAP-70 kinase. SLAT reduced the association of ZAP-70 with TCR-␨ and interfered with ZAP-70 but not Lck signaling. Consistent with these results, pharmacological inhibition of ZAP-70 also induced Th2 skewing. Thus, SLAT is a protein which plays a role in Th2 development and/or activation, perhaps by interfering with ZAP-70 signaling. Introduction T helper (Th) cells play a central role in the immune response. Antigen-stimulated CD4⫹ Th0 cells differentiate into Th1 or Th2 cells, which are associated with discrete cytokine production profiles in both mice and humans (Del Prete et al., 1991; Mosmann et al., 1986). In addition to T cell receptor (TCR) signals, the differentiation and maintenance of Th1/Th2 subsets is regulated by cytokines and costimulatory signals (Abbas et al., 1996; Murphy et al., 2000; O’Garra and Murphy, 1994). Progress was recently made in characterization of transcription factors that dictate the development of Th1 or Th2 subsets (Dong and Flavell, 2001; Glimcher and Murphy, 2000; Murphy et al., 2000). While Th2 development is associated with the expression of GATA-3 (Ferber et al., 1999; Ouyang et al., 1998; Zhang et al., 1997, 1999; Zheng and Flavell, 1997) and c-Maf (Ho et al., 1996, 1998; Kim et al., 1999), T-bet plays a central role in Th1 development (Szabo et al., 2000). Earlier studies described differences between Th1 and Th2 cells in TCR-induced protein tyrosine kinase (PTK) activation, tyrosine phosphorylation profiles, and Ca2⫹ signaling (Fitch et al., 1993; Gajewski et al., 1990; Tamura et al., 1993, 1995), but the basis of these differences has not been elucidated. More recent studies pointed to the importance of mitogen-activated protein kinases (MAPKs) in Th1/Th2 differentiation and cytokine production (Dong et al., 2001), but little information exists re*Correspondence: [email protected]

garding earlier, TCR-proximal signaling events that are unique to these subsets. Here we report the isolation of a TCR-regulated protein that plays a role in signaling events leading to Th2 development and/or activation, which we named SWAP70-like adapter of T cells (SLAT) based on its selective expression in T cells and its homology with SWAP-70, a B cell-enriched protein that functions as a scaffolding component of the Ig DNA recombination complex in B lymphocytes (Borggrefe et al., 1998). SLAT is selectively upregulated in Th2 cells, translocates to the immunological synapse (IS) upon antigen stimulation, and has opposite effects on IL-4 versus IFN␥ production in retrovirus-transduced T cells. We provide additional evidence that SLAT may mediate this regulatory activity via its association with the ZAP-70 kinase and inhibition of its function. Results Isolation and Structure of SLAT To identify Th2-specific genes, we performed a differential display analysis (Liang and Pardee, 1992) on cDNA libraries from in vitro-differentiated Th1 and Th2 cells derived from AD10 TCR-transgenic mice. Several differentially expressed cDNAs were revealed, the most prominent of which was selectively expressed in Th2 but not Th1 cells (Figure 1A). Sequencing revealed a sequence of 1003 nucleotides, termed Cl-45, with minimal homology to known sequences. This cDNA fragment hybridized to a ⵑ1.8 kb transcript, which was selectively expressed in Th2 cells (Figure 1B). Using a Th2 cDNA library, rapid amplification of cDNA ends (RACE) was used to obtain a complete reading frame included within a cDNA sequence of 2217 nucleotides. The partial cDNA (Cl-45) corresponds to nucleotides 1211–2217 of this sequence. Nucleotides 1–1893 contain a complete reading frame, which encodes a putative protein of 630 amino acids (Figure 2A). Comparison with the NCBI GenBank database yielded significant amino acid homology (45%) with mouse SWAP-70 (Figure 2B) (Borggrefe et al., 1998). Furthermore, the domain structure of the putative protein is similar to that of SWAP-70. Thus, we named this cDNA SLAT, for SWAP-70 like adapter of T cells. The predicted amino acid sequence contains a potential Ca2⫹ binding EF hand, an imperfect ITAM-like motif, a pleckstrin-homology (PH) domain, a potential nuclear localization signal (NLS), and an ezrin-radixin-moesin (ERM)-homology domain (Figure 2C). Expression of SLAT To examine SLAT protein expression, we generated a polyclonal rabbit antiserum. The specificity of this antibody was confirmed by demonstrating that it immunoprecipitated a 75 kDa protein from SLAT-transfected but not from empty vector-transfected 293T cells (data not shown). This antiserum recognized a protein of 75 kDa, which was present in peripheral blood T cells and

Immunity 404

Figure 1. Isolation of a Partial Th2-Specific cDNA (Cl-45) (A) Differential display analysis. mRNAs were isolated from in vitrodifferentiated Th2 and Th1 cells on day 4 were amplified by RTPCR. cDNA populations were analyzed on a 6% sequencing gel. (B) Expression of SLAT mRNA. mRNAs isolated from in vitro-differentiated Th1 or Th2 populations as in (A) were hybridized with SLAT (left) or G3PDH (right) probes and analyzed by Northern blotting.

thymocytes but not in nonlymphoid cells (Figures 3F and 3G and data not shown). SLAT was detectable in fresh primary T cells. Its level increased after 4 days of culture under Th2-polarizing conditions but not in Th1-polarized cells (Figure 3A). RTPCR analysis revealed that mRNAs for IFN␥ or IL-4 were induced in the differentiating T cells by day 2 of culture, before the first detectable increase in SLAT expression (Figure 3B). Therefore, we addressed the possibility that SLAT expression is induced by Th2-specific cytokines, which are produced earlier in response to TCR and/or costimulatory signals, by testing the effect of IL-4-, IL12-, and IFN␥-neutralizing antibodies on SLAT expression. Because these antibodies prevented polarization of naive T cells into Th1 or Th2 populations, we used them in secondary, antigen-restimulated cultures (Figure 3C). Prior to restimulation (d0), both Th2 and Th1 cells expressed relatively low and similar levels of SLAT. Restimulation caused a substantial increase in SLAT expression on day 2 and especially on day 5 in Th2 but not in Th1 cells (Figure 3C). Importantly, the neutralizing antibodies did not prevent the upregulation of SLAT in Th2 cells, nor did they affect its basal expression in Th1 cells. These results indicate that IL-4, IL-12, and IFN␥ are not required for upregulation of SLAT expression. Rather, the observed increase in SLAT expression in Th2 cells occurs, most likely, in response to initial TCR (and/or costimulatory) signals. The presence of a potential plasma membrane-targeting pH domain in SLAT led us to examine SLAT expression in T cell membranes. Membranes of unstimulated or 2 day-stimulated CD4⫹ cells contained very low levels of SLAT (Figure 3D). SLAT was consistently upregulated after 4 days of culture in the differentiated Th2 but not Th1 cells. This difference was confirmed by

confocal analysis (Figure 3E). SLAT was mostly localized in the membrane of T cells with a much fainter cytoplasmic expression. It was much more abundant in Th2 cells than in naive or Th1 cells. Parallel staining with an anti-TCR␤ antibody revealed similar levels of predominantly membrane expression of TCR␤ in all three T cell types. More importantly, merging of the SLAT and TCR␤ images indicates a more intense colocalization of SLAT with TCR␤ in Th2 cells by comparison with naive or Th1 cells. This colocalization is also consistent with results shown later (Figure 4). Next, we analyzed the expression of SLAT in different cell lines or mouse tissues. SLAT was expressed in purified human peripheral blood T cells, an established Th2 clone, Jurkat T cells, and THP-1 cells; however, very little or no expression was observed in a Th1 clone, EL4 thymoma, a B cell lymphoma, or a mast cell line (Figure 3F). Similar analysis of fresh murine organs or tissues revealed abundant SLAT expression in the thymus but not in other organs or cells (Figure 3G). However, longer development of the same membrane also revealed SLAT expression in the spleen and lymph nodes (data not shown). Similar results were obtained in multitissue Northern blot analysis (data not shown).

Antigen-Induced Translocation of SLAT to the Immunological Synapse The membrane localization of SLAT in Th2 cells (Figure 3D) and the apparent regulation of its expression by TCR signals (Figure 3C) led us to examine the effect of antigen stimulation on the intracellular localization of SLAT in peptide-stimulated differentiated AD10 Th2 cells (Figure 4). In unstimulated Th2 cells, SLAT was fairly uniformly distributed in the membrane (Figure 4A). Agonist stimulation induced translocation of SLAT to the contact area between the T cells and APCs (Figure 4E) and its colocalization with TCR␤ (Figure 4F). TCR␤ was also concentrated, albeit not exclusively localized, at the IS (Figure 4D). Further analysis of SLAT localization vis-a`-vis that of talin revealed localization of both proteins to the IS in agonist-stimulated Th2 cells (Figures 4J and 4K). However, SLAT was also localized in the central area of the IS where talin was not detectable, i.e., the cSMAC (Figure 4L). Thus, agonist stimulation induces translocation of SLAT to the IS, where it is found both in the pSMAC and cSMAC. A similar localization of PKC␪, which is not restricted to either the cSMAC or pSMAC, was recently observed in T cells stimulated by TCR ligation in the absence of CD28 costimulation (Huang et al., 2002). We also analyzed the effect of an antagonistic altered peptide ligand (APL) on SLAT localization. The APL failed to induce substantial TCR␤ or PKC␪ translocation to the IS (data not shown) but caused SLAT to translocate to the T cell-APC contact area (Figures 4G–4I). However, the localization of SLAT in the contact area appeared to be less focused than in agonist-stimulated Th2 cells (compare Figures 4E versus 4H), and SLAT-TCR␤ colocalization was minimal (Figure 4I). The ability of the APL to induce an incomplete synapse between the T cells and APCs is consistent with our recent finding (Huang et al., 2000).

SLAT, a Th2-Regulating Adapter Protein 405

Figure 2. Sequence and Domain Structure of SLAT (A) Nucleotide and deduced amino acid sequence of murine SLAT. The EF hand, the ITAM-like motif, the pH domain, the nuclear localization signal (NLS), and the ERM domain are underlined and indicated by the numbers 1–5, respectively, shown along the deduced amino acid sequence. (B) Comparison of the deduced amino acid sequence of murine SLAT and SWAP-70. Identical amino acids are boxed in black. (C) Domain structure of SLAT. Numbers above the scheme refer to amino acid residues.

Immunity 406

Figure 3. Selective Expression of SLAT in Th2 Lineage Cells (A) SLAT protein expression in primary T cells. Naive CD4⫹ AD10 T cells were differentiated under Th2- or Th1-inducing conditions, and lysates prepared at the indicated time points after stimulation were analyzed by immunoblotting as indicated. The data shown are representative of three independent experiments. (B) Expression of SLAT and cytokine mRNA. AD10 T cells were differentiated as in (A) and the expression of mRNA for SLAT, IFN␥, IL-4, or actin was analyzed by a semiquantitative RT-PCR on the indicated days. (C) Effect of cytokine-neutralizing antibodies on SLAT expression. Naive AD10 T cells differentiated under Th2- or Th1-inducing conditions were restimulated on day 7 with PCC peptide plus APCs in the absence or presence of neutralizing anti-IL-4, -IL-12, and -IFN␥ antibodies (10 ␮g/ml each). Lysates prepared at different time points were immunoblotted as in (A). The data shown are representative of three independent experiments. (D) SLAT membrane expression. Membrane fractions were prepared at the indicated times from naive AD10 T cells differentiated under Th2or Th1-inducing conditions, and analyzed by anti-SLAT or anti-actin immunoblotting. Numbers under the SLAT blot indicate relative intensity of the SLAT signal, normalized to the actin expression level. The data are representative of three independent experiments. (E) Confocal analysis of SLAT localization in T cells. AD10 naive T cells or 14 day-differentiated Th1 or Th2 cells were fixed and permeabilized, and SLAT (green) or TCR␤ (red) were visualized by anti-SLAT or anti-TCR␤ antibody staining and immunofluorescence microscopy. (F) SLAT protein expression in cell lines. Extracts from human purified T cells, TCR/KAE (Th2 cell clone), AD10 (Th1 cell clone), Jurkat (T cell lymphoma), EL4 (thymoma), CH27 (B cell lymphoma), MCP-5 (mast cell line), or THP-1 (macrophage cell line) were analyzed by immunoblotting with an anti-SLAT antiserum (top) or with an actin-specific antibody (bottom). (G) Tissue distribution of SLAT protein. Cellular extracts from the indicated fresh mouse tissues and organs were analyzed as in (F).

SLAT Regulates IL-4 and IFN␥ Expression To determine whether SLAT regulates the production of Th1 and/or Th2 cytokines, we initially studied its effect on the activity of IL-4 or IFN␥ promoter-luciferase (Luc) reporter genes in Jurkat T cells. Compared to the empty vector-transfected cells, SLAT overexpression increased both the basal and anti-CD3-induced activity of the IL-4-Luc reporter gene, and conversely, it reduced the activity of the IFN␥-Luc gene (Figure 5A). Immunoblot analysis confirmed the overexpression of SLAT in the transfected cells (Figure 5A, inset). Next, we generated a retroviral SLAT expression vector (Figure 5B), which was used to infect anti-CD3/CD28stimulated, nonpolarized AD10 CD4⫹ T cells. Under these conditions, a transduction efficiency of 40%–50% was achieved (data not shown). In a representative ex-

periment (Figure 5C), transduction of primary T cells with SLAT reduced the fraction of IFN␥-producing cells in the GFP⫹ population from ⵑ49% to 34% (30% inhibition). In contrast, the fraction of IFN␥-producing cells in the nontransduced cells was not decreased and, in fact, slightly increased (from ⵑ28% to ⵑ33%; left quadrants). In four separate experiments, SLAT expression reduced the fraction of GFP⫹ IFN␥-producing cells from 46.5% ⫾ 1.3% to 37.8% ⫾ 4.0% (p ⬍ 0.01 by Student’s t test). We could not assess the effects of SLAT on IL-4producing cells in primary nonpolarized cultures, since ⬍1% of the cells produced IL-4 under these conditions (data not shown). Therefore, we assessed the effect of retroviral SLAT transduction in restimulated Th2 cells. Analysis of GFP⫹ IL-4-producing cells revealed a SLAT-induced increase of 24% in IL-4-producing cells

SLAT, a Th2-Regulating Adapter Protein 407

SLAT in TCR signaling by attempting to identify SLATassociated tyrosine-phosphorylated proteins. SLAT immunoprecipitates from antigen-stimulated polarized Th2 cells contained a few tyrosine-phosphorylated proteins of ⵑ62, ⵑ70, and ⵑ98 kDa (data not shown); however, no phosphotyrosine (pTyr)-containing protein with a size corresponding to SLAT was detected (see Figure 6D), suggesting that SLAT itself is not phosphorylated. We identified the ⵑ70 kDa protein as ZAP70. Endogenous ZAP-70 from unstimulated Jurkat cells was associated with a very low level of transfected SLAT, a level that was not increased by phorbol ester plus Ca2⫹ ionophore stimulation; however, anti-CD3 stimulation increased the amount of ZAP-70-associated SLAT (Figure 6A). Similarly, endogenous ZAP-70 from antigen-stimulated Th2 cells also coimmunoprecipitated with SLAT (Figure 6B). In preliminary experiments we found that SLAT is not phosphorylated on tyrosine and, furthermore, that the ITAM-like motif of SLAT (Figure 2C) does not seem to be required for its association (data not shown).

Figure 4. Antigen-Induced SLAT Translocation to the IS In vitro-differentiated AD10 TCR-transgenic Th2 cells were incubated for 30 min with CH27 cells that were either nonpulsed (A–C) or pulsed with PCC agonist (D–F and J–L) or antagonist (G–I) peptide. Cells were processed for TCR␤ (red [A, D, and G]) plus SLAT (green [B, E, and H]), or SLAT (red [J]) plus talin (green [K]). Overlay of the red and green images is shown in the right column (C, F, I, and L).

in a representative experiment (Figure 5D). This increase was even more pronounced when comparing the fraction of IL-4-producing cells among the SLAT-infected, GFP⫹ cells (72.8%) to that in the noninfected (GFP⫺) population (39.8%). In six independent experiments, this increase averaged 22% (p ⬍ 0.001). We also examined the effect of SLAT transduction on IFN␥-producing cells in secondary restimulated Th1 cultures but found no consistent effects (data not shown), suggesting that SLAT primarily reduces Th1 expansion from naive T cells but not already differentiated Th1 cells. We conclude that SLAT moderately but consistently reduces the proportion of Th1 cells and, conversely, increases the level of IL-4-producing cells. SLAT Interacts with ZAP-70 The results above argue in favor of a potentially important role of SLAT in TCR signaling events, which regulate in a reciprocal manner the activation and/or expansion of Th1 and Th2 cells. Early TCR signaling events include the formation of signaling complexes composed of enzymes and adaptor proteins, many of which are phosphorylated on tyrosine (Kane et al., 2000; Rudd, 1999). Therefore, we began to analyze the potential role of

SLAT Selectively Inhibits ZAP-70-Dependent Signaling The inducible association of SLAT with ZAP-70 led us to examine whether SLAT modulates ZAP-70-dependent functions. Since T cell activation requires Lck-induced tyrosine phosphorylation of TCR-␨ chain and subsequent recruitment of ZAP-70 to phospho-␨ (Chan et al., 1992; Chu et al., 1998; Iwashima et al., 1994; Madrenas et al., 1995; Sloan-Lancaster et al., 1994), we assessed the effect of SLAT on these events (Figure 6C). To facilitate the detection of SLAT:ZAP-70 complexes, the cells were also cotransfected with a fixed amount of ZAP70 DNA. Increasing amounts of ZAP-70 were found to associate with immunoprecipitated SLAT in a dosedependent manner; furthermore, ␨ was not detectable in the SLAT immunoprecipitates (left four lanes). In contrast, the association of ZAP-70 with immunoprecipitated ␨ was reduced and inversely related to the expression of SLAT (right four lanes), and no SLAT was detectable in the ␨ immunoprecipitates. These results indicate that SLAT decreases the amount of TCR-␨associated ZAP-70 in activated T cells and, furthermore, that ZAP-70:SLAT and ZAP-70:TCR-␨ complexes are mutually exclusive, supporting the notion that SLAT competes with TCR-␨ for ZAP-70 binding. To determine how the association of SLAT with ZAP70 affects its inducible tyrosine phosphorylation, we also assessed the pTyr content of SLAT- versus phospho␨-associated ZAP-70 in similarly transfected cells. As shown above (Figure 6C), more ZAP-70 was associated with phospho-␨ than with endogenous SLAT, and this ratio was reversed in SLAT-overexpressing cells (Figure 6D, top panel). While the relative pTyr content of ZAP70 associated with endogenous SLAT and phospho-␨ was similar, SLAT overexpression led to a more pronounced loss of pTyr from the phospho-␨-associated fraction of ZAP-70 (second panel from top). Moreover, the total content of Tyr-319-phosphorylated ZAP-70 was considerably reduced in SLAT-overexpressing cells (Figure 6D, right panels). Thus, increased expression of SLAT, which occurs in differentiated Th2 cells, is associated with reduced activation of ZAP-70.

Immunity 408

We further assessed total tyrosine phosphorylation profiles in SLAT-overexpressing Jurkat cells (Figure 6E). Anti-CD3 stimulation increased the total pTyr level in empty vector-transfected cells, and increased SLAT expression was associated with a dose-dependent decrease in the basal or anti-CD3-induced total tyrosine phosphorylation of some substrates (top panel). However, this decrease was selective in that SLAT overexpression decreased the pTyr content of p16-21, p3036, p42, and p70, but not p26 and p56-60. In order to identify some of the pTyr-containing proteins and further determine whether SLAT overexpression differentially affects Lck- versus ZAP-70-mediated phosphorylation events, we assessed the tyrosine phosphorylation of immunoprecipitated LAT, which is a direct substrate of ZAP-70 (Zhang et al., 1998), phospholipase C-␥1 (PLC␥1), whose phosphorylation is ZAP-70 dependent (Williams et al., 1998), or TCR-␨, an established Lck substrate (Iwashima et al., 1994) (Figure 6D, bottom five panels). SLAT reduced the inducible tyrosine phosphorylation of immunoprecipitated LAT in a dose-dependent manner and also inhibited the phosphorylation of PLC␥1, while having no detectable effect on the inducible phosphorylation of TCR-␨. These results indicate that the reduction of the ZAP-70:␨ complex by increased SLAT expression (Figures 6C and 6D) does not result from decreased TCR-␨ tyrosine phosphorylation. More important, the intact tyrosine phosphorylation of TCR-␨ in SLAT-overexpressing cells in the presence of reduced LAT and PLC␥1 phosphorylation strongly suggests that SLAT selectively inhibits ZAP-70- but not Lck-mediated phosphorylation events.

Figure 5. Ectopic SLAT Expression Activates the IL-4 Gene and Inhibits the IFN␥ Gene (A) IL-4 and IFN␥ promoter transactivation. Jurkat-TAg cells were cotransfected with IL-4 or IFN␥ promoter-reporter plasmids plus a ␤-Gal reporter plasmid together with a SLAT expression vector (or a control empty vector). Two days later, the cells were left unstimulated or stimulated with a crosslinked anti-CD3 antibody (OKT3; 2 ␮g/ml) for 16 hr. Cell extracts were assayed for ␤-Gal-normalized luciferase activity. Expression levels of transfected SLAT are shown in the inset. The data shown are representative of three independent experiments. (B) Schematic diagram of retroviral SLAT constructs in the pMIG vector. (C) Naive CD4⫹ T cells were infected with a SLAT-expressing or control (GFP) retrovirus after primary activation by anti-CD3 plus -CD28 antibodies plus IL-2. Cells were harvested on day 4, restimulated with anti-CD3 plus -CD28 antibodies, and cytokine-producing

Pharmacological ZAP-70 Inhibition Induces Preferential Th2 Differentiation Next, we wished to determine whether selective inhibition of ZAP-70 by upregulated SLAT accounts for the observed effects of SLAT expression on Th1 versus Th2 activation. We evaluated the effects of piceatannol, a compound that selectively inhibits the activities of ZAP70 and Syk (Oliver et al., 1994; Soede et al., 1998), on Th differentiation. Piceatannol (2.5 ␮g/ml) reduced by ⵑ50% the fraction of IFN␥-producing cells in stimulated naive T cells cultured under Th1-inducing conditions (Figure 7A) and, conversely, increased by 2-fold the fraction of IL-4-producing cells in Th2-differentiated cultures (Figure 7B). Consistent with these results, piceatannol treatment reduced IFN␥ secretion by ⵑ70% and moderately increased (by ⵑ37%) the production of IL-4 (Figures 7C and 7D, respectively). Under the same conditions, piceatannol failed to inhibit proliferation of the same cells (Figures 7E and 7F, respectively). The effect

cells were enumerated by ICCS. Data are displayed as two-color dot plots showing GFP (horizontal axis) versus intracellular IFN␥ (vertical axis) expression. The data shown are representative of four independent experiments. (D) Seven day-differentiated Th2 cells were restimulated with antiCD3 plus -CD28 antibodies and infected with the indicated retroviruses. Intracellular IL-4 staining was performed on day 11 (4 days after restimulation) as in (C). The data shown are representative of six independent experiments.

SLAT, a Th2-Regulating Adapter Protein 409

Figure 6. SLAT Interacts with ZAP-70 and Selectively Inhibits Its Function (A) Jurkat-TAg cells transfected with SLAT (10 ␮g) were either left unstimulated or stimulated with PMA plus ionomycin or with crosslinked anti-CD3 antibody for 5 min. ZAP-70 immunoprecipitates were analyzed by SDS-PAGE and immunoblotting with anti-SLAT (top panel) or antiZAP-70 (middle panel) antibodies. An aliquot of the cell lysates was immunoblotted with anti-SLAT (bottom panel). (B) Differentiated Th2 cells were stimulated with APCs that were either nonpulsed or pulsed with 3 ␮M PCC peptide. SLAT immunoprecipitates were immunoblotted with anti-ZAP-70 (top panel) or anti-SLAT (middle panel) antibodies. An aliquot of the cell lysates was immunoblotted with an anti-ZAP-70 antibody (bottom panel). (C) Jurkat-TAg cells cotransfected with ZAP-70 (2 ␮g) plus increasing amounts of SLAT (or empty vector) were stimulated for the final 10 min of a 36 hr culture with crosslinked anti-CD3. SLAT (left right lanes) or TCR-␨ (right four lanes) immunoprecipitates were immunoblotted with anti-ZAP-70, -Xpress (SLAT), or -TCR-␨ antibodies. Aliquots of cell lysates were also blotted with anti-ZAP-70 (bottom panel). No ZAP-70 was detected in immunoprecipitates from unstimulated cells (data not shown). (D) Jurkat-TAg cells were cotransfected and stimulated as in (C). SLAT (left two lanes) or TCR-␨ (right two lanes) immunoprecipitates were analyzed by immunoblotting with anti-ZAP-70, -pTyr, -Xpress (SLAT), or -TCR-␨ antibodies. Aliquots of cell lysates were blotted with antiZAP-70 or -phospho-ZAP-70 (Tyr-319) antibodies (right panel). (E) Jurkat-TAg cells cotransfected as in (C) were left unstimulated or stimulated with anti-CD3. Aliquots of cell lysates were immunoblotted with an anti-pTyr, -HA (ZAP-70), -Xpress (SLAT) or -actin antibodies (top four panels, respectively). LAT, PLC␥1, or TCR-␨ immunoprecipitates from the same cells were immunoblotted with anti-pTyr, -LAT, or PLC␥1 antibodies (five bottom panels). The data shown are representative of three independent experiments.

of higher piceatannol concentrations could not be evaluated reliably since they inhibited proliferation, although they did not appear to be toxic (data not shown). To confirm inhibition of cellular ZAP-70 activity by piceatannol, we immunoblotted lysates of cells treated or not with increasing concentrations of piceatannol with an antibody specific for phospho-Tyr-319 of ZAP-70, whose autophosphorylation is critical for ZAP-70 downstream signaling (Di Bartolo et al., 1999; Williams et al., 1999). Piceatannol inhibited the autophosphorylation of Tyr-319 in a dose-dependent manner. Discussion We report the isolation of a mouse SWAP-70 homolog, termed SLAT. Sequence comparison indicates that SLAT is most likely the T cell counterpart of SWAP-70 (Figure 2B). A search of the NCBI GenBank database subsequently revealed a homologous human cDNA known as def-6 encoding a putative protein of 631 amino acids (accession number NM_022047) and a corresponding mouse partial cDNA sequence of 380 nucleo-

tides (accession number X96705). Since mouse SLAT and Def-6 display a 92% amino acid homology, we conclude that Def-6 is the human homolog of SLAT. The study describing a partial murine def-6 sequence, which corresponds to nucleotides 42–423 of SLAT, did not report its expression in T cells (Hotfilder et al., 1999). Here, we show that SLAT is expressed in thymocytes and in differentiated Th2 cells and, in addition, in a monocyte cell line. The latter expression is consistent with the original isolation of Def-6 from a differentiating myeloid cell line (Hotfilder et al., 1999). Furthermore, we show that SLAT plays a role in TCR-mediated signal transduction pathways associated with Th2 differentiation and/or activation. Extensive studies addressed the role of cytokine signals in Th1 and Th2 development (Abbas et al., 1996; O’Garra and Murphy, 1994). However, cytokine signaling occurs downstream of the initial regulation of Th1 and Th2 cells, which must rely on production of IL-4, IFN␥, and IL-12 in response to TCR and costimulatory signals in the first place. Examples of this are findings that Th2 cells can be generated in the complete absence of the

Immunity 410

Figure 7. Pharmacological Inhibition of ZAP-70 Induces Preferential Th2 Differentiation Naive AD10 CD4⫹ T cells were differentiated under Th1 (A, C, and E) or Th2 (B, D, and F) -inducing conditions in the absence or presence of piceatannol (2.5 ␮g/ml). On day 10, the cells were restimulated with anti-CD3 plus -CD28 mAbs. The data shown are representative of three independent experiments. (A and B) Cytokine-producing cells were enumerated by ICCS. (C and D) Levels of IFN␥ or IL-4 in 48 hr stimulated culture supernatants of untreated (empty bars) or piceatannol-treated (black bars) cells were quantified by an ELISA. (E and F) Proliferation was determined after 72 hr of stimulation by 3 HTdR uptake in cells labeled for the final 16 hr. All data are expressed as the mean value of triplicate determinations ⫾SE. (G) Naive CD4⫹ T cells (3 ⫻ 106 cells) pretreated with or without piceatannol for 2 hr were stimulated by a crosslinked anti-CD3 antibody for 2 min. Aliquots of cell lysates were immunoblotted with anti-pZAP-70 (Tyr-319) or actin antibodies. Relative densities of the phospho-ZAP70 signal normalized to the actin signal are shown.

IL-4R or its signaling intermediate STAT6 (Dent et al., 1998; Finkelman et al., 2000; Jankovic et al., 2000), and that Th1 cells can be generated in the absence of the IL12R signaling intermediate STAT4 (Kaplan et al., 1998). Thus, commitment to Th1 or Th2 differentiation pathways is decided before cytokine receptor signaling occurs, and the latter may serve primarily to amplify the number of Th1 and Th2 cells. Several findings indicate that SLAT acts at a proximal step during TCR signaling. First, SLAT resides in the membrane of naive T cells, and it is recruited to the IS in antigen-stimulated Th2 cells. Second, SLAT inducibly associates with ZAP-70, a proximal TCR-associated tyrosine kinase essential for T cell activation (Chu et al., 1998). The inability of PMA plus ionomycin treatment to induce this association suggests that it is regulated by proximal TCR signals occurring upstream of Ca2⫹ mobilization and/or protein kinase C activation. Third, transient SLAT overexpression inhibited ZAP-70-dependent tyrosine phosphorylation of LAT without interfering with tyrosine phosphorylation of TCR-␨, a known Lck sub-

strate (Iwashima et al., 1994). Therefore, TCR and/or costimulatory signals, rather than cytokines, likely regulate SLAT, a conclusion supported by our finding that neutralization of secreted IL-4, IL-12, and IFN␥ did not have a significant effect on the upregulation of SLAT in Th2 cells. Increased expression of SLAT was first observed in primary differentiating Th2 cells only after 3–4 days of culture, and perhaps a little earlier (2 days) in restimulated Th2 cells. Therefore, SLAT does not appear to regulate the earliest TCR signaling steps in naive Th0 cells but, rather, does appear to function at a later point, after Th1/Th2 commitment has occurred, to regulate the differentiation and/or expansion of Th1 and Th2 cells, leading to a decrease in the number of the former and an increase in the number of the latter. Such a role is consistent with our findings that the reduction of IFN␥secreting Th1 cells and the increase of IL-4-producing Th2 cells induced by SLAT retrovirus infection are relatively moderate. A number of possibilities may account for the relatively late effects of SLAT. For example, SLAT

SLAT, a Th2-Regulating Adapter Protein 411

may positively regulate the expression and persistence of Th2-determining transcription factors such as GATA-3 or c-Maf, or it may provide a selective growth or survival signal to developing Th2 cells. The inducible association of SLAT with ZAP-70, which may competitively reduce the association of ZAP-70 with phospho-␨, provides a potential mechanism for the ability of SLAT to positively regulate Th2 cells, namely, via inhibition of ZAP-70-dependent signaling, which may reduce the overall strength of TCR signaling, thereby favoring Th2 development. Such a mechanism is supported by several independent observations. First, treatment of antigen-specific T cells with piceatannol, a ZAP-70 inhibitor, reduced Th1 induction and, conversely, enhanced Th2 induction and IL-4 production (Figure 7). Second, in contrast to Th1 cells, ZAP-70 is not activated in Th2 cells (Tamura et al., 1995) and APLs with lower affinity for the TCR, which skewed Th differentiation toward a Th2 phenotype, failed to activate ZAP-70 and Fyn (Faith et al., 1999; Singh et al., 1999). Third, TCR triggering was found to induce a weaker overall tyrosine phosphorylation and ZAP-70:␨ association in human Th2 than in Th1 clones (Hannier et al., 2002). The latter finding is especially consistent with our putative model of a competition between (nonproductive) SLAT and (productive) phospho-␨ for binding ZAP-70. Last, selective blocking of Lck function, which prevents ZAP-70 recruitment to the TCR and its activation, also induced Th2 skewing (al-Ramadi et al., 1996). Together, these findings support the notion that ZAP-70 function is more critical for Th1 differentiation and cytokine production. However, we cannot rule out a potential, similar role for Syk, which is expressed at low levels in primary T cells. This mechanism for the selective role of SLAT in Th development is consistent with observations that changes in overall TCR affinity or signaling strength can significantly affect Th1/Th2 differentiation and the resulting cytokine secretion profile (Constant and Bottomly, 1997). In many (Blander et al., 2000; Constant et al., 1995; Hosken et al., 1995; Kumar et al., 1995) but not all (Pearson et al., 1997) instances, induction of Th2 cells has been associated with a weaker TCR-activating signal, as appears to be the case with regard to SLAT. Another potential mechanism that could account for the observed effects of SLAT is implicated by the homology between SLAT and SWAP-70. SWAP-70 expression increases after stimulation, and it undergoes nuclear translocation, which correlates with the onset of Ig class switch in B cells (Borggrefe et al., 1999; Masat et al., 2000). Consistent with this function, SWAP-70-deficient mice display impaired IgE responses (Borggrefe et al., 2001). Later findings that SWAP-70 translocates to the plasma membrane and associates with membrane IgG early after BCR stimulation (Masat et al., 2000) suggested that SWAP-70 may have an additional role in proximal BCR signaling pathways. Surprisingly, however, a recent study reported that the putative ERM domain of SWAP-70 is, in fact, a weakly conserved Dblhomology (DH) domain, which activates Rac in vitro and in vivo in fibroblasts (Shinohara et al., 2002). Studies to determine whether SLAT also possesses guanine nucleotide exchange activity are in progress. In this regard, a precedent exists for a differential role of Rac in Th1 versus Th2 differentiation (Li et al., 2000).

In summary, our findings indicate that SLAT plays a role in TCR-mediated signal transduction pathways in Th2 differentiation, activation, and/or expansion. Further work should be aimed at defining the precise mechanisms that regulate the expression and function of SLAT in T lymphocytes, including its potential role in T cell development. Furthermore, the selective effects of SLAT on Th1 versus Th2 differentiation and cytokine production suggest that SLAT may represent a potential drug target for diseases that are characterized by skewing of the Th1/Th2 balance. Experimental Procedures Mice and Reagents B10.A mice were purchased from The Jackson Laboratories. AD10 TCR-transgenic B10.A mice expressing a TCR specific for PCC peptide 88–104 in association with I-Ek (Kaye et al., 1992) were bred and maintained in our animal facility. Recombinant IL-2, IL-4, and IL12 were purchased from PeproTech. Monoclonal antibodies (mAbs) specific for IL-4 (11B11), IL-12 (C17.8), IFN␥ (H22), and TCR␤ (H57597) were purchased from Pharmingen. A talin-specific mAb, 8d4, was purchased from Sigma. Polyclonal anti-ZAP-70 (LR) and antiPKC␪ (C-18) antibodies were from Santa Cruz Biotechnology, and an anti-phospho-ZAP-70 (Tyr-319) polyclonal antibody was from Cell Signaling Technology. SLAT-specific antisera were prepared by immunizing two rabbits with a bacterial GST-SLAT fusion protein. Cell Culture, Stimulation, and Transfection Mouse lymph node and spleen cells were passed through a T cell enrichment column (R&D Systems). CD4⫹ T cells were enriched by negative selection using a magnetic activated cell sorting (MACS) system with rat anti-mouse CD8 and B220 antibodies (Pharmingen) followed by incubation with goat anti-rat Ig-coated magnetic beads (Miltenyi Biotech). Residual APCs and in vivo-activated T cells were removed by centrifugation through a Percol (Sigma) step gradient of 45%, 53%, 62%, and 80%. Over 95% of the resulting cells displayed a CD62L⫹, CD44low phenotype characteristic of naive CD4⫹ T cells. Cells were cultured in 24-well plates (2.5 ⫻ 105 cells/well) in a total volume of 2 ml and stimulated with 0.3 ␮M PCC peptide plus irradiated (3000 rad) B10.A spleen cells (5 ⫻ 106/well) as APCs in the presence of 10 U/ml recombinant IL-12 and 10 ␮g/ml antiIL-4 antibody to promote Th1 development, or in the presence of 100 U/ml recombinant IL-4 and 10 ␮g/ml anti-IL-12 antibody to promote Th2 differentiation. In some experiments, the cells were cultured in the presence of piceatannol (2.5 ␮g/ml). Differentiated Th1 and Th2 cells (1 ⫻ 106/well) were restimulated on day 7 with 0.3 ␮M PCC peptide plus irradiated B10.A spleen cells (3 ⫻ 106/well) in the absence or presence of neutralizing antiIL-4 (10 ␮g/ml), anti-IL-12 (10 ␮g/ml), and anti-IFN␥ (10 ␮g/ml) antibodies in 24-well plates. Human leukemic Jurkat T cells and simian virus 40 large T antigentransfected Jurkat (Jurkat-TAg) cells were cultured and transfected as described (Villalba et al., 2000). After 48 hr, cells were collected, resuspended (2 ⫻ 107 cells/ml) in 0.5 ml of medium, and treated with PMA (100 ng/ml) plus ionomycin (1 ␮g/ml), or anti-CD3 (OKT3) antibody (2 ␮g/ml) crosslinked with a secondary goat anti-mouse IgG (5 ␮g/ml) for 5 min at 37⬚C. Confocal and FACS Analysis These procedures were performed as described (Bi et al., 2001). In brief, paraformaldehyde-fixed and permeabilized cells were stained with primary antibodies. After washing, samples were incubated with Alexa594-coupled secondary antibody, washed, and mounted on glass slides. For antigen-specific stimulation, agonist (PCC 88104) or antagonist (T102G) (Huang et al., 2000) PCC peptide-pulsed APCs were settled on poly(L)lysine-coated glass slides. Differentiated Th2 cells were cultured on the slides for 30 min, fixed, permeabilized, and stained with TCR-, talin-, and/or SLAT-specific antibodies plus Alexa488- and Alexa594-coupled secondary antibodies (Bi

Immunity 412

et al., 2001). Imaging was done using a Bio-Rad MRC 1024 laser scanning confocal imaging system. Subcellular Fractionation, Immunoprecipitation, and Immunoblotting Jurkat cells were lysed as described (Villalba et al., 2000). For antigen-specific stimulation, in vitro-differentiated Th2 cells from AD10 TCR-transgenic mice were stimulated with PCC peptide-pulsed or nonpulsed CH27 lymphoma cells as APCs for 30 min at 37⬚C. Cells were lysed in 300 ␮l lysis buffer (20 mM Tris-HCl [pH 7.4], 2 mM MgCl2, 0.1 mM EDTA, 100 mM (NH4)2SO4, 30 mM ␤-glycerol phosphate, 1 mM Na3VO4, 0.75% Brij 58, and 10 ␮g/ml each aprotinin and leupeptin) for 20 min on ice. Insoluble materials were removed by centrifugation at 16,000⫻ g (15 min at 4⬚C). Subcellular fractionation and immunoprecipitation were performed as reported previously (Villalba et al., 2000). Following transfer to nitrocellulose membranes, the membranes were analyzed by immunoblotting. Blots were developed using an enhanced chemiluminescence (ECL) kit (Amersham), and signals were analyzed using the public domain NIH Image program. Luciferase Reporter Assay The Luc reporter gene driven by the human IFN␥ promoter (⫺346 to ⫹7) (Kaminuma et al., 2002) and the IL-4-Luc construct (⫺270 to ⫺12) (Pesch et al., 1996) was described. Jurkat-TAg cells were transfected with combinations of reporter plasmids (4 ␮g), a normalization control ␤-galactosidase (␤-Gal) reporter plasmid (2 ␮g), and SLAT or control (empty) expression vectors (10 ␮g). Luc assays were performed as described (Villalba et al., 2000). ICCS Th1 or Th2 cells or T cells stimulated with plate-bound anti-CD3 mAb (2C11; 5 ␮g/ml) and anti CD28 mAb (37.51; 5 ␮g/ml) for 8 hr were treated with 10 ␮g/ml brefeldin A for the final 2 hr of culture. Cells were harvested, washed twice with 1% BSA in PBS, fixed in 3.7% paraformaldehyde, washed again, resuspended in PBS buffer containing 0.5% saponin plus 1% BSA, and stained with FITC-conjugated anti-IFN␥ and PE-conjugated anti-IL-4 antibodies (Caltag, Burlingame, CA) for 30 min. Cells were washed twice, resuspended in 1% BSA in PBS, and analyzed on a FACScan. Differential Display, cDNA Library Construction, and RACE mRNA was purified from 4 day-cultured, in vitro-differentiated Th1 or Th2 cells using Fast Track (Invitrogen). The mRNA was reverse transcribed with degenerate oligo-dT primers (5⬘-T12 MA-3⬘, 5⬘-T12 MT-3⬘, 5⬘-T12 MG-3⬘, and 5⬘-T12 MC-3⬘, where M represents a mixture of A, G, and C). Different combinations of primer sets composed of four anchored oligo-dT primers and five short arbitrary primers (AP-1, 5⬘-AGCCAGCGAA-3⬘; AP-2, 5⬘-GACCGCTTGT-3⬘; AP-3, 5⬘-AGG TGACCGT-3⬘; AP-4, 5⬘-GGTACTCCAC-3⬘; and AP-5, 5⬘-GTTGCG ATCC-3⬘) were used in standard PCR. Products were analyzed on a 6% sequencing gel. A Th2 cDNA library was prepared from differentiated AD10 Th2 cells restimulated on day 8 with peptide plus irradiated B10.A splenocytes in the absence of cytokines. Total RNA was prepared 3 days later. Poly A⫹ RNA was isolated on oligo-dT magnetic beads (CPG). cDNA synthesis and library construction were carried out using the Marathon cDNA Amplification Kit (Clontech). Library synthesis included adaptor ligation at both ends of the cDNAs. 3⬘- and 5⬘RACE reactions were performed using two primers based on the sequence of Cl-45, which were designed to include a 30 bp overlap between the 3⬘- and 5⬘-RACE products: AGCACCAACGTGAAA CACTGGAATGTCCAG (5⬘) and CTGGACATTCCAGTGTTTCAGGTT GGTGCT (3⬘). The RACE products were used as templates to isolate the full-length cDNA (Figure 2A). RT-PCR and Northern Blot Analysis Total RNA was isolated from purified peptide/APC-stimulated T cells using an RNeasy Kit (Qiagen). RT-PCR was performed using the Access RT-PCR System (Promega) with the following primers: SLAT, CCCTGTTCTCCGATGCTGTGTTTAC (5⬘) and GCTGAGATGGAGCT GAAGAAG (3⬘); IL-4, GACTCATTCATGGTGCAGCTTATCG (5⬘) and CGAAGAACACCACAGAGAGTGAGCT (3⬘); IFN-␥, GTCACAGTTTT

CAGCTGTATAGGG (5⬘) and AGCGGCTGACTGAACTCAGATTGTAG (3⬘); ␤-actin, TAAAACGCAGCTCAGTAACAGTCCG (5⬘) and TGG AATCCTGTGGCATCCATGAAAC (3⬘). Ten micrograms of each PCR product was separated on 1.2% agarose/6% formaldehyde gels, transferred onto nylon membrane in SSC overnight, and covalently bound using a UV crosslinker. Northern blots were performed according to standard protocols and hybridized with radiolabeled SLAT or G3PDH cDNA probes. Retroviral Constructs and Transduction The SLAT cDNA was subcloned into the EcoRI site of the retroviral vector pMIG. Platinum-E packaging cells (Morita et al., 2000) (.75 ⫻ 106 ) were plated on 60 mm dishes in 3 ml DMEM with 10% FBS. Following overnight incubation, the cells were transfected with 3 ␮g retroviral plasmid DNA using FuGENE 6 transfection reagent (Roche). After 20 hr, the medium was replaced with DMEM plus 10% FBS. Cultures were maintained for 24 hr, the retroviral supernatant was harvested, supplemented with 5 ␮g/ml polybrene, and used to infect CD4⫹ T cells that had been preactivated with anti-CD3, anti-CD28, and 100 U/ml recombinant IL-2 for 18 hr. Plates were centrifuged for 1 hr (2000 rpm, 33⬚C) and incubated for 8 hr at 33⬚C and for 16 hr at 37⬚C, followed by two additional retroviral infections at daily intervals. The medium was exchanged with RPMI-1640 medium supplemented with 10% FBS plus 20 U/ml recombinant IL-2. Acknowledgments We thank D. Fang, H. Gray, O. Kaminuma, T. Kawakami, T. Kitamura, F.-T. Liu, Y.-C. Liu, C. Staib, and K. Sugie for generously providing cells and reagents and for helpful technical advice, and N. Weaver for manuscript preparation. This work was supported by National Institutes of Health grant CA35299 (A.A.) and by an Uehara Memorial Foundation grant (Y.T.). This is publication number 485 from the La Jolla Institute for Allergy and Immunology. Received: July 29, 2003 Revised: January 23, 2003 References Abbas, A.K., Murphy, K.M., and Sher, A. (1996). Functional diversity of helper T lymphocytes. Nature 383, 787–793. al-Ramadi, B.K., Nakamura, T., Leitenberg, D., and Bothwell, A.L.M. (1996). Deficient expression of p56lck in Th2 cells leads to partial TCR signaling and a dysregulation in lymphokine mRNA levels. J. Immunol. 157, 4751–4761. Bi, K., Tanaka, Y., Coudronniere, N., Hong, S., Sugie, K., van Stipdonk, M.J.B., and Altman, A. (2001). Antigen-induced translocation of PKC-␪ to membrane rafts is required for T cell activation. Nat. Immunol. 2, 556–563. Blander, J.M., Sant’Angelo, D.B., Bottomly, K., and Janeway, C.A., Jr. (2000). Alteration at a single amino acid residue in the T cell receptor ␣ chain complementarity determining region 2 changes the differentiation of naive CD4 T cells in response to antigen from T helper cell type 1 (Th1) to Th2. J. Exp. Med. 191, 2065–2074. Borggrefe, T., Wabl, M., Akhmedov, A.T., and Jessberger, R. (1998). A B-cell-specific DNA recombination complex. J. Biol. Chem. 273, 17025–17035. Borggrefe, T., Masat, L., Wabl, M., Riwar, B., Cattoretti, G., and Jessberger, R. (1999). Cellular, intracellular, and developmental expression patterns of murine SWAP-70. Eur. J. Immunol. 29, 1812– 1822. Borggrefe, T., Keshavarzi, S., Gross, B., Wabl, M., and Jessberger, R. (2001). Impaired IgE response in SWAP-70-deficient mice. Eur. J. Immunol. 31, 2467–2475. Chan, A.C., Iwashima, M., Turck, C.W., and Weiss, A. (1992). ZAP70: a 70 kd protein-tyrosine kinase that associates with the TCR ␨ chain. Cell 71, 649–662. Chu, D.H., Morita, C.T., and Weiss, A. (1998). The Syk family of protein tyrosine kinases in T-cell activation and development. Immunol. Rev. 165, 167–180.

SLAT, a Th2-Regulating Adapter Protein 413

Constant, S.L., and Bottomly, K. (1997). Induction of Th1 and Th2 CD4⫹ T cell responses: the alternative approaches. Annu. Rev. Immunol. 15, 297–322. Constant, S., Pfeiffer, C., Woodard, A., Pasqualini, T., and Bottomly, K. (1995). Extent of T cell receptor ligation can determine the functional differentiation of naive CD4⫹ T cells. J. Exp. Med. 182, 1591– 1596. Del Prete, G.F., De Carli, M., Mastromauro, C., Biagiotti, R., Macchia, D., Falagiani, P., Ricci, M., and Romagnani, S. (1991). Purified protein derivative of Mycobacterium tuberculosis and excretory-secretory antigen(s) of Toxocara canis expand in vitro human T cells with stable and opposite (type 1 T helper or type 2 T helper) profile of cytokine production. J. Clin. Invest. 88, 346–350. Dent, A.L., Hu-Li, J., Paul, W.E., and Staudt, L.M. (1998). T helper type 2 inflammatory disease in the absence of interleukin 4 and transcription factor STAT6. Proc. Natl. Acad. Sci. USA 95, 13823– 13828. Di Bartolo, V., Me`ge, D., Germain, V., Pelosi, M., Dufour, E., Michel, F., Magistrelli, G., Isacchi, A., and Acuto, O. (1999). Tyrosine 319, a newly identified phosphorylation site of ZAP-70, plays a critical role in T cell antigen receptor signaling. J. Biol. Chem. 274, 6285–6294. Dong, C., and Flavell, R.A. (2001). Th1 and Th2 cells. Curr. Opin. Hematol. 8, 47–51. Dong, C., Davis, R.J., and Flavell, R.A. (2001). Signaling by the JNK group of MAP kinases. J. Clin. Immunol. 21, 253–257. Faith, A., Akdis, C.A., Akdis, M., Joss, A., Wymann, D., and Blaser, K. (1999). An altered peptide ligand specifically inhibits Th2 cytokine synthesis by abrogating TCR signaling. J. Immunol. 162, 1836–1842. Ferber, I.A., Lee, H.J., Zonin, F., Heath, V., Mui, A., Arai, N., and O’Garra, A. (1999). GATA-3 significantly downregulates IFN-␥ production from developing Th1 cells in addition to inducing IL-4 and IL-5 levels. Clin. Immunol. 91, 134–144. Finkelman, F.D., Morris, S.C., Orekhova, T., Mori, M., Donaldson, D., Reiner, S.L., Reilly, N.L., Schopf, L., and Urban, J.F., Jr. (2000). Stat6 regulation of in vivo IL-4 responses. J. Immunol. 164, 2303– 2310. Fitch, F.W., McKisic, M.D., Lancki, D.W., and Gajewski, T.F. (1993). Differential regulation of murine T lymphocyte subsets. Annu. Rev. Immunol. 11, 29–48. Gajewski, T.F., Schell, S.R., and Fitch, F.W. (1990). Evidence implicating utilization of different T cell receptor-associated signaling pathways by Th1 and Th2 clones. J. Immunol. 144, 4110–4120.

of PKC ␪ within the immunologic synapse. Proc. Natl. Acad. Sci. USA 99, 9369–9373. Iwashima, M., Irving, B.A., van Oers, N.S., Chan, A.C., and Weiss, A. (1994). Sequential interactions of the TCR with two distinct cytoplasmic tyrosine kinases. Science 263, 1136–1139. Jankovic, D., Kullberg, M.C., Noben-Trauth, N., Caspar, P., Paul, W.E., and Sher, A. (2000). Single cell analysis reveals that IL-4 receptor/Stat6 signaling is not required for the in vivo or in vitro development of CD4⫹ lymphocytes with a Th2 cytokine profile. J. Immunol. 164, 3047–3055. Kaminuma, O., Elly, C., Tanaka, Y., Mori, A., Liu, Y.-C., Altman, A., and Miyatake, S. (2002). Vav-induced activation of the human IFN-␥ promoter is mediated by upregulation of AP-1 activity. FEBS Lett. 514, 153–158. Kane, L.P., Lin, J., and Weiss, A. (2000). Signal transduction by the TCR for antigen. Curr. Opin. Immunol. 12, 242–249. Kaplan, M.H., Wurster, A.L., and Grusby, M.J. (1998). A signal transducer and activator of transcription (Stat)4-independent pathway for the development of T helper type 1 cells. J. Exp. Med. 188, 1191–1196. Kaye, J., Vasquez, N.J., and Hedrick, S.M. (1992). Involvement of the same region of the T cell antigen receptor in thymic selection and foreign peptide recognition. J. Immunol. 148, 3342–3353. Kim, J.I., Ho, I.C., Grusby, M.J., and Glimcher, L.H. (1999). The transcription factor c-Maf controls the production of interleukin-4 but not other Th2 cytokines. Immunity 10, 745–751. Kumar, V., Bhardwaj, V., Soares, L., Alexander, J., Sette, A., and Sercarz, E. (1995). Major histocompatibility complex binding affinity of an antigenic determinant is crucial for the differential secretion of interleukin 4/5 or interferon ␥ by T cells. Proc. Natl. Acad. Sci. USA 92, 9510–9514. Li, B., Yu, H., Zheng, W., Voll, R., Na, S., Roberts, A.W., Williams, D.A., Davis, R.J., Ghosh, S., and Flavell, R.A. (2000). Role of the guanosine triphosphatase Rac2 in T helper 1 cell differentiation. Science 288, 2219–2222. Liang, P., and Pardee, A.B. (1992). Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971. Madrenas, J., Wange, R.L., Wang, J.L., Isakov, N., Samelson, L.E., and Germain, R.N. (1995). ␨ phosphorylation without ZAP-70 activation induced by TCR antagonists or partial agonists. Science 267, 515–518.

Glimcher, L.H., and Murphy, K.M. (2000). Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 14, 1693–1711.

Masat, L., Caldwell, J., Armstrong, R., Khoshnevisan, H., Jessberger, R., Herndier, B., Wabl, M., and Ferrick, D. (2000). Association of SWAP-70 with the B cell antigen receptor complex. Proc. Natl. Acad. Sci. USA 97, 2180–2184.

Hannier, S., Bitegye, C., and Demotz, S. (2002). Early events of TCR signaling are distinct in human Th1 and Th2 cells. J. Immunol. 169, 1904–1911.

Morita, S., Kojima, T., and Kitamura, T. (2000). Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 7, 1063–1066.

Ho, I.C., Hodge, M.R., Rooney, J.W., and Glimcher, L.H. (1996). The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85, 973–983.

Mosmann, T.R., Cherwinski, H.M., Bond, M.W., Giedlin, M.A., and Coffman, R.L. (1986). Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136, 2348–2357.

Ho, I.C., Lo, D., and Glimcher, L.H. (1998). c-maf promotes T helper cell type 2 (Th2) and attenuates Th1 differentiation by both interleukin 4-dependent and -independent mechanisms. J. Exp. Med. 188, 1859–1866. Hosken, N.A., Shibuya, K., Heath, A.W., Murphy, K.M., and O’Garra, A. (1995). The effect of antigen dose on CD4⫹ T helper cell phenotype development in a T cell receptor-␣␤-transgenic model. J. Exp. Med. 182, 1579–1584.

Murphy, K.M., Ouyang, W., Farrar, J.D., Yang, J., Ranganath, S., Asnagli, H., Afkarian, M., and Murphy, T.L. (2000). Signaling and transcription in T helper development. Annu. Rev. Immunol. 18, 451–494. O’Garra, A., and Murphy, K. (1994). Role of cytokines in determining T-lymphocyte function. Curr. Opin. Immunol. 6, 458–466.

Hotfilder, M., Baxendale, S., Cross, M.A., and Sablitzky, F. (1999). Def-2, -3, -6 and -8, novel mouse genes differentially expressed in the haemopoietic system. Br. J. Haematol. 106, 335–344.

Oliver, J.M., Burg, D.L., Wilson, B.S., MaLaughlin, J.L., and Geahlen, R.L. (1994). Inhibition of mast cell Fc⑀RI-mediated signaling and effector function by the Syk-selective inhibitor, piceatannol. J. Biol. Chem. 269, 29697–29703.

Huang, J., Sugie, K., La Face, D.M., Altman, A., and Grey, H.M. (2000). TCR antagonist peptides induce formation of APC-T cell conjugates and activate a Rac signaling pathway. Eur. J. Immunol. 30, 50–58.

Ouyang, W., Ranganath, S.H., Weindel, K., Bhattacharya, D., Murphy, T.L., Sha, W.C., and Murphy, K.M. (1998). Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity 9, 745–755.

Huang, J., Lo, P.F., Zal, T., Gascoigne, N.R., Smith, B.A., Levin, S.D., and Grey, H.M. (2002). CD28 plays a critical role in the segregation

Pearson, C.I., van Ewijk, W., and McDevitt, H.O. (1997). Induction of apoptosis and T helper 2 (Th2) responses correlates with peptide

Immunity 414

affinity for the major histocompatibility complex in self-reactive T cell receptor transgenic mice. J. Exp. Med. 185, 583–599. Pesch, J., Brehm, U., Staib, C., and Grummt, F. (1996). Repression of interleukin-2 and interleukin-4 promoters by tumor suppressor protein p53. J. Interferon Cytokine Res. 16, 595–600. Rudd, C.E. (1999). Adaptors and molecular scaffolds in immune cell signaling. Cell 96, 5–8. Shinohara, M., Terada, Y., Iwamatsu, A., Shinohara, A., Mochizuki, N., Higuchi, M., Gotoh, Y., Ihara, S., Nagata, S., Itoh, H., et al. (2002). SWAP-70 is a guanine-nucleotide-exchange factor that mediates signalling of membrane ruffling. Nature 416, 759–763. Singh, R.A., Zang, Y.C., Shrivastava, A., Hong, J., Wang, G.T., Li, S., Tejada-Simon, M.V., Kozovska, M., Rivera, V.M., and Zhang, J.Z. (1999). Th1 and Th2 deviation of myelin-autoreactive T cells by altered peptide ligands is associated with reciprocal regulation of Lck, Fyn, and ZAP-70. J. Immunol. 163, 6393–6402. Sloan-Lancaster, J., Shaw, A.S., Rothbard, J.B., and Allen, P.M. (1994). Partial T cell signaling: altered phospho-␨ and lack of Zap70 recruitment in APL-induced T cell anergy. Cell 79, 913–922. Soede, R.D., Wijnands, Y.M., Van Kouteren-Cobzaru, I., and Roos, E. (1998). ZAP-70 tyrosine kinase is required for LFA-1-dependent T cell migration. J. Cell Biol. 142, 1371–1379. Szabo, S.J., Kim, S.T., Costa, G.L., Zhang, X., Fathman, C.G., and Glimcher, L.H. (2000). A novel transcription factor, T-bet, directs TH1 lineage commitment. Cell 100, 655–669. Tamura, T., Yanagida, T., and Nariuchi, H. (1993). Difference in signal transduction pathway for IL-2 and IL-4 production in T helper 1 and T helper 2 cell clones in response to anti-CD3. J. Immunol. 151, 6051–6061. Tamura, T., Nakano, H., Nagase, H., Morokata, T., Igarashi, O., Oshimi, Y., Miyazaki, S., and Nariuchi, H. (1995). Early activation signal transduction pathways of Th1 and Th2 cell clones stimulated with antiCD3. Roles of protein tyrosine kinases in the signal for IL-2 and IL-4 production. J. Immunol. 155, 4692–4701. Villalba, M., Coudronniere, N., Deckert, M., Teixeiro, E., Mas, P., and Altman, A. (2000). Functional interactions between Vav and PKC␪ are required for TCR-induced T cell activation. Immunity 12, 151–160. Williams, B.L., Schreiber, K.L., Zhang, W., Wange, R.L., Samelson, L.E., Leibson, P.J., and Abraham, R.T. (1998). Genetic evidence for differential coupling of Syk family kinases to the T-cell receptor: reconstitution studies in a ZAP-70-deficient Jurkat T-cell line. Mol. Cell. Biol. 18, 1388–1399. Williams, B.L., Irvin, B.J., Sutor, S.L., Chini, C.C., Yacyshyn, E., Bubeck Wardenburg, J., Dalton, M., Chan, A.C., and Abraham, R.T. (1999). Phosphorylation of Tyr319 in ZAP-70 is required for T-cell antigen receptor-dependent phospholipase C-␥1 and Ras activation. EMBO J. 18, 1832–1844. Zhang, D.H., Cohn, L., Ray, P., Bottomly, K., and Ray, A. (1997). Transcription factor GATA-3 is differentially expressed in murine Th1 and Th2 cells and controls Th2-specific expression of the interleukin-5 gene. J. Biol. Chem. 272, 21597–21603. Zhang, W., Sloan-Lancaster, J., Kitchen, J., Trible, R.P., and Samelson, L.E. (1998). LAT: the ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular activation. Cell 92, 83–92. Zhang, D.H., Yang, L., Cohn, L., Parkyn, L., Homer, R., Ray, P., and Ray, A. (1999). Inhibition of allergic inflammation in a murine model of asthma by expression of a dominant-negative mutant of GATA-3. Immunity 11, 473–482. Zheng, W., and Flavell, R.A. (1997). The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89, 587–596. Accession Numbers The sequence of mouse SLAT has been submitted to the NCBI Genbank database (accession number AF329497). This sequence is identical to the recent sequence of mouse Def6 submitted independently (accession number NM_027185).