Symmetrical transcription in bacteriophage φ29 DNA

Biochimie 70 (1988) 605-609 (~ Socirt6 de Chimie biologique/Elsevier, Paris

605

Symmetrical transcription in bacteriophage q 29 DNA Isabel BARTHELEMY, Rafael P. M E L L A D O and Margarita SALAS* Centro de Biologfa Molecular (CSIC-UAM), Universidad Autrnoma Canto Blanco, 28049 Madrid, Spain (Received 30-6-1987, accepted after revision 3-9-1987)

Summary m Transcription of some early genes occurring during q~29infection in the absence but not in the presence of chloramphenicol has been shown to depend upon the synthesis of the viral protein p4, the positive regulator of late transcription. In addition, the early promoter B 1, responsible for early transcription on the late region of the tp29 genome, has been accurately mapped by nuclease $1 protection experiments. The deduced promoter sequence shares homology with that of the other early ~p29 promoters previously described and with the consensus sequence of the promoters recognized by the Bacillus subtilis tr 43-RNA polymerase. ~p29transcription / early promoter functions / transcriptional control

Introduction The bacteriophage q~29 promoters have been identified and accurately mapped by S~ protection experiments along the viral genome [1]. The I_J'l~l/--It

~li.,~lUl.,lll~.,lJ.,~

IL/l

131.11 U I

LIllI~

~/.tff

]JIILIIIlIILILI~Ib,j

except that of the early one, B1, have been determined and all of them were shown to function both in vivo and in vitro [2, 3]. The main late promoter, A3, is positively regulated by the product of the viral gene 4 [4]. The early promoter A2a shares some homology with the late one [3]. This and the fact that the transcripts initiated at the A2a promoter are present only when Bacillus subtilis is infected with tp29 in the absence of chloramphenicol [1] suggested that it could be regulated by protein p4, as is the A3 late promoter. The early promoter B2 directs the synthesis of mRNA in the opposite direction and on the opposite strand of the DNA than the late A3 promoter, and a possible regulatory role for the B2 transcripts has been considered [1]. $1 mapping experiments reported here add further evidence for the regulation of the A2a promoter by

*Author to whom correspondence should be addressed.

protein p4 and enable us to accurately locate the early promoter B 1, also responsible for the existence of symmetrical transcription on the tp29 genome.

Materials and methods Bacteria, bacteriophage strains, reagents and enzymes B. subtilis 11ONA trp- spoA- su- was used as the host for the growth of wild type phage q~29or the non-sense mutant sus4(56) [5]. Restriction endonucleases were from New England BioLabs, Inc., Aspergillus oryzae nuclease SI was from PL Biochemicals, Inc. Calf intestinal alkaline phosphatase and T4 polynucleotide kinase were from Boehringher Mannheim Biochemicals. [~/-32p]ATP (---3000 Ci/mmol) was from Amersham International, plc. Nucleic acid manipulations;S1 mapping Total RNA from B. subtilis infected with ~29, both in the presence or absence of chloramphenicol, was obtained as described previously [1]. tp29 DNA was prepared as described by Sogo et al. [4]. q~29DNA

600

I. Barthelemy et ai.

fragments produced by the indicated restriction enzymes were treated with alkaline phosphatase, labeled at their 5' ends by incubation with [y-32p]ATP and poiynucleotide kinase and their strands separated and purified as described earlier [1]. For the S~ mapping, mixtures containing the appropriate end-labeled DNA strand and 25-50 ~g of RNA were denatured, hybridized and digested with nuclease St, as indicated by Barthelemy et al. [1]. The protected DNA-RNA hybrids were analyzed by electrophoresis in denaturing polyacrylamide gels [61.

+CM -CM -CM

A

wt

wt

sus4

ELEL

E L

~...~ A-E 690-570--,~

S

--

--

--

.mq

H

I m-~d

Results and Discussion t, mM

The activity o f the early A2a promoter is dependent upon protein p4 in vivo When tp29 infects B. subtilis in the presence of chioramphenicol, only early RNAs are synthesized, whereas in the absence of the drug, both early and late RNAs are produced. The Hindlll H fragment of tp29 D N A contains the A2a, A2b and A2c early promoters and the main late promoter A3, the A2b promoter being the one where in vivo early transcription mainly starts. It has been shown that in the absence of chloramphenicol, transcription of the early and late strands of the HindllI H fragment from the A2a and A3 promoters, respectively, could occur, whereas in the presence of the drug, basically no transcription from the A2a or A3 promoters was detected [1]. To check whether the viral protein p4 would also control transcription initiation at the A2a promoter, RNA was extracted from cell cultures infected with wild type phage ~p29, both in the absence or presence of chloramphenicol, and from cell cultures infected with the tp29 nonsense mutant in gene 4, sus4(56) [5]. The Hindlll H fragment from tp29 DNA was labeled at its 5' ends, the separated strands were hybridized to the different RNAs and the hybrids digested with nuclease Sl. The protected oligodeoxynucleotides were fractionated in denatunng 4% polyacrylamide gels (Fig. 1). As expected, mainly an oligonucleotide of 570 bases was protected from the early strand of the HindlIl H fragment when hybridized to RNA isolated from cells infected with ~p29in the presence of chioramphenicol, corresponding to transcription initiated at the A2b promoter, whereas mainly an oligonucleotide of 78 bases was protected from the late strand of the fragment when hybridized

re-

•

Ii --N

690nt 570nt 1~5021 Hindlll

[-- ....

A Z c l A ~ I A311AZal H i n d ~

152611

Fig. 1. Stimulation of the early A2a promoter in vivo by the product of gene 4. A. Transcription initiation within the 763 bp long ~p29HindIIl H fragment. E and L refer to early and late DNA strands, respectively. +CM and - C M indicate ff the ~p29infection was carried out i'a the presence or absence of chloramphenicol, respectively, wt and sus4 indicate whether the infection was done ~,ith wild type phage ~p29or with the non-sense mutant sus4(56). Approximately 25/~g of RNA extracted 30 min after infection were used in the hybridization reactions. Letters at the right margin are the HindIII fragments of ~p29 DNA carried as size markers. Figures at the left margin are the sizes of the $1 protected oligonucleotides. B. Location of the tp29 promoters within the Hindlil H fragment of ~p29 DNA. Figures between parentheses indicate the positions of the endonuclease sites on the tp29 genome [7]. Arrows indicate the direction and extent of transcription. Vertical bars are ~29 promoters.

to the RNA made in the absence of the drug, corresponding to transcription initiated at the A3 promoter. In the latter case, an oligonucleotide of 690 bases was also protected from the early strand of the Hindlll H fragment, corresponding to transcription initiated at the A2a promoter. Neither this oligonucleotide nor the 78 base long one were protected from St diges-

Symmetrical transcription in ~p29DNA tion when RNA from cells infected with the sus4 mutant was used, clearly showing the dependence upon protein p4 for the transcription initiation at the A2a promoter. Thus, protein p4 would not only regulate transcription of the late genes in ~o29 DNA, but could also be a safety mechanism for the transcription of its own gene, as well as those other early genes that could be needed at late stages of ~029 infection (see Fig. 4). An oligonucleotide with the same mobility as the entire HindIII H fragment was also protected from the early strand of the fragment when hybridized to RNA extracted from ce!!s infected, either with wild type phage ~o29 or the sus4

A

,E 380--

607

mutant (Fig. 1). To locate more precisely the initiation of this transcript in the ~029 genome, the 641 bp long A c c I - BclI fragment, spanning from position 5063 to 5703 of the viral DNA [7], was labeled at its 5' ends and the separated strands hybridized to RNA extracted from cqlls infected with wild type phage tp29. An oligonucleotide around 380 bases long was protected from S~

A

T

N

qlf-K

-'

B

,w --L

163-1t.Snt

(107/,2)Hindl[

I ...... |'ar ! Hinf 1.315)

C 029 e~ly ¢o~sus

B 380nt

(5063) AccIl- A3111A2a

I npa| ffUl3a)

.~

~ TTGACA TATAAT Blpromoter GATCTTGTTCATTTTCTCCAATAATGTAAACTTTCAT

qp-M

A

-Ik5

,,

Itinf 111568)

-4

-I Bc! 115703)

Fig. 2. Location of an early transcript initiating upstream from the HindIII H fragment. &. Oligonucleotide protected from SI digestion by RNA isolated from cells infected in the presence of chloramphenicol !5 min after infection. E and L refer to early and late DNA strands, respectively, of the A c c I - B c l l fragment. Letters at the right margin are the HindIII fragments carried as size markers. The size of the protected oligonucleotide is indicated at the left. B. Physical map of the ~29 DNA region encoding the transcript. Figures between parentheses indicate the positions of the endonuclease sites on the ~029 genome [7]. Vertical solid bars are ~29 promoters; the vertical hatched bar indicates the initiation or processing site. Arrows indicate the direction and extent of transcription; the broken line ended by an arrow indicates the presumed early transcription initiated upstream from the depicted fragment.

TTGACAAA

TGNTANAATAG

Fig. 3. Precise location of the transcripts initiating close to the B1 binding ~ite. A. Transcription initiation within the 253 bp long Hinfl fragment of q~29 DNA containing the B1 site. a. Product of digestion with nuclease S~ after hybridization of the early strand of the 253 bp long Hinfl fragment with RNA extracted 15 rain after B. subtilis infection with ,029 in the presence of chioramphenicol. Figures at the left margin are the size of the protected oligodeoxynucleotides. Sequencing reactions are from the Hindll fragment comprised between nucleotides 10732 and 11043 of q~29 DNA and were done as indicated by Maxam and Gilbert [6]. The sizes of the protected oligonucleotides are corrected by the nucleotide difference in mobility relative to oligodeoxynucleotides generated by chemical sequencing reactions [11]. B. Physica! map of the region of q,29 DNA containing the B 1 promoter. Figures between parentheses are the positions of the endonuclease sites on the q~29 genome. The vertical bar indicates the BI promoter. The arrow indicates the direction and extent of transcription within the Hinfl subfragment (see text). C. The consensus sequence for the promoters recognized by the B. subtilis or 43-RNA polymerase is compared with that of the BI promoter of phage q~29and with the consensus sequence derived for the ¢29 early promoters [2].

1. Barthelemy et al.

608

digestion (Fig. 2). The DNA sequence corresponding to that region of the ~p29 genome [7] showed no features in common with the sequences derived for the ~p29promoters [2, 3]. Thus, this transcript was considered to be a product of processed early transcripts initiated further upstream, something that has been found before in q~29 [1, 2].

compared with the consensus sequence of the q~29 early promoters and of those recognized by B . s u b t i l i s or 43-RNA polymerase (Fig. 3C). Fig. 4 summarizes our current knowledge of ~029 transcription at early and late times after infection. Symmetrical transcription at the late region of q~29 DNA takes place from the early promoters B1 and B2. Precise termination points for the B2 transcripts have been determined (TB1, TB2), although some reading through also takes place [9]. No precise termination sites for the transcription initiated at the B 1 site have been found [9]; thus processing of this symmetrical transcription could give rise to transcripts of different lengths that could eventually modulate the ~029 late gene expression at the post-transcriptional level as anti-sense RNA, a mechanism that occurs naturally in E. coli [10]. Experiments to determine whether this negative regulation takes place are under way.

Early transcription within the q~29late region Previous experiments showed that early transcription initiating within the late region of q~29 DNA occurred in vivo close to the B. subtilis RNA polymerase binding sites B1 and B2 [1]. The B2 promoter has been precisely located on the q~29 genome and its sequence determined [2]. To accurately map the initiation of transcription close to the B I binding site, the Hinfl fragment spanning from position 11315 to 11568 of ~p29 DNA [8] was radioactively labeled at its 5' ends and the separated strands hybridized to the RNA extracted from cells infected with wild type phage q~29in the presence of chloramphenicol. An oligodeoxynucleotide 143-145 bases long was protected from SI digestion. Its precise site was determined by fractionation of the protected oligonucleotide side by side with a set of DNA sequencing reactions (Fig. 3A). The sequence of the promoter responsible for this transcription could be derived from the viral DNA sequence data and it is also shown and

1 ,

A

,'

2 3 ~567 I! . . . .

~!'

iiii i

i

8 8.5 9 . i

i |

,,,,

: i

Early genes

: ,

Acknowledgments This investigation has been aided by Research Grant 2 RO1 GM27242-07 from the National Institutes of Health, by grant no. 3325 from the Comisi6n Asesora para el Desarrollo de la Investigaci6n Cientffica y T6cnica and by a grant from Fondo de Investigaciones Sanitarias. I.B. is the recipient of a Fellowship from the Spanish Research Council.

10 11

12

13 1L, 15 16

',

:

',

I

I

I

,

]

,

,

l

l A1

ml A'2c ~,2b/~3 ~2a

I

..~

=

Late genes

TA1

L

17

I

Early gene TB2 TB1

I Ol

TD1

I B2

I Cl

I [2

D

TD1

Fig. 4. Genetic and transcriptional maps of ~,29 DNA. A. The genetic map is derived from that of Mellado et ai. [5]. B. The transcriptional map is derived from those of Barthelemy et al. [1,9]. The vertical bars indicate the 029 promoters that have been found to initiate both in vivo and in vitro [3]; arrows indicate the direction and extent of transcription. L and H indicate light and heavy ~29 DNA strands, respectively. A1, A2a, A2b, A2c, A3, B1, B2, C1 and C2 are ~o29protnoters; TA1, TBI, TB2 and TDI are transcription termination signals. Broken lines indicate undefined transcription initiation and termination points.

Symmetrical transcription in 029 D N A

References 6 1 Barthelemy I., Salas M. & Mellado R. P. (1986) J. Virol. 60, 874-879 2 Mellado R. P., Barthelemy I. & Salas M. (1986) J. Mol. Biol. 191,191-197 3 Mellado R. P., Barthelemy I. & Salas M. (1986) Nucleic Acids Res. 14, 4731-4741 4 Sogo J. M., Inciarte M. R., Corral J., Vifiuela E. & Salas M. (1979) J. Mol. Biol. 127, 411-436 5 Meilado R. P., Moreno F., Vifiuela E., Salas M.,

7 8 9 10 11

609

Reilly B. E. & Anderson D. L. (1976) J. Virol. 19,495-500 Maxam A. M. & Gilbert W. (1980) Methods Enzymol. 65,499-560 Yoshikawa H. & Ito J. (1982) Gene 17,323-335 Vl(:ek ~. & Pa(:es V. (1986) Gene 46, 215-225 Barthelemy I., Salas M. & Mellado R. P. (1987) J. Virol. 61, 1751-1755 Coleman J., Green P. J. & lnouye M. (1984) Cell 37, 429-436 Sollner-Webb B. & Reeder R. H. (1979) Cell 18, 485-489