- Email: [email protected]
Synergistic effects of pemetrexed and amrubicin in non-small cell lung cancer cell lines: Potential for combination therapy
Cancer Letters 343 (2014) 74–79
Contents lists available at ScienceDirect
Cancer Letters journal homepage: www.elsevier.com/locate/canlet
Synergistic effects of pemetrexed and amrubicin in non-small cell lung cancer cell lines: Potential for combination therapy Yukihisa Hatakeyama, Kazuyuki Kobayashi ⇑, Tatsuya Nagano, Daisuke Tamura, Masatsugu Yamamoto, Motoko Tachihara, Yoshikazu Kotani, Yoshihiro Nishimura Division of Respiratory Medicine, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan
a r t i c l e
i n f o
Article history: Received 30 December 2012 Received in revised form 10 September 2013 Accepted 14 September 2013
Keywords: Non-small cell lung cancer Thymidylate synthase Pemetrexed Amrubicin
a b s t r a c t The purpose is to examine the synergistic effect of pemetrexed (PEM) and amrubicin (AMR) on the proliferation of lung cancer cell lines. In vitro, dose-dependent synergistic effects of concurrent PEM and AMRol, which is an active metabolite of AMR were observed in A549 and H460 cells. In real-time RT-qPCR analysis and western blotting, expression of the target enzymes of PEM were suppressed in cells treated with amrubicinol alone. In vivo, AMR/PEM treatment also showed synergistic antitumor activity both in A549-bearing and H520-bearing mice. PEM and AMR work synergistically to inhibit the proliferation of several different lung cancer cell lines. Ó 2013 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Lung cancer is the leading cause of cancer-related mortality worldwide [1]. Non-small cell lung cancer (NSCLC), which includes adenocarcinoma, squamous cell carcinoma, large cell carcinoma and bronchioloalveolar carcinoma, accounts for nearly 85% of all cases of lung cancer [2]. In the past few decades, there has been a tremendous increase in the understanding of the biological mechanisms that underlie NSCLC, which has led to novel therapeutic strategies. Despite such progress in molecular targeted therapies, anti-cancer cytotoxic drugs are still essential options for the management of patients because of recurrent diseases and acquired drug resistance. Systemic chemotherapy [3] such as platinum doublet therapy (cisplatin and third-generation drugs) is still recommended as first-line therapy in advanced-staged NSCLC [4]. Given that lung cancer results in a poor prognosis overall and requires many therapeutic options for various clinical courses and phenotypes, novel combination therapies are desired. We investigated the synergistic effects of the two cytotoxic drugs, pemetrexed (PEM) and amrubicin (AMR), which arrest tumor cell cycle at the same phase. Inhibition of DNA synthesis is one of the major antitumor mechanisms. PEM is an antifolate drug with a similar
⇑ Corresponding author. Tel.: +81 78 382 5846; fax: +81 78 382 5859. E-mail address: [email protected] (K. Kobayashi). 0304-3835/$ - see front matter Ó 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.canlet.2013.09.019
structure to folate that inhibits three enzymes: thymidylate synthase (TS), which is essential for DNA replication and repair [5,6], and dihydrofolate reductase (DHFR) and glycinamide ribonucleotide transformylase (GARFT), which are involved in DNA and RNA synthesis [7,8]. Anticancer drugs that target enzymes such as TS exert their cytotoxic effect during S phase of the cell cycle [9]. In contrast, AMR is a topoisomerase inhibitor that induces the accumulation of cancer cells in S phase by suppressing TS activity [10]. The synergistic effect of amrubicin and pemetrexed with respect to cell cycle progression or TS expression levels has not been reported in lung cancer cells. We hypothesized that a combination of PEM and AMRol, the active metabolite of AMR, would have synergistic effects on lung cancer cells by inducing cell cycle arrest in S phase and suppressing TS expression. We evaluated the synergistic effects of PEM and AMRol on cancer cell proliferation and TS expression in lung cancer cell lines.
2. Materials and methods 2.1. Cell culture and reagents The NSCLC cell lines, A549 (adenocarcinoma), H460 (large cell lung carcinoma) and H520 (squamous cell carcinoma), were obtained from American Type Culture Collection (Manassas, VA, USA). All cells were cultured in RPMI 1640 medium (Sigma, St. Louis, MO, USA) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin (Wako, Osaka, Japan) under 5% CO2 at 37 °C. PEM was purchased from Eli Lilly & Co. (Indianapolis, IN, USA). AMRol was obtained from Dainippon Sumitomo Pharmaceuticals Co., Ltd. (Osaka, Japan).
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79 Table 1 The primer sequences for real-time RT-qPCR of the PEM target enzymes. Primer sequences (50 –30 ) Thymidylate synthase (TS)
Dihydrofolate reductase (DHFR)
Glycinamide ribonucleotide transformylase (GARFT)
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
Forward: CCTGAATCACATCGAGCCACT Reverse: GAAGAATCCTGAGCTTTGGGAA Forward: GGATAGTTGGTGGCAGTTCTGTT Reverse: TGCATGATCCTTGTCACAAATAGTT Forward: GCTCCCTTCTTTTAAGGGTTCAA Reverse: ACCAGTAACTGTGACTCCGGT Forward: GCACCGTCAAGGCTGAGAAC Reverse: ATGGTGGTGAAGACGCCAGT
2.2. Cell proliferation assay for growth inhibition and drug combination studies To determine the inhibitory effects of PEM and AMRol on cell growth, we used a cell proliferation assay (Cell Counting Kit-8, Dojindo, Kumamoto, Japan) according to the manufacturer’s instructions. A549, H460 and H520 cells were plated at a concentration of 1 104 cells/well in 96-well culture plates, and were treated with each drug at various concentrations for 48 h. Drug interactions between PEM and AMRol were assessed at a fixed concentration ratio using the combination index (CI). Data analysis was performed using computational software (Calcusyn, Biosoft, Oxford, UK), which performs multiple drug dose–effect calculations using the Median Effect methods described by Chou [11]. 2.3. RNA isolation and real-time RT-qPCR Total RNA was extracted from cells using ISOGEN (Nippon Gene, Tokyo, Japan). Single-stranded cDNA was synthesized using ExScript RT reagent kits (Takara, Otsu, Japan). Real-time RT-qPCR was performed using an ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) with primers purchased from Operon Biotechnologies (Tokyo, Japan) (Table 1). Amplifications were performed in duplicate with SYBR Premix Ex Taq (Takara), according to the manufacturer’s instructions. Target mRNA levels were normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the relative mRNA expression levels were calculated. The experiments were performed in triplicate. 2.4. siRNAs The TS siRNA (sc44978) and control siRNA (sc37007) duplexes were obtained from Santa Cruz Biotechnology, CA. Cells were plated in six-well plates at a density of 2 105 cells per well. The siRNA or control siRNA duplexes were mixed with transfection reagent sc36868 (Santa Cruz) in serum-free RPMI-1640 medium as described by the manufacturer’s protocol and added to the plated cells. The cells were used for assessments 48 h after the addition of fresh medium.
75
50 lg/mL propidium iodide. Ten thousand events were acquired on a FACSCalibur (BD Biosciences, San Jose, CA, USA) and analyzed using CellQuest Pro software (BD Biosciences). 2.7. Serum starvation For synchronization of cell cycles, cells grown to approximately 70–80% confluency were washed twice with PBS and starved in RPMI1640 containing 0.5% FBS for 72 h. Cells were washed with regular medium containing serum and further incubated in complete medium for the time points indicated in the experiments (G1/ S phase).
3. Experimental mice model Female BALB/c nude mice (6-weeks-old) were purchased from SLC Japan (Shizuoka, Japan). Mice were inoculated subcutaneously in the flank with 5.0 106 cells/100 ll suspension of A549 and H520. This study was approved by the Institutional Animal Care and Use Committee (Permission number: P130503) and carried out according to the Kobe University Animal Experimentation Regulations. 3.1. In vivo growth inhibition assay The length (a) and width (b) of the tumor masses and body weight (BW) were measured twice a week, and tumor volume (TV) was calculated using TV = (a b2)/2. Relative tumor volume (RTV) on day n was calculated using RTV = TVn/TV0, where TVn is the tumor volume on day n and TV0 is the tumor volume on day 0. Relative body weight (RBW) was calculated using RBW = BWn/BW0. When TV reached 100 mm3, mice were divided into four groups consisting of 5 mice per group (day 0). One group was injected with mouse PEM into intraperitoneal injection at 100 mg/kg/week which is one-third of the maximum tolerated dose (MTD) on day 1, 8, and 15. A second group of mice was treated with AMR at 25 mg/kg, which is the MTD into the tail vein on day 1. A third group of mice was treated with a combination of PEM and AMR at the same dose. A control group of mice (fourth) was treated with sterile PBS under similar conditions into intraperitoneal injection. We evaluated the effects of PEM/AMR by comparing the data between PEM/AMR and the additive effect (expected RTV). Expected RTV was calculated using (RTV of PEM) (RTV of AMR)/(RTV of control), as reported [12]. 4. Results 4.1. Sensitivity of NSCLC cells to PEM and AMRol
2.5. Western blotting The TS protein level was analyzed at four different concentrations of drug. Total cellular protein was isolated with Cell Lysis Buffer M (purchased from Wako, Osaka, Japan) containing proteinase inhibitors (Roche Applied Science, Indianapolis, IN, USA), and equal amounts (30 lg) of protein were separated by SDS-PAGE (5–20% tris/glycine gels, Wako) and transferred to nitrocellulose membranes. A primary rabbit antibody against TS (1:1000, Cell Signaling Technology Inc., Danver, MA) was incubated with the membranes overnight at 4 °C. After washing in TBST (150 mM NaCl, 20 mM Tris, 1% Tween 20, pH 7.4), the membranes were treated with a biotin-conjugated anti rabbit secondary antibody for 1 h at room temperature. The blots were developed using an enhanced chemiluminescence detection kit (Thermo Fisher Scientific Inc., Waltham, MA, USA).
The dose-dependent inhibition of cell proliferation by both drugs was observed in all cell lines (A549, H460 and H520). In clinical settings, lung adenocarcinoma cells are more sensitive to PEM than large cell lung carcinoma and squamous cell carcinoma of the lung. In this study, the IC50 values for PEM and AMRol, which
2.6. Analysis of cell cycle distribution Exponentially growing cells (A549, H460, H520) were seeded in six-well plates and treated with PEM alone at several concentrations according to the IC50 values (A549, 1.6 lM; H460, 1.6 lM; H520, 6.4 lM), with AMRol alone at several concentrations according to the IC50 values (A549, 0.16 lM; H460, 0.16 lM; H520, 0.64 lM), or with both PEM and AMRol for 4 h, 12 h and 24 h. Cells were fixed with 70% cold ethanol at 4 °C for 2 h. The fixed cells were washed twice with PBS containing 0.25 mg/mL RNase at room temperature for 1 h and stained with
Fig. 1. Inhibitory effect of PEM and AMRol. Dose dependent inhibition curves for all cell lines following treatment with PEM and AMRol.
76
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79
A549
H460
H520
Fig. 2. Relative survival rate was evaluated by the combination index. Combination index values were calculated at the 50%, 75% and 90% effective dose (ED). Dose-dependent inhibition of cell growth was observed in the A549 and H460 cell lines. C.I. was below 1 between ED50–ED90 except in H520 cells.
Table 2 A synergistic effect of combined PEM and AMRol in three cell lines. Cell line
Treatment
IC50 (lM)
Combination index 50%
75%
90%
A549 H460 H520
Pem + AMRol Pem + AMRol Pem + AMRol
3.23 ± 2.1 3.28 ± 3.4 4.98 ± 3.3
0.63 ± 0.22 0.93 ± 0.30 1.07 ± 0.49
0.39 ± 0.14 0.66 ± 0.12 0.92 ± 0.37
0.31 ± 0.19 0.53 ± 0.03 0.82 ± 0.31
Fig. 4. Dose-dependent suppression of TS protein expression was observed in A549 and H460 cells, similar to the results of real-time PCR analysis. However, in H520 cells, TS expression did not change significantly following drug treatment.
4.2. Antiproliferative effects of PEM in combination with AMRol works as AMR in the NSCLC cell lines ranged from 1.6 lM (A549, H460) to 6.4 lM (H520), and from 0.16 lM (A549, H460) to 0.64 lM (H520), respectively (Fig. 1). At the value of IC50 AMRol is significantly strong compared to PEM (p = 0.04, 0.06, 0.08, respectively).
Based on the IC50 values of PEM and AMRol, the molar ratio of PEM:AMRol of 1:10 was used for the drug combination studies in all cell lines. Fig. 2 shows the median-effect and the combination index plots. Combination indices (CIs) of <1.0 are indicative of
Fig. 3. All three cell lines were treated with different concentrations of AMRol alone. Expression of TS, DHFR and GARFT mRNAs was down regulated in A549 and H460 cells. In H520 cells, TS and DHFR mRNA expression did not change significantly after AMRol administration (A). The cell growth of TS knockdown group was suppressed compared to that of the control group (B). We validated efficiency of TS suppression caused by treatment of siRNA (C).
77
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79
synergistic interactions between 2 agents, additive interactions are indicated by CIs of 1.0, and antagonism by CIs of >1.0. Marked synergism was observed between an Fa (fraction of cells affected) of 0.2 and 0.9 in A549 cells, and 0.5 and 0.9 in H460 cells (Fig. 2). Theoretically, the CI method is most reliable around an Fa of 0.5, and our data therefore suggested a synergistic effect of combined PEM and AMRol in these cell lines. However, an additive effect was only observed at a constant range of administration in H520 cells (Table 2).
sion in A549 (IC50 10 vs. non-treatment, P < 0.0001, and IC50 vs. non-treatment, P = 0.005, respectively) and H460 cell lines (IC50 10 vs. non-treatment, P = 0.003, and IC50 vs. non-treatment, P = 0.03, respectively) (Fig. 3A). AMRol tended to decrease GARFT expression in all three cell lines; however, only a high dose of AMRol, i.e., 100-fold the IC50 value, decreased TS and DHFR expression in H520 cells. 4.4. Antiproliferative effect of TS knockdown in cell growth
4.3. Effects of AMRol on the expression of TS, DHFR and GARFT mRNAs in NSCLC cell lines TS, DHFR and GARFT mRNA expression levels were measured in all experimental samples. AMRol suppressed TS and DHFR expres-
control
IC50
1/10
To determine the effect of TS knockdown on inhibiting cell growth, the gene expression of TS was knocked out by siRNA of TS. The cell proliferation curve and the expression level of mRNA of TS under conditions giving rise to TS knockdown is described
IC50
IC50
10
H520
H460
A549
A
0h
4h
12h
24h
H520
H460
A549
B
Fig. 5. Cell cycle distribution was analyzed by flow cytometry. Exposure to AMRol (0.64 lM/ml) arrested the cell cycle in S-phase in all cell lines in a time-dependent manner (B). A dose-dependent increase in S-phase cells was observed 24 h after exposure to AMRol in all cell lines (A). Cell cycle distribution is expressed as the percentage of cells in the different phases (G0/G1, S, G2/M). Results are expressed as a bar graph to indicate the percentage of cells in different phases of the cell cycle in each sample (C). The cell growth of cell synchronization group was suppressed compared to that of control in A549 and H520 (D).
78
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79
C
D
Fig. 5 (continued)
Fig. 3B, and C. The cell growth of TS knockdown group was inhibited compared to that of the control group. 4.5. Western blotting analysis of TS protein expression in NSCLC cell lines At the protein level, AMRol reduced TS expression in a dosedependent manner in all three cell lines (Fig. 4).
AMR groups was suppressed compared with RTV of single agents (PEM, AMR). In addition, the curve of the combination group was less than the estimated additive effect curve. In A549 groups tumor growth was able to be observed to the point of day 28, but in H520 groups, the observation of tumor growth was terminated by progression of tumor size or tumor volume on day 19. No significant change was observed to evaluation of RBW change in four groups.
4.6. Analysis of cell cycle distribution
5. Discussion
AMRol treatment (IC50 concentration) resulted in an increase in the fraction of cells in S-phase after 24 h in A549, H460 and H520 cells. The increased number of cells in S-phase was most pronounced after 24 h, with 26%, 29% and 59% of A549, H460 and H520 cells, respectively, arrested in S-phase (Fig. 5A–C). We also performed variation analysis in cases of dose gradient administration (IC50 1/10, IC50, and IC50 10). The highest increase in the G2/M phase cell population was observed at IC50 1/10. By contrast, an increase in the number of cells in Sphase was observed at IC50 and IC50 10 in all cell lines. All cell lines showed a pronounced propensity to peak in G2/M phase at a dose of IC50 1/10, and to peak in S phase at a dose equal to IC50. Then, we compared the efficacy of PEM under definite conditions cell synchronization (phase G1/S) with control (Fig. 5D). The cell growth of synchronization group was suppressed compared to that of control.
This study showed the synergistic effect of combined PEM and AMRol treatment on growth inhibition in NSCLC cell lines. We evaluated the synergistic effect between PEM and AMRol using the combination index method with Calcusyn computational software, and investigated the underlying mechanisms of this synergistic effect by comparison with AMRol and PEM alone with respect to TS expression and cell cycle modulation. Expression of TS was down-regulated in A549 and H460 cells following AMRol treatment, while no significant change in TS expression was observed in H520 cells. Other enzymes associated with folic acid, such as GARFT and DHFR, were suppressed by AMRol in a dose-dependent manner in all cell lines. This effect of AMR against folic acid-associated enzymes has not been reported previously, and this finding supports our hypothesis that AMRol synergizes with PEM to suppress the expression of these enzymes [9]. In lung cancer, it was previously reported that higher TS expression was observed in squamous cell carcinoma compared to adenocarcinoma [13]. It has also been reported that low TS expression is a predictive factor for overall survival in patients with malignant pleural mesothelioma treated with PEM-based chemotherapy [14]. Our results are consistent with these previous reports, and
4.7. In vivo tumor growth inhibition assay We evaluated the efficacy and adverse effect of PEM and AMR by RTV and RBW, respectively (Fig. 6A and B). The RTV of PEM/
79
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79
A
B
cell carcinoma cell line, and this synergy is due to the modulation of TS expression and cell cycle progression mainly via AMR. Our results suggest a new option for the treatment of NSCLC with preexisting antitumor agents. The safety and feasibility of this combination should be addressed in future studies.
Conflict of Interest The authors report no conflicts of interest. No financial support for this study was provided. Acknowledgement Kiyomi Kawakita’s acknowledged.
technical
assistance
is
gratefully
References
C
Fig. 6. RTV of combination groups was suppressed compared with RTV of single agents (PEM, AMR). In addition, the curve of the combination group was less than the additive effect curve (A). As for RBW which reflects toxicity effect, no significant change was observed in four groups (B). Macroscopic images showed the highest anti-tumor effect in PEM/AMR groups in A549- and H520-bearing mice (C).
AMR plays an important role in the synergism between AMR and PEM for lung cancer treatment. We performed cell cycle analysis to further investigate the mechanism of this synergy, and observed that AMR increased the proportion of cells in S phase at the effective dose. Previous studies showed that topoisomerase inhibitors increased the proportion of cells in S phase [15], and our findings are consistent with these studies. These results suggest that this synergy is partly caused by AMRol increasing the number of cells in S-phase, because PEM exerts a good antitumor effect in such cells [9]. PEM treatment does not provide any benefit to patients with squamous cell lung cancers. However, PEM showed a good effect when TS was suppressed by AMR in our study, and this result suggests the possible use of PEM for the treatment of squamous cell carcinoma. Regarding adverse events such as pancytopenia, which is often a matter of concern in the use of AMR, PEM is comparatively safe [16]. The combination of PEM and AMR is an attractive option for reducing the risk of pancytopenia because their combination reduces the dose of each agent. In conclusion, the combination of PEM and amurubicin has a synergistic effect in several NSCLC cell lines, including a squamous
[1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancer statistics, CA: Cancer J. Clinicians 61 (2011) 69–90. [2] T.E. Stinchcombe, C.B. Lee, M.A. Socinski, Current approaches to advancedstage non-small-cell lung cancer: first-line therapy in patients with a good functional status, Clin. Lung Cancer 7 (Suppl 4) (2006) S111–117. [3] J.H. Schiller, D. Harrington, C.P. Belani, C. Langer, A. Sandler, J. Krook, J. Zhu, D.H. Johnson, Comparison of four chemotherapy regimens for advanced nonsmall-cell lung cancer, N. Engl. J. Med. 346 (2002) 92–98. [4] P. Goldstraw, D. Ball, J.R. Jett, T. Le Chevalier, E. Lim, A.G. Nicholson, F.A. Shepherd, Non-small-cell lung cancer, Lancet 378 (2011) 1727–1740. [5] P.V. Danenberg, H. Malli, S. Swenson, Thymidylate synthase inhibitors, Semin. Oncol. 26 (1999) 621–631. [6] M.P. Costi, S. Ferrari, A. Venturelli, S. Calo, D. Tondi, D. Barlocco, Thymidylate synthase structure, function and implication in drug discovery, Curr. Med. Chem. 12 (2005) 2241–2258. [7] J. Sigmond, H.H. Backus, D. Wouters, O.H. Temmink, G. Jansen, G.J. Peters, Induction of resistance to the multitargeted antifolate pemetrexed (ALIMTA) in WiDr human colon cancer cells is associated with thymidylate synthase over expression, Biochem. Pharm. 66 (2003) 431–438. [8] C. Shih, V.J. Chen, L.S. Gossett, S.B. Gates, W.C. MacKellar, L.L. Habeck, K.A. Shackelford, L.G. Mendelsohn, D.J. Soose, V.F. Patel, S.L. Andis, J.R. Bewley, E.A. Rayl, B.A. Moroson, G.P. Beardsley, W. Kohler, M. Ratnam, R.M. Schultz, LY231514, a pyrrolo[2,3-d]pyrimidine-based antifolate that inhibits multiple folate-requiring enzymes, Cancer Res. 57 (1997) 1116–1123. [9] R.G. Azrak, S. Cao, H.K. Slocum, K. Toth, F.A. Durrani, M.B. Yin, L. Pendyala, W. Zhang, H.L. McLeod, Y.M. Rustum, Therapeutic synergy between irinotecan and 5-fluorouracil against human tumor xenografts, Clin. Cancer Res.: An official J. Am. Assoc. Cancer Res. 10 (2004) 1121–1129. [10] H. Takiuchi, S. Kawabe, M. Gotoh, K. Katsu, Thymidylate synthase gene expression in primary tumors predicts activity of s-1-based chemotherapy for advanced gastric cancer, Gastrointest. Cancer Res. 1 (2007) 171–176. [11] T.C. Chou, Drug combination studies and their synergy quantification using the Chou-Talalay method, Cancer Res. 70 (2010) 440–446. [12] T. Nagano, M. Yasunaga, K. Goto, H. Kenmotsu, Y. Koga, J. Kuroda, Y. Nishimura, T. Sugino, Y. Nishiwaki, Y. Matsumura, Synergistic antitumor activity of the SN-38-incorporating polymeric micelles NK012 with S-1 in a mouse model of non-small cell lung cancer, Int. J. Cancer J. Int. du Cancer 127 (2010) 2699– 2706. [13] P. Ceppi, M. Volante, S. Saviozzi, I. Rapa, S. Novello, A. Cambieri, M. Lo Iacono, S. Cappia, M. Papotti, G.V. Scagliotti, Squamous cell carcinoma of the lung compared with other histotypes shows higher messenger RNA and protein levels for thymidylate synthase, Cancer 107 (2006) 1589–1596. [14] L. Righi, M.G. Papotti, P. Ceppi, A. Bille, E. Bacillo, L. Molinaro, E. Ruffini, G.V. Scagliotti, G. Selvaggi, Thymidylate synthase but not excision repair crosscomplementation group 1 tumor expression predicts outcome in patients with malignant pleural mesothelioma treated with pemetrexed-based chemotherapy, J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 28 (2010) 1534–1539. [15] J.A. Seiler, C. Conti, A. Syed, M.I. Aladjem, Y. Pommier, The intra-S-phase checkpoint affects both DNA replication initiation and elongation: single-cell and -DNA fiber analyses, Mol. Cell. Biol. 27 (2007) 5806–5818. [16] G.V. Scagliotti, P. Parikh, J. von Pawel, B. Biesma, J. Vansteenkiste, C. Manegold, P. Serwatowski, U. Gatzemeier, R. Digumarti, M. Zukin, J.S. Lee, A. Mellemgaard, K. Park, S. Patil, J. Rolski, T. Goksel, F. de Marinis, L. Simms, K.P. Sugarman, D. Gandara, Phase III study comparing cisplatin plus gemcitabine with cisplatin plus pemetrexed in chemotherapy-naive patients with advanced-stage non-small-cell lung cancer, J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 26 (2008) 3543–3551.
Contents lists available at ScienceDirect
Cancer Letters journal homepage: www.elsevier.com/locate/canlet
Synergistic effects of pemetrexed and amrubicin in non-small cell lung cancer cell lines: Potential for combination therapy Yukihisa Hatakeyama, Kazuyuki Kobayashi ⇑, Tatsuya Nagano, Daisuke Tamura, Masatsugu Yamamoto, Motoko Tachihara, Yoshikazu Kotani, Yoshihiro Nishimura Division of Respiratory Medicine, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan
a r t i c l e
i n f o
Article history: Received 30 December 2012 Received in revised form 10 September 2013 Accepted 14 September 2013
Keywords: Non-small cell lung cancer Thymidylate synthase Pemetrexed Amrubicin
a b s t r a c t The purpose is to examine the synergistic effect of pemetrexed (PEM) and amrubicin (AMR) on the proliferation of lung cancer cell lines. In vitro, dose-dependent synergistic effects of concurrent PEM and AMRol, which is an active metabolite of AMR were observed in A549 and H460 cells. In real-time RT-qPCR analysis and western blotting, expression of the target enzymes of PEM were suppressed in cells treated with amrubicinol alone. In vivo, AMR/PEM treatment also showed synergistic antitumor activity both in A549-bearing and H520-bearing mice. PEM and AMR work synergistically to inhibit the proliferation of several different lung cancer cell lines. Ó 2013 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Lung cancer is the leading cause of cancer-related mortality worldwide [1]. Non-small cell lung cancer (NSCLC), which includes adenocarcinoma, squamous cell carcinoma, large cell carcinoma and bronchioloalveolar carcinoma, accounts for nearly 85% of all cases of lung cancer [2]. In the past few decades, there has been a tremendous increase in the understanding of the biological mechanisms that underlie NSCLC, which has led to novel therapeutic strategies. Despite such progress in molecular targeted therapies, anti-cancer cytotoxic drugs are still essential options for the management of patients because of recurrent diseases and acquired drug resistance. Systemic chemotherapy [3] such as platinum doublet therapy (cisplatin and third-generation drugs) is still recommended as first-line therapy in advanced-staged NSCLC [4]. Given that lung cancer results in a poor prognosis overall and requires many therapeutic options for various clinical courses and phenotypes, novel combination therapies are desired. We investigated the synergistic effects of the two cytotoxic drugs, pemetrexed (PEM) and amrubicin (AMR), which arrest tumor cell cycle at the same phase. Inhibition of DNA synthesis is one of the major antitumor mechanisms. PEM is an antifolate drug with a similar
⇑ Corresponding author. Tel.: +81 78 382 5846; fax: +81 78 382 5859. E-mail address: [email protected] (K. Kobayashi). 0304-3835/$ - see front matter Ó 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.canlet.2013.09.019
structure to folate that inhibits three enzymes: thymidylate synthase (TS), which is essential for DNA replication and repair [5,6], and dihydrofolate reductase (DHFR) and glycinamide ribonucleotide transformylase (GARFT), which are involved in DNA and RNA synthesis [7,8]. Anticancer drugs that target enzymes such as TS exert their cytotoxic effect during S phase of the cell cycle [9]. In contrast, AMR is a topoisomerase inhibitor that induces the accumulation of cancer cells in S phase by suppressing TS activity [10]. The synergistic effect of amrubicin and pemetrexed with respect to cell cycle progression or TS expression levels has not been reported in lung cancer cells. We hypothesized that a combination of PEM and AMRol, the active metabolite of AMR, would have synergistic effects on lung cancer cells by inducing cell cycle arrest in S phase and suppressing TS expression. We evaluated the synergistic effects of PEM and AMRol on cancer cell proliferation and TS expression in lung cancer cell lines.
2. Materials and methods 2.1. Cell culture and reagents The NSCLC cell lines, A549 (adenocarcinoma), H460 (large cell lung carcinoma) and H520 (squamous cell carcinoma), were obtained from American Type Culture Collection (Manassas, VA, USA). All cells were cultured in RPMI 1640 medium (Sigma, St. Louis, MO, USA) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin (Wako, Osaka, Japan) under 5% CO2 at 37 °C. PEM was purchased from Eli Lilly & Co. (Indianapolis, IN, USA). AMRol was obtained from Dainippon Sumitomo Pharmaceuticals Co., Ltd. (Osaka, Japan).
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79 Table 1 The primer sequences for real-time RT-qPCR of the PEM target enzymes. Primer sequences (50 –30 ) Thymidylate synthase (TS)
Dihydrofolate reductase (DHFR)
Glycinamide ribonucleotide transformylase (GARFT)
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
Forward: CCTGAATCACATCGAGCCACT Reverse: GAAGAATCCTGAGCTTTGGGAA Forward: GGATAGTTGGTGGCAGTTCTGTT Reverse: TGCATGATCCTTGTCACAAATAGTT Forward: GCTCCCTTCTTTTAAGGGTTCAA Reverse: ACCAGTAACTGTGACTCCGGT Forward: GCACCGTCAAGGCTGAGAAC Reverse: ATGGTGGTGAAGACGCCAGT
2.2. Cell proliferation assay for growth inhibition and drug combination studies To determine the inhibitory effects of PEM and AMRol on cell growth, we used a cell proliferation assay (Cell Counting Kit-8, Dojindo, Kumamoto, Japan) according to the manufacturer’s instructions. A549, H460 and H520 cells were plated at a concentration of 1 104 cells/well in 96-well culture plates, and were treated with each drug at various concentrations for 48 h. Drug interactions between PEM and AMRol were assessed at a fixed concentration ratio using the combination index (CI). Data analysis was performed using computational software (Calcusyn, Biosoft, Oxford, UK), which performs multiple drug dose–effect calculations using the Median Effect methods described by Chou [11]. 2.3. RNA isolation and real-time RT-qPCR Total RNA was extracted from cells using ISOGEN (Nippon Gene, Tokyo, Japan). Single-stranded cDNA was synthesized using ExScript RT reagent kits (Takara, Otsu, Japan). Real-time RT-qPCR was performed using an ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) with primers purchased from Operon Biotechnologies (Tokyo, Japan) (Table 1). Amplifications were performed in duplicate with SYBR Premix Ex Taq (Takara), according to the manufacturer’s instructions. Target mRNA levels were normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the relative mRNA expression levels were calculated. The experiments were performed in triplicate. 2.4. siRNAs The TS siRNA (sc44978) and control siRNA (sc37007) duplexes were obtained from Santa Cruz Biotechnology, CA. Cells were plated in six-well plates at a density of 2 105 cells per well. The siRNA or control siRNA duplexes were mixed with transfection reagent sc36868 (Santa Cruz) in serum-free RPMI-1640 medium as described by the manufacturer’s protocol and added to the plated cells. The cells were used for assessments 48 h after the addition of fresh medium.
75
50 lg/mL propidium iodide. Ten thousand events were acquired on a FACSCalibur (BD Biosciences, San Jose, CA, USA) and analyzed using CellQuest Pro software (BD Biosciences). 2.7. Serum starvation For synchronization of cell cycles, cells grown to approximately 70–80% confluency were washed twice with PBS and starved in RPMI1640 containing 0.5% FBS for 72 h. Cells were washed with regular medium containing serum and further incubated in complete medium for the time points indicated in the experiments (G1/ S phase).
3. Experimental mice model Female BALB/c nude mice (6-weeks-old) were purchased from SLC Japan (Shizuoka, Japan). Mice were inoculated subcutaneously in the flank with 5.0 106 cells/100 ll suspension of A549 and H520. This study was approved by the Institutional Animal Care and Use Committee (Permission number: P130503) and carried out according to the Kobe University Animal Experimentation Regulations. 3.1. In vivo growth inhibition assay The length (a) and width (b) of the tumor masses and body weight (BW) were measured twice a week, and tumor volume (TV) was calculated using TV = (a b2)/2. Relative tumor volume (RTV) on day n was calculated using RTV = TVn/TV0, where TVn is the tumor volume on day n and TV0 is the tumor volume on day 0. Relative body weight (RBW) was calculated using RBW = BWn/BW0. When TV reached 100 mm3, mice were divided into four groups consisting of 5 mice per group (day 0). One group was injected with mouse PEM into intraperitoneal injection at 100 mg/kg/week which is one-third of the maximum tolerated dose (MTD) on day 1, 8, and 15. A second group of mice was treated with AMR at 25 mg/kg, which is the MTD into the tail vein on day 1. A third group of mice was treated with a combination of PEM and AMR at the same dose. A control group of mice (fourth) was treated with sterile PBS under similar conditions into intraperitoneal injection. We evaluated the effects of PEM/AMR by comparing the data between PEM/AMR and the additive effect (expected RTV). Expected RTV was calculated using (RTV of PEM) (RTV of AMR)/(RTV of control), as reported [12]. 4. Results 4.1. Sensitivity of NSCLC cells to PEM and AMRol
2.5. Western blotting The TS protein level was analyzed at four different concentrations of drug. Total cellular protein was isolated with Cell Lysis Buffer M (purchased from Wako, Osaka, Japan) containing proteinase inhibitors (Roche Applied Science, Indianapolis, IN, USA), and equal amounts (30 lg) of protein were separated by SDS-PAGE (5–20% tris/glycine gels, Wako) and transferred to nitrocellulose membranes. A primary rabbit antibody against TS (1:1000, Cell Signaling Technology Inc., Danver, MA) was incubated with the membranes overnight at 4 °C. After washing in TBST (150 mM NaCl, 20 mM Tris, 1% Tween 20, pH 7.4), the membranes were treated with a biotin-conjugated anti rabbit secondary antibody for 1 h at room temperature. The blots were developed using an enhanced chemiluminescence detection kit (Thermo Fisher Scientific Inc., Waltham, MA, USA).
The dose-dependent inhibition of cell proliferation by both drugs was observed in all cell lines (A549, H460 and H520). In clinical settings, lung adenocarcinoma cells are more sensitive to PEM than large cell lung carcinoma and squamous cell carcinoma of the lung. In this study, the IC50 values for PEM and AMRol, which
2.6. Analysis of cell cycle distribution Exponentially growing cells (A549, H460, H520) were seeded in six-well plates and treated with PEM alone at several concentrations according to the IC50 values (A549, 1.6 lM; H460, 1.6 lM; H520, 6.4 lM), with AMRol alone at several concentrations according to the IC50 values (A549, 0.16 lM; H460, 0.16 lM; H520, 0.64 lM), or with both PEM and AMRol for 4 h, 12 h and 24 h. Cells were fixed with 70% cold ethanol at 4 °C for 2 h. The fixed cells were washed twice with PBS containing 0.25 mg/mL RNase at room temperature for 1 h and stained with
Fig. 1. Inhibitory effect of PEM and AMRol. Dose dependent inhibition curves for all cell lines following treatment with PEM and AMRol.
76
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79
A549
H460
H520
Fig. 2. Relative survival rate was evaluated by the combination index. Combination index values were calculated at the 50%, 75% and 90% effective dose (ED). Dose-dependent inhibition of cell growth was observed in the A549 and H460 cell lines. C.I. was below 1 between ED50–ED90 except in H520 cells.
Table 2 A synergistic effect of combined PEM and AMRol in three cell lines. Cell line
Treatment
IC50 (lM)
Combination index 50%
75%
90%
A549 H460 H520
Pem + AMRol Pem + AMRol Pem + AMRol
3.23 ± 2.1 3.28 ± 3.4 4.98 ± 3.3
0.63 ± 0.22 0.93 ± 0.30 1.07 ± 0.49
0.39 ± 0.14 0.66 ± 0.12 0.92 ± 0.37
0.31 ± 0.19 0.53 ± 0.03 0.82 ± 0.31
Fig. 4. Dose-dependent suppression of TS protein expression was observed in A549 and H460 cells, similar to the results of real-time PCR analysis. However, in H520 cells, TS expression did not change significantly following drug treatment.
4.2. Antiproliferative effects of PEM in combination with AMRol works as AMR in the NSCLC cell lines ranged from 1.6 lM (A549, H460) to 6.4 lM (H520), and from 0.16 lM (A549, H460) to 0.64 lM (H520), respectively (Fig. 1). At the value of IC50 AMRol is significantly strong compared to PEM (p = 0.04, 0.06, 0.08, respectively).
Based on the IC50 values of PEM and AMRol, the molar ratio of PEM:AMRol of 1:10 was used for the drug combination studies in all cell lines. Fig. 2 shows the median-effect and the combination index plots. Combination indices (CIs) of <1.0 are indicative of
Fig. 3. All three cell lines were treated with different concentrations of AMRol alone. Expression of TS, DHFR and GARFT mRNAs was down regulated in A549 and H460 cells. In H520 cells, TS and DHFR mRNA expression did not change significantly after AMRol administration (A). The cell growth of TS knockdown group was suppressed compared to that of the control group (B). We validated efficiency of TS suppression caused by treatment of siRNA (C).
77
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79
synergistic interactions between 2 agents, additive interactions are indicated by CIs of 1.0, and antagonism by CIs of >1.0. Marked synergism was observed between an Fa (fraction of cells affected) of 0.2 and 0.9 in A549 cells, and 0.5 and 0.9 in H460 cells (Fig. 2). Theoretically, the CI method is most reliable around an Fa of 0.5, and our data therefore suggested a synergistic effect of combined PEM and AMRol in these cell lines. However, an additive effect was only observed at a constant range of administration in H520 cells (Table 2).
sion in A549 (IC50 10 vs. non-treatment, P < 0.0001, and IC50 vs. non-treatment, P = 0.005, respectively) and H460 cell lines (IC50 10 vs. non-treatment, P = 0.003, and IC50 vs. non-treatment, P = 0.03, respectively) (Fig. 3A). AMRol tended to decrease GARFT expression in all three cell lines; however, only a high dose of AMRol, i.e., 100-fold the IC50 value, decreased TS and DHFR expression in H520 cells. 4.4. Antiproliferative effect of TS knockdown in cell growth
4.3. Effects of AMRol on the expression of TS, DHFR and GARFT mRNAs in NSCLC cell lines TS, DHFR and GARFT mRNA expression levels were measured in all experimental samples. AMRol suppressed TS and DHFR expres-
control
IC50
1/10
To determine the effect of TS knockdown on inhibiting cell growth, the gene expression of TS was knocked out by siRNA of TS. The cell proliferation curve and the expression level of mRNA of TS under conditions giving rise to TS knockdown is described
IC50
IC50
10
H520
H460
A549
A
0h
4h
12h
24h
H520
H460
A549
B
Fig. 5. Cell cycle distribution was analyzed by flow cytometry. Exposure to AMRol (0.64 lM/ml) arrested the cell cycle in S-phase in all cell lines in a time-dependent manner (B). A dose-dependent increase in S-phase cells was observed 24 h after exposure to AMRol in all cell lines (A). Cell cycle distribution is expressed as the percentage of cells in the different phases (G0/G1, S, G2/M). Results are expressed as a bar graph to indicate the percentage of cells in different phases of the cell cycle in each sample (C). The cell growth of cell synchronization group was suppressed compared to that of control in A549 and H520 (D).
78
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79
C
D
Fig. 5 (continued)
Fig. 3B, and C. The cell growth of TS knockdown group was inhibited compared to that of the control group. 4.5. Western blotting analysis of TS protein expression in NSCLC cell lines At the protein level, AMRol reduced TS expression in a dosedependent manner in all three cell lines (Fig. 4).
AMR groups was suppressed compared with RTV of single agents (PEM, AMR). In addition, the curve of the combination group was less than the estimated additive effect curve. In A549 groups tumor growth was able to be observed to the point of day 28, but in H520 groups, the observation of tumor growth was terminated by progression of tumor size or tumor volume on day 19. No significant change was observed to evaluation of RBW change in four groups.
4.6. Analysis of cell cycle distribution
5. Discussion
AMRol treatment (IC50 concentration) resulted in an increase in the fraction of cells in S-phase after 24 h in A549, H460 and H520 cells. The increased number of cells in S-phase was most pronounced after 24 h, with 26%, 29% and 59% of A549, H460 and H520 cells, respectively, arrested in S-phase (Fig. 5A–C). We also performed variation analysis in cases of dose gradient administration (IC50 1/10, IC50, and IC50 10). The highest increase in the G2/M phase cell population was observed at IC50 1/10. By contrast, an increase in the number of cells in Sphase was observed at IC50 and IC50 10 in all cell lines. All cell lines showed a pronounced propensity to peak in G2/M phase at a dose of IC50 1/10, and to peak in S phase at a dose equal to IC50. Then, we compared the efficacy of PEM under definite conditions cell synchronization (phase G1/S) with control (Fig. 5D). The cell growth of synchronization group was suppressed compared to that of control.
This study showed the synergistic effect of combined PEM and AMRol treatment on growth inhibition in NSCLC cell lines. We evaluated the synergistic effect between PEM and AMRol using the combination index method with Calcusyn computational software, and investigated the underlying mechanisms of this synergistic effect by comparison with AMRol and PEM alone with respect to TS expression and cell cycle modulation. Expression of TS was down-regulated in A549 and H460 cells following AMRol treatment, while no significant change in TS expression was observed in H520 cells. Other enzymes associated with folic acid, such as GARFT and DHFR, were suppressed by AMRol in a dose-dependent manner in all cell lines. This effect of AMR against folic acid-associated enzymes has not been reported previously, and this finding supports our hypothesis that AMRol synergizes with PEM to suppress the expression of these enzymes [9]. In lung cancer, it was previously reported that higher TS expression was observed in squamous cell carcinoma compared to adenocarcinoma [13]. It has also been reported that low TS expression is a predictive factor for overall survival in patients with malignant pleural mesothelioma treated with PEM-based chemotherapy [14]. Our results are consistent with these previous reports, and
4.7. In vivo tumor growth inhibition assay We evaluated the efficacy and adverse effect of PEM and AMR by RTV and RBW, respectively (Fig. 6A and B). The RTV of PEM/
79
Y. Hatakeyama et al. / Cancer Letters 343 (2014) 74–79
A
B
cell carcinoma cell line, and this synergy is due to the modulation of TS expression and cell cycle progression mainly via AMR. Our results suggest a new option for the treatment of NSCLC with preexisting antitumor agents. The safety and feasibility of this combination should be addressed in future studies.
Conflict of Interest The authors report no conflicts of interest. No financial support for this study was provided. Acknowledgement Kiyomi Kawakita’s acknowledged.
technical
assistance
is
gratefully
References
C
Fig. 6. RTV of combination groups was suppressed compared with RTV of single agents (PEM, AMR). In addition, the curve of the combination group was less than the additive effect curve (A). As for RBW which reflects toxicity effect, no significant change was observed in four groups (B). Macroscopic images showed the highest anti-tumor effect in PEM/AMR groups in A549- and H520-bearing mice (C).
AMR plays an important role in the synergism between AMR and PEM for lung cancer treatment. We performed cell cycle analysis to further investigate the mechanism of this synergy, and observed that AMR increased the proportion of cells in S phase at the effective dose. Previous studies showed that topoisomerase inhibitors increased the proportion of cells in S phase [15], and our findings are consistent with these studies. These results suggest that this synergy is partly caused by AMRol increasing the number of cells in S-phase, because PEM exerts a good antitumor effect in such cells [9]. PEM treatment does not provide any benefit to patients with squamous cell lung cancers. However, PEM showed a good effect when TS was suppressed by AMR in our study, and this result suggests the possible use of PEM for the treatment of squamous cell carcinoma. Regarding adverse events such as pancytopenia, which is often a matter of concern in the use of AMR, PEM is comparatively safe [16]. The combination of PEM and AMR is an attractive option for reducing the risk of pancytopenia because their combination reduces the dose of each agent. In conclusion, the combination of PEM and amurubicin has a synergistic effect in several NSCLC cell lines, including a squamous
[1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancer statistics, CA: Cancer J. Clinicians 61 (2011) 69–90. [2] T.E. Stinchcombe, C.B. Lee, M.A. Socinski, Current approaches to advancedstage non-small-cell lung cancer: first-line therapy in patients with a good functional status, Clin. Lung Cancer 7 (Suppl 4) (2006) S111–117. [3] J.H. Schiller, D. Harrington, C.P. Belani, C. Langer, A. Sandler, J. Krook, J. Zhu, D.H. Johnson, Comparison of four chemotherapy regimens for advanced nonsmall-cell lung cancer, N. Engl. J. Med. 346 (2002) 92–98. [4] P. Goldstraw, D. Ball, J.R. Jett, T. Le Chevalier, E. Lim, A.G. Nicholson, F.A. Shepherd, Non-small-cell lung cancer, Lancet 378 (2011) 1727–1740. [5] P.V. Danenberg, H. Malli, S. Swenson, Thymidylate synthase inhibitors, Semin. Oncol. 26 (1999) 621–631. [6] M.P. Costi, S. Ferrari, A. Venturelli, S. Calo, D. Tondi, D. Barlocco, Thymidylate synthase structure, function and implication in drug discovery, Curr. Med. Chem. 12 (2005) 2241–2258. [7] J. Sigmond, H.H. Backus, D. Wouters, O.H. Temmink, G. Jansen, G.J. Peters, Induction of resistance to the multitargeted antifolate pemetrexed (ALIMTA) in WiDr human colon cancer cells is associated with thymidylate synthase over expression, Biochem. Pharm. 66 (2003) 431–438. [8] C. Shih, V.J. Chen, L.S. Gossett, S.B. Gates, W.C. MacKellar, L.L. Habeck, K.A. Shackelford, L.G. Mendelsohn, D.J. Soose, V.F. Patel, S.L. Andis, J.R. Bewley, E.A. Rayl, B.A. Moroson, G.P. Beardsley, W. Kohler, M. Ratnam, R.M. Schultz, LY231514, a pyrrolo[2,3-d]pyrimidine-based antifolate that inhibits multiple folate-requiring enzymes, Cancer Res. 57 (1997) 1116–1123. [9] R.G. Azrak, S. Cao, H.K. Slocum, K. Toth, F.A. Durrani, M.B. Yin, L. Pendyala, W. Zhang, H.L. McLeod, Y.M. Rustum, Therapeutic synergy between irinotecan and 5-fluorouracil against human tumor xenografts, Clin. Cancer Res.: An official J. Am. Assoc. Cancer Res. 10 (2004) 1121–1129. [10] H. Takiuchi, S. Kawabe, M. Gotoh, K. Katsu, Thymidylate synthase gene expression in primary tumors predicts activity of s-1-based chemotherapy for advanced gastric cancer, Gastrointest. Cancer Res. 1 (2007) 171–176. [11] T.C. Chou, Drug combination studies and their synergy quantification using the Chou-Talalay method, Cancer Res. 70 (2010) 440–446. [12] T. Nagano, M. Yasunaga, K. Goto, H. Kenmotsu, Y. Koga, J. Kuroda, Y. Nishimura, T. Sugino, Y. Nishiwaki, Y. Matsumura, Synergistic antitumor activity of the SN-38-incorporating polymeric micelles NK012 with S-1 in a mouse model of non-small cell lung cancer, Int. J. Cancer J. Int. du Cancer 127 (2010) 2699– 2706. [13] P. Ceppi, M. Volante, S. Saviozzi, I. Rapa, S. Novello, A. Cambieri, M. Lo Iacono, S. Cappia, M. Papotti, G.V. Scagliotti, Squamous cell carcinoma of the lung compared with other histotypes shows higher messenger RNA and protein levels for thymidylate synthase, Cancer 107 (2006) 1589–1596. [14] L. Righi, M.G. Papotti, P. Ceppi, A. Bille, E. Bacillo, L. Molinaro, E. Ruffini, G.V. Scagliotti, G. Selvaggi, Thymidylate synthase but not excision repair crosscomplementation group 1 tumor expression predicts outcome in patients with malignant pleural mesothelioma treated with pemetrexed-based chemotherapy, J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 28 (2010) 1534–1539. [15] J.A. Seiler, C. Conti, A. Syed, M.I. Aladjem, Y. Pommier, The intra-S-phase checkpoint affects both DNA replication initiation and elongation: single-cell and -DNA fiber analyses, Mol. Cell. Biol. 27 (2007) 5806–5818. [16] G.V. Scagliotti, P. Parikh, J. von Pawel, B. Biesma, J. Vansteenkiste, C. Manegold, P. Serwatowski, U. Gatzemeier, R. Digumarti, M. Zukin, J.S. Lee, A. Mellemgaard, K. Park, S. Patil, J. Rolski, T. Goksel, F. de Marinis, L. Simms, K.P. Sugarman, D. Gandara, Phase III study comparing cisplatin plus gemcitabine with cisplatin plus pemetrexed in chemotherapy-naive patients with advanced-stage non-small-cell lung cancer, J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 26 (2008) 3543–3551.