Synergistic influence of sucrose and abscisic acid on the genes involved in starch synthesis in maize endosperm

Carbohydrate Research 346 (2011) 1684–1691

Contents lists available at ScienceDirect

Carbohydrate Research journal homepage: www.elsevier.com/locate/carres

Synergistic influence of sucrose and abscisic acid on the genes involved in starch synthesis in maize endosperm Jiang Chen a, Binquan Huang a, Yangping Li a, Hai Du a, Yong Gu a, Hanmei Liu b, Junjie Zhang b, Yubi Huang a,⇑ a b

Maize Research Institute, Sichuan Agricultural University, Chengdu 611130, China College of Life Science, Sichuan Agricultural Universities, Ya’an 625014, China

a r t i c l e

i n f o

Article history: Received 17 March 2011 Received in revised form 20 April 2011 Accepted 3 May 2011 Available online 10 May 2011 Keywords: Maize endosperm Starch synthesis Sucrose and abscisic acid Regulation

a b s t r a c t Starch is the major carbon reserve in plant storage organs, the synthesis of which is orchestrated by four major enzymes, ADP-glucose pyrophosphorylase, starch synthase, starch-branching enzyme and starchdebranching enzyme. There is available much information on the function of these key enzymes; however, little is known about their transcriptional regulation. In order to understand the transcriptional regulation of starch biosynthesis, the expression profiles of 24 starch genes were investigated in this work. The results showed major transcriptional changes for 15 of the 24 starch genes observed in maize endosperm, most of which are elevated at the early and middle stages of the developing endosperm. Sucrose, abscisic acid (ABA) and indole-3-acetic acid (IAA) had a significant correlation with the expression of 15 genes, indicating that sugars and phytohormones might take part in the regulation of starch synthesis. Also, we found that there is interaction of abscisic acid and sucrose on regulation the expression of these genes. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction Starch is an insoluble polymer of glucose (Glc) produced by the majority of higher plant species and plays important roles in agriculture, industry and human consumption. The production of starch in higher plants is orchestrated by four major types of enzymes, namely ADP-glucose pyrophosphorylase (EC 2.7.7.27, AGPase), starch synthase (EC2.4.1.21, SS), starch-branching enzyme (EC 2.4.1.18, SBE), and starch-debranching enzyme (EC 3.2.1.68, DBE). Starch synthesis begins with the synthesis of ADPG from Glu-1-P and ATP via AGPase. SS catalyzes linear chain elongation by addition of a Glc unit donated from the nucleotide sugar (ADP-Glc) to the nonreducing end of an acceptor chain. Branch linkages are formed by the action of SBE, which cleaves a linear chain and transfers the released fragment to a C6 hydroxyl group of the same or a neighboring chain. DBE hydrolyzes branch linkages, and genetic evidence indicates that this function is necessary for plants in order to accumulate crystalline starch.1 Starch has two major components, the basically linear a-polyglucan amylose and the branched a-polyglucan amylopectin. It is generally held that granule-bound starch synthase is responsible Abbreviations: DAP, day after pollination; ABA, abscisic acid; GA3, gibberellic acid; IAA, indole-3-acetic acid; ZT, zeatin; HPLC, high-performance liquid chromatography; FW, fresh weight. ⇑ Corresponding author. Tel.: +86 139 0816 0283. E-mail address: [email protected] (Y. Huang). 0008-6215/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.carres.2011.05.003

for amylose synthesis, located within the starch granules, while other isoforms of starch synthase, together with starch-branching enzymes, synthesize amylopectin.2 A greater complexity in plant starch biosynthesis is that, although the a-(1?4)- and a-(1?6)glucosidic linkages of glycogen in bacteria and animals can possibly be synthesized by a single form of glycogen synthase and glycogen branching enzyme, starch in higher plants is formed by multiple types of SS (SSI, SSII, and SSIII), BE (BEI and BEII), and DBE [isoamylase (ISA) and pullulanase (PUL)].3 Multiple classes of SBE, SS, and DBE are highly conserved in the plant kingdom.4 Analysis of the expression patterns of individual genes is helpful for us to elucidate the regulation model. It is known that phytohormones are of particular significance given their role in the regulation of germination, growth, reproduction, and the protective responses of plants against stress.5 They are recognized as functioning in complex signaling networks, often keeping a balance6,7 or crosstalk with each other8–10 in plant metabolism. On the other hand, sugar signaling is a well-established phenomenon in a number of plants. A diverse array of plant developmental, physiological and metabolic processes are known or believed to be regulated in response to alterations in the levels or flux of soluble sugars.11–14 Some studies have shown that phytohormones correlated with sugars take part in the metabolic processes of the plant.15,16 In order to elucidate the regulation model, four main phytohormones (ABA, GA, IAA, and ZT), along with sugars (sucrose and

J. Chen et al. / Carbohydrate Research 346 (2011) 1684–1691

glucose), were chosen to investigate their role in the starch synthesis gene expression. We presumed that phytohormones and sugars might have taken part in the expression of starch synthesis genes and regulated their expression. In the present study, the expression pattern of starch synthesis genes in developing maize endosperm were measured by quantitative real-time PCR. The results were compared with the contents of the common signals (sugars and hormones). The present observations reveal that genes involved in starch synthesis show differences in expression and demonstrate special properties at various stages. Some of these genes strongly express in maize endosperm, and most are elevated at early- and middle-stages of the developing endosperm. And the content of sucrose, ABA and IAA significantly correlate with the pattern of gene expression. A series of treatments were used in order to clarify the effect of the sugars and phytohormones on the regulation of the starch synthesis genes. It is interesting that sucrose combined with ABA can significantly induce the expressions for the genes that mainly express in maize endosperm. 2. Materials and methods 2.1. Plant materials and growth conditions Maize seedlings (08-614 inbred line, Chinese Elite Corn) were grown in the field in Ya’an, Sichuan, in April, 2010. Developing endosperms of the grains were collected from a maize plant at 7, 12, 17, 22, 27, and 32 days after pollination (DAP) for mRNA expression and the analysis of sugars and phytohormones. DAP 10 grain endosperms were chosen for the induction treatments. First, sugar and phytohormones were used separately to give the induction treatments. Sugar induction treatments consisted of the maize endosperms with MS medium17 supplemented with 200 mM sucrose, while phytohormone induction treatments did that respectively with 100 lM ABA, 100 lM GA, 100 lM IAA, and 100 lM ZT. All concentrations refer to the work of Acevedo-Hernández et al.18 Unsupplemented MS medium was used as the control. In order to elucidate the connection of sugar and phytohormones, 200 mM sugars combined with 100 lM of each phytohormone with MS medium were used to treat to the maize endosperms. Mannitol (200 mM) was used instead of sucrose as a second control in order to eliminate the influence of osmotic pressure. Considering that all the factors must have enough time to have function, the maize endosperms were harvested after 24-h treatments. 2.2. Sequence retrieval and primer design The genes encoding four major proteins involved in the core pathway of starch biosynthesis, ADP-Glc pyrophosphorylase (AGPase), starch synthase (SS), starch branching enzyme (BE), debranching enzyme (DBE), were selected for our study. We retrieved maize genomic sequences of these starch synthesis genes from the National Center for Biotechnology Information database (NCBI, http://www.ncbi.nlm.nih.gov/), as referenced by Hannah,19 Yan et al.20 and Huang et al.21 Then more detailed sequence information was obtained by BLASTN searches in Maize Sequence (http:// www.maizesequence.org). Primers for q-RT-PCR were designed specially, for example, the length about 200 bp across the gene intron structure. Gene details for PCRs are presented in Table 1. 2.3. RNA extraction and real-time quantitative RT-PCR analysis Total RNA was isolated by a Total RNA Extraction Kit (TIANGEN Biotech Co., Ltd, German). Reverse transcription was carried out by using Prime Script™ reagent Kit Perfect Real Time (TaKaRa, Japan),

1685

which contains the process of removing contaminating genomic DNA. Real-time quantitative reverse transcriptase polymerase chain reaction (RT-PCR) assays were achieved by using an iCycler instrument model 5.0 (Bio-Rad, Hong Kong). The PCR mixture contained (in a total volume of 20) 0.5 vol of forward primer, 0.5 vol of reverse primer, 1 vol of cDNA, 8 vol of doubly distilled H2O, and 10 vol of SYBR Green II (SYBR PrimeScript™ RT-PCR Kit Perfect Real Time from TaKaRa, Japan). 2.4. Hormone extraction procedure The methods mainly refer to those of Shindy and Smith.22 In different experiments, about 1 g of frozen maize endosperms was ground in cold 80% (v/v) aq MeOH with a mortar and pestle. The macerate was transferred to a flask with fresh MeOH, and the volume was adjusted to 10 mL with MeOH. The tissue was allowed to extract for 12 h at 4 °C and centrifuged (6,500g, 15 min, 4 °C). The centrifugate was extracted twice more, and all the supernatants were combined to give about 30 mL total. After concentrating at 37–40 °C under vacuum, the aqueous phase was collected. Then an equal volume of petroleum ether was added to the aqueous phase. After shaking for about 20 min, the aqueous phase was separated via a separatory funnel. This procedure was repeated twice and the aqueous extracts were combined. After removing the remaining petroleum ether by vacuum evaporation, the aqueous phase was adjusted to pH 2.8 with 1% (v/v) HCl, and an equal volume of EtOAc was added. Attention is drawn to the fact that both the aqueous phase and EtOAc phase were maintained. The collected ethyl acetate was concentrated under vacuum at 40–45 °C in order to remove the ethyl acetate, and 2 mL of precooled MeOH was added to it for ABA, IAA and GA analysis (A). After the remaining aqueous phase was adjusted to pH 8.6 with 1% (w/v) NaOH, an equal volume of n-butanol was added to the aqueous phase, and the phases were partitioned three times. The n-butanol phases were combined and concentrated under vacuum at 55–60 °C to remove the n-butanol phase. Pre-cooled MeOH (2 mL) was added to the concentrate for ZT analysis (B). At last, a combination A and B (5 mL) was prepared for the sample. 2.5. HPLC analysis Shimadzu HPLC systems were used in our experiments, which consisted of two LC-20AD pumps, SIL-20AC auto sampler, CTO20AC column oven, SPD-M20A detector. A reversed-phase C18 column (25 cm  4.6 mm, 5 lm, shim-pack VP-ODS, Japan) was used for separation. The mobile phase was a mixture of water and glacial HOAc (0.6% v/v), eluting under gradient conditions as detailed in Table 2, with a 1.00 mL/min flow rate. 2.6. Measurement of sugar The determination of glucose was carried out by using the iodometry method, a classical method referred to Shaffer and Hartmann.23 Constant weight material (50 mg) was added to 4 mL of EtOH (80% v/v) and left at 80 °C for 30 min. This step was repeated three times and the supernatants were combined. Distilled water was added to each sample to 25 mL, and the mixture was then transferred to an iodine flask. Then 25 mL standard I2 solution was added to the iodine flask using a burette. NaOH (2 M) was slowly added to the iodine flask until the solution appeared yellow. Then the solution was rendered acidic using 2 mL of 6 M HCl, and the mixture was immediately titrated with Na2S2O3 solution until the solution appeared yellow. Starch indicator (2 mL) was added, and the titration was stopped when the blue color disappeared. The glucose content was then calculated.

1686

J. Chen et al. / Carbohydrate Research 346 (2011) 1684–1691

Table 1 Gene information for RT-PCR Gene name

Acc. No.

Primer sequence (50 –30 )

small

ZmAGPS1

DQ118038.1

small

ZmAGPS2

GU550073.1

small

ZmAGPS3

AY032604

large

ZmAGPL1

DQ406819.1

large

ZmAGPL2

NM_001112247.1

large

ZmAGPL3

NM_001127632.1

ZmSSI

AF036891.2

Starch synthase IIa

ZmSSIIa

AF019296.1

Starch synthase IIb1

ZmSSb1

AF019297.1

Starch synthase IIb2

ZmSSb2

EF472249.1

Starch synthase IIc

ZmSSIIc

EU284113.1

Starch synthase IIIa

ZmSSIIIa

AF023159.1

Starch synthase IIIb1

ZmSSIIIb1

EF472250.1

Starch synthase IIIb2

ZmSSIIIb2

EF472251.1

Granule-bound starch synthase I

ZmGBSSI

AY109531.1

Granule-bound starch synthase IIa

ZmGBSSIIa

EF471312.1

Granule-bound starch synthase IIb

ZmGBSSIIb

EF472248.1

Starch branching enzyme I

ZmSBEI

AY105679.1

Starch branching enzyme IIa

ZmSBEIIa

U65948.1

Starch branching enzyme IIb

ZmSBEIIb

EF433557.1

Starch branching enzyme III

ZmSBEIII

EU333945.1

SPullulanase

ZmPUL

AF080567.1

Isoamylase II

ZmISA2

AY172633.3

Isoamylase III

ZmISA3

AY172634.2

F*:GACGAAGAAGGGAGGATT R*:ATTGTTCACGGAGGAGC F:ATTACCGTTGCTGCCCTACC R:ACTGCTCTCCTTTCGGTTTCTC F:AACTCTGCTTCGCTCAACC R:TGCTCCTCAAATAGCCACAT F:AAGAATGCGAGGATAGGG R:ACGACAGTGATGCCAGAT F:GATGGGTGCGGATTTGTAT R:TTGGAACGCCCTCTTTGT F:GGGAGCGGACACCTATGAA R:AGCCTCTTGGATGCCCTTAC F:CTTTCGGTGAGAATGGAGAGC R:GAGGACTTGTGTTCCCTGTATG F:GGGGAAGTAGGCAGGAAATCAT R:CAGATAAACAGGCAGGAGTGC F:CGCACTTCTGCCTGTCTATCTA R:AGTGGTCGATGTAGTGTTCAGG F:TACCTATGGGAGCTGAGGACAT R:GTCTCGAACGTGTAGTTGGTGT F:TATCACCAACGAGACCCTTCG R:AGGAACCATCACTCTGACCACT F:GCTTCTTCTGTCGTTCTGCTCT R:GCGTAGTTTTCCTTGTGTAGCC F:GAGAGAAGAGAAAGGGAGAGTGC R:CACGTACTTCGAGTGGCTCAGTA F:GACAGGTGGTTTTACTGGGTTC R:GTGGCTCGTCATAGGTTAGACA F:CATCTACAGGGACGCAAAGAC R:CGAAGGACGACTTGAATCTCTC F:GGGAAAGAAGAAGATGGAGGAG R:GCTCGGGACGATAATGAAGTC F:GTTGAGTTGGATGGTGTCCTTC R:GAGAGCCTTTGCTTCAGTTACC F:CCTGTGTGGCTTATTACCGTGT R:GCCTCCTTGTCTTCTTTGCTAC F:CTTCAGAGATGAGGTGCTTCCA R:GAGTCCCAAAACGGCTACTTG F:GTGGGGTAGGTTTTGACTATCG R:CCTCCTATTTGTCAGTGTGTGC F:GTCCACCCAACATTCTTCACTG R:CACACCAACACGATACGACTG F:GAACTGTCAAAACTCCCTCCAG R:CTGGGTTACTTGCATAGCTTCC F:GGGGGATGAATGTGGAAACTC R:CTCTGGAAAATGTCTGCTCGTC F:CTGAGAGAGGCAACCAAGATG R:AGAACACCAGAAGCAGGCAAAC

Enzymes

Full gene name

AGPase

ADP-glucose pyrophosphorylase subunit1 ADP-glucose pyrophosphorylase subunit2 ADP-glucose pyrophosphorylase subunit3 ADP-glucose pyrophosphorylase subunit1 ADP-glucose pyrophosphorylase subunit2 ADP-glucose pyrophosphorylase subunit3 Starch synthase I

SSS

GBSS

SBE

Starch debranching enzyme: DBE

Others

Brittle-244

Shrunken-245

SU246

Dull-1 (du1)47

WAX48

Amylose-extender (ae)49

SU150

Acc no.: GenBank accession number in NCBI. Primer abbreviations: F, forward; R, reverse.

*

3. Results

Table 2 Gradient conditions Time (min)

Percentage of methanol (%)

Time (min)

Percentage of methanol (%)

0 10

96 70

20 40

60 50

The determination of sucrose was carried out using the anthrone–sulfuric acid method as reported by Dubois et al.24 The first phase of the preparations was the same as that for the measurements of glucose. For sucrose, 10 mL of the solution was decolorized with charcoal, then 0.1 mL of KOH (30% w/v) was added to the sample, and the mixture was heated at 100 °C for 10 min, after which time 3 mL of the anthrone–sulfuric acid reagent (150 mg anthrone and 76% (v/v) sulfuric acid) was also added to the sample with warming at 40 °C for 15 min. The sucrose content was determined at 620 nm.

3.1. Phylogenetic relationships among the genes for starch synthesis in maize, rice and Arabidopsis The present study focused on the genes encoding four classes of enzymes, namely AGPase, SS (and GBSS), BE, and DBE (ISA and PUL). For each enzyme class, the phylogenetic relationships among the maize genes and their corresponding homologues in widely studied monocot rice (Oryza sativa) and the model dicot Arabidopsis thaliana were examined. The databases of the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) were searched for general entries of nucleotide sequences. Multiple sequence alignment analyses for the deduced amino acid sequences were carried out using the CLUSTAL W program (http://clustalw.genome.jp/), and the NJ tree with bootstrapping analysis was generated by using MEGA version 4.0. The results of the comparisons are presented as dendrograms in Figure 1.

J. Chen et al. / Carbohydrate Research 346 (2011) 1684–1691

The results showed that sequences for the AGPase gene can be divided into two main groups corresponding to small and large subunits (Fig. 1A), and maize AGPase large subunits were more recently evolved than the small subunits. The biggest class of starch-synthesizing genes, the starch synthases (SS), was phylogenetically separated into five subgroups corresponding to the five subclasses of SS genes: SSI, SSII, SSIII, SSIV, and GBSS (Fig. 1B). The maize SSIII subclass appeared to be the most ancient relative to the other SS. And SSIIa, SSIIc, SSI and GBSSI genes had homologues in maize. SBEIII emerged much earlier than SBEI and SBEII in maize (Fig. 1C). All the maize debranching enzymes had homologues, ZmISA with AtISA, and ZmPUL with OsPUL (Fig. 1D). 3.2. Expression patterns of each class of genes during endosperm development The expression patterns for the 24 starch synthesis genes were determined by RT-PCR analysis. All the genes involved in starch synthesis have expressions in the developing endosperm, although they are somewhat diverse (Fig. 2). The expression profiles throughout seed development for each class of genes are described below. 3.2.1. AGPase AGPl2, AGPl3, AGPs2 and AGPs3 were shown to be vigorously expressed at the early phase of grain development, their transcripts being abundant from the onset of seed development, sharply rising

1687

to peak at 12 DAF, then declining abruptly thereafter (Fig. 2A). All throughout seed development, the transcript level of AGPs1 was relatively low, while AGPl1 was scarcely expressed. These results suggest that the expression of AGPl2, AGPl3, AGPs2 and AGPs3 contribute to most of the AGPase activities and possess development stage-specific expression properties. 3.2.2. SS and GBSS The expression profiles of the SS and GBSS genes were highly variable (Fig. 2B).The SSI transcript level was already high at the earliest phase of seed formation, slightly increasing to peak at 12 DAF, then remaining almost constant through the late-milk stage of endosperm development (32 DAF). This is consistent with the fact that SSI is the major SS form in cereal endosperm.25 However, it is interesting that, among the SS genes, SSIIa and SSIIIa appeared to be the most vigorously expressed, more so than SSI. At the same time, SSIIc had high gene expression. Across all sampling periods, the transcripts of SSIIb (SSIIb1 and SSIIb2) and SSIIIb (SSIIIb1 and SSIIIb2) were consistently lower than those of SSIIa, SSIIIa, SSI and SSIIc. In the test of SS genes, almost all have their maximum transcripts at the earliest period of developing endosperm and decrease at the late stage. The GBSSI transcripts were low at the beginning of seed development. They increased at 12 DAF and then had a low expression (Fig. 2B). Until the end of endosperm, they dramatically increased to peak at 32 DAF. The GBSSIIb expression showed a single peak at 12 DAF. Clearly, the amount of GBSSI transcript was higher than

Figure 1. Dendrograms of gene families encoding four classes of starch-synthesizing enzymes of maize (Zea mays), rice (Oryza sativa), and Arabidopsis thaliana. (A) ADPglucose pyrophosphorylase (AGPase); (B) starch synthase [soluble starch synthase (SS) and granule-bound starch synthase (GBSS)]; (C) starch branching enzyme (SBE); (D) starch debranching enzyme (DBE) [isoamylase (ISA) and pullulanse (PUL)]. The GenBank number of each gene is shown in parenthesis. Genes from maize, rice and Arabidopsis are indicated by the prefixes Zm, Os and At, respectively.

1688

J. Chen et al. / Carbohydrate Research 346 (2011) 1684–1691

Figure 2. Results of RT-PCR analysis of partial genes in maize. Total RNA samples obtained from developing endosperm for RT-PCR were used to measure RNA expression levels of the partial starch synthesis genes in maize. All of these are relative expression, and the expression of 18S is made as the loading control. Thermocycling times and temperatures were as follows: 94 °C for 4 min, followed by cycles of 94 °C for 30 s, respective annealing temperature for 30 s, 72 °C for 40 s and a final extension step of 72 °C for 4 min. A is the expression of AGPase; B for SS; C for GBSS; D for SBE; E for DBE.

that of GBSSIIb, and markedly higher than that of GBSSIIa, which was scarcely expressed throughout the developing endosperm. 3.2.3. SBEx Compared with the number of transcripts of the other three SBEs, those of SBEIIa showed a low level in the developing endosperm. The transcript levels of SBEI, SBEIIb and SBEIII were already high at the earliest phase of seed formation, slightly increased to peak at 12 DAF, and then were lower expressed (Fig. 2C). Though there was some diversity, it was clear that they had a coexpression. 3.2.4. DBE The transcripts of ISA2 and PUL rose steeply from 7 DAF to reach peak levels at 12 DAF, then gradually decreased to lower but still significant levels at 32 DAF (Fig. 2D), while ISA3 was scarcely expressed during maize endosperm development. This suggests that ISA2 and PUL play important roles in the whole endosperm starch accumulation.

Through the sampling periods, though some genes have their maximum transcripts at the late period of developing endosperm, most of the starch synthesis genes generate them at the early and middle period of the developing endosperm. It was obvious that all the genes showed a peak at about 12 DFP. These data suggest that starch synthesis genes have a co-expression in developing maize endosperm. 3.3. Measurements of phytohormones and sugars In the present study, the content of phytohormones and sugars were measured. As shown in Figure 3A, the amounts of ABA and IAA were higher than those of the other two phytohormones. It was clear that the ABA and IAA show a singlet during the endosperm development, with a peak at about early and middle stage of the developing endosperm, as reported by Yang et al. for rice.26 The content of GA decreased gradually during the endosperm development, while the content of ZT was the least. Sucrose showed a singlet during the endosperm development, with the

1689

J. Chen et al. / Carbohydrate Research 346 (2011) 1684–1691 Table 3 Correlations

AGPl1 AGPl2 AGPl3 AGPs1 AGPs2 AGPs3 SSI SSIIa SSIIb1 SSIIb2 SSIIc SSIIIa SSIIIb1 SSIIIb2 GBSSI GBSSIIa GBSSIIb SBEI SBEIIa SBEIIb SBEIII ISA2 ISA3 PUL * **

Figure 3. Time courses of phytohormone and sugar contents in maize grain. A is the content of phytohormone (GA IAA ZT ABA); B is the sugar contents (sucrose and glucose).

ABA

GA

IAA

ZT

Sucrose

Glucose

0.509 0.567 0.46 0.348 0.825* 0.831* 0.836* 0.887* 0.161 0.388 0.66 .954** 0.495 0.605 0.36 0.138 0.569 .817* 0.561 0.753 0.733 0.781 0.041 0.594

0.68 0.457 0.504 0.556 0.601 0.458 0.429 0.539 0.18 0.349 0.567 0.582 0.219 0.281 0.727 0.551 0.568 0.499 0.917* 0.564 0.552 0.568 0.495 0.252

0.182 0.441 0.266 0.104 0.702 0.797 0.808 0.836* 0.333 0.294 0.5 0.907* 0.505 0.611 0.02 0.252 0.382 0.765 0.115 0.607 0.613 0.674 0.433 0.636

0.057 0.033 0.192 0.407 0.256 0.364 0.491 0.437 0.268 0.584 0.02 0.609 0.004 0.109 0.165 0.523 0.054 0.33 0.127 0.125 0.113 0.229 0.73 0.277

0.406 0.543 0.414 0.355 0.818* 0.843* 0.798 0.908* 0.165 0.342 0.661 0.971** 0.53 0.639 0.284 0.026 0.535 0.854* 0.43 0.725 0.748 0.786 0.164 0.62

0.574 0.543 0.598 0.593 0.643 0.476 0.47 0.566 0.041 0.225 0.598 0.606 0.288 0.33 0.633 0.536 0.665 0.489 0.874* 0.575 0.58 0.63 0.482 0.363

Correlation is significant at the 0.05 level (2-tailed). Correlation is significant at the 0.01 level (2-tailed).

surprising given that Gao et al. have reported that SBEIIa is mainly expressed in the leaves.28 Through these results, we are convinced that ABA, IAA and sucrose have a strong relationship with the expression of the genes. We hypothesize that ABA, IAA and sucrose could have regulated starch synthesis genes via co-expression in maize endosperm, though the details are not clear.

3.5. Effect of sugar and phytohormone treatments on starch synthesis gene expression peak at about 12 DAP as we reported previously,21 while glucose decreased gradually during the endosperm development (Fig. 3B). The results for sugar content were about the same as the report by Jain et al. in sorghum.27 Phytohormones and sugars show a close relationship to gene expression, for all cases studied had maximum gene expression at the early and middle stages of the developing endosperm. It was thus strongly presumed that the sugar and phytohormone together must play an important role in starch synthesis gene expression. As the results of Gibson15 and Tonini et al.16 show, sugars and phytohormones take part in the plant metabolism, and we thus assume that sugars and phytohormones also take part in the regulation of starch synthesis. 3.4. Correlation analysis between the contents of signals and the gene expression In order to elucidate the relationship between gene expressions and signals, a correlation analysis was made using SPSS between the 24 genes and their signals. As shown in Table 3, ABA, IAA, and sucrose all had a close relationship among the gene expressions. The ABA content significantly correlated with AGPs2, AGPs3, SSI, SSIIa, SSIIIa and SBEI. The sucrose content significantly correlated with AGPs2, AGPs3, SSIIa, SSIIIa and SBEI. Besides, the IAA content significantly correlated with SSIIa and SSIIIa. Including the significantly correlated genes, other genes involved in starch synthesis also have a strong correlation with ABA, IAA and sucrose. Although the SBEIIa genes have a strong correlation with GA and glucose, it is scarcely expressed in maize endosperm, which not

To learn more details about the roles of ABA, IAA and sucrose, a series of treatments were used. First, ABA, IAA and sucrose were used separately to culture the endosperm in vitro as induction treatments. At the same time, 15 of 24 starch synthesis genes, mainly expressed in maize endosperm, were measured by RT-PCT. In order to counter the effect of osmotic pressure, mannitol was added to the MS medium that was chosen as a control. From the results (Fig. 4A), osmotic pressure has little effect on the gene expression involved in starch synthesis. There is little difference between treating with mannitol and treating with nothing at all. All the genes involved in starch synthesis that mainly express in maize endosperm can be up-regulated by sucrose. ABA can inhibit starch gene expression, especially for the AGPs2 (Fig. 4A) and SSIIIa (Fig. 4B), by more than three times. IAA can inhibit starch gene expression, although it is not as serious as ABA except for SSIIIa (Fig. 4B). Then, sucrose combined with phytohormones was used for induction treatment. In order to determine the effects that were indeed induced by the interaction between sucrose and phytohormone, we combined the mannitol with phytohormones as a control, eliminating the effect of osmotic pressure by sucrose (Fig. 4B). The data indicate that most of the genes involved in starch synthesis can be induced in the induction treatment by sucrose combined with ABA (Fig. 4). Most of the gene transcript levels are twice that of the control, especially for GBSSI (Fig. 4C) and SSIIb (Fig. 4D). While sucrose combined with IAA was used to treat the maize endosperm, though the effects are inhibited, most of gene expressions are higher than the control, indicating

1690

J. Chen et al. / Carbohydrate Research 346 (2011) 1684–1691

Figure 4. Effects of sucrose (200 mM) and phytohormone (100 lM), and the synergistic effects of sucrose (200 mM) and phytohormone (100 lM) on the expression of maize starch synthesis genes. In order to directly know the effect, materials were harvested after a 24-h induction treatment. A is the expression of AGPase; B for SS; C for GBSS; D for SBE; E for DBE.

that sucrose plays a more important role in starch synthesis gene regulation. For additional studies, a treatment combining sucrose, ABA and IAA was examined. The results show that the gene expression can be enhanced, but the effect is not just as the treatment by sucrose combined with phytohormones. All in all, sucrose combined with ABA synergistically influences gene expression involved in starch synthesis in maize endosperm.

SSIIa,32 and GBSSI,33 our results show that, including that which has been reported, AGPl2, AGPl3, and SSI, etc. (Fig. 4) can strongly express in maize endosperm. Although some of these genes expressed have peak expressions at the late stage of endosperm development, we can still clearly see that there is a co-expression at the early and middle stage of the developing endosperm, thus proving the opinion put forth by Li et al. that genes involved in starch synthesis are co-expressed.34

4. Discussion 4.1. The starch synthesis gene expression pattern

4.2. Measurements of the contents of sugars and phytohormones

The starch biosynthesis pathway in cereals contains AGPase, SS, BE and DBE proteins.29,30 A total of 24 genes encode these proteins in maize according to the present study. We characterize 24 genes of starch synthesis in maize endosperm, and there are a number of differences among the expression of these genes. Some of the genes strongly express in maize endosperm, while the others have a low expression. Although a number of genes involved in starch synthesis have been reported that mainly express in maize endosperm, such as AGPs2 and AGPs3,31

Many methods are used to measure the content of phytohormone. Two of those which are mostly used are the ELISA assay and an HPLC method. Because the procedure for ELISA is somewhat complicated, we opted for the HPLC method, which has better sensitivity and selectivity. Although there are a great many experiments using HPLC to measure the content of phytohormones,35,36 the effects are different for different tissues. For a multitude of chemical substances in the maize developing endosperm, the process of extraction and separation of phytohormones from develop-

J. Chen et al. / Carbohydrate Research 346 (2011) 1684–1691

1691

References

Figure 5. The chromatogram map (processed) for one of samples. The standard of each phytohormone are shown at top right corner. Each phytohormone is noted in the map.

ing maize endosperm seems to be very difficult, but it is essential for the separation of the phyohormone mixture. In our experiments, gradient conditions were chosen to separate the mixture. From the data in Figure 5 (the original is supplied in the Supplementary data), it is clear that choosing gradient conditions can entirely separate the mixture. At the same time, the sugar contents were measured the traditional way. After the data were analyzed, a close correlation was found between sugar content and gene expression. 4.3. The effect of sucrose and phytohormones It has been reported that the genes for starch metabolism, such as AGPase in Arabidopsis,37 GBSSI in sweet potato,38 AGPase, GBSSI, SSII and SSIII in potato,39–41 and SBE in cassava42,43 are controlled by sugars. Our data suggest that the starch synthesis gene in maize developing endosperm can be induced by sucrose. In our previous report that concerned maize leaves,21 ABA was found to inhibit AGPase gene expression, and the present data indicate ABA can inhibit most of the starch gene expression in maize endosperm, especially for the AGPs2 and SSIIIa, by more than three times. Acevedo-Hernández et al. report that sugar and ABA can co-regulate the gene expression in a light-responsive gene.18 Our results showed that sucrose and ABA also co-regulate the gene expression of starch synthesis gene in the developing endosperm of maize. In conclusion, the expression of starch synthesis genes varies in the developing endosperm of maize. The development of stagespecific expression properties for some genes was observed. There is evidence of extensive co-expression among the starch synthesis genes. And most of these genes show a peak at early and middle stage in the developing endosperm. In order to determine the regulation pattern of these genes, the contents of both the sugars and phytohormones were also measured. The data show that sucrose, ABA and IAA are significantly correlated with starch synthesis gene expressions. After a series of treatments, we find that sucrose and ABA significantly influence gene expression. We presume that sucrose and ABA co-regulate starch gene expression, which could explain the maize expression pattern. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.carres.2011.05.003.

1. Myers, N.; Mittermeier, R.; Mittermeier, C.; da Fonseca, G.; Kent, J. Nature 2000, 403, 853–858. 2. Ball, S.; Morell, M. Annu. Rev. Plant Biol. 2003, 54, 98–108. 3. Hennen-Bierwagen, T. A.; Liu, F.; Marsh, R. S.; Kim, S.; Gan, Q.; Tetlow, I. J.; Emes, M. J.; James, M. G.; Myers, A. M. Plant Physiol. 2008, 146, 1892–1908. 4. Leterrier, M.; Holappa, L.; Broglie, K.; Beckles, D. BMC Plant Biol. 2008, 8, 98–108. 5. Davies, P. J. Plant Horm. 2010, 1–12. 6. Christianson, M.; Warnick, D. Dev. Biol. 1985, 112, 494–497. 7. Sakhabutdinova, A.; Fatkhutdinova, D.; Bezrukova, M.; Shakirova, F.; Bulg, J. Plant Physiol. 2003, 1, 314–319. 8. Schmelz, E.; Engelberth, J.; Alborn, H.; O’Donnell, P.; Sammons, M.; Toshima, H.; Tumlinson, J. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 10552–410557. 9. Bostock, R. Phytopathology 2005, 43, 545–580. 10. Reski, R. Plant Biol. 2006, 8, 277–280. 11. Li, Y.; Smith, C.; Corke, F.; Zheng, L.; Merali, Z.; Ryden, P.; Derbyshire, P.; Waldron, K.; Bevan, M. Plant Cell Online 2007, 19, 2500–2515. http:// www.plantcell.org/ (accessed 04/27/2011). 12. de Sousa, S.; Paniago, M.; Arruda, P.; Yunes, J. Plant Mol. Biol. 2008, 68, 203–213. 13. Silvente, S.; Reddy, P.; Khandual, S.; Blanco, L.; Alvarado-Affantranger, X.; Sanchez, F.; Lara-Flores, M. J. Exp. Bot. 2008, 59, 1279–1294. 14. Rook, F.; Bevan, M. J. Exp. Bot. 2003, 54, 495–501. 15. Gibson, S. J. Exp. Bot. 2004, 55, 253–264. 16. Tonini, P.; Purgatto, E.; Buckeridge, M. Ann. Bot. 2010, 106, 607–616. 17. Murashige, T.; Skoog, F. Physiol. Plant 1962, 15, 473–497. 18. Acevedo-Hernández, G.; León, P.; Herrera-Estrella, L. R. Plant J. 2005, 43, 506– 519. 19. Hannah, L. Maydica 2005, 50, 497–506. 20. Yan, H. B.; Pan, X. X.; Jiang, H. W.; Wu, G. J. TAG Theor. Appl. Gen. 2009, 119, 815–825. 21. Huang, B.; Chen, J.; Zhang, J.; Liu, H.; Tian, M.; Gu, Y.; Hu, Y.; Li, Y.; Liu, Y.; Huang, Y. Plant Mol. Biol. Rep. 2010, 1–10. 22. Shindy, W.; Smith, O. Plant Physiol. 1975, 55, 550–554. 23. Shaffer, P.; Hartmann, A. J. Biol. Chem. 1921, 45, 365–390. 24. Dubois, M.; Gilles, K.; Hamilton, J.; Rebers, P.; Smith, F. Anal. Chem. 1956, 28, 350–356. 25. Cao, H.; Imparl-Radosevich, J.; Guan, H.; Keeling, P. L.; James, M. G.; Myers, A. M. Plant Physiol. 1999, 120, 205–216. 26. Yang, J.; Zhang, J.; Wang, Z.; Zhu, Q.; Wang, W. Plant Physiol. 2001, 127, 315–323. 27. Jain, M.; Chourey, P. S.; Li, Q. B.; Pring, D. R. J. Plant Physiol. 2008, 165, 331–344. 28. Gao, M.; Fisher, D.; Kim, K.; Shannon, J.; Guiltinan, M. Plant Physiol. 1997, 114, 69–78. 29. James, M.; Denyer, K.; Myers, A. Curr. Opin. Plant Biol. 2003, 6, 215–222. 30. Satoh, H.; Shibahara, K.; Tokunaga, T.; Nishi, A.; Tasaki, M.; Hwang, S.; Okita, T.; Kaneko, N.; Fujita, N.; Yoshida, M. Plant Cell Online 2008, 20, 1833–1849. http:// www.plantcell.org/ (accessed 04/27/2011). 31. Rsti, S.; Denyer, K. J. Mol. Evol. 2007, 65, 316–327. 32. Harn, C.; Knight, M.; Ramakrishnan, A.; Guan, H.; Keeling, P.; Wasserman, B. Plant Mol. Biol. 1998, 37, 639–649. 33. Shure, M.; Wessler, S.; Fedoroff, N. Cell 1983, 35, 225–233. 34. Li, L.; Ilarslan, H.; James, M.; Myers, A.; Wurtele, E. J. Exp. Bot. 2007, 58, 3323–3342. 35. Wang, G.; Kuan, S.; Francis, O.; Ware, G.; Carman, A. J. Agric. Food Chem. 1990, 38, 185–190. 36. Liu, H.; Li, Y.; Luan, T.; Lan, C.; Shu, W. Chromatographia 2007, 66, 515–520. 37. Sokolov, L.; Déjardin, A.; Kleczkowski, L. Biochem. J. 1998, 336, 681–687. 38. Wang, S.; Yeh, K.; Tsai, C. Plant Sci. 2001, 161, 635–644. 39. Visser, R.; Somhorst, I.; Kuipers, G.; Ruys, N.; Feenstra, W.; Jacobsen, E. Mol. Gen. Genet. 1991, 225, 289–296. 40. Nakata, P.; Okita, T. Plant Physiol. 1995, 108, 361–368. 41. Kossmann, J.; Abel, G.; Springer, F.; Lloyd, J.; Willmitzer, L. Planta 1999, 208, 503–511. 42. Salehuzzaman, S.; Jacobsen, E.; Visser, R. Plant Sci. 1994, 98, 53–62. 43. Baguma, Y.; Sun, C.; Borén, M.; Olsson, H.; Rosenqvist, S.; Mutisya, J.; Rubaihayo, P.; Jansson, C. Plant Signal. Behav. 2008, 3, 439–455. 44. Hannah, L.; Shaw, J.; Giroux, M.; Reyss, A.; Prioul, J.; Bae, J.; Lee, J. Plant Physiol. 2001, 127, 173–183. 45. Giroux, M.; Hannah, L. Mol. Gen. Genet. 1994, 243, 400–408. 46. Jaynes, T.; Nelson, O. Plant Physiol. 1971, 47, 623–628. 47. Gao, M.; Wanat, J.; Stinard, P.; James, M.; Myers, A. Plant Cell Online 1998, 10, 399–412. http://www.plantcell.org/ (accessed 04/27/2011). 48. Varagona, M.; Purugganan, M.; Wessler, S. Plant Cell Online 1992, 4, 811–820. http://www.plantcell.org/ (accessed 04/27/2011). 49. Kim, K.; Fisher, D.; Gao, M.; Guiltinan, M. Plant Mol. Biol. 1998, 38, 945–956. 50. Whitt, S.; Wilson, L.; Tenaillon, M.; Gaut, B.; Buckler, E. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 12959–12962.