Synthesis and characterisation of oligodeoxynucleotides containing thio analogues of (6-4) pyrimidine—pyrimidinone photo-dimers1

J. Mol. Biol. (1998) 279, 89±100

Synthesis and Characterisation of Oligodeoxynucleotides Containing Thio Analogues of (6-4) Pyrimidine ±Pyrimidinone Photo-dimers Mark A. Warren1, James B. Murray2 and Bernard A. Connolly1* 1

Department of Biochemistry and Genetics, University of Newcastle, Newcastle upon Tyne NE2 4HH, UK 2

Department of Biology University of Leeds Leeds LS2 9JT, UK

A method for the preparation of an oligodeoxynucleotide, 20 bases in length, containing centrally located thio analogues of (6-4) pyrimidinepyrimidinone thymine photo-dimers is reported. The approach is based on the selective irradiation, at 350 nm, of a Tp4ST (4ST ˆ 4-thiothymidine) step within a 20-mer having the sequence: d(ACTCGGACCT(4ST)CGCTGTGAT). Conversion of the S5-(6-4)/S5-thietane pyrimidine-pyrimidinone, initially formed, to its S5-Dewar isomer is by a subsequent irradiation at 300 nm. Both of the photo-dimer-containing oligonucleotides were puri®ed by HPLC (ion exchange and reverse phase) and characterised by base composition analysis. The S5-(6-4)/S5-thietane pyrimidine-pyrimidinone containing 20-mer has a characteristic UV absorbance at 320 nm and exhibits strong ¯uorescence when excited at this wavelength. As expected, conversion to the S5-Dewar isomer abolished both the 320 nm absorbance and the ¯uorescence emission. The lengths of the oligonucleotides produced allowed the formation of stable double-stranded DNA, by hybridisation to a complementary sequence. Examination of these duplexes by circular dichroism spectroscopy showed that they formed B-DNA, with little changes to their gross structure as compared to the parent duplex. However, local structural perturbations in the region of the photo-dimer cannot be excluded. The S5-(64)/S5-thietane photoproduct lowered the tm by 10.5 deg. C and the Dewar isomer by 12 deg. C. The degree of curvature induced in the DNA sequence by the introduction of the photo-dimers was assessed by analysing the migration of modi®ed and unmodi®ed multimer ladders on polyacrylamide gels. Both photoproducts induced considerable bending into the DNA. A comparison with a six-base-pair T tract, a bending standard that has a known bend angle of 19 , gave values of around 47 for the S5-(6-4)/S5-thietane product and about 28 for the S5-Dewar isomer. # 1998 Academic Press Limited

*Corresponding author

Keywords: UV light; thymine photo-dimers; (6-4) pyrimidine ± pyrimidinone; 4-thiothymidine; DNA bending

Introduction When DNA is subjected to UV radiation a large number of photoproducts are formed (Ananthaswamy & Piercell, 1990; Cadet & Vigny, 1990). Among the major photoproducts are the Present address: J. B. Murray, Department of Chemistry, Indiana University, Bloomington, IN 47405, USA. Abbreviations used: HPLC, high performance liquid chromatography; CD, circular dichroism; DTT, dithiothreitol. 0022±2836/98/210089±12 $25.00/0/mb981719

pyrimidine photo-dimers, which arise from the crosslinking of two adjacent pyrimidines (usually thymidine) on the same DNA strand. Pyrimidine photo-dimers occur as two major families; the cyclobutane pyrimidine dimers and (6-4) pyrimidine ± pyrimidinone adducts. The latter exists in two isomeric forms, the (6-4) derivative and its Dewar isomer, as illustrated in Figure 1 (Taylor & Cohrs, 1987). These photo-dimers have been implicated in mutagenesis and cancer, particularly skin cancer (Protic-Sabljic et al., 1986; Mitchell & Nairn, 1989; Brash et al., 1991). # 1998 Academic Press Limited

90 Investigation of UV-induced damage to DNA is dependent upon obtaining suf®cient quantities of pure de®ned substrates. These are essential for studying DNA repair enzymes and to evaluate any effects the photoproducts may have on DNA conformation. Considerable progress has been made with the cyclobutane pyrimidine dimers, where it has been possible to produce an appropriately protected dimer synthon for use in the chemical synthesis of oligodeoxynucleotides (Taylor et al., 1987; Taylor & Brockie, 1988; Taylor & Nadji, 1991). This approach has not been reported for the (6-4) photo-dimers. An examination of the structure of these dimers (Figure 1) shows the presence of both a 2-pyrimidinone and a 5-6 saturated pyrimidine. Both of these functions are not 100 % stable to the conditions of oligonucleotide synthesis (Schulhof et al., 1988; Connolly & Newman, 1989). Also an additional secondary hydroxyl group is introduced at the 50 -position of the saturated pyrimidine, and this would require protection during oligonucleotide synthesis. The simplest method for preparing DNA, containing (6-4) photo-dimers, has been 260 nm irradiation of short synthetic oligonucleotides, followed by HPLC separation of the resulting photoproducts. This has been achieved with DNA sequences containing a single TpT step to produce both the (6-4) photo-dimer and, by a subsequent irradiation at 300 nm, its Dewar isomer (Le Clerc et al., 1991; Smith & Taylor, 1993; Zhao & Taylor, 1994; Zhao et al., 1995; Kim & Choi, 1995; Hwang et al., 1996). However, the complexity of the reaction produces a large number of different photoproducts, which require careful HPLC separation and characterisation. Consequently, the yields of the desired photoproducts are low. For example, irradiation of the hexamer d(AATTAA) was reported to give only a 3% yield for the (6-4) adduct (Smith & Taylor, 1993). However, higher yields of around 10% have been found for d(CGCATTACGC) (Kim & Choi, 1995; Hwang et al., 1996). A subsequent enzymic ligation can be used to convert the short, photo-dimer-containing oligonucleotides initially formed into products of a length suitable for the study of DNA repair (Svoboda et al., 1993; Reardon et al., 1993; Zhao et al., 1995). An alternative approach uses the sequence Tp4ST, where 4ST is the modi®ed pyrimidine, 4thiothymidine. 4-Thiothymidine has a UV absorbance maximum at around 340 nm, well resolved from the absorbances of the four normal bases (Connolly & Newman, 1989; Favre, 1990). It has been shown that irradiation of the dimer Tp4ST, in the 340 nm region, gives high yields of S5-(6-4) photo-dimers (Clivio et al., 1991, 1992). Conversion of the S5-(6-4) product to its S5-Dewar isomer was achieved by a subsequent irradiation at 320 nm. As shown in Figure 1, the products formed from Tp4ST are very close structural homologues of the natural (6-4) photo-dimer and its Dewar isomer. The only difference being an SH, rather than an OH, at the 50 position of the saturated pyrimidine.

Thio Analogues of Pyrimidine ±Pyrimidinones

There is, however, one important difference in the behaviour of the photoproducts formed from TpT and Tp4ST. (6-4) Photodimers are formed via a four-membered ring intermediate (Figure 1). With TpT the oxetane formed is unstable, except at very low temperatures (Rahn & Hosszu, 1969), and immediately converts to the (6-4) photoproduct. A similar mechanism generates S5-(6-4) photoproducts from Tp4ST, but in this case the corresponding four-membered ring thietane intermediate is reasonably stable (Clivio et al., 1991, 1992). Thus the product formed is actually a mixture of the thietane and the S5-(6-4) forms with the equilibrium being in favour of the thietane by a ratio of 3:1 (Clivio et al., 1991, 1992). Recently this approach has been extended to short oligodeoxynuceleotides (Liu & Taylor, 1996). In this study an 80 -mer, GTAT(4ST)ATG, was used as the starting material to prepare oligonucleotides containing Tp4ST-derived photo-dimers, and to study some of their properties. With this oligonucleotide the initial photoproduct formed was predominantly the thietane with little of the S5-(6-4) form being detected. In agreement with the above observations, theoretical calculations have also shown that pyrimidine-derived thietanes and their ringopened forms are of similar stability, with perhaps a slight preference for the ring-opened form. Simi-

Figure 1. The structures of the photo-dimers investigated in this paper. A, (TpT)/(Tp4ST); B, oxetane/S5thietane; C, (6-4)/S5-(6-4); D, (Dewar)/(S5-Dewar); In all cases these structures are embedded in the 20-mer d(ACTCGGACCTTCGCTGTGAT) at the underlined, central TpT step. Irradiation of TpT (254 nm) or Tp4ST (350 nm) initially gives the four-membered ring oxetane (TpT) or thietane (Tp4ST). The oxetane is unstable and immediately converts to the (6-4). The thietane is reasonably stables and exists as an equilibrium mixture with the S5-(6-4). Further irradiation of both the (6-4) and S5-(6-4) at 300 nm gives the Dewar isomers.

Thio Analogues of Pyrimidine ±Pyrimidinones

lar calculations clearly showed that oxetanes are far less stable than their ring-opened isomers (Liu & Taylor, 1996; Heelis & Shubin, 1997). Given the similar stability of S5-(6-4) photo-dimers and their thietane forms, it might be expected that the proportions of them in an equilibrium mixture would be highly sensitive to DNA sequence and structure (double versus single-stranded DNA) and also environmental conditions (pH, ionic strength, nature of positively charged counterions, etc.). Here we have extended the Tp4ST approach to oligodeoxynucleotides 20 bases long. DNA of this length, containing photo-dimers, can be hybridised to a complementary strand to give a stable duplex. This has enabled us to study some of the properties of a double-stranded DNA containing a single photolesion of the (6-4) family. For convenience, throughout this paper, we have referred to the initial photoproduct formed as the S5-(6-4) pyrimidine-pyrimidinone. However, as discussed above, this product is actually an equilibrium mixture of the (6-4) and the thietane forms, of unknown proportions, which probably favours the thietane. When necessary we have discussed this distinction. Experiments have also been carried out with oligonucleotides containing a single S5-Dewar photodimer.

Results and Discussion Preparation of oligonucleotides containing S5-(6-4) pyrimidine-pyrimidinone and S5-Dewar photo-dimers Initial experiments showed that the conversion of Tp4ST-containing oligodeoxynucleotides, to the S5-(6-4) pyrimidine ± pyrimidinone derivative, was considerably improved in the presence of the complementary strand. Yields were higher and less side products were visible by HPLC. Formation of (6-4) derivatives involves the reaction of two adjacent pyrimidines, and presumably the geometrical arrangement required for optimal reaction is better in double than single-stranded DNA. Figure 2A shows an HPLC trace of the starting oligonucleotide, and its complement. As 4ST absorbs at 340 nm, the oligonucleotide that contains this base can also be detected at this wavelength. Irradiation at 350 nm, until the 4ST-containing oligonucleotide had disappeared, gave two main products that were formed in about equal quantities, as shown in Figure 2B. (6-4) Photo-dimers have a characteristic absorbance maximum in the range of 315 to 325 nm (Varghese & Wang, 1968; Franklin et al., 1982; Rycyna & Alderfer, 1985; Blais et al., 1994), allowing the product to be identi®ed by monitoring HPLC traces at 254 nm and 315 nm simultaneously (Figure 2B). The S5-(6-4) photo-dimercontaining oligonucleotide was isolated from the reaction mixture by HPLC on a reverse phase C18 column followed by an ion-exchange column (Figure 2B, and C). It is important to separate the complementary strand and the S5-(6-4) oligonu-

91 cleotide as completely as possible on the ®rst, reverse phase, column. The peak eluting at about 18 minutes on the second, ion-exchange, column is a duplex composed of these two oligonucleotides. Even at high temperatures (up to 65 deg. C) it proved dif®cult to melt this duplex completely under the conditions used for the ion exchange column. The ®nal purity, of the S5-(6-4) oligonucleotide was high, as shown by the HPLC trace in Figure 2D. Yields were typically 10%, which, considering the length of the oligonucleotide, compare favourably with the 25% reported for the production of S5-(6-4) photo-dimer from Tp4ST (Clivio et al., 1992). The major side product of the photolysis reaction, shown in Figure 2B, turned out to be an oligonucleotide in which the Tp4ST step had been converted to TpT, i.e. conversion of the 4-keto sulphur to an oxygen. This was established by HPLC co-elution with an authentic oligonucleotide and base composition analysis (not shown). Photooxidation of 4ST is a well-known reaction (Favre, 1990) and we initially assumed that this was the cause of the side reaction. However, attempts to minimise photo-oxidation such as: extensive degassing of solvents, performing the reaction under nitrogen, and the presence of dithiothreitol as an oxygen scavenger, had little effect. The desired S5(6-4) photoproduct and the TpT containing side product were invariably obtained in approximately 1:1 ratios. We are currently investigating the idea that this side reaction may be due to photohydrolysis rather than photo-oxidation, with the 4-keto oxygen atom derived from water rather than oxygen. In this case the side reaction may be minimised by lowering the pH. A further reason for the low yield is the close elution of the complementary oligonucleotide and the desired S5-(6-4) photoproduct on reverse phase HPLC (Figure 2B), which gives rise to some losses during puri®cation. We have experimented with the 50 -dimethoxytrityl derivative of the complement, which is well separated from the S5-(6-4) product on reverse phase HPLC. Unfortunately, we observed considerable loss of the dimethoxytrityl group during the irradiation step. Nevertheless, it should be possible to improve this separation, and thus the yield, by other variations to the complementary oligodeoxynucleotide e.g. a shorter strand that only hybridises to the central bases of the Tp4ST-containing oligonucleotide, or a longer oligomer with single-stranded overhangs. The 20-mer containing the S5-(6-4) photoproduct, which was initially formed, could be isomerised to the Dewar product by a subsequent irradiation at 300 nm. We were unable to separate the S5-(6-4) 20-mer from its S5-Dewar isomer by reverse phase HPLC. However, these two compounds could be separated by ion-exchange HPLC as shown in Figure 3A. Thus ion-exchange HPLC provided the best method of monitoring the reaction (Figure 3A) and also carrying out the ®rst stage of the puri®cation (Figure 3B). However, a second puri®cation

92

Thio Analogues of Pyrimidine ±Pyrimidinones

Figure 2. The preparation and puri®cation of an oligonucleotide containing a S5-(6-4) photo-dimer as monitored by HPLC. A, 1:1 mixture of d(ACTCGGACCT(4ST)CGCTGTGAT (-Tp4ST-) and its complement d(ATCACAGCGAAGGTCCGAGT) (ApA) examined by C-18 reverse phase HPLC. Blue trace, 260 nm; red trace, 340 nm. B, As in A but following irradiation at 350 nm until all the -(Tp4ST)-containing oligonucleotide had disappeared. -S5-(6-4)- and -TpT- represent oligonucleotides containing these functions at the central TpT step. This column was used to partially purify the -S5-(6-4)-containing oligonucleotide. Blue trace, 260 nm; red trace, 315 nm. C, Second puri®cation step of the -S5-(6-4)-containing oligonucleotide on ion-exchange HPLC. Blue trace, 260 nm; red trace, 315 nm. D, Final purity of the -S5-(6-4)-containing oligonucleotide as assessed by C-18 reverse phase HPLC. Blue trace, 260 nm; red trace, 315 nm.

step, based on reverse phase HPLC (Figure 3C), was needed to give completely pure product (Figure 3D). As expected, conversion to the S5Dewar isomer resulted in a loss of the absorbance at 315 nm (Taylor & Cohrs, 1987). The yield of S5Dewar-containing oligonucleotide was approximately 20%, from the S5-(6-4) 20-mer. Characterisation of oligonucleotides containing Tp4ST-derived photo-dimers Figure 4A shows that the 20-mer that we puri®ed by HPLC, and that we assumed contained the S5-(6-4) dimer, absorbs light at around 320 nm, clearly visible as a shoulder on the main 260 nm

peak. This is characteristic of (6-4) derivatives (Varghese & Wang, 1968; Franklin et al., 1982; Rycyna & Alderfer, 1985, Blais et al., 1994). For comparison, the spectrum of a control oligonucleotide, identical in sequence but having a TpT step in place of the S5-(6-4) product, is given. Here, no shoulder at 320 nm can be seen. Dewar isomers of (6-4) derivatives lack 320 nm absorbance (Taylor & Cohrs, 1987) and, as expected, the UV spectrum of this oligonucleotide is identical to that of the control oligonucleotide (Figure 4A). Oligonucleotides that contain (6-4) photo-dimers exhibit ¯uorescence when excited at 320 nm, due to the presence of the pyrimidinone (Hauswirth & Wang, 1973; Blais et al., 1994). This ¯uorescence is

Thio Analogues of Pyrimidine ±Pyrimidinones

93

Figure 3. The conversion of d(ACTCGGACC[S5-(6-4)]CGCTGTGAT to d(ACTCGGACC[S5-Dewar]CGCTGTGAT, by irradiation at 300 nm, monitored by HPLC. A, Ion-exchange HPLC of the reaction mixture, at about 50% conversion, illustrating the separation of the S5-(6-4) and the S5-(Dewar)-containing oligonucleotides. When all the -S5-(6-4)derivative had disappeared, this column was used for the initial puri®cation of the -S5-(Dewar)- species. Blue trace, 260 nm; red trace, 315 nm. B, Appearance of the -S5-(Dewar)-containing oligonucleotide, as assessed by ion-exchange HPLC, following the initial puri®cation step. Blue trace, 260 nm; red trace, 315 nm. C, As in B, but analysis using C18 reverse phase HPLC. D, Final purity of the -S5-(Dewar)-containing oligonucleotide, following a second chromatographic step using a reverse phase column, as assessed by C18 reverse phase HPLC. Blue trace, 260 nm; red trace, 315 nm.

good for diagnosis of (6-4) adducts as the four normal bases and the vast majority of DNA photoproducts are non-¯uorescent. The oligonucleotide containing the S5-(6-4) was strongly ¯uorescent, when excited at 320 nm, with an emission maximum around 370 nm (Figure 4B). This value is lower than that at 393 to 405 nm reported for the (6-4) photo-dimer of TpT (Hauswirth & Wang, 1973; Franklin et al., 1982; Blais et al., 1994). However, this difference is probably due to our oligonucleotide containing an S5-(6-4) dimer, rather than the (6-4) dimer investigated in the other studies. At present we do not know whether the ¯uorescence arises solely from the S5-(6-4) component of the S5(6-4)/thietane equilibrium mixture, or whether the

thietane also contributes to the ¯uorescence. The oligonucleotide containing the S5-Dewar photoproduct was not ¯uorescent, as expected (Figure 4B). Likewise, the control oligonucleotide, having a TpT step, also showed no ¯uorescence (not shown). Further characterisation of the photoproduct containing 20-mers used base composition analysis, by total digestion with snake venom phosphodiesterase and alkaline phosphatase (Connolly, 1991). Both the starting 20-mer d(ACTCGGACCT(4ST)CGCTGTGAT) and a control oligonucleotide, in which the 4ST is replaced by T, gave the expected base compositions (Figure 5A and B). With the 4ST containing oligonucleotide an extra

94 peak, corresponding to the modi®ed base, was clearly visible and one less T, compared to the control, was present. The analysis of the S5-(6-4) photo-dimer containing 20-mer (Figure 5C) shows an additional peak, which absorbs better at 315 than 254 nm. The characteristic 315 nm absorbance almost certainly identi®es this peak as the S5-(6-4) photo-dimer dinucleotide released from the 20-mer during the enzymic hydrolysis. Furthermore, this 20-mer lacked two T bases, compared to the control, as expected. Analysis of the S5-Dewar-containing oligodeoxynucleotide did not reveal any extra peaks. The S5-Dewar dimer contains a 5,6-saturated pyrimidine and a Dewar benzene component (Figure 1), neither of which shows appreciable UV absorbance at 254 or 315 nm. Therefore, one would not expect to see an additional peak corresponding to an S5-Dewar photo-dimer dinucleotide. As anticipated, the Dewar 20-mer also contained two fewer T bases than the control. The TpT, Tp4ST, S5-(6-4) and S5-Dewar containing 20-mers were labelled at their 50 ends with 32P. Analysis by denaturing polyacrylamide gel electrophoresis revealed single bands of identical mobility, at the position expected for a 20-mer (not shown). Properties of oligonucleotides containing Tp4ST-derived photo-dimers The CD spectra of the double-stranded oligonucleotides containing S5-(6-4) and S5-Dewar adducts were very similar to those of the unmodi®ed oligomers (Figure 4C). All the CD spectra shown in Figure 4C are very characteristic of B-DNA (Fairall et al., 1989). This suggests that the introduction of the two photo-dimers does not result in a drastic overall change to the conformation of the duplex. However, CD spectroscopy is a relatively blunt method that reports on overall conformational parameters. The spectra shown in Figure 4C are fully consistent with local structural perturbations, in the vicinity of the photo-dimer, and relatively normal B-DNA ¯anking this region. NMR spectroscopy of 10-mers containing both a (6-4) and a Dewar lesion, has indicated structural perturbations, con®ned mainly to the immediate location of the photo-dimer (Kim & Choi, 1995; Kim et al., 1995; Hwang et al., 1996). We have measured the tm values for the oligodeoxynucleotides under study (table 1). The control duplex 20 base-pairs in length, containing a normal TpT step, and the corresponding duplex, containing Tp4ST, had similar tm values of 63.5 and 61 C, respectively. Introduction of S5-(6-4) and S5Dewar reduces the tm of the sequence to 53 C and 51 C, respectively. This lowering of tm by 10.5 deg. C for the S5-(6-4) and 12.5 deg. C for the S5-Dewar is most probably due to the lesion disrupting base-pairing to the complementary dA residues, creating a single-stranded bubble in the middle of the sequence. Investigation by NMR spectroscopy suggested that (6-4) dimers result in a loss of Watson ±Crick base-pairing at the 30 T,

Thio Analogues of Pyrimidine ±Pyrimidinones Table 1. The melting temperatures of the oligodeoxynucleotides used in this study Oligodeoxynucleotide -(TpT)-(Tp4ST)-S5-(6-4)-S5-(Dewar)-

Melting temperature (tm  C) 63.5  1.5 61.0  1.0 53.0  1.5 51.0  1.0

All oligodeoxynucleotides were derivatives of the sequence d(ACTCGGACCTTCGCTGTGAT) with the functions shown at the underlined TpT step. Duplexes were prepared by hybridisation with a complementary sequence.

whereas with Dewar dimers base-pairing at both T residues is abolished (Kim & Choi, 1995; Kim et al., 1995; Hwang et al., 1996). However, these investigators observed that a 10-mer containing a Dewar dimer is more stable than one containing a (6-4) adduct. It was proposed that the Dewar oligonucleotide was less distorted than the (6-4) and this more than compensated for the loss of an extra base-pairing interaction. In contrast, we see very little difference in tm values for S5-(6-4) and S5-Dewar-containing oligonucleotides. Structural distortions to duplex DNA, such as curvature and unwinding, can be readily detected by anomalies in their electrophoretic mobilities on polyacrylamide gels (Koo & Crothers, 1988; Hagerman, 1990; Diekmann, 1992). The oligonucleotides containing TpT, Tp4ST, S5-(6-4) and S5Dewar were blunt-end ligated to form multimer distributions. Blunt-ended ligation means that the oligonucleotides can be joined in two orientations that place the photo-dimers on the ``top'' or ``bottom'' strand. However, for phased T tracts, at least in the absence of Mg2‡, it has been shown that the strand location of the T tract does not affect the bending of the DNA (Koo et al., 1986; Hagerman, 1990). We have assumed that this is also true for the photo-dimers. As the oligonucleotides used are all 20 base-pairs in length, with the lesion exactly centrally located, ligation will result in multimers having the photo-dimers spaced by 20 bases. This is nearly in phase with the helical repeat of DNA, which varies from 10.3 base-pairs for T6 multimers to 10.5 base-pairs for ``ideal'' B-DNA (Peck & Wang, 1981; Diekmann & Wang, 1985; Drak & Crothers, 1991). Therefore any bending caused by the photo-dimers will be additive and result in considerable migration anomalies on electrophoresis. For comparison, ligation ladders have also been produced from a related 20 base-pair oligonucleotide, containing a central T6 sequence. This is known to bend DNA by between 18 and 23 (Koo & Crothers, 1988; Koo et al., 1990; Hagerman, 1990; Diekmann, 1992). The electrophoretic migration of the unmodi®ed 20-mers (containing a central TpT or Tp4ST), the S5-(6-4) and S5-Dewar containing 20mers and the T6 oligomer DNA ladders were analysed on 10% polyacrylamide gels. A typical gel of the ligation ladders is shown in Figure 6. The multimers produced from the 20-mers containing the

Thio Analogues of Pyrimidine ±Pyrimidinones

95

Figure 4. Spectral properties of oligodeoxynucleotides derived from d(ACTCGGACCTTCGCTGTGAT) and containing TpT (black traces), Tp4ST (red traces), S5-(6-4) photo-dimers (green traces) and S5-(Dewar) photo-dimers (cyan traces) at the central TpT step. A, UV spectra. B, Fluorescence spectra. The spectra of the -(TpT)- and (Tp4ST)-containing oligonucleotides are not shown, but were identical to that of the -S5-(Dewar)- derivative, i.e. non-¯uorescent. C, Circular dichroism (CD) spectra. In this case all the oligonucleotides were hybridised with their complementary sequence d(ATCACAGCGAAGGTCCGAGT).

central TpT and Tp4ST sequences migrated according to their molecular masses as assessed using molecular mass standards (10  n base-pair markers). As expected the ligation products of the T6 oligonucleotide migrated more slowly than similarly sized markers (either the 10  n base-pair standards or the ladder produced from the 20-mer containing a central TpT), due to the bending induced by this tract. The multimers produced from both the S5-(6-4) and the S5-Dewar-containing 20-mers showed a considerable reduction in their mobilities when compared with the molecular mass standards. These ligation products migrated signi®cantly more slowly than T6-containing oligonucleotides of the same size, and more retardation was seen for the S5-(6-4) as compared to the S5Dewar product. Inspection of Figure 6 leads to the conclusion that the presence of both an S5-(6-4) or

an S5-Dewar photo-dimer in an oligonucleotide causes considerable bending, greater than the 18 to 23 resulting from a T6 tract. In fact the S5-(6-4)containing oligonucleotide multimers were so retarded that it proved dif®cult to obtain suitable molecular mass markers. We had hoped to use a 100  n base-pair ladder but, as shown in Figure 6, this ladder migrated in an anomalous manner on polyacrylamide gels (although it behaved as expected on agarose gels). Thus the ladder produced from the 20-mer containing a central TpT was again used as a reference, although this does not allow investigation of the most retarded bands seen for the S5-(6-4) multimers. By comparing the mobilities of the well-resolved multimers produced from T6, S5-(6-4) and S5-Dewar, and for which molecular mass standards are available, apparent lengths can be determined. The migration data

96

Thio Analogues of Pyrimidine ±Pyrimidinones

Figure 5. Base composition analysis of oligodeoxynucleotides derived from d(ACTCGGACCTTCGCTGTGAT) and containing, at their central TpT step: A, TpT; blue trace, 260 nm; red trace, 315 nm; mole fraction of T ˆ 6. B, Tp4ST; blue trace, 260 nm; red trace, 340 nm; mole fraction of T ˆ 5. C, -S5-(6-4)-; blue trace, 260 nm; red trace, 315 nm; mole fraction of T ˆ 4. D, -S5-(Dewar)-; blue trace, 260 nm; red trace, 315 nm; mole fraction of T ˆ 4. In all cases peak integrals/extinction coef®cients of the bases were used for the determination of mole fractions (Connolly, 1991).

obtained from the gel shown in Figure 6, for multimers of between 40 and 180 base-pairs in length, is represented as a plot of RL (apparent length/actual length) versus number of base-pairs in Figure 7. This Figure con®rms that the migration anomaly is in the order S5-(6-4) > S5-Dewar T6. The RL values for T6, S5-(6-4) and S5-Dewar multimers plateau at higher numbers of base-pairs, probably because the spacing used (20 bases) is not an exact multiple of the helix repeat (10.3 to 10.5 base-pairs; Drak & Crothers, 1991). We have calculated the bending angles (Koo & Crothers, 1988; Wang & Taylor, 1993) for the S5-(6-4) and the S5-Dewar photoproducts using the multimers comprising 100, 120, 140 and 160 base-pairs. At these lengths the tailing off of RL values is not too severe. A bend angle of 47(7) was found for the S5-(6-4) photo-dimer and a value of 28(3) was measured for the S5Dewar photoproduct. These Figures should be

treated as a ®rst approximation, as the gel conditions used (10% polyacrylamide) are slightly different from the 8% polyacrylamide used previously (Koo & Crothers, 1988), where the equations for bend-angle determination were empirically derived. Furthermore, reduced mobility in gels is highly sensitive to phasing and the above bend angles are calculated by reference to the known bending caused by the T6 tract. Although the spacing of the T6 bending standard and the S5-(6-4)/Dewar oligonucleotides are the same, the comparison between them will only be completely valid if they have identical phasing relative to the helical repeat of the DNA. This question is currently being addressed using oligonucleotides in which the spacing between the lesions is varied. Finally, anomalous electrophoretic behaviour may result from features other than bending. Nevertheless, NMR spectroscopy has indicated

97

Thio Analogues of Pyrimidine ±Pyrimidinones

Figure 7. Plots of RL against actual length (in base-pairs) derived for the multimers of the oligonucleotides shown in Figure 6. RL is the ratio of the apparent length of the DNA fragment to its actual length, i.e. the mobility of the fragment under study/the mobility of a standard fragment of the same length. The TpT ladder, shown in Figure 6, was used as the standard. The data shown in Figure 7 are derived from the averages of three ladder gels of the type shown in Figure 6.

Figure 6. Ligation ladder gel. The ligation ladders were produced by blunt-ended ligation of oligodeoxynucleotides derived from dp(ACTCGGACCTTCGCTGTGAT) and containing, at their central TpT step: TpT, Tp4ST, S5(6-4) and S5-(Dewar). All these oligonucleotides were hybridised with a complementary strand, dp(ATCACAGCGAAGGTCCGAGT), prior to ligation. As a bending standard a T6 ladder was prepared by blunt-ended ligation of dp(CGCGCCGTTTTTTGCCGCGC) and its complement dp(GCGCGGCAAAAAACGGCGCG). From the left: lane 1, 100-base-pair ladder standard (these standards run in an anomalous manner on this gel); lane 2, ten-base-pair ladder standard; lane 3, -(TpT)-ladder; lane 4, -(Tp4ST)- ladder; lane 5, -S5-(6-4)ladder; lane 6, -S5-(Dewar)-ladder; lane 7, T6 ladder; lane 8, ten-base-pair ladder standard; lane 9, 100-basepair ladder standard.

that (6-4) photoproducts cause bending of 44 (Kim & Choi, 1995), in reasonable agreement with the value we have measured. A number of techniques have also indicated that (6-4) dimers disrupt DNA structure to a greater extent than their Dewar isomers (Taylor et al., 1988; Reardon et al., 1993; Taylor, 1995), again in agreement with our results. Finally, it appears that DNA bending due to thymine photo-dimers varies greatly with the nature of the photo-dimer. Values of 7 and 22 have been found for the cis-

syn and trans-syn-I cyclobutane dimers of TpT (Wang & Taylor, 1991, 1993).

Conclusion We have developed a method for the preparation of oligonucleotides, 20 bases in length, containing S5-(6-4) pyrimidine-pyrimidinone thymine dimers and their S5-Dewar isomers, based on the speci®c irradiation of 4-thiothymidine. Oligonucleotides of this length have not yet been prepared, in a pure form, by direct irradiation of TpT steps. In general the yield, of approximately 10%, for the formation of the S5-(6-4) product is slightly better than, or about the same as, those reported for irradiation of short oligonucleotides containing TpT (Smith & Taylor, 1993; Kim & Choi, 1995). Nevertheless, we ®nd this yield, and that of 20% observed for the subsequent production of the Dewar isomer, disappointing, particularly for the production of quantities suitable for NMR spectroscopy and X-ray crystallography. Attempts are being made to try to improve on these values. We are also trying to determine the equilibrium constant for the S5-(6-4)/thietane mixture (Clivio et al., 1991, 1992; Liu & Taylor, 1996) in various DNA contexts and under different buffer conditions. Although, for convenience, we have referred to the initial photoproduct formed as S5-(6-4) throughout,

98 it is more accurately described as a equilibrating mixture containing an unknown preponderance of the thietane. Thus it is not clear how much the thietane form contributes to the large degree of bending seen with the S5-(6-4) photo-dimer or if the S5-(6-4) and thietane forms bend DNA differently. Finally, we are attempting to characterise much more fully the structural perturbations shown by oligonucleotides containing S5-(6-4) and S5-Dewar photo-dimers. On the initial basis of gel electrophoresis these appear to be considerable. As part of this study it is hoped to determine if the S5(6-4) and its thietane isomer are structurally different. These properties will be critical for a full understanding of the repair of these lesions (Svoboda et al., 1993; Reardon et al., 1993).

Materials and Methods Oligonucleotide synthesis, deprotection and purification All reagents for oligodeoxynucleotide synthesis, including a 4-thiothymidine derivative with the sulphur protected with a 2-cyanoethyl group, were supplied by Cruachem Ltd (Glasgow, UK). Oligonucleotide synthesis, deprotection and puri®cation were carried out in the standard manner, with modi®cations for 4-thiothymidine as described (Nikiforov & Connolly, 1991, 1992). Preparation and purification of oligonucleotides containing an S5-(6-4) pyrimidine-pyrimidinone photo-dimer and its S5-Dewar isomer Typically between 1 and 10 mg of the oligonucleotide together with an equivalent amount of the complementary strand d(ATCACAGCGAAGGTCCGAGT), were dissolved in 10 mM KH2PO4/K2HPO4 (pH 8.0), 10 mM NaCl, 1 mM dithiothreitol to a ®nal volume of between 2 and 10 ml. The mixture was heated to 100 C for ®ve minutes, then allowed to cool to room temperature to enable the two DNA strands to anneal. During cooling, nitrogen was bubbled through the mixture to displace any dissolved air. The sample was irradiated at 350 nm in a Rayonet RMR-600 photochemical reactor for 30 minutes using RPR3500A lamps (approximate power 24 W). The reaction was cooled, by the passage of tap water through a jacket during irradiation, and nitrogen was bubbled through the sample continuously. pyrimidine-pyrimidinone-containing The S5-(6-4) deoxyoligonucleotide was puri®ed by a combination of reverse phase and ion-exchange chromatography. The crude mixture was fractionated on a C18 reverse phase HPLC column (Apex-1-ODS, 5 mm particle size, 4.6 mm  250 mm; Jones Chromatography, Mid-Glamorgan, Wales) column using an acetonitrile gradient of 6% to 12.4% over 30 minutes (¯ow rate 1 ml/min) in a 0.1 M triethylammonium acetate buffer (pH 7.5). The column was run at 55 C. The fraction containing the S5-(64) oligonucleotide was concentrated (rotary evaporator) and then puri®ed to homogeneity using an anionexchange HPLC column (NucleoPac PA-100, 4 mm  250 mm, Dionex (UK) Ltd, Camberley, Surrey) with a gradient consisting of 0.675 M to 1.5 M ammonium acetate (pH 7.5, containing 10 % (v/v) acetonitrile) at a ¯ow rate of 1.5 ml/min. The puri®ed S5-(6-4) oligonucleotide was concentrated in a Centriprep-3 spin

Thio Analogues of Pyrimidine ±Pyrimidinones concentrator (Amicon) prior to desalting with a disposable G-25 NAP gel ®ltration column (Pharmacia). The conversion of the oligonucleotide containing the S5-(6-4) photoproduct, to its S5-Dewar isomer, was achieved by irradiation at 300 nm for 30 minutes using RPR3000A lamps (approximate power 21 W). Approximately 80 mg of the S5-(6-4) oligonucleotide was dissolved in 1 ml 10 mM KH2PO4/K2HPO4 (pH 8.0), 10 mM NaCl, 1 mM DTT and degassed under nitrogen before irradiation. The S5-Dewar-containing oligonucleotide was isolated from the reaction mixture by a single run on the anion-exchange HPLC column, using the same conditions that were used to isolate the S5-(6-4)containing oligonucleotide (see above). The fraction containing the S5-Dewar oligonucleotide was concentrated in a Centriprep-3 spin concentrator and then puri®ed to homogeneity on a C18 reverse phase HPLC column, using an acetonitrile gradient of 6% to 22% over 30 minutes (¯ow rate 1 ml/min) in a 0.1 M triethylammonium acetate buffer (pH 7.5). The puri®ed (6-4) and Dewar-containing oligonucleotides were stored frozen at ÿ20 C.

Spectral measurements The UV absorbance spectra of oligonucleotides (absorbance of 1 per ml at 260 nm) were measured in 5 mM KH2PO4/K2HPO4 (pH 8.0) using a Shimadzu UV-1601 dual beam spectrophotometer. Spectra were recorded between 200 and 400 nm. Any ¯uorescence of oligonucleotides (sample preparation identical to UV spectroscopy) was recorded using an SLM Aminco ¯uorescence spectrophotometer. Fluorescence emission spectra were recorded between 340 and 540 nm using an excitation wavelength of 320 nm. CD measurements were carried out using a Jobin-Yvon Instruments SA CD6 spectrophotometer. Oligonucleotide were dissolved in 20 mM KH2PO4/K2HPO4 (pH 7.5), 100 mM NaCl, 0.1 mM EDTA at a concentration of 1 260 nm absorbance unit per ml. The CD spectra were recorded from 220 to 350 nm. Melting temperature curves were obtained using a Hewlett Packard HPUV8452A diode array spectrophotometer with a HP89090A Peltier unit controlled via a PC. Sample preparation was identical to that used for CD spectroscopy. Melting pro®les were obtained by increasing the temperature at a rate of 0.2 deg. C per min with the absorbance and temperature being recorded every three minutes.

Base composition analysis A 0.5 absorbance unit (260 nm) of oligonucleotide was dissolved in 100 ml 10 mM KH2PO4/K2HPO4 (pH 7.0), 10 mM MgCl2. Ten units of alkaline phosphatase (Boehringer) and 0.3 unit of snake venom phosphodiesterase (Boehringer) were added. The reaction was incubated at 37 C overnight to ensure total digestion of the sample. The digests were analysed using a C18 reverse phase column (details above) with a 0 to 7% acetonitrile gradient in 0.1 M triethylammonium acetate buffer (pH 7.5), over 30 minutes (¯ow rate 1 ml/min). To analyse the digest of the thiol-containing oligonucleotide, the 0 to 7% acetonitrile gradient was followed by a 7 to 49% acetonitrile gradient over ten minutes. This column was operated at room temperature. The mole fraction of each deoxynucleoside was obtained by integration (Connolly, 1991).

Thio Analogues of Pyrimidine ±Pyrimidinones Ligation ladder gels A 1 mg sample of oligonucleotide was dissolved in 50 mM Tris-HCl (pH 7.6), 10 mM MgCl2, 1 mM ATP, 1 mM DTT and phosphorylated using six units of bacteriophage T4 polynucleotide kinase (New England Biolabs) by incubation at 37 C for two hours. The single strand was mixed with 1 mg of its complement strand that had been similarly phosphorylated. The mixture was heated to 70 C, then cooled slowly to 4 C. Then two units of T4 DNA ligase (GibcoBRL or MBI) was added and the reaction mixture was incubated at 4 C for two hours. The DNA was precipitated with ethanol prior to loading on a 10% (w/v) polyacrylamide gel (29:1 (w/w) acrylamide to bis-acrylamide, made up in 45 mM Trisborate, 1.25 mM EDTA) and run at 30 W at room temperature. After running, the gel was stained with ethidium bromide prior to photography. The gel was placed on 280 to 380 nm UV transilluminator and photographed through a red optical ®lter (2 Kodak no. 25) using a high-resolution black and white ®lm (Ilford FP4, 125 ASA). The ®lm negative was enlarged to approximately 1.4 times the original gel size (255 mm  197 mm) and analysed. The mobilities of oligonucleotide ladders containing S5-(6-4) and S5-Dewar photo-dimers together with the T6 oligonucleotide bending standard d(CGCGCCGTTTTTTGCCGCGC) were compared with ``normal'' multimer ladders. The latter consisted of either a 10  n base-pair ladder reference (MBI) or the multimers derived from blunt-ended ligation of d(ACTCGGACCTTCGCTGTGAT). A 100  n base-pair reference ladder (MBI) ran in an anomalous fashion in this gel system and could not be used. RL values and bend angles were calculated as described (Koo & Crothers, 1988; Wang & Taylor, 1993).

Acknowledgement This work was supported by a grant from the North of England Cancer Research Campaign.

References Ananthaswamy, H. N. & Piercell, W. E. (1990). Molecular mechanisms of ultraviolet radiation carcinogenesis. Photochem. Photobiol. 52, 1119± 1136. Blais, J., Douki, T., Vigny, P. & Cadet, J. (1994). Fluorescence quantum yield determination of pyrimidine (6-4) pyrimidone photoadducts. Photochem. Photobiol. 59, 402± 404. Brash, D. E., Rudolph, J. A., Simon, J. A., Lin, A., McKenna, G. J., Baden, H. P., Halperin, A. J. & Ponten, J. (1991). A role for sunlight in skin cancer: UV-induced p53 mutations in squamous cell carcinoma. Proc. Natl Acad. Sci. USA, 88, 10124± 10128. Cadet, J. & Vigny, P. (1990). The photochemistry of the nucleic acids. In Bioorganic Photochemistry (Morrison, H., ed.) vol. 1, pp. 1 ± 272, John Wiley & Sons, New York. Clivio, P., Fourrey, J.-L. & Gasche, J. (1991). DNA photodamage mechanistic studies: characterisation of a thietane intermediate in a model reaction relevant to 6-4 lesions. J. Am. Chem. Soc. 113, 5481± 5483. Clivio, P., Fourrey, J.-L., Gasche, J. & Favre, A. (1992). Novel insight into the stereochemical pathway lead-

99 ing to (6-4) pyrimidine-pyrimidinone photoproducts in DNA. Tetrahedron. Letters, 33, 1615± 1618. Connolly, B. A. (1991). Oligonucleotides containing modi®ed bases. In Oligonucleotides and Analogues, a Practical Approach (Eckstein, F., ed.), pp. 155± 183, Oxford University Press, Oxford, UK. Connolly, B. A. & Newman, P. C. (1989). Synthesis and properties of oligonucleotides containing 4-thiothymidine, 5-methyl-2-pyrimidinone-1-b-D-(20 -deoxyriboside) and 2-thiothymidine. Nucl. Acids Res. 17, 4957± 4974. Diekmann, S. (1992). Analyzing DNA curvature in polyacrylamide gels. Methods Enzymol. 212, 30 ± 46. Diekmann, S. & Wang, J. C. (1985). On the sequence determinants and ¯exibility of the kinetoplast DNA fragment with abnormal gel electrophoretic mobilities. J. Mol. Biol. 186, 1 ± 11. Drak, J. & Crothers, D. M. (1991). Helical repeat and chirality effects on DNA gel electrophoretic mobility. Proc. Natl Acad. Sci. USA, 88, 3074± 3078. Fairall, L., Martin, S. & Rhodes, D. (1989). The DNA binding site of the Xenopus transcription factor IIIA has a non-B-form structure. EMBO J. 8, 1809± 1817. Favre, A. (1990). 4-Thiouridine as an intrinsic photoaf®nity probe of nucleic acid structure and interactions. In Bioorganic Photochemistry (Morrison, H., ed.) vol. 1, pp. 379± 425, John Wiley & Sons, New York. Franklin, W. A., Lo, K. M. & Haseltine, W. A. (1982). Alkaline lability of ¯uorescent photoproducts produced in ultraviolet light-irradiated DNA. J. Biol. Chem. 257, 13535± 13543. Hagerman, P. J. (1990). Sequence speci®c curvature of DNA. Annu. Rev. Biochem. 59, 751±781. Hauswirth, W. & Wang, S. Y. (1973). Pyrimidine adduct ¯uorescence in UV irradiated nucleic acids. Biochem. Biophys. Res. Commun. 51, 819± 826. Heelis, P. F. & Shubin, L. (1997). Photoenzymic repair of the DNA 6-4 product: a density functional theory and semiempirical study. J. Am. Chem. Soc. 119, 2936± 2937. Hwang, G.-S., Kim, J.-K. & Choi, B.-S. (1996). NMR structural studies of DNA decamer duplex containing the Dewar photoproduct of thymidylyl(30 ! 50 )thymidine. Conformational changes of the oligonucleotide duplex by photoconversion of a (6-4) adduct to its Dewar valence isomer. Eur. J. Biochem. 235, 359± 365. Kim, J.-K. & Choi, B.-S. (1995). The solution structure of DNA duplex-decamer containing the (6-4) photoproduct of thymidylyl(30 ! 50 )thymidine by NMR and relaxation matrix re®nement. Eur. J. Biochem. 228, 849± 54. Kim, J.-K., Patel, D. & Choi, B.-S. (1995). Contrasting structural impacts induced by cis-syn cyclobutane dimer and (6-4) adduct in DNA duplex decamers: implication in mutagenesis and repair activity. Photochem. Photobiol. 62, 44 ± 50. Koo, H.-S. & Crothers, D. M. (1988). Calibration of DNA curvature and a uni®ed description of sequencedirected bending. Proc. Natl Acad. Sci. USA, 85, 1763± 1767. Koo, H.-S., Wu, H.-M. & Crothers, D. M. (1986). DNA bending at adenine-thymine tracts. Nature, 320, 501± 506. Koo, H.-S., Drak, J., Rice, J. A. & Crothers, D. M. (1990). Determination of the extent of DNA bending by an adenine-thymine tract. Biochemistry, 29, 4227± 4234.

100

Thio Analogues of Pyrimidine ±Pyrimidinones

Le Clerc, J. E., Borden, A. & Lawrence, C. W. (1991). The thymine-thymine pyrimidine-pyrimidone (6-4) ultraviolet light photoproduct is highly mutagenic and speci®cally induces 30 thymine-to-cytosine transitions in Escherichia coli. Proc. Natl Acad. Sci. USA, 88, 9685± 9689. Liu, J.-Q. & Taylor, J.-S. (1996). Remarkable photoreversals of a thio analog of the Dewar valence isomer of the (6-4) photoproduct of DNA to the parent nucleotides. J. Am. Chem. Soc. 118, 3287± 3288. Mitchell, D. L. & Nairn, R. S. (1989). The biology of the (6-4) photoproduct. Photochem. Photobiol. 49, 805± 819. Nikiforov, T. T. & Connolly, B. A. (1991). The synthesis of oligonucleotides containing 4-thiothymidine residues. Tetrahedron Letters, 32, 3851 ±3854. Nikiforov, T. T. & Connolly, B. A. (1992). Straightforward preparation and use in oligodeoxynucleotide synthesis of 50 -O-(4,40 -dimethoxytrityl)-4[S-2-cyanoethyl]-thiothymidine. Tetrahedron Letters, 33, 2379± 2382. Peck, L. J. & Wang, J. C. (1981). Sequence dependence of the helical repeat of DNA in solution. Nature, 292, 375± 378. Protic-Sabljic, M., Tuteja, N., Munson, P. J., Hauser, J., Kraemer, K. H. & Dixon, K. (1986). UV lightinduced cyclobutane pyrimidine dimers are mutagenic in mammalian cells. Mol. Cell Biol. 6, 3349± 3356. Rahn, R. O. & Hosszu, J. L. (1969). Photochemical studies of thymine in ice. Photochem. Photobiol. 10, 131± 137. Reardon, J. T., Nichols, A. F., Keeney, S., Smith, C. A., Taylor, J.-S., Linn, S. & Sancar, A. (1993). Comparative analysis of binding of human damaged DNA-binding protein (XPE) and Escherichia coli damage recognition protein (UvrA) to the major ultraviolet photoproducts: T[c,s]T, T[t,s]T, T[6-4]T, and T[Dewar]T. J. Biol. Chem. 268, 21301± 21308. Rycyna, R. E. & Alderfer, A. L. (1985). UV irradiation of nucleic-acids: formation, puri®cation and solution conformational-analysis of the 6-4-lesion of dTpdT. Nucl. Acids Res. 13, 5949±5963. Schulhof, J. C., Molko, D. & Teoule, R. (1988). Synthesis of DNA fragments containing 5,6-dihydrothymine, a major product of thymine gamma radiolysis. Nucl. Acids Res. 16, 9± 26. Smith, C. A. & Taylor, J.-S. (1993). Preparation and characterization of a set of deoxyoligonucleotide

49-mers containing site-speci®c cis-syn, trans-syn-I, (6-4), and Dewar photoproducts of thymidylyl(30 ! 50 )-thymidine. J. Biol. Chem. 268, 11143± 11151. Svoboda, D. L., Smith, C. A., Taylor, J.-S. & Sancar, A. (1993). Effect of sequence, adduct type, and opposing lesions on the binding and repair of ultraviolet photodamage by DNA photolyase and (A)BC excinuclease. J. Biol. Chem. 268, 10694± 10700. Taylor, J.-S. (1995). DNA, Sunlight and skin cancer. Pure Appl. Chem. 67, 183± 190. Taylor, J.-S. & Brockie, I. R. (1988). Synthesis of a transsyn thymine dimer building block. Solid phase synthesis of CGTAT[t,s]TATGC. Nucl. Acids Res. 16, 5123± 5136. Taylor, J.-S. & Cohrs, M. P. (1987). DNA, Light, and Dewar pyrimidine: the structure and biological signi®cance of TpT3. J. Am. Chem. Soc. 109, 2834± 2835. Taylor, J.-S. & Nadji, S. (1991). Unravelling the origin of the major mutation induced by ultraviolet light, the C ! T transition at dTpdC sites. A DNA synthesis building block for the cis-syn cyclobutane dimer of dTpdU. Tetrahedron, 47, 2579± 2590. Taylor, J.-S., Brockie, I. R. & O'Day, C. L. (1987). A building block for the sequence-speci®c introduction of cis-syn thymine dimers into oligonucleotides. Solid-phase synthesis of TpT[c,s]pTpT. J. Am. Chem. Soc. 109, 6735± 6742. Taylor, J.-S., Garrett, D. S. & Cohrs, M.-P. (1988). Solution-state structure of the Dewar pyrimidinone photoproduct of thymidylyl-(30 ! 50 )-thymidine. Biochemistry, 27, 7206± 7215. Varghese, A. J. & Wang, S. Y. (1968). Thymine-thymine adduct as a photoproduct of thymine. Science, 160, 186± 187. Wang, C.-I. & Taylor, J.-S. (1991). Site-speci®c effect of thymine dimer formation on dAn. dTn tract bending and its biological implications. Proc. Natl Acad. Sci. USA, 88, 9072± 9076. Wang, C.-I. & Taylor, J.-S. (1993). The trans-syn-I thymine dimer bends DNA by approximately 22 degrees and unwinds DNA by approximately 15 degrees. Chem. Res. Toxicol. 6, 519± 523. Zhao, X. & Taylor, J.-S. (1994). Eliciting DNA photoproduct speci®c antibodies with a dinucleotide photoproduct antigen. 116, 8870± 8876. Zhao, X., Kao, J.-L. & Taylor, J.-S. (1995). Preparation and characterization of a deoxyoligonucleotide 49-mer containing a site-speci®c thymidylyl-(30 ,50 )deoxyadenosine photoproduct. Biochemistry, 34, 1386± 1392.

Edited by J. Karn (Received 17 November 1997; received in revised form 9 February 1998; accepted 17 February 1998)