3C

Neuron,

Vol.

13,885~898,

October,

1994,

Copyright

0

1994

by Cell

Press

Synaptic Targeting of Rabphilin3A, a Synaptic Vesicle Ca*+/Phospholipid-Binding Protein, Depends on rab3k13C Cai Li,* Kohji Takei,* Martin Ceppert,* Laurie Daniell,* Katinka SteniuQ Edwin R. Chapma@ Reinhard Jahn,§*t Pietro De Camilli,*f and Thomas C. Siidhof*+ *Department of Molecular Genetics +Howard Hughes Medical institute The University of Texas Southwestern Medical Center Dallas, Texas 75235 *Department of Cell Biology SDepartment of Pharmacology IlHoward Hughes Medical Institute Yale University School of Medicine New Haven, Connecticut 06510

Summary rab3A, a low molecular weight CTP-binding protein of synaptic vesicles with a putative function in synaptic vesicle docking, interacts in a CTP-dependent manner with rabphilin-3A, a peripheral membrane protein that binds Ca*+and phospholipids. W e now show that rabphilin3A is an evolutionarily conserved synaptic vesicle protein that is attached to synaptic vesicle membranes via its N terminus and exhibits a heterogeneous distribution among synapses. In rab3A-deficient mice, rabphilin3A is decreased in synapses belonging to neurons that primarily express rab3A and accumulates in the perikarya of these neurons. In contrast, neurons expressing significant levels of rab3C still contain normal levels of rabphilin-3A in a synaptic pattern, and rabphilin-3A binds rab3C in vitro. These results suggest that analogous to the membrane recruitment of raf by ras, rab3A and rab3C may function in recruiting rabphilin-3A to the synaptic vesicle membrane in a CTP-dependent manner. Introduction rab3A is a low molecular weight GTP-binding protein from brain that is highly concentrated on synaptic vesicles (Touchot et al., 1987; Matsui et al., 1988; Fischer von Mollard et al., 1990). rab3A is posttranslationally geranyl geranylated at its C terminus (Farnsworth et al., 1991). This hydrophobic modification confers properties of an intrinsic membrane protein onto this otherwise soluble protein (Farnsworth et al., 1991; Johnston et al., 1991). A significant portion of rab3A in brain is cytosolic in spite of the hydrophobic modification, probably because it is complexed to guanine nucleotide-dissociation inhibitor (GDI), a protein capable of enveloping the geranylgeranyl groups of rab proteins and dissociating them from membranes (Ullrich et al., 1993). Stimulation of nerve terminals causes dissociation of rab3A from synaptic vesicles, suggesting that the binding of rab3A to synaptic vesicles is state dependent (Fischer von Mallard et al., 1991). Together, these data suggest that rab3A

cycles in nerve terminals between a synaptic vesicleattached, GTP-bound form and a soluble GDP-bound form that is complexed to GDI. rabSC, a slightly larger and less abundant isoform of rab3A, is also on synaptic vesicles in brain and dissociates from them after exocytosis (Fischer von Mallard et al., 1994). Recently, studies of mice lacking rab3A have revealed a selective deficiency in synaptic vesicle recruitlment to release sites (Geppett et al., 1994), indicating a function for rab3A in ensuring efficient docking of synaptic vesicles. However, the mechanism of action of rab3A is unknown. Three rab3Ainteracting proteins ha,ve been characterized. GDI was identified by its ability to inhibit GDP dissociation from rab3A (Sasaki et al., 1990) but probablyfunctions in dissociating GDP-bound rab proteins from membranes and maintaining a !soluble pool of these proteins (Ullrich et al., 1993). Mlammalian suppressor of sec4 was cloned based on its ability to suppress sec4 mutations in yeast and bind to several rab proteins in vitro (Burton et al., 1993). Rabphilin3Awas discovered because of its GTP-dependent binding to rab3A (Shirataki et al., 1992,1993). Of these three proteins, GDI and mammalian suppressor of sec4 are likelyto be involved in multiple rab-dependent membrane trafficking steps, whereas the specificity of rabphilin-3A is unknown. Rabphilin3Acointains an N-terminal rab3A-binding region and a C-terminal domain that is homologous to synaptotagmiln (Perin et al., 1990) and binds Ca2+ and phospholipids (Yamaguchi et al., 1993). Rabphilin3A has a weak G ’TPase stimulating activity on rab3A and inhibits the stronger rabSAGTPase stimulating activity present in t:issue homogenates (Kishida et al., 1993), suggesting a potential role for rabphilin-3A in rab3A-mediated functions. However, the specificity of rabphilin-3A for rab proteins and its subcellular localization are unknown, making it difficult to formulate hypotheses regarding its function. W e have now addressed these questions and find that rabphilin-3A is a synaptic vesicle protein whose localization unexpectedly depends on the presence of rab3A or rab3C. Results Structure and Evolutionary Conservatioln of Rabphilin3A Although bovine rabphilin-3A is well characterized, most studies on mammalian synaptic transmission are performed in rodents. Therefore, we set out to characterizerat rabphilin-3Aand isolated rabphilin-3AcDNA clones from a rat brain cDNA library. Of more than ten clones isolated, eight clones were sequenced, and the rat rabphilin-3A amino acid sequence was deduced from their nucleotide sequence l(Figure la). No differences in the primary structures of the cDNA clones or evidence for alternative splicing was ob-

Neuron 666

Figure 1. Structure and Evolutionary servation of Rat Rabphilin-3A

b Rabphilin-3A

_,.,’ 35% ‘.,, 69%

ND

98% Cysteine-rich

70%

a ;“.q 35s/b ~ /35%

‘.

100%

97ii

b ,/---‘; :x:,’

c

38% ... . . . . . ~

Synaptotagmin

mains that probably bind Ca2+/phospholipids Wamaguchi etal., 1993). Pairwise comparisons 3A and synaptotagmin I reveal identities ranging from 32% to 40% as shown by dotted

served except for a single position, at which two of the five clones covering this region had a three amino acid insert with respect to the other three clones (residues266-268; Figure la). Since this sequencevariation was isolated multiple times, it is probably caused by alternative splicing. Alignment of the rat and bovine rabphilin-3A sequences revealed a high degree of overall sequence conservation but a strikingly uneven distribution of conserved and nonconserved residues (Figure la). At the N terminus, a short divergent sequence in the rabphilins is followed by a highly conserved region containing a cluster of nine cysteine residues, eight of which are arranged in four pairs of CxxC sequences that are typical for metal-binding sequences (see, for example, Quest et al., 1994; Figure 1, stippled). This conserved domain corresponds to the rab3hbinding region of rabphilin-3A (Shirataki et al., 1993), and it is possible that this domain has a coordinated metal ion, such as zinc. A poorly conserved sequence that is rich in small side chain amino acids (proline, glycine, and serine) and contains phosphorylation consensus sequences for CAMP-dependent protein kinase and Ca*+/calmodulin-dependent protein kinase II follows the conserved cysteine-rich domain. The C-terminal half of rabphilin is made up by two highly conserved

Con-

(a) Alignment of the rat and bovine rabphiIinJA sequences. Mismatches are identified by asterisks. Sequences are shown in single-letter amino acid code with hyphens indicating gaps, labeled on the left (R, rat; B, bovine), and numbered on the right. The conserved cysteine residues in the N-terminal domains are stippled. The three amino acids EQC (residue numbers 266268) are present in only some cDNA clones and absent from others, suggesting alternative splicing. The rat sequence was determined from the nucleotide sequence (GenBank accession number, U12571) of multiple overlapping cDNA clones; the bovine sequence is from Shirataki et al., 1993. (b) Domain structure of rabphilin-3t\; comparison to synaptotagmin I. The top bar shows the structure of rabphilin-3A with the degree of sequence identity between rat and bovine rabphilin indicated above each domain. The bottom bar depicts the domain structure of synaptotagmin (Perin et al., 1991), with the degree of sequence identity between rat and bovine synaptotagmin I shown below each domain (Davletov et al., 1993). Rabphilin-3A consists of three principal domains: a conserved cysteine-rich N terminus that probably binds rab3A, a middle domain that is not well conserved evolutionarily and has multiple consensus sequences for protein kinases, and a C terminus composed of two C, dobetween individual Cz domains of rabphilinlines.

CZ domains that are homologous to those of synaptotagmin (Perin et al., 1990) and presumably mediate theCa*+/phospholipid bindingactivityof rabphilin-3A (Yamaguchi et al., 1993). The sequence characteristics of rabphilin-3A allowed formulation of a domain model that can be compared to that of the homologous protein synaptotagmin (Figure lb). Both proteins are membrane proteins with two CZ domains in their C-terminal halves. In isoforms of synaptotagmin, the two C2 domains have distinct conserved sequence characteristics, suggesting an individual specialization of the first and second C2 domain (Geppert et al., 1991). Pairwise comparisons of individual CZ domains of synaptotagmins and rabphilin-3A demonstrated that they are approximately equally related, indicating that the conserved differences between individual C?:domains in the synaptotagmins are not maintained between synaptotagmins and rabphilin-3A. In addition, rabphilin3A contains a spacer sequence between the two C2 domains that is absent from synaptotagmins, and synaptotagmins have a longer C-terminal sequence than rabphilin3A. Therefore, the presence of two CZ domains in these two different proteins probably arose independently in evolution and may serve distinct purposes.

Targeting 887

of Rabphilin-3A

Depends

on rab3A/3C

Rab3A

Rab5

Figure 2. Binding

of rab Proteins

to Recombinant

Rabphilin9A

Bacterial recombinant glutathione S-transferase (CST, left lanes) or a GST-rabphilin fusion protein containing full-length rabphilin-3A (GST-Raph, right lanes) were attached to glutathione agarose beads and incubated with Triton X-100 solubilized brain homogenate in the presence of 3 m M Mg*+, 3 m M Ca2+, and 50 pM GTPTS. Bound proteins were then sequentially eluted with 5 m M EDTA and 5 m M EGTA. followed bv 5 m M EGTA in 1 M NaCI. and the eluates and resin were analyzed by SDS-PAGE and immunoblotting with antibodies’to rab3A, rablb, and rab5.

Biochemical Characterization of Rabphilin3A Using rat rabphilin-3A cDNAs, we produced recombinant fusion proteins of rabphilin with glutathione S-transferase (GST). These were used to raise antibodies against different domains of rabphilin3A and to investigate the rab-specificity of rabphilin3A. Previous experiments demonstrated that two rab3hinteracting molecules, GDI and mammalian suppressor of sec4, also interact with several other rab proteins (UIIrich et al., 1993; Burton et al., 1993). To evaluate hypotheses about rabphilin-3A function, it was -important to determine whether rabphilin-3A interacts promiscuously with many rab proteins. Therefore, we analyzed rab protein binding to immobilized recombinant rabphilin3A in the presence of GTP. Of three rab proteins tested, only rab3A bound, whereas rablb and rab5 did not (Figure 2). Rabphilin3A is a membrane protein (Shirataki et al., 1992), but its sequence does not predict a hydrophobic segment (see Figure 1). Therefore, we tested whether rabphilin-3A could be removed from the membrane by salt washes. Rabphilin-3A appeared to be membrane associated at low ionic strength, but most of it was solubilized by NaCl at concentrations of 0.25-0.5 M, suggesting, in agreement with previous studies (Shirataki et al., 1992), a weak interaction of rabphilin-3A with the membrane (data not shown). To gain further insight into the membrane association of rabphilin3A, we used partial proteolysis and antibodies raised against its N-terminal and C-terminal regions to test which part is bound. Rat brain

membranes were incubated either without additions or with trypsin, chymotrypsin, and WI protease and then separated into membrane and soluble fractions, both of which were analyzed by immunoblotting with the N-terminal and C-terminal antibodies. Incubation of the membranes in the absence of proteases caused limited proteolysis of rabphilin-3A (open arrows in Figure 3a). In the presence of proteases, rabphilin-3A fragments of up to 50 kDa could be detected in the soluble fraction with C-terminal antibodies, whereas N-terminal antibodies detected proteolytic breakdown products as small as 20 kDa that were associated with the membrane (closed arrows in Figure 3a). This result suggests that rabphilin-3A is selectively bound to membranes via a small N-terminal sequence. The membraneassociation of rabphilin-3Acould involve a hydrophobic modification, especially in view of the conserved cysteine residues in the N-terminal domain of rabphilin3A that could be palmitoylated or isoprenylated. To investigate this plossibility, extraction with Triton X-114 was used to determine whether rabphilin-3A had hydrophobic properties, and synaptosomes were labeled with palmitic acid to test for palmitoylation. Both experiments failed to detect hydrophobic modifications on rabphilin-3A (Figure 3b and data not shown). localization of Rabphilin-3A in Neurons The localization of rabphilin-3A in rat brain was analyzed by immunofluorescence microscopy. In all regions of the nervous system examined,, rabphilin-3A

Neuron 888

a IFraction) Tj S/P/S\

P!Sj PiSiP N-Terminal

Antibody

C-Terminal Anti body

Triton-X-

b

1 14 Extraction

Rabphilin Rab3A Figure 3. Membrane

Attachment

of Rabphilin3A

(a) Controlled partial proteolysis of rabphilin-3A to map its membrane-binding domain. Rat brain membranes were incubated without additions or with trypsin, chymotrypsin, or V8 protease as indicated and separated into soluble (S) and pellet fractions (P) by centrifugation. Fractions and total starting material (T) were analyzed by SDS-PAGE and immunoblotting using antibodies to N-terminal and C-terminal domains of rabphilin-3A. Open arrows point to rabphilin-3A fragments generated by endogenous proteases. Closed arrows point to the smallest proteolytic fragments still associated with the membrane after proteolysis (top) or the largest fragments released into the buffer after proteolysis (bottom). A 15-20 kDa fragment (trypsin and chymotrypsin digestion) that reacts with the N-terminal antibody is the smallest fragment bound to the membrane, whereas a 55 kDa WI fragment reactive with the C-terminal antibody is the largest released fragment. Numbers on the left indicate positions of molecular weight markers. (b) Rabphilin3A is not attached to membranes by a hydrophobic modification. Brain homogenates were extracted with Triton X-114 (Bordier, 1981), and fractions were analyzed by immunoblotting. rab3A is modified by geranyl geranylation and partitions largely into the detergent fraction, whereas rabphilin3A does not. The presence of rabphilin-3A in the pellet indicates that rabphilin3A is partially insoluble in Triton X-114.

Targeting 889

of Rabphilin3A

Depends

Figure 4. lmmunofluorescence

on rab3AI3C

Localization

of Rabphilin3A

in Rat Brain

Double immunofluorescence micrographs comparing the distributions of rabphilin-3A, rab3A, and synaptophysin. (a and b) Sections of cerebellar cortex double labeled for rabphilin-3A and rab3A. Both fields exhibit a typical synaptic : pattern, but subpopulations of nerve terminals are positive for only one of the two antigens. Small arrows (a) point to intensely ratbp rhilin-positive synapses along Purkinje cell dendrites in the molecular layer (ML). Large arrows in (a) and (b) identify rab3A-positive glo ‘meruli in the granule cell layer (CL) that are negative for rabphilin-3A. (c and d) Brain stem sections double labeled for rabphilin3A and rab3a. Brightly immunoreactive puncta that outlilne perikarya (p) and dendrites (d) represent nerve terminals positive for both antigens. in (e and f) CA3 region of the hippocampus double labeled for rabphilin-3A and synaptophysin. Large mossy fiber nelrvs ! terminals thestratum radiatum (SR)are intenselyimmunoreactivefor both rabphilin-3Aand synaptophysin. In thestratum oriens(S0) , rabphilin3A whereas the is less abundant than synaptophysin. All rab3A labeling in this figure was performed with a rab3A-specific antibody, immunolabeling shown in Figure 7 and Figure 9 was performed with an antibody reactive with multiple forms of rab3 I. SP, stratum pyramidale. Bar, 20 Rm.

Neuron 890

Figure 5. Rabphilin3A aptic Vesicles

Copurifies

with Syn-

Synapticvesicles were purified by differential centrifugation and controlled pore glass chromatography, and fractions were immunoblotted with antibodies to rabphiIinSA and rab3A (Fischervon Mollard et al., 1990). Note theequivalent coenrichment of rabphilin3A with rab3A.

immunoreactivityexhibited atypical synaptic staining pattern similar to that of rabSA, which is consistent with a selective concentration of the protein in nerve terminals (Figure 4). Double immunofluorescence experiments revealed thatthe distributions of rabphilin3A and rab3A, although largely overlapping, are not identical. Figures4aand4b showafieldofthecerebellar cortex. Rabphilin3A and rab3A immunoreactivities are abundant in the molecular layer, where they have a similar but not precisely overlapping distribution. In the granule cell layer, rabphilin3A is present at some but not all rab3A-positive glomeruli, which primarily represent synaptic contacts by mossy fiber nerve terminals onto granule cell dendrites. Figures 4c and 4d show a section of an area of the brain stem in which most nerve terminals are positive for both rab3A and rabphilin-3A. In other areas of the brain stem, rabphilin-3A had a more restricted distribution than rab3A (data not shown). Figures 4e and 4f show a field from the CA3 region of the hippocampus double labeled for rabphilin3A and synaptophysin, a widely distributed synaptic vesicle marker (Navone et al., 1986). The large mossy fiber nerve terminals that establish synapses with the proximal portion of apical dendrites of pyramidal cells are strongly positive for both rabphilin-3A and synaptophysin. However, in the stratum oriens, rabphilin3A is less abundant than synaptophysin, indicating the presence of rabphilin3A-negative nerve terminals. Subcellular fractionation was performed to identify the synaptic structure with which rabphilin3Aassociates. Synaptic vesicles were purified by centrifugation and controlled pore glass chromatography, and fractions were analyzed by immunoblotting. This experiment revealed that rabphilin-3Acopurifieswith multiple synaptic vesicle markers (demonstrated for rab3A

in Figure S), suggesting that rabphilin-3A is a synaptic vesicle protein. To determine whether rabphilin-3A is associated with synaptic vesicles in vivo, immunoelectron microscopy was used to localize rabphilin-3A in nerve terminals. Rat brain stem fragments were mildly homogenized, embedded in agarose, and labeled for rabphilin-3A by immunogold staining, a procedure designed to maximize accessibility of antigens localized in cytosolic compartments to immunological probes (De Camilli et al., 1983a, 1983b; Takei et al., 1992). Consistent with the immunofluorescence results, rabphilin-3A immunoreactivity was detectable by electron microscopy in nerve terminals, in which the immunogold labeling was primarily associated with synaptic vesicles (Figure 6). Although the bulk of gold particles were directly attached to the cytoplasmic surface of synaptic vesicles, some appeared to be localized on the matrix surrounding synaptic vesicles. A similar pattern of labeling was previously observed with antibodies directed against synapsin (a peripheral membrane protein of synaptic vesicles), but not with antibodies directed against intrinsic membrane proteins of synaptic vesicles (Navone et al., 1986). The cytoplasmic surface of the plasma membrane was generally unlabeled with the exception of very few intensely labeled patches (for example, arrowheads in Figures 6a and 6~). Although tubular or vacuolar profiles of nerve endings were in general devoid of labeling (arrows in Figure 6b), some labeled vacuoles were observed that may represent endosomes (arrows in Figure 6~). In agreement with the immunofluorescence results, some nerve terminals were completely unlabeled in spite of the presence of large discontinuities in their plasmalemma (Figure 6d). Thus, rabphilin-3A immunoreactivity as recog-

Targeting 891

of Rabphilin-3A

Figure 6. Subcellular

Depends

Localization

on rab3A13C

of Rabphilin-3A

in Nerve

Terminals

by lmmunoelectron

Microscopy

All pictures are from agarose-embedded brain stem fragments that were incubated with antirabphilin antibodies and gold-labeled protein A. Gold particles are primarily associated with synaptic vesicles as shown in (a), (b), and (c). Most large valcuolar structures are devoid of labeling (arrows in [b]) although a few are labeled (arrows in [cl). Patches of labeling are also visible on the cytoplasmic face of the plasmamembrane (arrowheads in [a] and [cl). Mitochondria (M) are consistently unlabeled. The nerve terminal shown in (d) is unlabeled for rabphilin3A even though its plasmalemma has clearly been disrupted and is accessible to antibodies and gold particles. Bars, 200 nm.

nized by our antibodies appears to be missing from a subpopulation of nerve terminals.

Effect of the Deletion of rab3A on Rabphilin-3A localization We have recently generated mice deficient in rab3A that exhibit an impairment in neurotransmitter release during repetitive stimulation (Geppert et al., 1994). In these mice, the steady-state concentration of rabphilin-3A is decreased by 70% in spite of normal mRNA levels. These findings, together with the synaptic vesicle localization of rabphilin3A demonstrated above, suggest that rabphilin-3A may be an effector protein for rab3A and that in the absence of rab3A, rabphilin-3A is destabilized. To test this hypothesis, we analyzed the distribution of rabphilin-3A in rab3Adeficient mice.

Double immunofluorescence experiments were performed on frozen sections of the cerebellar cortex using a polyclonal antibody to rabphilin3A and a monoclonal antibodyto rab3 that recognizes multiple rab3 isoforms (rab3A/36/3C; Matteoli et al., 1991). Both antibodies reacted with high affinity with the corresponding murine proteins (see Figure 8; data not shown). In wild-type mice, rabphilin-3A immunoreactivity exhibited a typical synaptic pattern similar to that observed in the rat with only minimal staining of the neuronal perikarya, dendrites, and axons (Figure 7). Similar but not identical staining patterns for rabphilin-3Aand rab3Awereobserved in murinecerebellum, as shown above for rat cerebellum (see Figure 4) and as shown for a subpopulation of mossy fibers seen at high magnification in Figures 17~and 7d (arrows). In rab3A-deficient mice, rabphilin-3A staining

Neuron 892

Rab3A mutant

W ild type

Figure

7. Relative

Localizations

of Rabphilin-3A

and rab3A/rab3C

in the Cerebellar

Cortex

of Wild-Type

and rab3A-Deficient

Mice

Panels show double-immunofluorescence pictures of cryostat sections labeled with a polyclonal antibody to rabphilin-3A and a monoclonal antibody to rab3 proteins recognizing multiple isoforms (rab3A/3B/3C). (a-d) Low power views (a and b) and high power views (c and d) of wild-type cerebellar cortex showing close colocalization of rab3proteins and rabphilin-3A in almost all nerve terminals of this region. Note, however, the heterogeneous expression of rabphilin-3A in the glomeruli of the granular cell layer (CL; large arrows in [c] and [d]). (e-h) Low power views.(e and f) and high power views (g and h) of the cerebellar cortex from rab3Adeficient mice. Rabphilin3A and rab3 immunoreactivities are drastically reduced in most nerve terminals, but the staining is almost unchanged at the pinceaux (small arrows in [e] and [g]), the structures formed by basket cell axon terminals surrounding the initial segment of Purkinje cells. The high magnification view (g and h) reveals additional colocalization of low levels of rabphilin-3A and rab3 immunoreactivity in the rab3Adeficient mouse in a subpopulation of nerve terminals in the molecular layer (ML). Note the lack of both immunoreactivities from the glomeruli in the granule cell layer (CL). Bars, 100 pm (a, b, c, and f); 20 pm (c, d, g, and h), 20 Wm.

Targeting 893

of Rabphilin3A

Depends

on rab3AI3C

a

JRab3C \Rab3A

b

JRab3C -Rab3A

Figure 8. Binding

of rab3C to Rabphilin3A

(a)Antibodyspecificities for rab3A and rab3C; enrichment of rab3C in chromaffin granule membranes. Rat brain and bovine chromaffin granule membrane proteins were analyzed by immunoblotting with a monoclonal antibody specific for rab3A (left two lanes) and an antibody that recognizes multiple rab3s (middle two lanes). Note that rab3C is more abundant than rab3A in chromaffin granules. On the right two lanes, brain membranes from wild-type and rab3A-deficient mice were analyzed with the antirab3PJ3B/3C antibody to illustrate the selective reactivity of this antibody with rab3C in the absence of rab3A. (b) Affinity purification of rab3C and rab3A on immobilized recombinant rabphilin-3A. Solubilized chromaffin granule membrane proteins were bound to a glutathioneagarose column containing either only GST or GST-rabphilin. Bound proteins were eluted with high salt buffer and analyzed by immunoblotting with the monoclonal antibody recognizing multiple isoforms of rab3.

Neuron 894

Rab3A mutant

W ild type

Figure 9. Partially

Cytoplasmic

Localization

of Rabphilin-3A

in rab3A-Deficient

Mice

Panels show double immunofluorescence pictures of rabphilin-3Aand rab3A/3B/3C in thecerebellar medullaand brain stem of wild-type and rab3A-deficient mice. (a-d) In the deep cerebellar nuclei (DCN) of wild-type mice (a and b), antibodies to rabphilin-3A and rab3 isoforms (rab3A/3B/3C) produce strong immunostaining with a characteristic presynaptic pattern. The staining for rabphilin-3A and rab3A are abolished in most nerve terminals in the DCN in rab3Adeficient mice (c and d) but different from wild-type mice, the perikarya of the DCN neurons are now intensely stained for rabphilin3A (arrows in [cl). (e-h)Rabphilin-3Aand rab3A/3B/3Ccolocalize in nerveterminalsofthe brain stemofwild-typemice(eandf). However, in rab3Adeficient mice (g and h), rabphilin3A accumulates in the perikarya of neurons of the brain stem where the density of rabphilin- and rab3A-positive nerve terminals is much lower than in wild-type mice. Bars, 100 urn (a-d); 20 urn (e-h).

Targeting 895

of Rabphilin3A

Depends

on rab3A/3C

was drastically reduced in most nerve terminals, as would be predicted from the decrease in its protein levels. However, some synaptic terminals still exhibited unexpectedly strong rabphilin-3A immunoreactivity in the mutant mice. The rabphilin-positive nerve terminals in the rab3A-deficient mice precisely coincided with nerve terminals that still contained residual rab3 immunoreactivity in the absence of rab3A (for example, basket cell nerve terminals in Figures 7c, 7d, 7g, and 7h). lmmunoblots demonstrated that the major rab3 isoform in brain recognized by the monoclonal antibody in the absence of rab3A is rab3C (Figure 8a), indicating that rab3C is present at high levels in some neurons and targets rabphilin-3A to the synapses of these neurons. The experiments on the mutant mice (see Figure 7) suggest that rab3A is required for the synaptic targeting of rabphilin-3A and that in the absence of rab3A, rab3C substitutes for it at some synapses. This implies that rabphilin-3A should also bind rab3C. To test this hypothesis, we used chromaffin granule membranes that contain more rab3C than rab3A (Figure8a). Chromaffin granule membrane proteinswere solubilized and affinity purified over a rabphilin-3A column in the presence of GTPyS, revealing specific binding of rab3C to rabphilin3A (Figure 8b). Thequestion arisesofwhat happens to rabphilin-3A in rab3A-deficient neurons that do not express rab3C. To investigatethis question, weexamined the localization of rabphilin3A in large neurons of the brain stem and cerebellum. Significant perikaryal dendritic staining for rabphilin3A was observed in rab3A-deficient mice but not in wild-type mice, suggesting that rabphilin-3A remains in the cell body in neurons lacking rab3 immunoreactivity (Figure 9). A low magnification comparison of rabphilin3A and rab3A/3B/SC immunoreactivity in the deep cerebellar nuclei of wild-type and rab3hdeficient mice is shown in Figures 9a-9d. In wild-type mice, rabphilin-3A and rab3A/3B/3C immunoreactivity exhibited very similar nerve terminal patterns. In rab3hdeficient mice, the rab3A/3B/3C signal in the deep cerebellar nuclei was drastically reduced. A significant level of rabphilin-3A was visible in neuronal perikarya and dendrites in the mutant mice that was absent from wild-type mice (Figures 9d and 9h). Similar observations were made in several regions of the brain stem (Figures 9e-9h). Discussion

Rabphilin-3A is a brain protein that interacts with rab3A in a GTP-dependent manner via its N-terminal sequence and binds CaH and phospholipids via its C-terminal sequence that contains two CZ domains (Shirataki et al., 1992,1993;Yamaguchi et al., 1993). We have now shown that rabphilin3A is an evolutionarily conserved synaptic vesicle protein that binds rab3A and rab3C, both of which are also synaptic vesicle proteins (Fischer von Mallard et al., 1994), but not rablb and rab5. This characterizes rabphilin-3A as a

second Ca2+-binding protein specifically localized on synaptic vesicles in addition to synaptmotagmin (Brose et al., 1992). Comparison of the rat and bovine rabphilin-3A and synaptotagmin sequences suggests a (division of rabphilin-3A into three principal domains (see Figure 1): a conserved cysteine-rich N-terminal d’omain responsible for rab3A and membrane binding, a variable intermediate region with multiple phosphorylation consensus sequences that may be regulatory, and a C-terminal region containing two C, domains that are likely to mediate the CaVphospholipid binding of rabphilin-3A.Although the &domains of rabphilm-3A are homologous to those of synaptotagmin, pairwise comparisons among them demonstrate that the conserved sequence characteristics of the first and second CZ domains of synaptotagmins (Ceppert et al., 1991)arenotconservedintheCpdomainsof rabphilin3A. This suggests that the two sequential’C2 domains in synaptotagmin and rabphilin-3A arose independently and have distinct functional purposes. Although both rabphilin3A and synaptotagmin are membrane proteins of synaptic vesicles whose mernbraneassociation is mediated by their N-terminal domains, the mechanism of membrane attachment is very different. Synaptotagmin is an integral membrane protein that is permanently membrane associated, whereas rabphilin-3A is weakly bound to the synaptic vesicle membrane and could possibly even dissociate from synaptic vesicles during their exocytic and endocytic cycling. lmmunofluorescence localization of rabphilin-3A in normal rat and mouse brains demonstrated a heterogeneous distribution of the protein in presynaptic nerve terminals (see Figure 4 and Figure 7). Studies on other synaptic vesicle proteins have revealed that most of them, including rab3 isoforms, occur in multiple isoforms exhibiting differential distributions (for example, Fykse et al., 1993; Matteoli et ‘al., 1992). The absence of rabphilin-3A from some nerve terminals in rat and mouse brains observed here raises the possibility that, similar to other synaptic vesicle proteins, rabphilin3A is present in multiple isoforms with a differential distribution. Surprisingly, immunolocalization of rabphilin-3A in mutant mice that are deficient in rab3A demonstrated that rabphilin-3A localization is dependent on rab3A. Micedeficient in rab3Aexhibitadefect imthecontinuous recruitment of synaptic vesicles for exocytosis during repetitive stimulation (Geppert et al., 1994). Biochemically, these mice have no detectable changes except for a dramatic decrease in rabphilin-3A levels (Geppert et al., 1994). In the mutant mice, most nerve terminals are not reactive with an antibotdythat recognizes multiple isoformsof rab3. However, subpopulations of synapses in the rab3hdeficient mice are still reactive with this antibody (see Figure 7 and Figure 9)Thisstaining isprimarilydueto rab3C(seeFigure8), suggesting that rab3C is heterogeneouslly distributed between synapses. Interestingly, nerve terminals that

Neuron 8%

exhibit rab3C staining in the mutant mice contain normal levels of rabphilin-3A as judged by immunofluorescence staining, whereas nerve terminals lacking rab3C also lack rabphilin-3A reactivity (see Figure 7). This finding suggests that rab3A or rab3C can mediate the attachment of rabphilin-3A to synaptic vesicles and its targeting to nerve terminals, whereas rabphilin-3A is not localized to synapses in the absence of a rab3 protein. To determine the fate of rabphilin3A in the absence of rab3 protein, we examined the cell bodies of large neurons with synapses lacking rab3 proteins by immunofluorescence (Figure 9). A perikaryal accumulation of rabphilin-3A in mutant but not wild-type mice was found in many of these neuronal cell bodies, suggesting that, in the absence of rab3 proteins, rabphilin3A is not transported to synapses. The overall decreased levels of rabphilin-3A in the mutant mice suggest that the rabphilin-3A in the cell bodies is unstable and rapidly degraded. Together, these findings lead to a model in which rabphilin-3A is targeted to synaptic vesicles via its GTP-dependent binding to rab3A or rab3C. In the absence of either rab3 isoform, rabphilin3A fails to reach the synapse and is degraded. Recently, it was shown that the major function of ras consists of the GTP-dependent recruitment of raf to the membrane (reviewed in Hall, 1994). Our data suggesting that rab3A or rab3C are required for the recruitment of rabphilin-3A to synaptic vesicles point out a striking resemblance in the mechanisms of action of ras and rab proteins. It is possible that the major function of rab proteins will also be the GTPdependent recruitment of effector proteins. In the case of rab3A and rab3C, this would consist of the recruitment to synaptic vesicles of rabphilin-3A as a possible Caz+-dependent effector protein. However, it is currently unclear whether rab3A and rab3C are required only for the targeting of rabphilin3A to synapses as shown here or whether they also function in a GTP-dependent cycle of rabphilin-3A attachment to synaptic vesicles in the nerve terminal. Future experiments will have to clarify this issue. Experiments with rab3A-deficient mice have assigned to rab3A a function in the efficient recycling of synaptic vesicles, most likely at the docking step (Geppert et al., 1994). Ca* regulation of the docking stepwould be useful, sincethe bestwayto coordinate efficient synaptic vesicle recycling during bursts of triggered synaptic vesicle exocytosis would be to regulate other trafficking steps by Caz+ in addition to the actual exocytosis. Such a Ca2+-dependent function could be carried out by rabphilin-3A as an effector of rab3A and rab3C. Recent experiments have demonstrated that constitutively CTP-bound mutant forms of rab3A impair Ca*+-evoked secretion from endocrine cells (Holz et al., 1994; johannes et al., 1994). This result is consistent with the notion that clamping the interaction of rab3A with rabphilin-3A arrests the

synaptic vesicle cycle at a stage, maybe the docking stage, by inappropriately activating rabphilin-3Awithout releasing it from rab3A via GTP hydrolysis. Such a step may not be essential for low level synaptic vesicle recycling (Geppert et al., 1994) but could still interfere with regular recycling when inappropriately activated. This would explain how expression of a mutant protein could give a dominant phenotype even though the protein itself is not essential for the function with which the mutant protein interferes. All of these results are best compatible with a facilitatory function of rab3A in the docking of synaptic vesicles that may be mediated by rabphilin-3A as an effector. Experimental

Procedures

cDNA Cloning and Sequencing Polymerase chain reaction (PCR) primers (sequences, CGCGGTACCATGGA[A,G]G A[A,G]GA[C;?JCA[A,G]G~[A,G]GA[A,C]GC and GCCGTCGACTACTCGGAGCAIC.C1ACIA.CTTCIA.CTT TIT.0 TC[A,ClTrTT,C]TG; nucleotides in br&ketsV indicate ‘rebund& positions) were designed based on the amino acid sequence of bovine rabphilin-3A (Shirataki et al., 1993) and used to amplify part of the rat rabphilin3A cDNA using first-strand cDNA from rat brain as template. A PCR fragment of the correct size (0.96 kb) was subcloned, confirmed by sequencing, and used to screen a rat brain cDNA library as described (Wdhof et al., 1985). Of more than 100 positive plaques from approximately 1.5 x IO6 plaques, 12 were isolated and 8 were studied by DNA sequencing. DNA sequencing was performed on Ml3 subclones of cDNAs using the dideoxynucleotide chain termination method (Sanger et al., 1977) with Taq DNA polymerase and fluorescent primers. Sequencing reaction products were identified on an AB1370A automatic DNA sequencer. Construction of Bacterial Expression Vectors and Production of Recombinant Rabphilin3A-CST Fusion Proteins Four bacterial expression vectors encoding recombinant CSTrabphilin-3A fusion proteins with GST were constructed for this study by subcloning cDNA fragments into the vector pCEX-KC (Guan and Dixon, 1991): pCEX85-3 encodes amino acids 67-227 (used to raise antibody 1374); pCEX85-4 encodes amino acids 1-361 (used to raise antibody 1734); pGEX85-8 encodes amino acids 366-684 (used to raise antibody 1731); pGEX85-9 encodes the entire coding region of rabphilin (used for the rab3A affinity chromatography).AIIvectorswere made byamplifyingthecorresponding DNA fragments with specific primers containing appropriate restriction enzyme sites for subcloning, except for pGEX85-3, which was constructed by subcloning a 0.48 kb Ncol fragment directly into pGEX-KG. CST fusion proteins were expressed in bacteria and purified as described (Smith and Johnson, 1988). Affinity Purification of Rabphilin-Binding Proteins The full-length GST-rabphilin fusion protein and GST control protein were attached to glutathione agarose beads and incubated with solubilized total rat brain homogenate in 5 m M HEPES-NaOH, 50 m M Tris-HCI (pH 8.0), 0.1 M NaCI, 1% Nonidet P-40,1 m M EDTA, 3 m M Mg ?+, 3 m M CaZ+, 50 pM GTPyS, 1 m M phenylmethylsulfonyl fluoride, and 0.5 mgll leupeptin, pep statin, and aprotinin. After overnight incubation at 4OC, the beadswerewashed threetimeswith thesame buffer bycentrifugation and packed into a column. Bound proteins were eluted sequentially with 5 m M ECTA, 5 m M EDTA, 25 m M Tris-HCI (pH 8.0), 50 m M NaCI, 0.5% Nomidet P-40 and with the same buffer without the EDTA, containing 1 M NaCI. Fractions were analyzed by SDS-polyacrylamide gel electropharesis (SDS-PACE) and immunoblotting. Rabphilin-3Abindingproteinsin bovinechromaffin granules were isolated similarly.

Targeting 897

of Rabphilin-3A

Depends

on rab3A/3C

Generation and Characterization of rab3A-Deficient Mice The generation of mice deficient in rab3A was described previously (Geppert et al., 1994) and maintained as a homozygous colony with a genetically similar control line of the same parentage. Genetic status of the mice was followed by PCR of genomic tail DNA and by immunoblotting of brain tissue with anti-rab3A antibodies to confirm selective rab3A deletion. Generation and Affinity Purification of Antibodies The following polyclonal antibodies were raised against GSTrabphilin fusion proteins containing the following amino acid sequences of rabphilin: 1374 (amino acids 67-227), 1734 (amino acids l-361), and 1731 (amino acids 366-684). Specificity of antibodies was evaluated by studying COS cells transfected with rabphilin expression vectors and control DNA. Antibodies were affinity purified by immobilizing the corresponding recombinant GST-rabphilin proteins on cyanogen bromide-activated Sepharose4B and binding and eluting reactive antibodies. Most of the immunocytochemistrywas carried outwith antibody 1734. Monoclonal antibodies directed against rab3A that are either specific for rab3A (C142.2) or react with multiple rab3s (C142.1) and monoclonal antibodies directed against synaptophysin were described previously (Matteoli et al., 1991; Jahn et al., 1985). Rhodamineconjugated goat antirabbit IgGs and fluorescein isothicyanate-conjugated goat antimouse IgCs were from BoehringerMannheim (Indianapolis, IN); nonimmune rabbit IgGswerefrom Cappel (Cochranville, PA). Protein A-gold conjugates (6 nm)were prepared as described (Slot and Geuze, 1985). Partial Proteolysis of Rabphilin Total rat brain membranes were prepared in 10 m M HEPESNaOH (pH 7.4), 0.25 M NaCI, 2 m M EDTA and resuspended at a concentration of approximately 2 mg/ml. At this NaCl concentration, a significant percentage of rabphilin dissociates, and only strongly membrane-bound rabphilin-3A remains. Membranes (1.0-1.5 mg protein) were incubated at room temperature under constant agitation without additions or with 0.5 pg trypsin, 5 ug chymotrypsin, or 5 ug of V8 protease per milligram of membrane protein. Samples were then centrifuged for 30 min at 100,000 x g, and the pellet was washed three times in the incubation buffer and then resuspended in the samevolumeof incubation buffer. Samples were analyzed by SDS-PAGE and immunoblotting using antibodies 1374 and 1731 (see above). Protein Assays, SDS-PAGE, and lmmunoblotting Protein assays were carried out using the BCA protein assay kit (Pierce) or a Coomassie blue-based assay kit (BioRad). SDS-PAGE and immunoblotting were performed as described (Laemmli, 1970; Johnston et al., 1989). Reactive bands were visualized by enhanced chemiluminescence (Amersham). lmmunofluorescence Anaesthetized rats (150-200 g; Charles River) and mice were perfused with fixative (4% formaldehyde in 0.12 M sodium phosphate buffer). Frozen sections were immunostained essentially as described (De Camilli et al., 1983a;Takei et al., 1992). Immunolabeled sections were mounted in p-phenylenediamine-glycerol (1 mglml p-phenylenediamine in 70% glycerol). Pictures were taken in a standard Zeiss Axiophot immunofluorescence micro scope.

Hata for helpful discussions. This study was supported by grants from the National Institutes of Health (grant CA46128 to P. D. C.) and the Perot Family Foundation (to T. C. S.) and by a postdoctoral fellowship grant to M. C. from the Deutsche Forschungsgemeinschaft. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement”in accordance with 18 USC Section 1734 solely to indicate this fact. Received

June 13, 1994; revised

August

16, 1994.

References Bordier, C. (1981). Phase separation of integral membrane proteins in Triton X-114 solution. J. Biol. Chem. 256, 1604-1607. Brose, N., Petrenko, A. G., Stidhof, T. C., and Jahn, R. (1992). Synaptotagmin: a Ca2+ sensor on the synaptlic vesicle surface. Science 256, 1021-1025. Burton, J., Roberts, D., Montaldi, M., Novick, P., and De Camilli, P. (1993). A mammalian guanine-nucleotide-releasing protein enhances function of yeast secretory protein Sec4. Nature 367,464467. Davletov, B., Sontag, J. M., Hata, Y., Petrenko, A. G., Fykse, E. M., Jahn, R., and Sudhof,T. C. (1993). Phosphorylation of synaptotagmin I by casein kinase II. J. Biol. Chem. 268, 6816-6822. De Camilli, P., Cameron, R., and Greengard, P. (1983a). Synapsin I (Protein I), a nerve terminal-specific phosphoprotein. I. Its general distribution in synapses of the central and peripheral nervous system demonstrated by immunofluorescence in frozen and plastic sections. J. Cell Biol. 96, 1337-135,4. De Camilli, P., Harris, S. M., Huttner, W. B., and Greengard, P. (1983b). Synapsin I (Protein I), a nerveterminal-specific phosphoprotein. II. Its specific association with synaptic vesicles demonstrated byimmunocytochemistryinagarose-embedded synaptosomes. J. Cell Biol. 96, 1355-1373. Farnsworth, C. C., Kawata, and Glomset, J. A. (1991). protein smg p25A contains dues and a methyl ester. 6200.

M.,Yoshida, Y.,Takai, Y., Celb, M. H., C terminus of the small CTP-binding two geranylgeranyl,ated cysteine resiProc. Natl. Acad. Sci. USA 88, 6196-

Fischer von Mollard, G., Mignery, G. A., Baumert, M., Perin, M. S., Hanson, T. J., Burger, P. M., Jahn, R., and Siidhof, T. C. (1990). rab3 is a small GTP-binding protein exclusively localized to synaptic vesicles. Proc. Natl. Acad. Sci. USA 87, 1988-1992. Fischervon Mollard, G., Siidhof, GTP-binding protein dissociates exocytosis. Nature 349, 79-81.

T. C., and Jahn, R. (1991). A small from synaptic vesicles during

Fischer von Mollard, G., Stahl, B., Khoklatchev, A., Sudhof, T. C., and Jahn, R. (1994). Rab3C is a synaptic vesicle protein that dissociates from synaptic vesicles after stimulation of exocytosis. J. Biol. Chem. 269, 10971-10974. Fykse, E. M., Takei, K., Walch-Solimena, C., Geppert, M., Jahn, R., De Camilli, P., and Siidhof, T. C. (1993). Relative properties and localizations of synaptic vesicle protein isoforms: the case of the synaptophysins. J. Neurosci. 73, 4997-5007. Ceppert, M., Archer, B. T., Ill, and Siidhof, tagmin II: a novel differentially distributed min. J. Biol. Chem. 266, 13548-13552.

T.C. (1991). Synaptoform of synaptotag-

lmmunoelectron Microscopy lmmunogold staining of agarose-embedded brain stem fragments was carried out following the procedure previously described (De Camilli et al., 198313; Takei et al., 1992).

Ceppert, M., Bolshakov, V. Y., Siegelbaum, 5. A., Takei, K., De Camilli, P., Hammer, R. E., and Siidhof, T. C. (1994). Rab3A function in neurotransmitter release. Nature 369, ,493-497.

Acknowledgments

Cuan, K. L., and Dixon, J. E. (1991). Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedureof fusion proteins with glutathione S-transferase. Anal. Biochem. 792, 262-267.

We lent San von

wish to thank I. Leznicki, A. Roth, and E. Borowicz for exceltechnical assistance, Dr. William Balch (Scripps Institute, Diego,California)foragiftof rablbantibodies,Dr.G.Fischer Mollard for antibodies to rab5, and Dr. Nils Broseand Yutaka

Hall, A. (1994). A biochemical 264, 1413-1414. Holz, R. W., Brondyk,

function

for ras-at

W. H., Senter, R.A., Kuizon,

last. Science L.,andMacara,

Neuron 898

I. G. (1994). Evidence dependent exocytosis Chem. 269,10229-10234.

for the involvement of rab3A in Ca2+from adrenal chromaffin cells. J. Biol.

Jahn, R., Schiebler, W., Ouimet, C., and Greengard, P. (1985). A 38,000-dalton membrane protein (~38) present in synaptic vesicles. Proc. Natl. Acad. Sci USA 82, 4137-4141. Johannes, L., Lledo, P.-M., Roa, M., Vincent, J.-D., Henry, J.-P., and Darchen, F. (1994). The CTPase rab3A negatively controls calcium-dependent exocytosis in neuroendocrine cells. EMBO J. 73,2029-2037.

glutathione

S-transferase.

Gene 67, 31-40.

Siidhof, T. C., Goldstein, J. L., Brown, M. S., and Russell, D. W. (1985). The LDL receptor gene: a mosaic of exons shared with different proteins. Science 228, 815-822. Takei, K., Stukenbrok, H., Metcalf, A., Mignery, G. A., Siidhof, T. C., Volpe, P., and De Camilli, P. (1992). Ca2+ stores in Purkinje neurons: endoplasmic reticulum subcompartments demonstrated by the heterogeneous distribution of the lnsPs receptor, Ca*+-ATPase, and calsequestrin. J. Neurosci. 12, 489-505.

Johnston, P. A., Jahn, R., and Siidhof, T. C. (1989). Transmembranetopographyand evolutionary conservation of synaptophysin. J. Biol. Chem. 264, 1268-1273.

Touchot, N., Chardin, P., and Tavitian, A. (1987). members of the ras gene superfamily isolated by tide strategy: molecular cloning of YPT-related rat brain library. Proc. Natl. Acad. Sci. USA 84,

Johnston, P. A., Archer, B. T., III, Robinson, K., Mignery, C. A., Jahn, R., and Siidhof, T. C. (1991). Rab3A attachment to the synaptic vesicle membrane mediated by a conserved polyisoprenylated carboxy-terminal sequence. Neuron 7, 101-109.

Ullrich, O., Stenmark, H.,Alexandrov, K., Huber, L.A., Kaibuchi, K., Sasaki, T., Takai, Y., and Zerial, M. (1993). Rab GDP dissociation inhibitor as a general regulator for the membrane association of rab proteins. J. Biol. Chem. 268, 18143-18150.

Kishida, S., Shirataki, H., Sasaki, T., Kato, M., Kaibuchi, K., and Takai,Y. (1993). Rab3AGTPaseactivating protein-inhibitingactivityof Rabphilin3A, a putative Rab3Atarget protein. J. Biol. Chem. 268, 22259-22261.

Yamaguchi, T., Shirataki, H., Kishida, S., Miyazaki, M., Nishikawa, J., Wada, K., Numata, S., Kaibuchi, K., and Takai, Y. (1993). Two functionally different domains of Rabphilin3A, Rab3A p25/ smg p25A-binding and phospholipid-and Ca*+-binding domains. J. Biol. Chem. 268, 27164-27170.

Laemmli, assembly

U. K. (1970). Cleavage of structural proteins during the of the head of bacteriophage T4. Nature 227,680~685.

Matsui, Y., Kikuchi, A., Kondo, J., Hishida, T., Teranishi, Y., and Takai, Y. (1988). Nucleotide and deduced amino acid sequences of a CTP-binding protein family with molecular weights of 25,000 from bovine brain. J. Biol. Chem. 263,11071-11074. Matteoli, M.,Takei, K., Cameron, R., Hurlbut, P., Johnston, P. A., Siidhof, T. C., Jahn, R., and De Camilli, P. (1991). Association of rab3 with synaptic vesicles at late stages of the secretory pathway. J. Cell Biol. 775, 625-633. Matteoli, M., Takei, K., Perin, M., Siidhof, T. C., and De Camilli, P. (1992). Exo-endocytotic recycling of synaptic vesicles in developing processes of cultured hippocampal neurons. J. Cell Biol. 117, 849-861. Navone, F., Jahn, R., DiGioia, C., Stukenbrok, H., Creengard, P., and De Camilli, P. (1986). Protein ~38: an integral membrane protein specific for small vesicles of neurons and neuroendocrine cells. J. Cell Biol. 703, 2511-2527. Perin, M. S., Fried, V. A., Mignery, C. A., Jahn, R., and Stidhof, T. C. (1990). Phospholipid binding by a synaptic vesicle protein homologous to the regulatory region of protein kinase C. Nature 345, 260-263. Perin, M. S., Brose, N., Jahn, R., and SOdhof,T. C. (1991). Domain structure of synaptotagmin (~65). J. Biol. Chem. 266, 623-629. Quest, A. F. G., Bardes, E. S. C., and Bell, R. M. (1994). A phorbol ester binding domain of protein kinase Cg. J. Biol. Chem. 269, 2953-2960. Sanger, F., Nicklen, S., and Coulson, ing with chain-terminating inhibitors. 74, 5463-5467.

A. R. (1977). DNA sequencProc. Natl. Acad. Sci. USA

Sasaki, T., Kikuchi, A., Araki, S., Hata, Y., Isomura, M., Kuroda, S., and Takai, Y. (1990). Purification and characterization from bovine brain cytosol of a protein that inhibits the dissociation of GDP from and the subsequent binding of GTP to smg p25A, a ras p21-like GTP-binding protein. J. Biol. Chem. 265,2333-2337. Shirataki, H., Kaibuchi, K., Yamaguchi, T., Wada, K., Horiuchi, H., and Takai, Y. (1992). A possible target protein for smg-25A/ rab3A small CTP-binding protein. J. Biol. Chem. 267, 1094610949. Shirataki, H., Kaibuchi, K., Sakoda, T., Kishida, S., Yamaguchi, T., Wada, K., Miyazaki, M., and Takai, Y. (1993). RabphilinSA, a putative target protein for smg p25A/rab3A small CTP-binding protein related to synaptotagmin. Mol. Cell Biol. 73, 2061-2068. Slot, J. W., and Geuze, H. J. (1985). A new method of preparing gold probes for multiple-labeling cytochemistry. Eur. J. Cell Biol. 38, 87-93. Smith, D. B., and Johnson, of polypeptides expressed

K. S. (1988). Single-step purification in Escherichia coli as fusions with

Four additional an oligonucleocDNAS from a 8210-8214.