Synthesis of hepatitis B virus e antigen in E. coli

27

Virus Research, 14 (1989) 27-48 Elsevier

VIRUS

00513

Synthesis of hepatitis B virus e antigen in E. coli Takashi

Inada ‘, Yuko Misutni *, Masaharu Seno *, Shuicbi Kanezaki Yasuo Shibata I, Yushi Oka ’ and Haruo Onda 4

’ Nihon Pharmaceutical Company, ’ Takeda Chemical Industries, Central 2-chome, Yodogawaku, Osaka 532, Mitsui 4720 and 4 Tsukuba Research

3,

Research Division, 8-31, Tateishi, Katsushika-ku, Tokyo, Research Division, Biotechnology Laboratories, Jusohonmachi, 3 Biological Products Department, Hikari Plant, Hikarishi, Laboratories, Wadai 7, Tsukuba-shi, Ibaraki 300-42, Japan

(Accepted

11 May 1989)

Summary

Hepatitis B virus core antigen (HBcAg) gene was deleted at some unique restriction enzyme sites, or at random, and inserted into the expression plasmids of E. coli which had the tryptophan promoter. E. coli transformants with the plasmids, synthesized materials with many kinds of antigenicity of HBcAg, HBeAg, or both HBcAg and HBeAg. HBeAg-specific material smaller than native HBeAg was produced in a stable condition. Hepatitis B virus; HBcAg and HBeAg; Gene expression; polypeptide

E. coli; HBeAg specific

Introduction

In human hepatitis B vnus infection, four antigen-antibody systems have been found; hepatitis B virus surface antigen (HBsAg), core antigen (HBcAg), e antigen (HBeAg) and x antigen-antibodies. HBsAg is essential for eliciting antibodies for protection against HBV infection (Krugman et al., 1970; Soulter et al., 1972; Purcell et al., 1975; Hilleman et al., 1975). Hepatitis B core antigen was first recognized by Almeida et al. (1971) by treating Dane particles (Dane et al., 1970) with detergent; Nonidet P-40 (NP-40) is mainly

Correspondence to: T. Inada, Katsushika-ku, Tokyo, Japan.

0168-1702/89/$03.50

Nihon

Pharmaceutical

0 1989 Elsevier Science Publishers

Company,

Research

B.V. (Biomedical

Division,

Division)

8-31,

Tateishi,

28

observed in the nuclei of liver cells of humans or chimpanzees infected with hepatitis B virus. Naked HBcAg are scarcely detected in the sera even by the high-sensitivity detection method, radioimmunoassay. The HBcAg-anti-HBcAg antibody system is also important for detecting the occurrence of HBV infection (Hoofnagle et al., 1973, 1974). HBeAg, recognized by Magnius and Espmark (1972), is detectable in the blood at some stage of HBV infection. The antibody against HBeAg, anti-HBe antibody, is also detectable at another stage. This antigen-antibody system is well understood as a marker of HBV infectivity (Maynard et al., 1978) and the chronicity of hepatitis B (Miyakawa et al., 1978; Trepo et al., 1978). HBeAg and HBcAg (core particles) are closely related, as many researchers have reported. When HBcAg particles were treated with 2-mercaptoethanol (2-ME) or dithiothreitol (DTT), some kinds of protease and detergent, their HBcAg antigenicity as a phenotype of the particle disappeared and HBeAg antigenicity appeared with the dissociation of the particles (Ohori et al., 1980, 1984; Takahashi et al., 1980; Petit et al., 1985). The existence of HBeAg in HBV-infected human or animal (chimpanzee) serum shows the presence of abundant Dane particles, and these HBeAg-rich sera have high HBV infectivity (Yamada et al., 1979; Maynard et al., 1978; Nordenfel et al., 1975; Stevens et al., 1979). The molecular nature of the HBeAg is not well understood because of the limited amount of HBeAg obtainable from human HBeAg-positive sera. Recently, the four carboxyl-terminal amino acid residues of the HBeAg from HBV infected human sera have been found to be thr-thr-val-val (Takahashi et al., 1983), i.e., the 146-149 th amino acids from the amino-terminus of HBcAg polypeptide consisting of 185 amino acid residues (subtype adw). These results suggest that 36 carboxyl-terminal amino acid residues of the HBcAg polypeptide were digested during circulation in the blood. To reveal more of the HBeAg, a large amount of HBeAg material is needed. Recent progress in biotechnology has made it possible to express the HBV gene including HBsAg and HBcAg gene in prokaryote or eukaryote cells (Burrell et al., 1979; Pasek e al., 1979; Stahl et al., 1982; Miyanohara et al., 1986; Roossinck et al., 1986; Denniston et al., 1984; Hans et al., 1984). We wanted to clarify the relationship between the HBcAg and HBeAg antigenicity on the peptide level and to identify the minimum HBeAg molecule without HBcAg antigenicity. Therefore we first tried to express the HBcAg gene, and next the 3’-terminal region-deleted HBcAg genes, directly in E. coli.. Our work yielded many kinds of polypeptides with HBeAg antigenicity which lack the carboxyl-terminal amino acids of HBcAg. The fact that the polypeptides produced in E. coli which were smaller than native HBeAg polypeptides had the HBeAg antigenicity suggests that possible existence of many kinds of HBeAg molecules in HBV infected human or animal sera. We here present the experimental results on the synthesis of HBcAg and HBeAg in E. cob and their biophysical or immunochemical characteristics found using anti-HBcAg and anti-HBeAg antibodies.

29

Materials and Methods

HBV

DNA

Hepatitis B virus DNA total nucleotide sequences 1983).

Enzymes

(subtype adw) was cloned and named pHBV 933. The were determined as described elsewhere (Ono et al.,

and reagents

Restriction endonuclease was purchased from Takara Shuzo, New England Biolabs, and Boehringer-Mannheim. E. coli DNA polymerase I large fragment and T4 DNA ligase were obtained from New England Biolabs. Bacterial alkaline phosphatase was purchased from Bethesda Research Laboratories. The enzymes were used as recommended by their suppliers.

DNA sequence determination DNA modification, ligation, and transformation were carried out by the standard methods described by Maniatis et al. (1982). Plasmid DNA was prepared from E. coli DH 1 by the alkaline procedure followed by equilibrium density gradient centrifugation and digested with restriction endonuclease (EcoRI, PstI and ClaI), and then fractionated by gel electrophoresis. Purified DNA fragments were subcloned in Ml3 mp7 phages and the nucleotide sequence was determined by the dideoxy chain termination method of Sanger et al. (1977).

Radioimmunoassay

(RIA),

enzyme

immunoassay

(EIA) and antisera

HBeRIA, HBe-EIA, CORAB and CORZYME kits were purchased from Abbott Laboratories. HBeAg/Ab EIA Immunis, which uses monoclonal antibodies, was purchased from Sankyo Junyaku Co., Japan. The human anti-HBcAg immunoglobulin (IgG) fraction was prepared from HBsAg, HBeAg and anti-HBcAg antibody positive human serum as follows. Briefly, the serum was first chromatographed on insolubilized human anti-HBeAg antibody as described by Takahashi et al. (1977) for the elimination of HBeAg. Then, the y-globulin fraction obtained from the sera by precipitation with 33% saturation of (NH4)*S04 was extensively dialized against 0.05 M sodium phosphate buffer, pH 7.5, and chromatographed on DEAE-Sepharose CL 6B equilibrated with the buffer. The eluate with the buffer was collected, dialized against PBS (50 mM sodium phosphate, 0.1 M NaCl, pH 7.2) and used for the neutralization test. The elimination of HBeAg from the fraction was incomplete; however, when it was used for neutralization after dilution, remaining HBeAg was not detected.

30

Electron microscopy Specimens for electron microscopy were stained with 2% phosphotungstic (PTA) at pH 7.0 as described (Onda et al., 1978). Samples were examined JEMlOOB electron microscope at a magnification of 30,000. Construction

of HBcAg

expression

acid with a

vectors

Plasmid pHBV 933 which contains the whole HBV genome was digested with restriction enzyme HhaI, and the 1005 base pair DNA fragment containing the HBcAg coding region was separated by 1% agarose gel electrophoresis. After filling the single-stranded part of the HhuI site with T4 DNA polymerase, EcoRI linker 5’dGGAATTCC3’ was ligated and recloned into the EcoRI site of the plasmid, ptrp 781, named pHBcHE1. The EcoRI fragment was then cut and separated. This DNA fragment was treated with exonuclease Bal 31 for 0.5, 1, 2, and 3 min and the smaller DNA fragment containing the HBcAg gene was obtained. The start codon ATG containing C/u1 linker 5’dCATCGATG3’ was ligated to this DNA fragment and then the HBcAg gene was inserted into the C/a1 site of the expression vector ptrp 771 which has a tryptophan promoter (Kurokawa et al., 1983). After transformation of E. coli DH 1 strain with this ligated DNA, the transformants resistant to tetracycline (Tet) were selected. E. co/i transformants which have plasmids constructed in the right orientation of the HBcAg gene under the tryptophan promoter were selected by miniscreening and restriction enzyme mapping as described elsewhere (Maniatis et al., 1982). After confirming the HBcAg gene expression in E. co/i, the HBcAg positive clone pHBC2 was purified and digested with EcoRI and further digested with nuclease Bal 31. Addition of PstI linker, S’dGCTGCAGC3’, and recloning into the CluI and PstI site of ptrp 771 was conducted as shown in Fig. 1. After CluI and Bal 31 digestion, EcoRI linker 5’dGGAATTCC3’ was added and the EcoRI/PstI fragment was inserted into the EcoRI/PstI site of ptrp 781. The HBcAg expressing clone pHBC 3 was selected and the base sequence between the Shine Dalgarno (SD) and the start codon ATG was determined as described. As these were 16 base pairs between SD and ATG codon, the distance was shortened after EcoRI and Sl nuclease digestion. The new HBcAg positive clone was selected, and the base sequence about the ATG start codon of HBcAg was determined. This clone, named pHBC 6, had 9 bp between SD and the start codon ATG of the HBcAg gene (Fig. I). Construction

of HBeAg

expression

vectors

The plasmid pHBC 6 was purified and Sty1 fragment (863 bp) was separated and digested with some restriction enzymes, AvuI, AvuII, Mb011 and DruI. Next, the single-stranded portion of the enzyme-digested sites was filled or digested with Klenow fragment of DNA polymerase I and T4 DNA polymerase. The universal stop codon linker with the PstI recognition site, S’dATAACTAACTAACTGCA3 was ligated and digested with restriction enzyme PstI. Each HpuI- and PstI-di-

31

ECclRl

s, nuc,eare T4 DyA haare

Fig. 1. Construction of HBcAg expression vectors. The encoding region, HhaI/HhaI fragment (1005 bp) was prepared from the cloned HBV genome and recloned into the EcoRI site of expression vector ptrp 781 and named pHE1. The steps shown in Fig. 1 led to HBcAg expression vectors, pHBC2, pHBC3 and pHBC6.

gested DNA fragment was separated and inserted into the HpaI and PstI sites of ptrp 781 plasmid (Fig. 2) and Tet-resistant E. coli DH 1 transformants were obtained. HBcAg expression vector pHBC6 was digested with restriction enzyme AuaI and exonuclease Bal 31 treatment was conducted for 1, 3, 5, and 10 min at room temperature to delete the 3’ region of HBcAg gene. At the end of the deletion, the stop codon linker with EcoRl site 5’dCTAGAATTCTAG3’ was ligated and

Fig. 2. Construction of HBeAg expression vectors. The HBcAg expression vector pHBC6 was used for expression of the 3’ region-deleted HBcAg gene. The Au111 or AuaI. Six plasmid pHBC6 was digested with a unique restriction enzyme which recognized one site in the HBcAg gene, DraI, MboII, Hpall, plasmids lacking the 3’ region of the HBcAg gene were obtained and named pHBC6-4, pHBC6-32, pHBC6-41, pHBC6-47, pHBC6-64, pHBC6-71 and pHBC6-90.

33 Comparison

of HBcAg

production

between

pHBC2,

pHBC3

and pHBC6

Nucleotrde

sequences

between

SD and start codon ATG

~til3C2 AAGGGTATCGATGGGTGGCTTTGGGGCE SD oHBC3

AAGGGTATCGAATTCCGGGCD SD

DHBCG

AAGGGTATCGGGCE SD

Fig. 3. Comparison of HBcAg expression between SD sequence and translational pHBC3 and pHBC6 were assayed with expression products with HBcAg

rates between constructed vectors and their nucleotide numbers initiation codon ATG. The extracts of E. coli having pHBC2, HBe(c)EIA for the detection of HBcAg and the amounts of antigenicity were compared by diluting the preparations.

treated with EcoRI and the HpaI. Next, the HpaI and EcoRI DNA fragment was inserted into the expression vectors of E. co/i as shown in Fig. 2. Also, nucleotide sequences at the ligation sites of the stop codon liier were determined and the amino acid sequences replaced or changed by the addition of the linker were confirmed as shown in Fig. 3. In all these plasmid constructions, the sequence of the tip-promoter and the HBcAg gene flanking region were conserved. Assay of HBcAg and HBeAg produced in E. coli E. coli DH 1 transformed with expressions vectors with HBcAg gene and 3’ terminal region deleted HBcAg gene were cultured in M9 medium containing tetracycline (Tet), 8 pg/ml. Tryptophan promoter was induced with 3p-indoleacryl (IA% 25 CLgW) as described previously (Kurokawa et al., 1983). At three hours after IAA induction, 10 ml of the culture was centrifuged at 5,000 rpm for 10 min with the Sorval 125 centrifuge at 4 o C and E. coli was collected. The E. coli pellet was suspended with extraction buffer, consisting of 10% sucrose, 250 pg/ml lysozyme, 5 mM EDTA, 0.1 M NaCl, 1 mM phenylmethyl sulphonyl fluoride (PMSF) and 10 mM Tris-HCl, pH 7.8, on an ice bath for 1 h and sonicated for 30 s

34

at 50 watts. After centrifugation of the lysate for 30 n-tin at 18,000 rpm, the supernatant was removed and a 50-~1 aliquot was diluted to 200 ~1 with phosphatebuffered saline containing 2% bovine serum albumin and assayed with HBeAg radioimmunoassay (RIA) or HBeAg enzyme immunoassay (EIA) kit (Abbott Labs, U.S.A.). These HBe-RIA and HBe-EIA which use human polyclonal antibodies, reacted with both HBeAg and HBcAg, which were therefore called HBe(c)RIA and HBe(c)EIA. They were used for primary screening of gene expression. For the specific determination of HBcAg, we employed solid-phase antibodies of Abbott HBe-RIA, HBe-EIA and labeled antibodies of CORAB and CORZYME, and expressed these systems as HBc-RIA or HBc-EIA. HBeAg/Ab ELA Immunis which employed monoclonal antibodies (MoAb) was expected to react specifically with HBeAg, and we expressed this system as HBeEIA-MoAb. The absorbance at 492 nm was plotted on the serial diluted sample assayed with EIA. The immunodiffusion test of the bacterial extracts was conducted as described by Yamada et al. (1979), and the standard HBeAg was partially purified from sera as described by Takahashi et al. (1983).

CsCl and sucrose gradient centrifugation A 500~~1 portion of the extract of E. coli cultured in M9 medium for the expression of HBcAg gene was mixed with CsCl solution consisting of 0.15 M NaCl, 5 mM EDTA and 20 mM Tris-HCl (NET) buffer, pH 7.6 and the final concentration of CsCl was adjusted to 1.2 g/m13. Next, 12 ml of the preparation was centrifuged in a RPS 40 T rotor of a Hitachi ultracentrifuge at 32,000 rpm for 72 h at 10°C. A loo-y1 portion of the expression products of the HBcAg or the 3’ region-deleted HBcAg gene diluted with NET buffer to one-fourth were layered onto 12 ml of 5-2096 linear sucrose gradient solution consisting of NET buffer, pH 7.6. The gradient was centrifuged in a RPS 40 T rotor at 25,000 rpm for 3 h at 4” C. After centrifugation, the tube contents were fractionated into 20 fractions and the antigenicity of each fraction was assayed with the EIA kits for HBcAg and HBeAg.

Western blotting and molecular weight determination E. coli transformed with expression vectors with HBcAg gene, and 3’ region-deleted HBcAg genes were cultured in 10 ml of M 9 medium and pelleted. Laemmli’s sample buffer (Laemmli, 1970), 1 ml, was added and the mixture was heated for 5 min at 100 o C sonicated at 50 watts for 2 min and centrifuged at 15,000 t-pm for 15 min. The supernatant, 5 ~1, was applied to a 15% polyacrylamide gel and electrophoresed at 60 volts for 2 h. The separated proteins were transferred to nitrocellulose filter and then human anti-HBeAg antibodies and peroxidase-labelled goat anti-human IgG were used to detect the materials with HBeAg antigenicities and their molecular weights were determined.

35

Results and Discussion Expression

of HBcAg

gene in E. coli

First, 35 transformants with expression vectors in which the n-p-promoter and HBcAg gene were fused in the right orientation of transcription were selected by restriction enzyme mapping and cultured in M 9 medium and induced with IAA as described in Materials and Methods. When the extracted materials from these cultured transformants were assayed with HBcAg RIA kit, two clones named pHBC2 and pHBC2-1 were found to produce the HBcAg. Other HBcAg expressing clones obtained by recloning and reconstruction were named pHBC3 and pHBC6, respectively (Fig. 1). Considering the nucleotide sequence between the Shine and Dalgarno (SD) and the translational initiation codon ATG, the expression rate of HBcAg was compared on each transformant and summarized in Fig. 3. These results made it clear that clone pHBC3 and pHBC6 produced 16- and 256-fold more HBcAg than clone pHBC2. The distances between the SD and initiation codon ATG of pHBC2, pHBC3, and pHBC6 were 23, 16, and 9 bases, respectively. Thus, the difference in the HBcAg production between these expression vectors seemed to reflect the number of nucleotides between the SD sequence and the initiation codon ATG. Clearly the best space between the SD and initiation codon ATG was 9 bases for the expression of HBcAg gene, as has been found when the interferon gene (Shepard et al., 1982) and human immunoglobulin e gene were expressed under the control of the tryptophan promotor. Furthermore, the nucleotide sequences of the flanking region of the trp-promoter and the HBcAg gene revealed that the expression products of these vectors are directly translated from the initiation codon ATG of the HBcAg gene and do not contain any additional amino acid sequence of vector or linker origin, nor pre-HBcAg sequence (Tiollais et al., 1981; Ou et al., 1986). From these results, the 3’ terminal region deleted HBcAg gene expression vectors were constructed from the highest HBcAg gene expression clone pHBC6. Expression

of 3’ terminal region-deleted

HBcAg

gene

Transformants with expression vectors which contain the 3’ region-deleted HBcAg gene were obtained as described in Materials and Methods. From the nucleotide sequence analysis of the 3’ end-deleted HBcAg genes, clones pHBC6-4, pHBC6-32, pHBC6-41, pHBC6-47, pHBC6-64, pHBC6-71 and pHBC6-90 were lacking 4, 32, 41, 47, 64, 71, and 90 amino acid residues from the carboxyl terminal of the HBcAg polypeptide. However, clones pHBC6-4, pHBC6-32 and pHBC6-41 got three amino acids, Ile Thr Asn, at the carboxyl terminus by the stop codon linker addition. Also, clones pHBC6-47 and pHBC6-71 obtained 9 and 2 amino acids, respectively, by addition (Fig. 4). When these expression products were assayed with HBe(c)EIA, the products of clones pHBC6-4, pHBC6-32, pHBC6-41 and pHBC6-47 had the antigenicities of HBcAg or HBeAg. The products of

36 30 Met Asp Ile Asp Pm Tyr Lys Clo Pk Cly Ala Tbr VII Gin Leu Lea Ser Pbe Leu Pro Ser Asp Ph Pbe Pm Ser VII Arg Asp La

60 Leu Asp Thr Ala Ser Ala Lea Tp Arg Clu Ala Ln Clu Ser Pro Glu His Cys Ser Pro His His Tlu Ala Leu ArgC la Ah

I le Lea

90 Cys Trp Cly Glu Leu Met Tbr Lea Ala Tbr Trp VII Gly Asa Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu VII VII Asn Tyr VII Ass

120 Tbr Asn Met Cly Leu Lys I le Arg Gla Leu Leu Trp Pbe His I le Ser Cys Leu Tbr Pbe Cly Arg Glu Tbr VII ..a pH6C

6-90

Leo Clu Tyr Lea Val

Asp...

pH6C

6-71 150

Ser Ph Cly Vd Trp I le Arg Tbr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro ..a pH6C

6-64

Ile Leu Arg

I le

Ser Thr Leu Pro Glu ThrVaI

Val’Arg

Leu Glu Asp Clu Arg Ala Ser.** pH6C

1leTbr

6-47

Asn *a* pH6C6i41

Arg Arg Asp Arg Cly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Cln Ser Pro Arg Arg Arg Arg Ser Cln Ser

I le

Tbr ASII .** pH6C

Arg Glu Ser Gln Cys pH6C

I le

6-32

6

Tbr As.0 ..* pH6C6-4

Fig. 4. Amino acid sequences of HBcAg (subtype adw) and carboxyl terminal amino acid-deleted HBcAg polypeptides deduced fron~mtcleotide sequences. Amino acid sequences of HBcAg, 185 ammo acids, and that of each 3’ region-deleted clones are shown. The pHBC6-90 and pHBC6-64 had no additional amino acid residues at the carboxyl terminal, however, pHBC6-71, pHBC6-47, pHBC6-41, pHBC6-32 and pHBC6-4 had ammo acid sequences changed by the addition of stop linkers. The bars under the amino acid sequences show the replaced ammo acids by the addition of stop codon linkers.

pHBC6-64 which lacked 64 amino acids of the HBcAg polypeptide and was 28 amino acids shorter than that of native, serum derived HBeAg polypeptide also showed HBeAg antigenicity (Fig. 5). However, the products of pHBC6-71 and pHBC6-90 did not exhibit any antigenicities. Why these antigenicities were not detected is not clear, but two possibilities may be considered. One is that these products are unstable in E. coli and are degraded rapidly, and the other is that these products may be stable in E. coli and extracted easily, but the antigenic determinants had been lost. The titration curves of HBe(c)Ag reactive expression products of clones (Fig. 5) suggested that there were some types of expression products. These results suggest that expression products larger than that of pHBC6-64 are relatively stable in E. cofi and exhibit the antigenicities of HBeAg or HBcAg.

37

0

12

3

4

Dilution

Fig. 0.05 was that

5

6

7

0

9

4”XlO

DHBCG

u

pHBC6-64

L

oHBC6-4

M

pHBC6-71

w--o

IIHBC~-32

D----sI

pHBC6-90

pHBC6-41

c-l

ptrp 781

+ - --o D---a

pHBC6-47

*

5. Detection and titration of HBeAg produced in E. coli with EIA for the HBeAg (HBcAg) assay. A ml extract of cultured E. coli having HBcAg and 3’ region-deleted HBcAg gene expression vectors, diluted with phosphate-buffered saline as described in Materials and Methods and assayed. Note the extracts of cultured E. coli with pHBC6-90 and pHBC6-71 did not exhibit the antigenicity of HBeAg or HBcAg.

Neutralization of antigenicities of the gene products with human anti-HBcAg antibodies The expression product of the HBcAg gene or the 3’ region-deleted HBcAg gene was mixed with human anti-HBcAg antibody and the rates of neutralization of antigenicity of HBcAg and HBeAg were examined. As shown in Fig. 6, the products of pHBC6 and pHBC6-4 were neutralized by anti-HBcAg antibody at nearly 90-95% at 10m3 mg/ml IgG. The products of pHBC6-32 and pHBC6-41 were slightly neutralized, 20-25% by the same concentration of anti-HBcAg antibody. These results suggest that the products of pHBC6 and pHBC6-4 had mainly HBcAg antigenicity and the products of pHBC6-32 and pHBC6-41 had both HBcAg and HBeAg antigenicities. On the other hand, the products of pHBC6-47 and pHBC6-64 were not neutralized at any concentration of anti-HBcAg antibody, suggesting the absence of HBcAg but the presence of HBeAg antigenicity on their molecules. From these neutralization tests, the gene products were grouped into the three types of

38

DHBC6

O----K,

DHBC~-4

-

DHBC~-32

-

DHBC~-41

-

DHBC~-47

bd

DHBC~-64

-

lo-’

IO Human

anti-HBc

10 J IgG

IO hs/mll

Fig. 6. Neutralization assay of the expression products with human anti-HBcAg antibodies. The extracts of HBcAg and the 3’ region-deleted HBcAg gene expression products in E. coli were diluted with phosphate-buffered saline containing 2% bovine serum albumin to adjust the concentration of the products exhibiting the absorbance at 492 nm in EIA to 2.0. Next, 100 pl of each diluted sample was mixed with 100 ~1 of purified human anti-HBcAg IgG fraction from lo-’ to 10-l mg/ml and incubated at 37 o C for 1 h. The ordinary assay procedure for the detection of HBeAg was then done.

HBcAg, both HBcAg and HBeAg, and HBeAg antigenicity precise analysis of the antigenicity was conducted. Immunochemical

characteristics

alone, and then more

of the expression products

The antigenicities of these expression products were examined precisely to find whether the products have only HBcAg or only HBeAg, and also both HBeAg and HBcAg antigenicities or not, using HBe(c)EIA and HBcEIA as described above. Also, the EIA for HBeAg using monoclonal anti-HBeAg (HBeEIA-MoAb) was used to characterize the expression products. As shown in Fig. 7, the product of the clone pHBC6-4 which lacked four amino acid residues of the carboxyl terminus of HBcAg polypeptide (185 amino acid residues) exhibited positive reactions with HBe(c)EIA and HBeEIA, but not with HBeEIA-MoAb, like that of pHBC6. The non-reactivity of the products of pHBC6 and pHBC6-4 with monoclonal anti-HBeAg antibodies

Fig. 7. Antigenic

HBe Cc) EIA

-

DHBC~-4

.

HBcElA

I

HBeAs msitwe serum

j

0

-

08

-A

”

,5,

I

.

(MoAb)

DHBC~-47 HBeElA

\

-

:

:-

DHBC~-64

oHBC6-4

-:

specificities of the expression products. The extracts of expression products of each clone were serially diluted and assayed with EIA using anti-HBeAg antibodies or polyclonal (0 ~ 0) anti-HBcAg antibodies. -0) and monoclonal (A -A) polyclonal(0

oHBC6-32

I

40

suggests that the antigenic determinants, recognized with monoclonal anti-HBeAg antibodies, exist inside the HBcAg particles. The products of clones pHBC6-32 and pHBC6-41 exhibited positive reaction with any of the three EIA systems. This result agreed with that of the neutralization test using anti-HBcAg antibodies and demonstrated that the products exhibit both HBcAg and HBeAg antigenicities. However, the products of the clone with 47 and 64 deleted amino acid residues, pHBC6-47 and pHBC6-64, exhibited a positive reaction with HBe(c)EIA alone, suggesting that the HBcAg antigenicity and the antigenic determinant recognized by monoclonal anti-HBeAg antibodies had disappeared but the antigenic determinants recognized by human polyclonal anti-HBeAg antibodies still existed on these molecules. These results confirmed the results of the neutralization test as shown in Fig. 6. In the control experiments, native HBeAg reacted with polyclonal and monoclonal anti-HBeAg antibody and the extract of E. coli which had no HBeAg gene did not react with any antibodies. These results led to the conclusion that the products of pHBC6-47 and pHBC6-64 had only HBeAg antigenicity and those of pHBC6-41 had both HBcAg and HBeAg antigenicities. The products of pHBC6, and pHBC6-4 had only HBcAg antigenicity. An immunodiffusion test of the gene products was also conducted. As shown in Fig. 8, the product pHBC6 and pHBC6-4 formed a bold precipitin line identical to HBcAg. The products of pHBC6-32 and pHBC6-41 formed a precipitin line identical to HBcAg, which was not as bold, and in the case of pHBC6-41 an additional weak precipitin line identical to HBeAg was also formed. The products of pHBC6-47 formed two precipitin lines, one was distinct and the other indistinct, with each individually fused to the two precipitin lines formed between the partially purified human HBeAg and the mixture of human anti-HBeAg and anti-HBcAg antibodies. Thus, the precipitin lines were identical to HBeAg and might correspond to the el and e2 reported by Williams and Le Bouvier (1976) and Budkowska et al. (1979). The products of pHBC6-47 and pHBC6-64 did not react with purified anti-HBcAg antibody confirming the results of the neutralization test given in Fig. 6. The product of pHBC6-64 formed a distinct precipitin line, which fused to the precipitin lines between HBeAg and anti-HBeAg, anti-HBcAg antibodies. These results demonstrate that the products of pHBC6-47 and pHBC6-64 exhibit HBeAg antigenicity and still possess enough antigenic determinants to form precipitin lines, in spite of the lack of the antigenic determinants recognized by monoclonal anti-HBeAg antibodies.

Biophysical

characteristics

of the expression products

To know the biophysical properties of the expression products of the HBcAg and 3’ terminal region-deleted HBcAg genes in E. coli, the extracted preparations were analysed in CsCl or sucrose density gradient centrifugation. The extract of the E. coli transformed with pHBC6 was mixed with CsCl at the final density of 1.2 g/cm3 and centrifuged and the density of the HBcAg was determined.

pHBC6-4

pHBC6-4

1

oHBC6-32

pHBC6-64

Fig. 8. Immunodiffusion tests of the gene products. The extracts of E. coli with each expression plasmid were applied into the center well (No. 7) of the agarose gel plate. Normal human serum was in well number 1, partially purified HBeAg in 2 and 5, anti-HBeAg and anti-HBcAg antibodies positive sera in 3 and 6, and human anti-HBcAg antibodies (IgG fraction) in 4. After 72 h incubation, precipitin lines between each well were observed.

The HBcAg produced in E. coli had the density of 1.32-1.34 g/cm3 in CsCl indicating the particle of HBcAg as described elsewhere (Cohen and Richmond, 1983). Moreover, electron microscopic observation clearly revealed that the HBcAg banded at the density of 1.32-1.34 g/cm3 in CsCl was spherical particles with diameter of about 27 nm as shown in Fig. 9. And the analysis of the expression products by sucrose gradient centrifugation revealed, as expected, that whole HBcAg gene product sedimented faster than that of 3’ terminal region deleted HBcAg gene. The products of pHBC6 and pHBC6-4 sedimented at almost the same position indicated their morphological similarity. The deletion of four amino acids and replacement with three different ones at the carboxyl terminal might not influence the formation of particles. These results also suggested that the cystein residue at the carboxyl terminus (the 185th) of the HBcAg polypeptide did not affect the morphology of the HBcAg particle. Most of the products of pHBC6-32 and pHBC6-41 sedimented at almost the same position making a peak at fraction 15 and floating at lighter position (Fig. 10). However, the products of pHBC6-47 and pHBC6-64 did

Fig. 9. An electron micrograph buffer pH. 7.6, and centrifuged

of purified HBcAg particles. The peak fractions, fractions 5, 6, and 7, were pooled and dialysed against 10 mM Tris-HCI at 40,000 rpm for 7 h in the SW 50 rotor of a Beckman ultracentrifuge. The pellet was suspended, stained with PTA and observed by electron microscopy. The bar indicates 100 nm.

d

oHBC6-41

DHBCG

8%

f Fraction number

oHBC6-47

10

oHBC6-4

9 01

Pi

0

9 v

9

9

DHBC~-64

IO

oHBC6-32

20

Fig. 10. Sucrose gradient centrifugation of HBcAg and HBeAg produced in E. coli. The extracts of E. coli transformed with plasmid were centrifuged as described in Materials and Methods and shown as their antigenicities of HBcAg and HBeAg. The products of pHBC6 and pHBC6-4 sedimented at nearly the same position; however, that of pHBC6-32 and pHBC6-41 sedimented at a higher position with non-sedimenting HBeAg antigenicities. The products of pHBC6-41 and pHBC6-64 did not sediment and floated almost on the top of the gradients.

g

5

f

??

44

not sediment and floated at the top of the gradients. These results might explain the products of pHBC6-32 and pHBC6-41, which were suggested to have both HBcAg and HBeAg antigenicities, as having the aggregated form of 32 or 41 amino acids deleted expression products sedimenting at fraction 15 and taking the dissociated form floating at the top of the gradients. Almost all of the peak fraction of pHBC6-32 and pHBC6-41 had HBcAg antigenicity while the floated materials showed only HBeAg (data not shown). The critical point of whether or not to take a complex form depends on the number and chemical nature of amino acid residues composed of polypeptides, but the precise mechanism is not known. Probably the products of pHBC6-32 and pHBC6-41 first make a complex form and then gradually a dissociated form, for example, in the extraction steps from E. coli. In fact, we observed that the repeated freeze thawing of the products of pHBC6-32 and pHBC6-41 led to loss of the antigenicity of HBcAg and the gain of the HBeAg antigenicity detected with the assays system using HBeEIA-MoAb. The molecular weight of the expression products of HBcAg and 3’ region deleted HBcAg gene were determined by the

S4K 67K 43K

30K

20K

14.4K

Fig. 11. Western blot analysis of the expression products. The extracts of E. coli transformed with each plasmid were analyzed by polyacrylamide gel electrophoresis and transferred to nitrocellulose filter as described in Materials and Methods. After reaction with human anti-HBeAg antibodies, peroxidase labelled goat anti-human IgG was added and developed as described. The molecular weights of the expression products of pHBC6 and pHBC6-4 were 22,000-21,500O and that of pHBC6-64 was 13,00013.500.

45

western blotting methods. As shown in Fig. 11 the polypeptide of HBcAg has the molecular weight of 21,500-22,000. This value was similar to that of HBcAg polypeptide of the Dane particle. So, HBcAg obtained in our experiment has nearly the same core particles as the HBcAg derived from natural sources, HBcAg of Dane particles, or HBcAg from HBV infected chimpanzee (Onda et al., 1978) and human livers (Fields et al., 1975/76). When the deletion extent of HBcAg gene increased, the molecular weight of the expression products decreased. The molecular weight of the two polypeptides specific for HBeAg products of the pHBC6-47 and pHBC6-64 were determined to be 15,500 and 13,500-13,000 and these results were agreeable to those deduced from amino acid sequences. These results showed our success in obtaining HBcAg, especially HBeAg similar to native HBeAg. We also were able to obtain polypeptides with the HBeAg antigenicity which were smaller than native HBeAg. These products may be used for more sensitive and specific diagnosis of the anti-HBcAg and anti-HBeAg antibodies of patients and blood donors. In considering the effectiveness of HBcAg and HBeAg for the protection against HBV infection as reported by Prince et al. (1983), Iwarson et al. (1985) Murray et al. (1984, 1987, 1988) these HBcAg and HBeAg obtained by recombinant DNA techniques might be useful as a HBV vaccine in combination with HBsAg to obtain more effective protection against HBV infection (Milich et al., 1987).

Acknowledgement We thank Dr Y. Sugino, Director of the Central Research Division gement, Dr. R. Marumoto for synthesizing the oligonucleotides.

for encoura-

References Almeida, J.D., Rubenstein, D. and Stott, E.J. (1971) New antigen antibody system in an Australian antigen positive hepatitis. Lancet 2, 1225-1227. Budkowska, A., Kalinowska, B. and Nowosiawski, A. (1979) Identification of two HBeAg subspecificities revealed by chemical treatment and enzymatic digestion of liver derived HBcAg. J. Immunol. 123, 1415-1416. Burrell, C.J., MacKay, P., Greenaway, P.J., Hofschneider, P.H. and Murray, K. (1979) Expression in Escherichia coli of hepatitis B virus DNA sequences cloned in plasmid pBR 322. Nature (London) 279, 43-47. Cohen, B.J. and Richmond, J.E. (1982) Electron microscopy of hepatitis B core antigen synthesized in E. coli. Nature (London) 296, 677-678. Dane, D.S., Cameron, C.H. and Briggs, M. (1970) Virus-like particles in serum of patient with Australia-antigen associated hepatitis. Lancet 1, 697-698. Denmston, K.J., Yoneyama, T., Hoyer, B.H. and Geri, J.L. (1984) Expression of hepatitis B virus surface antigen and e antigen genes cloned in bovine papilloma virus vectors. Gene 32, 357-368. Fields, H.A., Dreesman, G.R., Hollinger, F.B., Marciano-Cabrai., Gyorkey, E. and Melmck, J.L. (1975/76) Endogenous DNA polymerase-positive core particles from hepatitis-infected hepatocytes. Intervirology 6, 224-233.

46 Hans, W., Roberto, C., Eberhard, P., Christa, K., Michael, R. and Heinz, S. (1984) Expression of hepatitis B antigen with a simian virus 40 vector. J. Virol. 50, 335-342. Hilleman, M.R., Buynak, E.B., Roehm, R.R., Tytel, A.A., Bertland, A.U. and Lampson, G.P. (1975) Purified and inactivated human hepatitis B vaccine. Am. J. Med. Sci. 270, 40-404. Hoofnagle, J.H., Gerety, R.J. and Barker, L.F. (1973) Antibody to hepatitis B core in man. Lancet 2, 869-873. Hoofnagle, J.H., Gerety, R.J. and Ni, L.Y. (1974) Antibody to hepatitis B core antigen. New Engl. J. Med. 290, 1336-1340. Iwarson, S., Tabor, E., Thomas, H.C., Snoy, P. and Gerety, R.J. (1985) Protection against hepatitis B virus infection by immunization with heptatitis B core antigen. Gastroenterology 88, 763-767. Krugman, S., Giles, J.P. and Hammond, J. (1970) Hepatitis virus: Effect of heat on the infectivity and antigenicity of the MS-1 and MS-2 strains. Infect. Dis. 122, 432-435. Kurokawa, T., Seno, M., Sasada, R., Ono, Y., Onda, H., Igarashi, K., Kikuchi, M., Sugino, Y. and Homo, T. (1983) Expression of human immunoglobulin E e chain cDNA in E. coli. Nucleic Acids Res. 11, 3077-3085. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 225, 880-885. Magnius, L.O. and Espmark, J.A. (1972) New specifications in Australia antigen positive sera distinct from the Le Bouvier determinants, J. Immunol. 109, 1017-1021. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Maynard, J.E., Barret, D.H., Murphya, B.L., Bradley, D.W., Berquist, K.R. and Bender, T.R. (1978) Relation of e antigen to hepatitis B virus infection in an area of hyperendemicity. J. Infect. Dis. 133. 339-342. Milich, D.R., McLachian, A., Thorton, G.B. and Hughes, J. (1987) Antibody production to the nucleocapsid and envelope of the hepatitis B virus primed by a single synthetic T cell site. Nature (London) 329, 547-549. K., Ohtomo, N. and Matsubara, K. (1986) Miyanohara, A., Imamura, T.. Araki, M., Sugawara, Expression of hepatitis B virus core antigen gene in Saccharomyces cereuisia: synthesis of two polypeptides translated from different initiation codons. J. Virol. 59, 176-180. Miyakawa, Y. and Mayumi, M. (1978) Characterization and clinical significance of HBeAg. In: G.N. Vyas, S.N. Cohen and R. Schmid (Eds.), Viral Hepatitis, pp. 193-201. Franklin Institute Press, Philadelphia. Murray, K., Bruce, S.A., Hinnen, A., Wingfield, P., van Eerd P.M.C.A., de Reus, A. and Schellenkens, H. (1984) Hepatitis B virus antigens made in microbial cells immunise against viral infection. Eur. Mol. Biol. Organ. J. 3, 645-650. Murray, K., Bruce, S.A., Wingefield, P., van Eerd, P., de Reus, A. and Schellekens, H. (1987) Protective immunization against hepatitis B with an internal antigen of the virus. J. Med. Virol. 23, 101-107. Murray, K. (1988) Application of recombinant DNA techniques in the development of viral vaccines. Vaccine 5, 164-174. Nordenfel, E. and Kjellen, L. (1975) Dane particles, DNA polymerase and e-antigen in two distinct categories of hepatitis B antigen carriers. Intervirology 5, 2255232. Ohori, H., Yamaki, M., Onodera, S., Yamada, E., and Ishida, N. (1980) Antigenic conversion from HBcAg to HBeAg by degradation of hepatitis B core particles. Intervirology 13, 74-82. Ohori, H., Shimizu, N., Yamada, Ei, Onodera, S. and Ishida, N. (1984) Immunological and morphologiin hepatitis B virus core particles. J. cal properties of HBeAg subtypes (HBeAg/l and HBeAg/2) Gen. Viral. 65, 4055414. Onda, H., Matsuda, S. and Oka, Y. (1978) Hepatitis B core particles with endogenous DNA polymerase activity from chimpanzee liver. Intervirology 10, 254-264. Ono, Y., Onda, H., Sasada, R., Igarashi, K., Sugino, Y. and Nishioka, K. (1983) The complete nucleotide sequences of the hepatitis B virus DNA; subtype adr and adw. Nucleic Acids Res. 11, 719-726. Ou, Jing-Hsiung, Laub, 0. and Rutter, W.J. (1986) Hepatitis B virus gene function; The precore region target the core antigen to cellular membranes and causes the secretion of the e antigen. Proc. Natl. Acad. Sci. USA 83, 1578-1582.

41 Pasek, M., Goto, T., Gilbert, W., Zink, B., Schaller, H., Mackay, P., Leadbetter, G. and Murray, K. (1979) Hepatitis B virus genes and their expression in E. coli. Nature (London) 282, 575-579. Petit, Marie-Anne and Pillot, J. (1985). HBc and HBe antigenicity and DNA-binding activity of major core protein p22 in hepatitis B virus core particles isolated from the cytoplasm of human liver cells. J. Virol. 53, 543-551. Prince, A.M., Vnek, J. and Stephan, W. (1983) A new hepatitis B vaccine containing HBeAg in addition to HBsAg. Second WHO/IABS Symposium on Viral Hepatitis: Standardization in Immunoprophylaxis of Infections by Hepatitis Viruses, Athens, Greece, 1982, Dev. Biol. Standard. Vol. 54, pp. 13-22. S. Karger, Basle. Purcell, R.H. and Germ, J.L. (1975) Hepatitis B subunit vaccine: a preliminary report of safety and efficacy tests in chimpanzees. Am. J. Med. Sci. 270, 401-404. Roossinck, M.J., Jameel, S., Loukin, S.H. and Siddiqui, A. (1986) Expression of hepatitis B viral core region in mammalian cells. Mol. Cell. Biol. 6, 1393-1400. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. Shepard, H.M., Yelverton, E. and Goeddel, D.V. (1982) Increased synthesis in E. coli of fibroblast and leukocyte interferons through alteration in ribosome binding sites. DNA 2, 125-131. Soulter, J.P., Blatix, C., Courouce, A.M. et al. (1972) Prevention of virus B hepatitis (SH hepatitis) Am. J. Dis. Child. 123, 429-434. Stahl, S., Mackay, P., Magazin, M., Bruce, S.A. and Murray, K. (1982) Hepatitis B virus core antigen: synthesis in Eschen’chia coli and application in diagnosis. Proc. Natl. Acad. Sci. USA 79, 16, 6-1610. Stevens, C.E., Neurath, R.A., Beasley, R.P. and Szmuness, W. (1979) HBeAg and anti-HBe detection by radioimmunoassay: correlation with vertical transmission of hepatitis B virus in Taiwan. J. Med. Virol. 3, 237-241. Takahashi, K., Fukuda, M., Baba, K., Imai, M., Miyakawa, Y. and Mayumi, M. (1977) Determination of e antigen and antibody to e by means of passive hemagglutination method. J. Immunol. 119, 1556-1559. Takabashi, K., Imai, M., Gotanda, T., Sano, T., Oinuma, A., Mishiro, S., Miyakawa, Y. and Mayumi, M. (1980) Hepatitis B e antigen polypeptides isolated from sera of individuals infected with hepatitis B virus: comparison with HBeAg polypeptide derived from Dane particles. J. Gen. Virol. 50, 49-57. Takahashi, K., Machida, A., Funatsu, G., Nomura, M., Usuda, S., Aoyagi, S., Tachibana, K., Miyamoto, H., Imai, M., Nakamura, T., Miyakawa, Y. and Mayumi, M. (1983) Immunochemical structure of hepatitis B e antigen in the serum. J. Immunol. 130, 2903-2907. Tiollais, P., Chamay, P. and Vyas, G.N. (1981) Biology of hepatitis B virus. Science 213, 406-411. Trepo, C., Hantz, O., Vitvitski, L., Chevallier, P., Williams, A., Lemaire, J.M. and Sepetjian, M. (1978) Heterogeneity and significance of HBeAg: Characterization of a third specificity (e3). In: G.N. Vyas., S.N. Cohen, R. Schmid (Eds.), Viral Hepatitis, Franklin Institute Press, pp. 203-209. Williams, A. and Le Bouvier, G. (1976) Heterogeneity and thermolability of ‘e’. Bibl. Haematol. 42, 75-11. Yamada, E., Ohori, H., and Ishida, N. (1979) Physicochemical heterogeneity of hepatitis B e antigen detected in asymptomatic carriers and carriers in a hemodialysis unit. J. Med. Virol. 4, 33-42. (Received

21 October

1988; revision

received

18 April 1989)