- Email: [email protected]
Syntaxin 1A is required for normal in utero development
Biochemical and Biophysical Research Communications 375 (2008) 372–377
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Syntaxin 1A is required for normal in utero development John E. McRory a, Renata Rehak a, Brett Simms a, Clinton J. Doering a, Lina Chen a, Tamara Hermosilla a, Carlie Duke b, Richard Dyck b, Gerald W. Zamponi a,* a b
Department of Physiology and Biophysics, The Hotchkiss Brain Institute, University of Calgary, 3330 Hospital Dr. NW, Calgary, Canada T2N 4N1 Department of Psychology, University of Calgary, 3330 Hospital Dr. NW, Calgary, Canada T2N 4N1
a r t i c l e
i n f o
Article history: Received 25 July 2008 Available online 17 August 2008
Keywords: Syntaxin Knockout mouse Lethal Development PCR Southern blot
a b s t r a c t We have generated a syntaxin 1A knockout mouse by deletion of exons 3 through 6 and a concomitant insertion of a stop codon in exon 2. Heterozygous knockout animals were viable with no apparent phenotype. In contrast, the vast majority of homozygous animals died in utero, with embryos examined at day E15 showing a drastic reduction in body size and development when compared to WT and heterozygous littermates. Surprisingly, out of a total of 204 offspring from heterozygous breeding pairs only four homozygous animals were born alive and viable. These animals exhibited reduced body weight, but showed only mild behavioral deficiencies. Taken together, our data indicate that syntaxin 1A is an important regulator of normal in utero development, but may not be essential for normal brain function later in life. Ó 2008 Elsevier Inc. All rights reserved.
Syntaxin 1 is a critical element in calcium triggered exocytosis in both neuronal and non-neuronal tissues [1,2]. In vertebrate synapses, syntaxin 1 is known to interact tightly with both SNAP-25 and a synaptic protein interaction site found in both N-type and P/Q-type calcium channels [3–5]. This macromolecular protein complex allows for the docking of synaptic vesicles via interactions with synaptotagmin and synaptobrevin, thus localizing vesicles within calcium microdomains supported by channel activity—a key requirement for efficient calcium triggered neurotransmitter release (for review see [6,7]). In addition to its role in exocytosis, syntaxin 1 is known to directly inhibit calcium channel activity by reducing channel availability [8–13]. From a structural point of view, syntaxin 1 is organized as a four helix bundle that can undergo conformational changes, as well as a membrane insertion domain near the C-terminal which is located adjacent to the BotC cleavage site [14–16]. The mammalian nervous system expresses two syntaxin 1 isoforms, syntaxin 1A and 1B, which are about 85% homologous at the amino acid level, are both cleaved by BotC, and appear to be differentially distributed in the brain [12]. In addition, alternate splicing may generate additional syntaxin 1A variants [14–16]. A recent study reported on the functional knockout of syntaxin 1A in mice [17]. The authors reported that the mice were viable with apparent impairment in long term potentiation and conditioned fear memory, perhaps suggesting the possibility of compensation from syntaxin 1B. These authors targeted their gene deletion * Corresponding author. Fax: +1 403 210 8106. E-mail address: [email protected] (G.W. Zamponi). 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.08.031
strategy towards exons 9 and 10, thus effectively removing the membrane insertion domain of syntaxin 1A, but sparing much of the syntaxin 1A molecule. The same group as well as others reported on the existence of a syntaxin variant (termed syntaxin 1C) that lacks the membrane insertion region as a result of alternate splicing and these truncated splice isoforms are also found in EST databases [18–20]. To determine if the lack of phenotype in the syntaxin 1A knockout animals may have been due to the fact that the authors effectively converted syntaxin 1A into a syntaxin 1C truncation protein, we created a syntaxin 1A null mouse in which we deleted exons three through six, and inserted an additional stop codon into exon 2. Our findings show that the deletion of the syntaxin 1A gene resulted in reduced embryonic growth leading to death in utero. Hence, syntaxin 1A appears to may be a key requirement for appropriate embryonic development. Materials and methods To target and excise the endogenous syntaxin-1A gene a cDNA construct utilizing the pPNT vector was used. A segment encompassing a portion of intron 2 to exon 10 was isolated from mouse DNA using PCR two oligos (ccaaagagcctcactgagc, acctccgtggttgatccc were used according to the manufacturer’s instructions, and the reaction product was analyzed on a 1.0% agarose gel; DNA bands were isolated, cloned into pGEM-T-easy (Stratagene), and sequenced to confirm identity. DNA from the in house embryonic cell line was used to optimize targeting of the vector as substantial nucleotide differences do occur between mouse lines. The confirmed DNA strand was cloned into the pPPNT vector for targeting
373
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
corresponded to exon 2 was added to fresh solution (2XSSC and 2Xs Denharts) and incubated at 55 °C. The blot was washed in 0.2XSSC and the exposed to radiographic film overnight at 80 °C. Of 254 colonies screened, 6 had undergone homologous recombination and were subsequently grown and sent for blastocyte microinjection at the ESTM facility (University of Calgary). The microinjection process resulted in two females and five chimeric males of which the two females were outcrossed to produce heterozygote animals. To determine genetic identity of all offspring or embryos we used genomic PCR and oligos specific to the wt allele and vector or targeted (oligo 3-ccaggagctgttccc and oligo 4ggcaccctgggcaataccgc) or wild type DNA/deleted regions of gene or wild type allele (oligo 3-ccaggagctgttccc and oligo 5-cccagtgcaaggaaccc) to determine genotype (Fig. 1A). DNA, oligos and10 mM dNTPs, and 3 U of Hot PROOF Start Taq (Qiagen) were used according to the manufacturer’s instructions. Southern blot analysis was performed using 10 lg of mouse tail DNA digested with KPN I overnight at 37 °C. Digested DNA was electrophoresed through a 1% agarose gel, transferred to nylon membrane (BioRad) overnight then the blot was allowed to dry. The blot was rehydrated in 2XSSC (1X’s = 0.15 M sodium chloride and 0.015 M sodium citrate.) and prehybridized with 2 denhardts solution in 2XSSC for 3 h. The random primed 33P probe corresponded to exon 2 was added to fresh solution (2XSSC and 2Xs Denharts) and incubated overnight at 55 °C. The blot was washed in 0.2XSSC three times for 2 h each and the exposed to radiographic film overnight
the mouse embryonic stem cells. Using XhoI and BamHI (Fig. 1A) the region targeted for recombination included exon 3 until the end of exon 6 and was excised and replaced with the neomycin resistance cassette (see dotted line in Fig. 1). The in frame stop codon was introduced using standard site directed mutagenesis protocol from Stratagene. This targeting vector was electroporated into embryonic stem cells and subsequently grown on irradiated mouse fibroblasts as per the University of Calgary embryonic stem cell facility protocols. Colonies which survived the neomycin treatment were purified, grown to confluency and then screened with PCR and Southern analysis to observe if proper incorporation had occurred. For PCR, DNA and oligos 3 and 4 (oligo 3-ccaggagctgttccc and oligo 4-ggcaccctgggcaataccgc), were used according to the manufacturer’s (Qiagen) instructions, the reaction product was analyzed on 2.0% agarose gel; DNA bands were isolated using a gel extraction kit (Qiagen), cloned into pGEM-T-easy (Stratagene), and sequenced to confirm identity. All further PCRs were cloned into pGEM-T-easy (Stratagene) and sequenced to confirm identity. Clones which showed a potential removal of the syntaxin 1A gene were screened with Southern blot analysis using 1 lg of ES cell DNA digested with KPN I (1 site in clone and other outside region) overnight at 37 °C. Digested DNA was electrophoresed through a 1% agarose gel, transferred to nylon membrane (Bio-Rad) overnight. The blot was rehydrated in 2XSSC (1Xs = 0.15 M sodium chloride and 0.015 M sodium citrate.) and prehybridized with 2 Denhardts solution in 2XSSC for 3 h. The random primed 33P probe
Deleted portion of gene 1
5
3
K
3
4
5
X
6
7
8
9
E
Wild type allele
1
2
7
2
8
9
Neo
1
Targeting vector
3
2
4
7
8
9
Knockout allele
Neo
In frame stop codon added 1
Wt
Het
2
3
192bp
mw 7 8 Wt allele ~5500bp
4 5 6 mw
K-out
K-out allele ~4000bp
9 10
192bp
Fig. 1. Schematic of the targeting protocol for the construction of the knockout mouse. (A) The top line shows the normal wt gene intron/exon structure. Within this schematic is the indicated KpnI (K) site used in Southern blots and the XhoI (X) and EcoRI (E) used in synthesize of the knockout vector. The PCR oligos used in the genotyping of the mouse pups are indicated by the numbers 3 and 5. Oligos used in the screening of ES cells are shown by the arrows and numbers 1 and 2 under exons 5 and 7, respectively. The next line shows the targeting vector where exons 3–6 have been replaced by the neomycin portion of the cassette. In addition, to prevent further translation a stop codon was engineered into exon 2. The bottom line demonstrates the integration of the cassette into the allele and disruption of the syntaxin gene (knockout allele). In addition, more oligos used in the genotyping of the mouse pups are shown by the arrows and numbered 3 and 4. (B) Southern blot panel done with DNA isolated from wild type, heterozygous and KO mice. Shown is the decrease in size from 5500 to 4000 bp of the targeted allele with the neomycin resistance gene incorporated in to the genome. (C) RT/PCR analysis of RNA extracted from wild type (lanes 1–3), heterozygous (lanes 4–6) or knockout mouse brains (lanes 7–10).
374
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
at 80 °C. Syntaxin-1A knockout mouse lines were then screened, backcrossed into non-related offspring and tested for eight generations in the University of Calgary animal care facility. RT/PCR used 10 lg RNA, 2 ll reverse oligo (oligo 2-tcactggtcgtggtccggc) and 4.5 ll water, the mixture was heated at 70 °C for 5 min and quenched on ice. Added according in amount and order to manufacturer’s instructions (Promega) to the denatured RNA mixture were Superscript buffer, dNTPs, DTT, RNA Guard (Promega) and 10 U of reverse transcriptase. The reaction was allowed to proceed for 90 min followed by PCR. The PCR consisted DNA, oligos 1 and 2 (oligo 1-gcattgagcagagcat and oligo 2-tcactggtcgtggtccggc) and 10m dNTPs, and 3 U of Hot PROOF Start Taq (Qiagen) were used according to the manufacturer’s instructions. Several tests were employed to elucidate any behavioral differences between Syntaxin 1A heterozygous(+/ ) (n = 4), wild type(+/+) (n = 5), and knockout( / ) (n = 3) mice. The Irwin Neurological Assessment [21] tests basic neurological function. The assessment includes observational measures (e.g., locomotor activity, body tone, spontaneous licking) and minor manipulations (e.g., provoked biting, corneal reflex, grip strength). Swimming behavior, including swim latency, limb-use asymmetry, episodes of forepaw disinhibition, and freezing behavior were assessed using the Swim Alley task [22]. The horizontal ladder [23] was used to measure fore- and hind-limb stepping, and inter-limb coordination. The hanging wire test [23] measured limb strength. The aforementioned tests were videotaped and analyzed using video replay. The Passive/Active avoidance tasks, used to assess associative learning and memory, and the prepulse Inhibition task [24] were measured using equipment and software from Hamilton–Kinder LLC; San Diego, CA. Spontaneous walking behavior was assessed in the open field test [22], and anxiety-like behavior in the elevated plus maze. The Morris Water Maze [25] was used to test spatial and working memory. The open field, elevated plus and Morris Water Maze tests were recorded and quantified using an automated video tracking system (HVS Image, Hampton, UK). All tests were performed independently of each other and during the animal’s light cycle. Mice were weighed every second day throughout the two-month testing period. Human embryonic kidney tsA-201 cells were transfected with rat Cav2.2, rat b1b, rat a2-d1 and enhanced green fluorescent protein +/ rat syntaxin constructs, as described by us previously [12]. Electrophysiological recordings were conducted using an Axopatch 200B amplifier and pCLAMP9 software. The external solution contained (in mM) : BaCl2 20, MgCl2 1, Hepes 10, TEA-Cl 40,CsCl 65, Glucose 10; pH 7.2 adjusted with TEA-OH. The internal solution with resistances between 2 and 4 MX and contained (in mM): Cs-methanesulfonate 108, MgCl2 4, EGTA 9, Hepes 9; pH 7.2 adjusted with Cs–OH. Half inactivation potentials were obtained by holding cells at various holding potentials for 5 s, prior to applying a test pulse to +20 mV. Steady state inactivation curves were fitted using the Boltzmann equation. All data are presented as means ± standard errors. Statistical significance was evaluated using one way ANOVA or t-tests as appropriate.
Results and discussion A breeding program was implemented based after the successful generation of seven heterozygous syntaxin 1A mice. In numerous breeding rounds of heterozygous breeding pairs, the relative numbers of wild type and heterozygous offspring was inconsistent with Mendelian genetics (i.e., 41 L of Het/Het crosses resulted in 64 (wild type)/156 (heteros)/4 (knockout). Since only four homozygous offspring were born (1 male, 3 female), the possibility of in utero death of homozygous animals was considered. To test this
possibility, we dissected pregnant mothers at day E15, and examined the embryos. As shown in Fig. 2, homozygous knockout embryos (as verified by PCR) were substantially smaller than their wild type or heterozygous litter mates, and lacked limbs, tail and facial features, thus resembling what would normally be observed at an earlier developmental stage. Similar results were observed in three different dissections, a total of 37 embryos were examined, with only three being homozygous knockout embryos (Fig. 2). This distribution of WT and heterozygous animals is consistent with a Mendelian heritance pattern, whereas the low numbers of homozygous embryos suggests reduced viability of homozygous knockout animals. Altogether, these data indicate that syntaxin 1A may have a critical determinant of normal embryonic development. Despite the aberrant development, four viable homozygous syntaxin 1A knockout animals were born. These animals showed a significant reduction in body weight over a two month period (Fig. 3A), consistent with our observations with the knockout embryos. These four animals, as well as wild type and heterozygous mice, were subjected to a comprehensive behavioral analysis at age 60 days. These included a Morris Water Maze test to probe for alterations in memory, an elevated plus maze test to examine anxiety behavior, an open field test to determine spontaneous walking behavior, passive and active avoidance tests to assess cognitive function, a swim alley task to assess swimming behavior, a hanging wire test to measure limb strength, a prepulse inhibition task, and a horizontal ladder task to examine limb placing and coordination. The three groups of animals (wt, Syntaxin 1A+/ , Syntaxin 1A / ) differed, significantly, only during the horizontal ladder test (Fig. 3B). The mice were tested over four different conditions: (i) all of the rungs in place, (ii) 9 rungs removed, (iii) 13 rungs removed, and (iv) 16 rungs removed. Foot faults, defined as a miss or slip (miss: limb fell through rung space, missing the rung completely and causing a loss of balance; slip: limb was placed on the rung, but slipped off upon weight-bearing) were measured for each condition. The number of foot faults was significantly different between heterozygote and wild type mice (t(9) = 8.12, p < 0.001), and heterozygotes and knockouts (t(9) = 5.41, p < 0.001) when 9 rungs were removed at random, but not between knockouts and wild type mice (t(9) = 1.81, p = 0.104). When 16 rungs were removed at random, significant differences were noted between heterozygotes and knockout mice (t(9) = 2.28, p = 0.048) and between wild type and knockout mice (t(9) = 2.32, p = 0.045) but not between wild type and heterozygous mice (t(9) = 0.07, p = 0.942). No significant differences were seen when all of the rungs were in place, nor, when 13 rungs were removed (p > 0.05). All other behavioral assessments failed to show any significant differences among the three groups of animals (p > 0.05). Overall, these data indicate that the absence of syntaxin 1A result in only a mild phenotype in viable knockout animals. We also attempted to breed the homozygous animals. This was successful in one instance, however, the mother eviscerated the pups within hours after birth (interestingly, without devouring them), and hence a further analysis of homozygous syntaxin 1A knockout animals was precluded. At this point, it is not clear if deletion of syntaxin 1A results in a truly embryonic lethal phenotype, or if incompletely developed mice are in fact born alive, but destroyed and eaten by the mother. The notion that only three homozygous embryos could be found among 35 embryos dissected from pregnant mothers is inconsistent with such a scenario, and suggests increased lethality or lack of development in utero. The fact that four animals did in fact survive may be due to some form of some compensation that may have occurred in these four animals, thus resulting in their viability. Overall, these data suggest that although syntaxin 1A is important for in utero development, its presence may be less critical later in life.
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
375
Fig. 2. Syntaxin 1A KO mice showed delayed in utero development. (A) The top panel shows three littermate E15 embryos from one pregnant mouse plus another embryo for another mother (#11). Embryos 4 and 5 were genotyped to be syntaxin gene deleted, a litter mate embryo #2 was genotyped to be wild type, and embryo #11 was a heterozygous animal. All four pictures are scaled identically, indicating a much smaller size of the KO embryo. Note lack of limbs, eye development and a lack of the vestibular tail. (B) PCR genotyping of 11 embryos obtained from a hetero–hetero breeding program, PCR product size is indicated on the left note the non Mendelian heritance pattern, suggesting increased mortality in the KO mice.
We have previously shown that syntaxin 1A truncation mutants lacking the regions that are spliced out in syntaxin 1C are capable of associating with N-type calcium channels [12]. To determine if syntaxin 1C can functionally regulate N-type channels, we coexpressed Cav2.2 channels with ancillary b1b and a2-d1 subunits in tsA-201 cells, and recorded N-type currents in the absence of syntaxin, in the presence of full length syntaxin 1A, and in the presence of syntaxin 1C. Neither the position of the current–voltage relation, nor current densities differed significantly among the three conditions, whereas the coexpression of syntaxin 1A mediated a previously well characterized negative shift in half inactivation potential relative to that observed in the absence of syntaxin (Fig. 3C). In contrast, syntaxin 1C, although capable of binding to the channel, did not alter the position of the inactivation curve. These data indicate that syntaxin 1c may not compensate for syntaxin 1A in its ability to regulate entry of calcium via N-type channels. Our data show that ablation of the syntaxin 1A gene results in a severe phenotype that is characterized by reduced in utero growth and possible embryonic lethality. These data contrast with a recent report by Fujiwara and colleagues [17] examining the effects of syntaxin 1A knockout, however, the authors of this study used targeted their gene deletion study towards exons 9 and 10, encom-
passing the H3 region and membrane insertion domain. Hence, these mice had the propensity to express a truncated form of syntaxin 1A. In their study, the authors displayed a Western blot probed with a monoclonal antibody that is specific to syntaxin 1A, and showed that the knockout animals lacked a 35 kDa syntaxin 1A band that was present in WT and heterozygotes. However, the Western blot shown by the authors did not extend to the reduced molecular weight expected for a syntaxin 1A truncation mutant lacking exons 9 and 10, and it is unclear if the uncharacterized monoclonal antibody used by the authors could in fact detect truncated syntaxin molecules. Hence, it is possible that the strategy employed by Fujiwara and colleagues may have simply resulted in the expression of shorter syntaxin 1A constructs that would resemble syntaxin 1C. It is clear that such putative truncation mutants cannot retain all of the key syntaxin 1A functions, since the removal of the membrane insertion domain via BotC1 both inhibits exocytosis and the functional regulation of N-type channels. Although syntaxin 1C was unable to regulate calcium channel activity, we have shown previously that truncated syntaxin molecules retain their ability to bind to N-type channels. Furthermore, syntaxin 1C per se has been shown to regulate intracellular transport of certain membrane proteins [20,26]. Hence, given the very different phenotype of our knockout animals which lack the entire
376
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
Fig. 3. (A) Comparison of body weight of wild type, heterozygous animals, and the four KO animals that survived. Note that the KO animals show a consistently reduced body weight over a two month period (from day 24 until day 32, p < 0.05, from day 33 to 46 p < 0.001, after day 48 p < 0.001). (B) Performance of WT (n = 6), heterozygous (n = 6) and homozygous (n = 4) mice in the horizontal ladder test. As more rungs were removed performance decrements were observed. However, only when 9 and 16 rungs were removed were significant differences in the number of foot faults observed between groups. Error bars, standard deviation;*p < 0.05. (C) Steady state inactivation curves obtained from tsA-201 cells expressing Cav2.2 (a2 d + b1b) channels in the absence of syntaxin, upon coexpression of syntaxin 1A or upon coexpression of syntaxin 1C. The data were fitted with the Boltzmann equation. Note the syntaxin 1A induced shift in half inactivation potential (see inset) in cells expressing syntaxin 1A, but not sytaxin 1C.
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
syntaxin 1A gene, we speculate that residual syntaxin 1A fragments in the exon 9/10 deletion mutant mouse of Fujiwara and colleagues may be sufficient to maintain some of the key syntaxin 1A functions required for appropriate in utero development. Alternatively, it is possible that other syntaxin isoforms such as syntaxin 1B may have more effectively compensated in mice expressing truncated syntaxin 1A proteins. Overall, our data reveal an important function of syntaxin 1A in development. The notion that vastly different phenotypes are observed in two separate knockout mouse studies underscores the importance to ensure that knockout strategies do not result in truncated versions of a protein of interest. Acknowledgments This works was supported by a Grant from the Canadian Institutes of Health Research (CIHR) to GWZ and the Novartis Chair for Schizophrenia Research. GWZ is a Scientist of the Alberta Heritage Foundation for Medical Research (AHFMR) and a Canada Research Chair. C.J.D. held a Studentship award from the AHFMR and a Canada Graduate Scholarship. References [1] M. Linial, Neurotoxins as tools in dissecting the exocytic machinery, Subcell Biochem. 34 (2000) 39–72. [2] J. Pevsner, S.C. Hsu, J.E. Braun, N. Calakos, A.E. Ting, M.K. Bennett, R.H. Scheller, Specificity and regulation of a synaptic vesicle docking complex, Neuron 13 (2) (1994) 353–361. [3] J. Rettig, C. Heinemann, U. Ashery, Z.H. Sheng, C.T. Yokoyama, W.A. Catterall, E. Neher, Alteration of Ca2+ dependence of neurotransmitter release by disruption of Ca2+ channel/syntaxin interaction, J. Neurosci. 17 (17) (1997) 6647–6656. [4] Z.H. Sheng, J. Rettig, T. Cook, W.A. Catterall, Calcium-dependent interaction of N-type calcium channels with the synaptic core complex, Nature 379 (6564) (1996) 451–454. [5] Z.H. Sheng, J. Rettig, M. Takahashi, W.A. Catterall, Identification of a syntaxinbinding site on N-type calcium channels, Neuron 13 (6) (1994) 1303–1313. [6] J.D. Spafford, G.W. Zamponi, Functional interactions between presynaptic calcium channels and the neurotransmitter release machinery, Curr. Opin. Neurobiol. 13 (3) (2003) 308–314. [7] S. Mochida, Z.H. Sheng, C. Baker, H. Kobayashi, W.A. Catterall, Inhibition of neurotransmission by peptides containing the synaptic protein interaction site of N-type Ca2+ channels, Neuron 17 (4) (1996) 781–788. [8] I. Bezprozvanny, R.H. Scheller, R.W. Tsien, Functional impact of syntaxin on gating of N-type and Q-type calcium channels, Nature 378 (6557) (1995) 623– 626. [9] I. Bezprozvanny, P. Zhong, R.H. Scheller, R.W. Tsien, Molecular determinants of the functional interaction between syntaxin and N-type Ca2+ channel gating, Proc. Natl. Acad. Sci. USA 97 (25) (2000) 13943–13948.
377
[10] S.E. Jarvis, W. Barr, Z.P. Feng, J. Hamid, G.W. Zamponi, Molecular determinants of syntaxin 1 modulation of N-type calcium channels, J. Biol. Chem. 277 (46) (2002) 44399–44407. [11] S.E. Jarvis, J.M. Magga, A.M. Beedle, J.E. Braun, G.W. Zamponi, G protein modulation of N-type calcium channels is facilitated by physical interactions between syntaxin 1A and Gbetagamma, J. Biol. Chem. 275 (9) (2000) 6388– 6394. [12] S.E. Jarvis, G.W. Zamponi, Distinct molecular determinants govern syntaxin 1A-mediated inactivation and G-protein inhibition of N-type calcium channels, J. Neurosci. 21 (9) (2001) 2939–2948. [13] E.F. Stanley, Syntaxin I modulation of presynaptic calcium channel inactivation revealed by botulinum toxin C1, Eur. J. Neurosci. 17 (6) (2003) 1303–1305. [14] I. Dulubova, S. Sugita, S. Hill, M. Hosaka, I. Fernandez, T.C. Sudhof, J. Rizo, A conformational switch in syntaxin during exocytosis: role of munc18, EMBO J. 18 (16) (1999) 4372–4382. [15] K.M. Misura, R.H. Scheller, W.I. Weis, Three-dimensional structure of the neuronal-Sec1-syntaxin 1a complex, Nature 404 (6776) (2000) 355–362. [16] M.A. Poirier, W. Xiao, J.C. Macosko, C. Chan, Y.K. Shin, M.K. Bennett, The synaptic SNARE complex is a parallel four-stranded helical bundle, Nat. Struct. Biol. 5 (9) (1998) 765–769. [17] T. Fujiwara, T. Mishima, T. Kofuji, T. Chiba, K. Tanaka, A. Yamamoto, K. Akagawa, Analysis of knock-out mice to determine the role of HPC-1/ syntaxin 1A in expressing synaptic plasticity, J. Neurosci. 26 (21) (2006) 5767–5776. [18] M.N. Jagadish, J.T. Tellam, S.L. Macaulay, K.H. Gough, D.E. James, C.W. Ward, Novel isoform of syntaxin 1 is expressed in mammalian cells, Biochem. J. 321 (Pt 1) (1997) 151–156. [19] T. Nakayama, K. Mikoshiba, T. Yamamori, K. Akagawa, Expression of syntaxin 1C, an alternative splice variant of HPC-1/syntaxin 1A, is enhanced by phorbolester stimulation in astroglioma: participation of the PKC signaling pathway, FEBS Lett. 536 (1–3) (2003) 209–214. [20] T. Nakayama, K. Mikoshiba, T. Yamamori, K. Akagawa, Activation of syntaxin 1C, an alternative splice variant of HPC-1/syntaxin 1A, by phorbol 12myristate 13-acetate (PMA) suppresses glucose transport into astroglioma cells via the glucose transporter-1 (GLUT-1), J. Biol. Chem. 279 (22) (2004) 23728–23739. [21] S. Irwin, Comprehensive observational assessment: Ia. A systematic, quantitative procedure for assessing the behavioral and physiologic state of the mouse, Psychopharmacologia 13 (3) (1968) 222–257. [22] P. Sgado, L. Alberi, D. Gherbassi, S.L. Galasso, G.M. Ramakers, K.N. Alavian, M.P. Smidt, R.H. Dyck, H.H. Simon, Slow progressive degeneration of nigral dopaminergic neurons in postnatal engrailed mutant mice, Proc. Natl. Acad. Sci. USA 103 (41) (2006) 15242–15247. [23] J.L. Tillerson, G.W. Miller, Grid performance test to measure behavioral impairment in the MPTP-treated-mouse model of Parkinsonism, J. Neurosci. Methods 123 (2) (2003) 189–200. [24] J.R. Ison, D.W. McAdam, G.R. Hammond, Latency and amplitude changes in the acoustic startle reflex of the rat produced by variation in auditory prestimulation, Physiol. Behav. 10 (6) (1973) 1035–1039. [25] R. Morris, Developments of a water-maze procedure for studying spatial learning in the rat, J. Neurosci. Methods 11 (1) (1984) 47–60. [26] K. Suga, T. Yamamori, K. Akagawa, Identification of the carboxyl-terminal membrane-anchoring region of HPC-1/syntaxin 1A with the substitutedcysteine-accessibility method and monoclonal antibodies, J. Biochem. (Tokyo) 133 (3) (2003) 325–334.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Syntaxin 1A is required for normal in utero development John E. McRory a, Renata Rehak a, Brett Simms a, Clinton J. Doering a, Lina Chen a, Tamara Hermosilla a, Carlie Duke b, Richard Dyck b, Gerald W. Zamponi a,* a b
Department of Physiology and Biophysics, The Hotchkiss Brain Institute, University of Calgary, 3330 Hospital Dr. NW, Calgary, Canada T2N 4N1 Department of Psychology, University of Calgary, 3330 Hospital Dr. NW, Calgary, Canada T2N 4N1
a r t i c l e
i n f o
Article history: Received 25 July 2008 Available online 17 August 2008
Keywords: Syntaxin Knockout mouse Lethal Development PCR Southern blot
a b s t r a c t We have generated a syntaxin 1A knockout mouse by deletion of exons 3 through 6 and a concomitant insertion of a stop codon in exon 2. Heterozygous knockout animals were viable with no apparent phenotype. In contrast, the vast majority of homozygous animals died in utero, with embryos examined at day E15 showing a drastic reduction in body size and development when compared to WT and heterozygous littermates. Surprisingly, out of a total of 204 offspring from heterozygous breeding pairs only four homozygous animals were born alive and viable. These animals exhibited reduced body weight, but showed only mild behavioral deficiencies. Taken together, our data indicate that syntaxin 1A is an important regulator of normal in utero development, but may not be essential for normal brain function later in life. Ó 2008 Elsevier Inc. All rights reserved.
Syntaxin 1 is a critical element in calcium triggered exocytosis in both neuronal and non-neuronal tissues [1,2]. In vertebrate synapses, syntaxin 1 is known to interact tightly with both SNAP-25 and a synaptic protein interaction site found in both N-type and P/Q-type calcium channels [3–5]. This macromolecular protein complex allows for the docking of synaptic vesicles via interactions with synaptotagmin and synaptobrevin, thus localizing vesicles within calcium microdomains supported by channel activity—a key requirement for efficient calcium triggered neurotransmitter release (for review see [6,7]). In addition to its role in exocytosis, syntaxin 1 is known to directly inhibit calcium channel activity by reducing channel availability [8–13]. From a structural point of view, syntaxin 1 is organized as a four helix bundle that can undergo conformational changes, as well as a membrane insertion domain near the C-terminal which is located adjacent to the BotC cleavage site [14–16]. The mammalian nervous system expresses two syntaxin 1 isoforms, syntaxin 1A and 1B, which are about 85% homologous at the amino acid level, are both cleaved by BotC, and appear to be differentially distributed in the brain [12]. In addition, alternate splicing may generate additional syntaxin 1A variants [14–16]. A recent study reported on the functional knockout of syntaxin 1A in mice [17]. The authors reported that the mice were viable with apparent impairment in long term potentiation and conditioned fear memory, perhaps suggesting the possibility of compensation from syntaxin 1B. These authors targeted their gene deletion * Corresponding author. Fax: +1 403 210 8106. E-mail address: [email protected] (G.W. Zamponi). 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.08.031
strategy towards exons 9 and 10, thus effectively removing the membrane insertion domain of syntaxin 1A, but sparing much of the syntaxin 1A molecule. The same group as well as others reported on the existence of a syntaxin variant (termed syntaxin 1C) that lacks the membrane insertion region as a result of alternate splicing and these truncated splice isoforms are also found in EST databases [18–20]. To determine if the lack of phenotype in the syntaxin 1A knockout animals may have been due to the fact that the authors effectively converted syntaxin 1A into a syntaxin 1C truncation protein, we created a syntaxin 1A null mouse in which we deleted exons three through six, and inserted an additional stop codon into exon 2. Our findings show that the deletion of the syntaxin 1A gene resulted in reduced embryonic growth leading to death in utero. Hence, syntaxin 1A appears to may be a key requirement for appropriate embryonic development. Materials and methods To target and excise the endogenous syntaxin-1A gene a cDNA construct utilizing the pPNT vector was used. A segment encompassing a portion of intron 2 to exon 10 was isolated from mouse DNA using PCR two oligos (ccaaagagcctcactgagc, acctccgtggttgatccc were used according to the manufacturer’s instructions, and the reaction product was analyzed on a 1.0% agarose gel; DNA bands were isolated, cloned into pGEM-T-easy (Stratagene), and sequenced to confirm identity. DNA from the in house embryonic cell line was used to optimize targeting of the vector as substantial nucleotide differences do occur between mouse lines. The confirmed DNA strand was cloned into the pPPNT vector for targeting
373
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
corresponded to exon 2 was added to fresh solution (2XSSC and 2Xs Denharts) and incubated at 55 °C. The blot was washed in 0.2XSSC and the exposed to radiographic film overnight at 80 °C. Of 254 colonies screened, 6 had undergone homologous recombination and were subsequently grown and sent for blastocyte microinjection at the ESTM facility (University of Calgary). The microinjection process resulted in two females and five chimeric males of which the two females were outcrossed to produce heterozygote animals. To determine genetic identity of all offspring or embryos we used genomic PCR and oligos specific to the wt allele and vector or targeted (oligo 3-ccaggagctgttccc and oligo 4ggcaccctgggcaataccgc) or wild type DNA/deleted regions of gene or wild type allele (oligo 3-ccaggagctgttccc and oligo 5-cccagtgcaaggaaccc) to determine genotype (Fig. 1A). DNA, oligos and10 mM dNTPs, and 3 U of Hot PROOF Start Taq (Qiagen) were used according to the manufacturer’s instructions. Southern blot analysis was performed using 10 lg of mouse tail DNA digested with KPN I overnight at 37 °C. Digested DNA was electrophoresed through a 1% agarose gel, transferred to nylon membrane (BioRad) overnight then the blot was allowed to dry. The blot was rehydrated in 2XSSC (1X’s = 0.15 M sodium chloride and 0.015 M sodium citrate.) and prehybridized with 2 denhardts solution in 2XSSC for 3 h. The random primed 33P probe corresponded to exon 2 was added to fresh solution (2XSSC and 2Xs Denharts) and incubated overnight at 55 °C. The blot was washed in 0.2XSSC three times for 2 h each and the exposed to radiographic film overnight
the mouse embryonic stem cells. Using XhoI and BamHI (Fig. 1A) the region targeted for recombination included exon 3 until the end of exon 6 and was excised and replaced with the neomycin resistance cassette (see dotted line in Fig. 1). The in frame stop codon was introduced using standard site directed mutagenesis protocol from Stratagene. This targeting vector was electroporated into embryonic stem cells and subsequently grown on irradiated mouse fibroblasts as per the University of Calgary embryonic stem cell facility protocols. Colonies which survived the neomycin treatment were purified, grown to confluency and then screened with PCR and Southern analysis to observe if proper incorporation had occurred. For PCR, DNA and oligos 3 and 4 (oligo 3-ccaggagctgttccc and oligo 4-ggcaccctgggcaataccgc), were used according to the manufacturer’s (Qiagen) instructions, the reaction product was analyzed on 2.0% agarose gel; DNA bands were isolated using a gel extraction kit (Qiagen), cloned into pGEM-T-easy (Stratagene), and sequenced to confirm identity. All further PCRs were cloned into pGEM-T-easy (Stratagene) and sequenced to confirm identity. Clones which showed a potential removal of the syntaxin 1A gene were screened with Southern blot analysis using 1 lg of ES cell DNA digested with KPN I (1 site in clone and other outside region) overnight at 37 °C. Digested DNA was electrophoresed through a 1% agarose gel, transferred to nylon membrane (Bio-Rad) overnight. The blot was rehydrated in 2XSSC (1Xs = 0.15 M sodium chloride and 0.015 M sodium citrate.) and prehybridized with 2 Denhardts solution in 2XSSC for 3 h. The random primed 33P probe
Deleted portion of gene 1
5
3
K
3
4
5
X
6
7
8
9
E
Wild type allele
1
2
7
2
8
9
Neo
1
Targeting vector
3
2
4
7
8
9
Knockout allele
Neo
In frame stop codon added 1
Wt
Het
2
3
192bp
mw 7 8 Wt allele ~5500bp
4 5 6 mw
K-out
K-out allele ~4000bp
9 10
192bp
Fig. 1. Schematic of the targeting protocol for the construction of the knockout mouse. (A) The top line shows the normal wt gene intron/exon structure. Within this schematic is the indicated KpnI (K) site used in Southern blots and the XhoI (X) and EcoRI (E) used in synthesize of the knockout vector. The PCR oligos used in the genotyping of the mouse pups are indicated by the numbers 3 and 5. Oligos used in the screening of ES cells are shown by the arrows and numbers 1 and 2 under exons 5 and 7, respectively. The next line shows the targeting vector where exons 3–6 have been replaced by the neomycin portion of the cassette. In addition, to prevent further translation a stop codon was engineered into exon 2. The bottom line demonstrates the integration of the cassette into the allele and disruption of the syntaxin gene (knockout allele). In addition, more oligos used in the genotyping of the mouse pups are shown by the arrows and numbered 3 and 4. (B) Southern blot panel done with DNA isolated from wild type, heterozygous and KO mice. Shown is the decrease in size from 5500 to 4000 bp of the targeted allele with the neomycin resistance gene incorporated in to the genome. (C) RT/PCR analysis of RNA extracted from wild type (lanes 1–3), heterozygous (lanes 4–6) or knockout mouse brains (lanes 7–10).
374
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
at 80 °C. Syntaxin-1A knockout mouse lines were then screened, backcrossed into non-related offspring and tested for eight generations in the University of Calgary animal care facility. RT/PCR used 10 lg RNA, 2 ll reverse oligo (oligo 2-tcactggtcgtggtccggc) and 4.5 ll water, the mixture was heated at 70 °C for 5 min and quenched on ice. Added according in amount and order to manufacturer’s instructions (Promega) to the denatured RNA mixture were Superscript buffer, dNTPs, DTT, RNA Guard (Promega) and 10 U of reverse transcriptase. The reaction was allowed to proceed for 90 min followed by PCR. The PCR consisted DNA, oligos 1 and 2 (oligo 1-gcattgagcagagcat and oligo 2-tcactggtcgtggtccggc) and 10m dNTPs, and 3 U of Hot PROOF Start Taq (Qiagen) were used according to the manufacturer’s instructions. Several tests were employed to elucidate any behavioral differences between Syntaxin 1A heterozygous(+/ ) (n = 4), wild type(+/+) (n = 5), and knockout( / ) (n = 3) mice. The Irwin Neurological Assessment [21] tests basic neurological function. The assessment includes observational measures (e.g., locomotor activity, body tone, spontaneous licking) and minor manipulations (e.g., provoked biting, corneal reflex, grip strength). Swimming behavior, including swim latency, limb-use asymmetry, episodes of forepaw disinhibition, and freezing behavior were assessed using the Swim Alley task [22]. The horizontal ladder [23] was used to measure fore- and hind-limb stepping, and inter-limb coordination. The hanging wire test [23] measured limb strength. The aforementioned tests were videotaped and analyzed using video replay. The Passive/Active avoidance tasks, used to assess associative learning and memory, and the prepulse Inhibition task [24] were measured using equipment and software from Hamilton–Kinder LLC; San Diego, CA. Spontaneous walking behavior was assessed in the open field test [22], and anxiety-like behavior in the elevated plus maze. The Morris Water Maze [25] was used to test spatial and working memory. The open field, elevated plus and Morris Water Maze tests were recorded and quantified using an automated video tracking system (HVS Image, Hampton, UK). All tests were performed independently of each other and during the animal’s light cycle. Mice were weighed every second day throughout the two-month testing period. Human embryonic kidney tsA-201 cells were transfected with rat Cav2.2, rat b1b, rat a2-d1 and enhanced green fluorescent protein +/ rat syntaxin constructs, as described by us previously [12]. Electrophysiological recordings were conducted using an Axopatch 200B amplifier and pCLAMP9 software. The external solution contained (in mM) : BaCl2 20, MgCl2 1, Hepes 10, TEA-Cl 40,CsCl 65, Glucose 10; pH 7.2 adjusted with TEA-OH. The internal solution with resistances between 2 and 4 MX and contained (in mM): Cs-methanesulfonate 108, MgCl2 4, EGTA 9, Hepes 9; pH 7.2 adjusted with Cs–OH. Half inactivation potentials were obtained by holding cells at various holding potentials for 5 s, prior to applying a test pulse to +20 mV. Steady state inactivation curves were fitted using the Boltzmann equation. All data are presented as means ± standard errors. Statistical significance was evaluated using one way ANOVA or t-tests as appropriate.
Results and discussion A breeding program was implemented based after the successful generation of seven heterozygous syntaxin 1A mice. In numerous breeding rounds of heterozygous breeding pairs, the relative numbers of wild type and heterozygous offspring was inconsistent with Mendelian genetics (i.e., 41 L of Het/Het crosses resulted in 64 (wild type)/156 (heteros)/4 (knockout). Since only four homozygous offspring were born (1 male, 3 female), the possibility of in utero death of homozygous animals was considered. To test this
possibility, we dissected pregnant mothers at day E15, and examined the embryos. As shown in Fig. 2, homozygous knockout embryos (as verified by PCR) were substantially smaller than their wild type or heterozygous litter mates, and lacked limbs, tail and facial features, thus resembling what would normally be observed at an earlier developmental stage. Similar results were observed in three different dissections, a total of 37 embryos were examined, with only three being homozygous knockout embryos (Fig. 2). This distribution of WT and heterozygous animals is consistent with a Mendelian heritance pattern, whereas the low numbers of homozygous embryos suggests reduced viability of homozygous knockout animals. Altogether, these data indicate that syntaxin 1A may have a critical determinant of normal embryonic development. Despite the aberrant development, four viable homozygous syntaxin 1A knockout animals were born. These animals showed a significant reduction in body weight over a two month period (Fig. 3A), consistent with our observations with the knockout embryos. These four animals, as well as wild type and heterozygous mice, were subjected to a comprehensive behavioral analysis at age 60 days. These included a Morris Water Maze test to probe for alterations in memory, an elevated plus maze test to examine anxiety behavior, an open field test to determine spontaneous walking behavior, passive and active avoidance tests to assess cognitive function, a swim alley task to assess swimming behavior, a hanging wire test to measure limb strength, a prepulse inhibition task, and a horizontal ladder task to examine limb placing and coordination. The three groups of animals (wt, Syntaxin 1A+/ , Syntaxin 1A / ) differed, significantly, only during the horizontal ladder test (Fig. 3B). The mice were tested over four different conditions: (i) all of the rungs in place, (ii) 9 rungs removed, (iii) 13 rungs removed, and (iv) 16 rungs removed. Foot faults, defined as a miss or slip (miss: limb fell through rung space, missing the rung completely and causing a loss of balance; slip: limb was placed on the rung, but slipped off upon weight-bearing) were measured for each condition. The number of foot faults was significantly different between heterozygote and wild type mice (t(9) = 8.12, p < 0.001), and heterozygotes and knockouts (t(9) = 5.41, p < 0.001) when 9 rungs were removed at random, but not between knockouts and wild type mice (t(9) = 1.81, p = 0.104). When 16 rungs were removed at random, significant differences were noted between heterozygotes and knockout mice (t(9) = 2.28, p = 0.048) and between wild type and knockout mice (t(9) = 2.32, p = 0.045) but not between wild type and heterozygous mice (t(9) = 0.07, p = 0.942). No significant differences were seen when all of the rungs were in place, nor, when 13 rungs were removed (p > 0.05). All other behavioral assessments failed to show any significant differences among the three groups of animals (p > 0.05). Overall, these data indicate that the absence of syntaxin 1A result in only a mild phenotype in viable knockout animals. We also attempted to breed the homozygous animals. This was successful in one instance, however, the mother eviscerated the pups within hours after birth (interestingly, without devouring them), and hence a further analysis of homozygous syntaxin 1A knockout animals was precluded. At this point, it is not clear if deletion of syntaxin 1A results in a truly embryonic lethal phenotype, or if incompletely developed mice are in fact born alive, but destroyed and eaten by the mother. The notion that only three homozygous embryos could be found among 35 embryos dissected from pregnant mothers is inconsistent with such a scenario, and suggests increased lethality or lack of development in utero. The fact that four animals did in fact survive may be due to some form of some compensation that may have occurred in these four animals, thus resulting in their viability. Overall, these data suggest that although syntaxin 1A is important for in utero development, its presence may be less critical later in life.
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
375
Fig. 2. Syntaxin 1A KO mice showed delayed in utero development. (A) The top panel shows three littermate E15 embryos from one pregnant mouse plus another embryo for another mother (#11). Embryos 4 and 5 were genotyped to be syntaxin gene deleted, a litter mate embryo #2 was genotyped to be wild type, and embryo #11 was a heterozygous animal. All four pictures are scaled identically, indicating a much smaller size of the KO embryo. Note lack of limbs, eye development and a lack of the vestibular tail. (B) PCR genotyping of 11 embryos obtained from a hetero–hetero breeding program, PCR product size is indicated on the left note the non Mendelian heritance pattern, suggesting increased mortality in the KO mice.
We have previously shown that syntaxin 1A truncation mutants lacking the regions that are spliced out in syntaxin 1C are capable of associating with N-type calcium channels [12]. To determine if syntaxin 1C can functionally regulate N-type channels, we coexpressed Cav2.2 channels with ancillary b1b and a2-d1 subunits in tsA-201 cells, and recorded N-type currents in the absence of syntaxin, in the presence of full length syntaxin 1A, and in the presence of syntaxin 1C. Neither the position of the current–voltage relation, nor current densities differed significantly among the three conditions, whereas the coexpression of syntaxin 1A mediated a previously well characterized negative shift in half inactivation potential relative to that observed in the absence of syntaxin (Fig. 3C). In contrast, syntaxin 1C, although capable of binding to the channel, did not alter the position of the inactivation curve. These data indicate that syntaxin 1c may not compensate for syntaxin 1A in its ability to regulate entry of calcium via N-type channels. Our data show that ablation of the syntaxin 1A gene results in a severe phenotype that is characterized by reduced in utero growth and possible embryonic lethality. These data contrast with a recent report by Fujiwara and colleagues [17] examining the effects of syntaxin 1A knockout, however, the authors of this study used targeted their gene deletion study towards exons 9 and 10, encom-
passing the H3 region and membrane insertion domain. Hence, these mice had the propensity to express a truncated form of syntaxin 1A. In their study, the authors displayed a Western blot probed with a monoclonal antibody that is specific to syntaxin 1A, and showed that the knockout animals lacked a 35 kDa syntaxin 1A band that was present in WT and heterozygotes. However, the Western blot shown by the authors did not extend to the reduced molecular weight expected for a syntaxin 1A truncation mutant lacking exons 9 and 10, and it is unclear if the uncharacterized monoclonal antibody used by the authors could in fact detect truncated syntaxin molecules. Hence, it is possible that the strategy employed by Fujiwara and colleagues may have simply resulted in the expression of shorter syntaxin 1A constructs that would resemble syntaxin 1C. It is clear that such putative truncation mutants cannot retain all of the key syntaxin 1A functions, since the removal of the membrane insertion domain via BotC1 both inhibits exocytosis and the functional regulation of N-type channels. Although syntaxin 1C was unable to regulate calcium channel activity, we have shown previously that truncated syntaxin molecules retain their ability to bind to N-type channels. Furthermore, syntaxin 1C per se has been shown to regulate intracellular transport of certain membrane proteins [20,26]. Hence, given the very different phenotype of our knockout animals which lack the entire
376
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
Fig. 3. (A) Comparison of body weight of wild type, heterozygous animals, and the four KO animals that survived. Note that the KO animals show a consistently reduced body weight over a two month period (from day 24 until day 32, p < 0.05, from day 33 to 46 p < 0.001, after day 48 p < 0.001). (B) Performance of WT (n = 6), heterozygous (n = 6) and homozygous (n = 4) mice in the horizontal ladder test. As more rungs were removed performance decrements were observed. However, only when 9 and 16 rungs were removed were significant differences in the number of foot faults observed between groups. Error bars, standard deviation;*p < 0.05. (C) Steady state inactivation curves obtained from tsA-201 cells expressing Cav2.2 (a2 d + b1b) channels in the absence of syntaxin, upon coexpression of syntaxin 1A or upon coexpression of syntaxin 1C. The data were fitted with the Boltzmann equation. Note the syntaxin 1A induced shift in half inactivation potential (see inset) in cells expressing syntaxin 1A, but not sytaxin 1C.
J.E. McRory et al. / Biochemical and Biophysical Research Communications 375 (2008) 372–377
syntaxin 1A gene, we speculate that residual syntaxin 1A fragments in the exon 9/10 deletion mutant mouse of Fujiwara and colleagues may be sufficient to maintain some of the key syntaxin 1A functions required for appropriate in utero development. Alternatively, it is possible that other syntaxin isoforms such as syntaxin 1B may have more effectively compensated in mice expressing truncated syntaxin 1A proteins. Overall, our data reveal an important function of syntaxin 1A in development. The notion that vastly different phenotypes are observed in two separate knockout mouse studies underscores the importance to ensure that knockout strategies do not result in truncated versions of a protein of interest. Acknowledgments This works was supported by a Grant from the Canadian Institutes of Health Research (CIHR) to GWZ and the Novartis Chair for Schizophrenia Research. GWZ is a Scientist of the Alberta Heritage Foundation for Medical Research (AHFMR) and a Canada Research Chair. C.J.D. held a Studentship award from the AHFMR and a Canada Graduate Scholarship. References [1] M. Linial, Neurotoxins as tools in dissecting the exocytic machinery, Subcell Biochem. 34 (2000) 39–72. [2] J. Pevsner, S.C. Hsu, J.E. Braun, N. Calakos, A.E. Ting, M.K. Bennett, R.H. Scheller, Specificity and regulation of a synaptic vesicle docking complex, Neuron 13 (2) (1994) 353–361. [3] J. Rettig, C. Heinemann, U. Ashery, Z.H. Sheng, C.T. Yokoyama, W.A. Catterall, E. Neher, Alteration of Ca2+ dependence of neurotransmitter release by disruption of Ca2+ channel/syntaxin interaction, J. Neurosci. 17 (17) (1997) 6647–6656. [4] Z.H. Sheng, J. Rettig, T. Cook, W.A. Catterall, Calcium-dependent interaction of N-type calcium channels with the synaptic core complex, Nature 379 (6564) (1996) 451–454. [5] Z.H. Sheng, J. Rettig, M. Takahashi, W.A. Catterall, Identification of a syntaxinbinding site on N-type calcium channels, Neuron 13 (6) (1994) 1303–1313. [6] J.D. Spafford, G.W. Zamponi, Functional interactions between presynaptic calcium channels and the neurotransmitter release machinery, Curr. Opin. Neurobiol. 13 (3) (2003) 308–314. [7] S. Mochida, Z.H. Sheng, C. Baker, H. Kobayashi, W.A. Catterall, Inhibition of neurotransmission by peptides containing the synaptic protein interaction site of N-type Ca2+ channels, Neuron 17 (4) (1996) 781–788. [8] I. Bezprozvanny, R.H. Scheller, R.W. Tsien, Functional impact of syntaxin on gating of N-type and Q-type calcium channels, Nature 378 (6557) (1995) 623– 626. [9] I. Bezprozvanny, P. Zhong, R.H. Scheller, R.W. Tsien, Molecular determinants of the functional interaction between syntaxin and N-type Ca2+ channel gating, Proc. Natl. Acad. Sci. USA 97 (25) (2000) 13943–13948.
377
[10] S.E. Jarvis, W. Barr, Z.P. Feng, J. Hamid, G.W. Zamponi, Molecular determinants of syntaxin 1 modulation of N-type calcium channels, J. Biol. Chem. 277 (46) (2002) 44399–44407. [11] S.E. Jarvis, J.M. Magga, A.M. Beedle, J.E. Braun, G.W. Zamponi, G protein modulation of N-type calcium channels is facilitated by physical interactions between syntaxin 1A and Gbetagamma, J. Biol. Chem. 275 (9) (2000) 6388– 6394. [12] S.E. Jarvis, G.W. Zamponi, Distinct molecular determinants govern syntaxin 1A-mediated inactivation and G-protein inhibition of N-type calcium channels, J. Neurosci. 21 (9) (2001) 2939–2948. [13] E.F. Stanley, Syntaxin I modulation of presynaptic calcium channel inactivation revealed by botulinum toxin C1, Eur. J. Neurosci. 17 (6) (2003) 1303–1305. [14] I. Dulubova, S. Sugita, S. Hill, M. Hosaka, I. Fernandez, T.C. Sudhof, J. Rizo, A conformational switch in syntaxin during exocytosis: role of munc18, EMBO J. 18 (16) (1999) 4372–4382. [15] K.M. Misura, R.H. Scheller, W.I. Weis, Three-dimensional structure of the neuronal-Sec1-syntaxin 1a complex, Nature 404 (6776) (2000) 355–362. [16] M.A. Poirier, W. Xiao, J.C. Macosko, C. Chan, Y.K. Shin, M.K. Bennett, The synaptic SNARE complex is a parallel four-stranded helical bundle, Nat. Struct. Biol. 5 (9) (1998) 765–769. [17] T. Fujiwara, T. Mishima, T. Kofuji, T. Chiba, K. Tanaka, A. Yamamoto, K. Akagawa, Analysis of knock-out mice to determine the role of HPC-1/ syntaxin 1A in expressing synaptic plasticity, J. Neurosci. 26 (21) (2006) 5767–5776. [18] M.N. Jagadish, J.T. Tellam, S.L. Macaulay, K.H. Gough, D.E. James, C.W. Ward, Novel isoform of syntaxin 1 is expressed in mammalian cells, Biochem. J. 321 (Pt 1) (1997) 151–156. [19] T. Nakayama, K. Mikoshiba, T. Yamamori, K. Akagawa, Expression of syntaxin 1C, an alternative splice variant of HPC-1/syntaxin 1A, is enhanced by phorbolester stimulation in astroglioma: participation of the PKC signaling pathway, FEBS Lett. 536 (1–3) (2003) 209–214. [20] T. Nakayama, K. Mikoshiba, T. Yamamori, K. Akagawa, Activation of syntaxin 1C, an alternative splice variant of HPC-1/syntaxin 1A, by phorbol 12myristate 13-acetate (PMA) suppresses glucose transport into astroglioma cells via the glucose transporter-1 (GLUT-1), J. Biol. Chem. 279 (22) (2004) 23728–23739. [21] S. Irwin, Comprehensive observational assessment: Ia. A systematic, quantitative procedure for assessing the behavioral and physiologic state of the mouse, Psychopharmacologia 13 (3) (1968) 222–257. [22] P. Sgado, L. Alberi, D. Gherbassi, S.L. Galasso, G.M. Ramakers, K.N. Alavian, M.P. Smidt, R.H. Dyck, H.H. Simon, Slow progressive degeneration of nigral dopaminergic neurons in postnatal engrailed mutant mice, Proc. Natl. Acad. Sci. USA 103 (41) (2006) 15242–15247. [23] J.L. Tillerson, G.W. Miller, Grid performance test to measure behavioral impairment in the MPTP-treated-mouse model of Parkinsonism, J. Neurosci. Methods 123 (2) (2003) 189–200. [24] J.R. Ison, D.W. McAdam, G.R. Hammond, Latency and amplitude changes in the acoustic startle reflex of the rat produced by variation in auditory prestimulation, Physiol. Behav. 10 (6) (1973) 1035–1039. [25] R. Morris, Developments of a water-maze procedure for studying spatial learning in the rat, J. Neurosci. Methods 11 (1) (1984) 47–60. [26] K. Suga, T. Yamamori, K. Akagawa, Identification of the carboxyl-terminal membrane-anchoring region of HPC-1/syntaxin 1A with the substitutedcysteine-accessibility method and monoclonal antibodies, J. Biochem. (Tokyo) 133 (3) (2003) 325–334.