- Email: [email protected]
Synthesis of hypoallergenic derivatives of the major allergen Fag t 1 from tartary buckwheat via sequence restructuring
Food and Chemical Toxicology 50 (2012) 2675–2680
Contents lists available at SciVerse ScienceDirect
Food and Chemical Toxicology journal homepage: www.elsevier.com/locate/foodchemtox
Synthesis of hypoallergenic derivatives of the major allergen Fag t 1 from tartary buckwheat via sequence restructuring Zhenhuang Yang, Yuying Li, Chen Li, Zhuanhua Wang ⇑ Key Laboratory of Chemical Biology and Molecular Engineering of Ministry of Education, Institute of Biotechnology, Shanxi University, Taiyuan 030006, PR China
a r t i c l e
i n f o
Article history: Received 30 September 2011 Accepted 7 March 2012 Available online 17 March 2012 Keywords: Tartary buckwheat allergy Fag t 1 Cupin superfamily Recombinant hypoallergens Immunotherapy
a b s t r a c t Fag t 1, a legumin-type protein, is the major allergen in tartary buckwheat. In the current study, three recombinant derivatives of Fag t 1, designated as Fag t 1-rs1, Fag t 1-rs2, and Fag t 1-rs3, were constructed via rational design and genetic engineering. However, because of the loss of their native-like folds, the Fag t 1 derivatives failed to bind IgE, and their allergenic activities were reduced. The recombinant hypoallergenic variants are promising vaccine candidates for specific immunotherapy of buckwheat allergy. The unfolding of the Fag t 1 structure reduced its high resistance to gastrointestinal proteolysis and strongly reduced its IgE reactivity. The derivatives showed a more than 90% reduction in allergenic activity compared with rFag t 1. These results suggest that the structure-dependent stability of 11S seed storage proteins is directly related to digestive stability and allergenic potential. Therefore, the destruction of the native conformation is the appropriate strategy to reduce the allergenicity of the cupin family food allergens. Ó 2012 Elsevier Ltd. All rights reserved.
1. Introduction Food allergies are a growing concern in many countries, where the percentage of the population exhibiting clinical food allergies has rapidly increased over the past few decades (Sicherer and Sampson, 2006). Now food allergy was a clinician’s criteria for including sera in a serum bank (Ballmer-Weber and Fernández-Rivas, 2008), and approaches to risk assessment in food allergy were reported (Madsen et al., 2009). Buckwheat hypersensitivity frequently occurs in Japan, Korea, and other Asian countries. As an IgE-mediated abnormal response, buckwheat hypersensitivity is similar to allergies caused by soybean and peanuts (Wieslander, 1996). Previously, Wang et al. (2004) isolated and identified the major allergen Fag t 1 (TBa) from tartary buckwheat (Fagopyrum tataricum), and the recombinant Fag t 1 (rFag t 1), which exhibits the structural and allergenic properties of natural Fag t 1, has been expressed in Escherichia coli (Wang et al., 2006). Fag t 1 belongs to the cupin superfamily as an 11S legumin-type protein, similar to peanut arachin (Ara h 3, 4) and soybean glycinin. The cupin and prolamin superfamilies and the protein families of the plant defense system are the most widespread groups of plant proteins that contain allergens. The cupin superfamily includes allergic seed storage proteins of the vicilin
⇑ Corresponding author. Address: Institute of Biotechnology, Shanxi University, No. 92 Wucheng Road, Taiyuan 030006, Shanxi Province, PR China. Tel.: +86 351 7019371; fax: +86 351 7011499. E-mail address: [email protected] (Z. Wang). 0278-6915/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fct.2012.03.039
and legumin types present in soybeans, peanuts, and tree nuts (Breiteneder and Radauer, 2004). Knowledge of plant genes and protein structures provides the foundation to understanding the biochemical processes that produce food allergy. To date, the genetic codes of the most important allergens have been deciphered, and recombinant allergens equivalent to their natural counterparts have been produced for diagnosis and immunotherapy (Valenta et al., 2011). Allergen-specific immunotherapy (SIT) represents the only disease-modifying treatment for IgE-mediated allergies. During the past decade, SIT clinical trials have been conducted using synthetic peptides containing T-cell epitopes, which are purified recombinant allergen derivatives modified via genetic engineering to reduce their allergenic activity (Larche et al., 2006). A large panel of genetically modified allergens with reduced allergenic activities has been characterized to improve the safety of immunotherapy and explore allergen-specific prevention strategies. Hypoallergenic proteins with reduced IgE antibody-binding capacities are considered novel allergen vaccines that reduce the frequency of adverse reactions during SIT (Vrtala, 2008). Biotechnology offers the prospect of producing low-IgE binding variants of allergens that can be used as vaccines to build immunotolerance in sensitive individuals (Herman and Burks, 2011). In the current study, we report the rational design as well as the structural and immunologic characterization of three recombinant hypoallergenic Fag t 1 derivatives without chemical denaturation steps. These derivatives were prepared via reassembly of the complete Fag t 1 sequence within single molecules using
2676
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
overlap extension polymerase chain reaction (PCR). The aim of our research was to identify the hypoallergenic molecules that can be used as alternative vaccines for successful immunotherapy. 2. Materials and methods 2.1. Sera and allergen preparation The sera of five patients (Table 1) with a history of respiratory, dermatologic, or gastrointestinal symptoms occurring within 1 h following ingestion of buckwheat were obtained from the Blood Center of Taiyuan, China. Healthy sera from volunteers not allergic to buckwheat food were used as the negative control. Natural Fag t 1 and rFag t 1 were prepared as previously described (Wang et al., 2004; Wang et al., 2006). The purified nFag t 1 was reduced, alkylated (R/A), and subsequently dialyzed against phosphate-buffered saline (PBS) buffer to unfold the protein structure. Fag t 1 was denatured in 5 M urea and 150 mM Tris–HCl (pH 8.5), reduced with 28 mM dithiothreitol at 50 °C for 45 min, and alkylated by adding iodoacetamide to a final concentration of 50 mM at room temperature to disrupt its tertiary structure. 2.2. Sequence analysis and molecular modeling A three-dimensional (3D) model for the Fag t 1 was constructed via comparative modeling of the protein sequences submitted to the SWISS-MODEL workstation using PyMOL. The molecular modeling was based on the X-ray-solved Cupin structure for the almond Pru1 protein (PDB code 3fz3), which is available in the Protein Data Bank (PDB). The InterProScan software was used to locate the protein sequences and identify the domain signatures and their potential protein families. The MHC class II binding regions in the antigen sequence were predicted using the MHC class II binding peptide prediction server, which is helpful in locating promiscuous binding regions for vaccine candidate selection (Singh and Raghava, 2001). 2.3. Preparation of Fag t 1 derivatives
Fig. 1. Hypoallergenic Fag t 1 derivatives. (A) Construction scheme of the Fag t 1 derivatives. The amino acids at the borders of the protein segments are indicated. (B) SDS–PAGE of the purified rFag t 1 and rFag t 1 derivatives. M, Molecular mass markers (kD); lane 1: rFag t 1; lane 2: rFag t 1-rs1; lane 3: rFag t 1-rs2; lane 4: rFag t 1-rs3.
Table 2 Primers for preparation of hypoallergenic derivatives. Primer no
Nucleotide sequence
P1
AT GGATCC GTATTCGACGACAACGTG BamHI TTGCTCCAATCCAACTATGGAGAAACG
P2 P3 P4 P5 P6
DNA genes were generated via overlap extension PCR based on the Fag t 1 sequence, producing three different recombinant Fag t 1 derivatives (Fig. 1A). The restructured Fag t 1 #1 (Fag t 1-rs1) consisted of two amino acid (aa) fragments, aa 91–195 and 1–90; the restructured Fag t 1 #2 (Fag t 1-rs2) consisted of three fragments, aa 141–195, 1–90, and 91–140; and Fag t 1 #3 (Fag t 1-rs3) consisted of four fragments, aa 51–90, 141–195, 1–50, and 91–140. The correct sequence and integrity of the open reading frames of all chimeras were confirmed via DNA sequence analysis. Finally, the PCR products were digested and ligated between the BamH I and Hind III multi-cloning sites into the pET-32 m expression vector. The primers used are listed in Table 2. All constructs were transformed into the E. coli strain BL21 (DE3). The expression of fusion proteins was induced by adding 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) in a lysogeny broth (LB) liquid medium. The recombinant proteins were purified using a HisTrap HP (5 ml) column (Amersham Biosciences, Sweden) in an ÄKTA purifier system (GE Healthcare, USA). 2.4. Electrophoresis and Western blotting 12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) was performed following the method of Laemmli (1970). The proteins were stained with Coomassie Brilliant Blue or detected via Western blotting, as previously described (Wang et al., 2006). For the detection of IgG-binding activity, rabbit antiFag t 1 antibodies and HRP-labeled goat anti-rabbit IgG were used as primary or secondary antibodies. An enhanced chemiluminescent (ECL) detection system (Amersham Biosciences, Sweden) was then used according to the manufacturer’s instructions.
P7 P8 P9 P10 P11
AT AAGCTT TTAACTCTTTCCTTCGTCTCC HindIII TTCTCCATAGTTGGATTGGAGCAAGCG AT GGATCC GTGTTGAGGGCGATC BamHI AT GGATCC CAC GTC GTC CTC TAC BamHI CGCCCTCAACACACTCTTTCCTTCGTC GAAGGAAAGAGTGTGTTGAGGGCGATC GTCGTCGAATACTTGGGCGCTAAGTTG CTTAGCGCCCAAGTATTCGACGACAAC AT AAGCTT TTACGAAGTCCTACCGGC HindIII
Restriction enzyme sites are underlined.
corded at the far UV range using a protein concentration of 0.3 mg/ml in PBS buffer at room temperature. The buffer scans were recorded under the same conditions and subtracted from the protein spectra before further analysis.
2.6. Protease digestion All protein samples were adjusted with the digestion buffer to pH 2.0 using 0.1 M HCl and subsequently digested with pepsin. Protease treatment was performed for 1, 5, 30, and 120 min at 37 °C. The reaction was stopped by increasing the pH to 7.5 using 1 M NaOH. For trypsin digestion, the allergens were dissolved in simulated duodenal buffer (50 mM Tris–HCl, 20 mM CaCl2, pH 8.0). Trypsin (10 lg) was added to the assay mixture, which was then incubated for 1, 5, 30, and 120 min at 37 °C. The reactions were stopped by placing the tube in a boiling water bath for 10 min. Controls without the enzyme were prepared with the digestion buffer, and bovine serum albumin (BSA) was used as the positive control.
2.7. Rabbit immunization and measurement of antibody production 2.5. Circular dichroism (CD) analysis CD spectral measurements were performed on an MOS-450 spectropolarimeter (Bio-Logic, Grenoble, France) at a scan speed of 100 nm/min, with three accumulations. The secondary structure of Fag t 1 and its derivatives (195–250 nm) were re-
Antibodies were produced as described by Campana et al. (2010), using three New Zealand rabbits by mixing purified rFag t 1 (0.5 mg/kg) to an equal volume of Freund’s adjuvant (Sigma Aldrich, St. Louis, MO). Serum IgG antibody levels were determined by ELISA assay with different dilutions, controls were performed with
Table 1 Characterization of sera from patients with positive IgE binding to buckwheat. Serum No.
Immediate hypersensitivity reaction
Sex
Age
Buckwheat-specific IgE levels(kU/L)
Major diagnosis
1 2 3 4 5
Positive Positive Positive Positive Positive
F F M F M
22 40 46 38 16
18.5 17.2 42.3 16.4 25.1
Buckwheat allergy and severe atopic dermatitis Buckwheat and elm pollen allergy Food allergy and allergic rhinitis Buckwheat and acarid allergy Food allergy and bronchial asthma
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
2677
Table 3 The HLA-DR binding regions of Fag t 1 predicted by ProPred.
The HLA-DR binding regions are shaded, the first amino acid of each region is in bold.
normal rabbit antibodies. Western blots were used to determine the rabbit antiserum specificity. The Local Care Use of Animals Committee approved the animal handling and experimental procedures. 2.8. ELISA and immunodot blotting ELISA was performed to detect the IgE/IgG-binding activity of Fag t 1 and its derivatives as previously described (Zhang et al., 2008). Serum samples and rabbit anti-Fag t 1 antibodies were added as the primary antibody respectively. HRP-conjugated mouse anti-human IgE or HRP-labeled goat anti-rabbit IgG was added as the secondary antibody, and then reacted with chromogen and o-phenylene diamine. Immunoblotting analysis was performed to test the specific IgE-binding and IgG-binding capacity of Fag t 1 and its derivatives. Two-microliter aliquots containing 1 mg purified nFag t 1, R/A Fag t 1, rFag t 1, each of the rFag t 1 derivatives, and BSA (as the negative control) were dotted onto a nitrocellulose (NC) membrane and blocked with PBS (pH 7.5) containing 5% skim milk. NC strips were incubated with sera from five individuals with buckwheat allergy, two individuals without allergy, rabbit anti-Fag t 1 antibodies or buffer without the addition of serum. Membrane incubation with the secondary antibody was performed using HRP-conjugated mouse anti-human IgE or HRP-labeled goat anti-rabbit IgG. The bound human IgE was detected via incubation with the colorimetric substrate 3,30 -diaminobenzidine (Boster Biotech, Wuhan, China), and the colors on the membranes were allowed to develop. The membranes were washed with copious amounts of PBS containing 0.1% Tween 20 after each step throughout the protocol. 2.9. Statistical analysis All experiments were conducted in triplicate, and data are expressed as mean ± S.D. Statistical differences were determined via one-way ANOVA followed by the Student–Newman–Keuls method (significance level, P < 0.05) using the SigmaStat 3.1 software (Systat Software Inc., San Jose, CA).
3. Results 3.1. Construction and characterization of Fag t 1 derivatives A 3D model of Fag t 1 was constructed and an InterProScan sequence search was performed to understand the Fag t 1 protein structure and epitope mapping. The InterProScan results predicted Fag t 1 as an 11-S seed storage protein belonging to the Cupin superfamily (RmlC type). In previous studies, the epitope mapping of Fag t 1 revealed the presence of several possible IgE-binding epitopes in the allergen (Ren et al., 2010). And potential T-cell epitopes were predicted by ProPred Server. There are 51 HLA-DR alleles belonging to nine serological specificities encoded by DRB1 and DRB5 genes covers more than 90% of MHC Class II molecules expressed on Antigen Presenting Cells. The server performs analysis for each of these alleles independently and computes the binding strength of all the peptide regions. The complete sequence of Fag t 1 was analyzed for HLA-DR binding prediction by using this virtual matrix-based prediction program at a threshold value of 3.0, the results are listed in Table 3. Three different recombinant Fag t 1 derivatives were constructed based on these studies. Fag t 1-rs1 was constructed by reassembling the hypoallergenic aa fragments 1–90 and 91–195 within one molecule as a tail-to-head construct, as previously described. The other two derivatives, Fag t 1-rs2 and Fag t 1-rs3, were prepared by reassembling aa 1–195, which contains four peptides (aa fragments 1–50, 51–90, 91–140, and 141–195). Given the pos-
sibility that aa fragments 1–90 and 91–195 may regain their allergenic activities, each fragment was broken into two pieces, and a mosaic molecule was constructed from these pieces. The proteins were expressed as 36 kDa His-tagged fusion proteins, with a final yield of 6 mg/L bacterial culture. Each of the recombinant proteins can be purified from the inclusion body fraction of the bacteria via Ni2+ affinity chromatography to more than 95% purity (Fig. 1B). The secondary structural elements of Fag t 1 and its derivatives were analyzed using CD spectroscopy. The spectra of the derivatives were completely different from those of the natural allergens, especially that of Fag t 1-rs3. The Fag t 1 spectra presented a large negative minimum at around 222 nm and a positive peak between 190 and 210 nm, indicating a typical b-sheet dominant structure. On the other hand, the spectra of the recombinant derivatives shifted toward a random coil conformation, reaching an almost completely unfolded state (Fig. 2).
3.2. Unfolded Fag t 1 reduces resistance to gastrointestinal digestion R/A Fag t 1 exhibited the same apparent molecular mass of 24 kDa compared with nFag t 1 on SDS–PAGE (Fig. 3A). The structural integrity and stability of both samples against gastrointestinal digestion were investigated. The CD spectrum of R/A Fag t 1 reveals a typically unfolded protein, showing specific features of the cupin family protein containing a b-sheet, with a minimum peak at 222 nm (Fig. 3B). Both nFag t 1 and R/A Fag t 1 were susceptible to proteolysis by pepsin, and the samples were insoluble at pH 2.0. However, in the subsequent proteolysis, nFag t 1 remained intact for at least 2 h after trypsin treatment, whereas R/A Fag t 1 was completely degraded after 10 min (Fig. 3C). Therefore, the resistance of unfolded Fag t 1 to gastrointestinal proteolysis was dramatically reduced. The enzymatic digestion of Fag t 1 derivatives was also detected
Fig. 2. Far-UV CD spectra of the rFag t 1 and rFag t 1 derivatives.
2678
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
4. Discussion With the application of recombinant DNA technology in allergen characterization, Recombinant allergens and allergen derivatives have also been successfully used for diagnostic (Valenta and Kraft, 2002). Recombinant allergens have become available for safe allergy vaccines, some hybrid allergen proteins have been created for combination vaccines, consisting of the most important epitopes or polypeptides but lack the IgE reactivity of the native allergens (Larche et al., 2006). Clinical studies from immunotherapy trials using recombinant allergens or recombinant hypoallergenic derivatives have recently become available (Cromwell et al., 2011). Generally, these studies demonstrate that such treatment is safe, induces an IgG1 response, and reduces IgE levels against the corresponding natural allergens. Several hypoallergenic derivatives that reduce allergenicity have been reported by González-Rioja et al. (2007), Reese et al. (2007), Campana et al. (2010), and Toda et al. (2011) in previous studies. Fragment, oligomer, mutant, hybrid, mosaic and unfolded protein are the commonly used types of recombinant hypoallergenic allergen derivatives. Reese et al. (2007) have reported that the destruction of the native conformation, rather than oligomerization, is the appropriate strategy to reduce the allergenicity of Bet v 1-homologous food allergens. The unfolded state of allergens has been observed in recombinant hypoallergens (González-Rioja et al., 2007), and Toda et al. (2011) have reported the unfolded Pru p 3 Fig. 3. Unfolded Fag t 1 and digestive stability analysis. (A) SDS–PAGE and Coomassie staining of nFag t 1 (lane 1) and after treatment using R/A (lane 2). (B) CD spectra of nFag t 1 and R/A Fag t 1. (C) The trypsin digestion of nFag t 1 and R/A Fag t 1 was analyzed via SDS–PAGE. The protein in H2O was used as the control (lane 1). The reaction was stopped after 1 min (lane 2), 5 min (lane 3), 30 min (lane 4), and 120 min (lane 5). (D) Trypsin digestion of the rFag t 1 and rFag t 1 derivatives. The reactions were stopped after 10 min. lane 1: rFag t 1; lane 2: rFag t 1-rs1; lane 3: rFag t 1-rs2; lane 4: rFag t 1-rs3.
after trypsin treatment (Fig. 3D), confirming that the derivatives do not possess the cupin dominant structure of Fag t 1.
3.3. Reduced IgE binding of Fag t 1 derivatives We further determined whether the three derivatives exhibited reduced binding with serum-specific IgE from patients with buckwheat allergy compared to native allergens. In a indirect ELISA using five sera from buckwheat-sensitized patients, the Fag t 1 derivatives and R/A Fag t 1 displayed a very weak IgE binding reactivity compared with natural Fag t 1 or rFag t 1 (P < .001; Fig. 4A). The IgG reactivity was conducted through ELISA with rabbit anti-Fag t 1 antibodies. The results confirm the recognition of the three derivatives by antibodies against rFag t 1 (Fig. 4B), suggesting that the polyclonal IgG antibodies recognize more epitopes than IgE, particularly the linear epitopes. Further analysis of IgE/IgG reactivity was conducted through immunodot and Western blotting. None of the five patients with buckwheat allergy exhibited any detectable IgE reactivity to R/A Fag t 1 or rFag t 1-rs3; however, they showed IgE binding to nFag t 1 and rFag t 1 (Fig. 5A, 1–5). No IgE reactivity to the control protein BSA was detected. The serum IgE from individuals without the allergy and the buffer showed no reactivity to any of the proteins (Fig. 5A, 6–8). The presence of rFag t 1 and rFag t 1 derivatives on the membrane was confirmed by testing with rabbit anti-rFag t 1 antibodies (Fig. 5A, 9 and 10). The NC-blotted rFag t 1 and rFag t 1 derivatives reacted with the polyclonal rabbit antibodies against rFag t 1 (Fig. 5B). The rabbit preimmune serum did not exhibit any binding (data not shown).
Fig. 4. IgE/IgG-binding to rFag t 1 and rFag t 1 derivatives. ELISA assay was conducted using the sera of patients (A) for IgE-binding activity and using rabbit anti-rFag t 1 antibodies; and (B) for IgG-binding activity of rFag t 1 and rFag t 1 derivatives. The results are expressed as the mean ± SD of three independent experiments.
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
2679
Fig. 5. (A) Dot blot immunoscreening of Fag t 1 and its derivatives. The NC-dotted nFag t 1, R/A Fag t 1, rFag t 1, rFag t 1-rs1, rFag t 1-rs2, rFag t 1-rs3, and BSA were exposed to sera from patients with buckwheat allergy (1–5), individuals without allergy (6–7), buffer (8), or anti-rFag t 1 antibodies (9–10). The bound IgE and rabbit IgG antibodies were detected and visualized via autoradiography. (B) IgG Western blotting of rFag t 1 and rFag t 1 derivatives. IgG reactivity of rFag t 1 (lane 1), rFag t 1-rs1 (lane 2), rFag t 1-rs2 (lane 3), and rFag t 1-rs3 (lane 4) with rabbit anti-Bet v 1 antibodies.
shows reduced allergenicity and antigenicity and preserves T-cell immunogenicity. Hypoallergenic proteins are related to the loss of natural conformation. As Zhang et al. (2008) reported the b-sheets and random coils in the cupin structure of Fag t 1 play significant roles in the allergic reaction. In our rational design of recombinant derivatives, the destruction of the native conformation was an important factor that was considered. Fag t 1 belongs to the 11S globulins (legumins) of the cupin superfamily and represents the conserved barrel domain of the family, which is built from tight b-sheet packing. The structural integrity and stability of the proteins were investigated via endolysosomal digestion, and the secondary structural elements were analyzed using CD spectroscopy. The 11S globulin of glycinin is susceptible to proteolysis by pepsin, although it is slightly soluble or insoluble between pH 3.5 and 6.5. However, even following proteolysis (with trypsin or chymotrypsin), the quaternary structure of the native protein is largely retained (Mills et al., 2002). To investigate the effect of the structural integrity on gastrointestinal digestion, R/A Fag t 1 was generated as a typically unfolded protein. The unfolded cupin protein lost its resistance to trypsin digestion. In contrast to native Fag t 1, the high resistance of the Fag t 1 derivatives to trypsin proteolysis was reduced, and their structures almost completely unfolded. It is seems that the unfolding of Fag t 1 abrogates its IgE reactivity and allergenic potency because of the destruction of the cupin domain. The analysis of the secondary structures of the derivatives via CD shows an almost total loss of the secondary structures, indicating the destruction of the conformational B-cell epitopes present in native allergens. In the current study, the three derivatives exhibited greatly reduced IgE reactivities; this result was also observed for R/A Fag t 1. Some linear epitopes not affected by structural changes may be responsible for the residual IgE-binding activity. The current principal approach to allergen alteration, as described by Larche et al. (2006), is to modify the B-cell epitopes to prevent IgE binding and effector cell activation while preserving the T-cell epitopes to retain the tolerance induction capacity. T-cell epitopes are usually short, linear amino acid sequences independent of the native conformation, and they possess low ability to crosslink IgE and activate effector cells. The ProPred analysis of Fag t 1 (195 aa) showed that more than 10 regions are located by 51 HLA-DR alleles, and each of those peptides are less than 12 aa. Most of the regions could bind >50% alleles and were considered as T-cell epitopes. Mustafa et al. (2005) evaluated the predicted peptides for recognition by T cells and reported it’s useful in predicting T-cell epitopes of Ag85B. The analysis could help us to prevent the disruption of potential T-cell epitopes in the design of the reassembled molecules. The ProPred analysis of Fag t 1
derivatives showed the binding regions are just the same to nFag t 1. We believe the strategy of mosaic molecules was achieved by destruction of conformational B cell epitopes and preservation of linear T cell epitopes. And this strategy may have several advantages over the allergen fragments. The mosaic strategy allows treatment with a single reassembled molecule, it’s easier to produce and purify one defined molecule instead of several fragments. As a promising vaccine, it’s more stable and cost-effective than chemical modified allergens. The reassembled molecules may represent a better way to prepare modified allergens for use as vaccines. Mosaic molecules with reduced IgE binding activity but retain T-cell reactivity, have been reported in previous studies (Mothes-Luksch et al., 2008; Ball et al., 2009). Therefore, the use of a structurally intact allergen in its natural conformation to induce a strong response from blocking antibodies may no longer be necessary (Reese et al., 2007). Although the induction of T-cell tolerance has not been confirmed at the present time for the results of preclinical study are unavailable. It is undoubted that the recombinant allergens with disrupted IgE epitopes and preserved dominant T-cell epitopes can be used as vaccine prototypes for SIT. 5. Conclusions In the present study, we constructed three recombinant hypoallergenic derivatives of the major tartary buckwheat allergen, Fag t 1, via rational molecular reassembly to obtain potential candidates for buckwheat allergy vaccines. The derivatives were constructed based on the MHC-binding region predictions, structural analyzes, 3D molecular modeling, and epitope mapping. Using Fag t 1 as a model for food allergens, we demonstrated that the structuredependent stability of the 11S seed storage proteins is directly related to its digestive stability and allergenic potential. The results indicate that the destruction of the native conformation of the cupin superfamily allergens is the appropriate strategy to reduce their allergenicity for the development of novel vaccine candidate. Conflict of Interest The authors declare that there are no conflicts of interest. Acknowledgments This work was supported by the Grants from the National Natural Science Foundation of China (30970611 and 31171659), the Science and Technology Committee of Shanxi Province (20100321101), and the Science and Technology Committee of Taiyuan (100622).
2680
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
References Ball, T., Linhart, B., Sonneck, K., Blatt, K., Herrmann, H., Valent, P., Stoecklinger, A., Lupinek, C., Thalhamer, J., Fedorov, A.A., Almo, S.C., Valenta, R., 2009. Reducing allergenicity by altering allergen fold: a mosaic protein of Phl p 1 for allergy vaccination. Allergy 64 (4), 569–580. Ballmer-Weber, B.K., Fernández-Rivas, M., 2008. Food allergy: a clinician’s criteria for including sera in a serum bank. Food Chem. Toxicol. 46 (Suppl 10), S2–S5. Breiteneder, H., Radauer, C., 2004. A classification of plant food allergens. J. Allergy Clin. Immunol. 113 (5), 821–830. Campana, R., Vrtala, S., Maderegger, B., Jertschin, P., Stegfellner, G., Swoboda, I., Focke-Tejkl, M., Blatt, K., Gieras, A., Zafred, D., Neubauer, A., Valent, P., Keller, W., Spitzauer, S., Valenta, R., 2010. Hypoallergenic derivatives of the major birch pollen allergen Bet v 1 obtained by rational sequence reassembly. J. Allergy Clin. Immunol. 126 (5), 1024–1031. Cromwell, O., Häfner, D., Nandy, A., 2011. Recombinant allergens for specific immunotherapy. J. Allergy Clin. Immunol. 127 (4), 865–872. González-Rioja, R., Ibarrola, I., Arilla, M.C., Ferrer, A., Mir, A., Andreu, C., Martínez, A., Asturias, J.A., 2007. Genetically engineered hybrid proteins from Parietaria judaica pollen for allergen-specific immunotherapy. J. Allergy Clin. Immunol. 120 (3), 602–609. Herman, E.M., Burks, A.W., 2011. The impact of plant biotechnology on food allergy. Curr. Opin. Biotechnol. 22 (2), 224–230. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Larche, M., Akdis, C.A., Valenta, R., 2006. Immunological mechanisms of allergenspecific immunotherapy. Nat. Rev. Immunol. 6, 761–771. Madsen, C.B., Hattersley, S., Buck, J., Gendel, S.M., Houben, G.F., Hourihane, J.O., Mackie, A., Mills, E.N., Nørhede, P., Taylor, S.L., Crevel, R.W., 2009. Approaches to risk assessment in food allergy: report from a workshop ‘‘developing a framework for assessing the risk from allergenic foods’’. Food Chem. Toxicol. 47 (2), 480–489. Mills, E.N., Jenkins, J., Marigheto, N., Belton, P.S., Gunning, A.P., Morris, V.J., 2002. Allergens of the cupin superfamily. Biochem. Soc. Trans. 30 (Pt 6), 925–929. Mothes-Luksch, N., Stumvoll, S., Linhart, B., Focke, M., Krauth, M.T., Hauswirth, A., Valent, P., Verdino, P., Pavkov, T., Keller, W., Grote, M., Valenta, R., 2008. Disruption of allergenic activity of the major grass pollen allergen Phl p 2 by reassembly as a mosaic protein. J. Immunol. 181 (7), 4864–4873.
Mustafa, A.S., Abal, A.T., Shaban, F., El-Shamy, A.M., Amoudy, H.A., 2005. HLA-DR binding prediction and experimental evaluation of T-cell epitopes of mycolyltransferase 85B (Ag85B), a major secreted antigen of Mycobacterium tuberculosis. Med. Princ. Pract. 14 (3), 140–146. Reese, G., Ballmer-Weber, B.K., Wangorsch, A., Randow, S., Vieths, S., 2007. Allergenicity and antigenicity of wild-type and mutant, monomeric, and dimeric carrot major allergen Dau c 1: destruction of conformation, not oligomerization, is the roadmap to save allergen vaccines. J. Allergy Clin. Immunol. 119 (4), 944–951. Ren, X., Zhang, X., Li, Y., Wang, Z., 2010. Epitope mapping and immunological characterization of a major allergen TBa in tartary buckwheat. Biotechnol. Lett. 32 (9), 1317–1324. Sicherer, S.H., Sampson, H.A., 2006. Food allergy. J. Allergy Clin. Immunol. 117, S470–S475. Singh, H., Raghava, G.P.S., 2001. ProPred: Prediction of HLA-DR binding sites. Bioinformatics 17 (12), 1236–1237. Toda, M., Reese, G., Gadermaier, G., Schulten, V., Lauer, I., Egger, M., Briza, P., Randow, S., Wolfheimer, S., Kigongo, V., Del Mar San Miguel Moncin, M., Fötisch, K., Bohle, B., Vieths, S., Scheurer, S., 2011. Protein unfolding strongly modulates the allergenicity and immunogenicity of Pru p 3, the major peach allergen. J. Allergy Clin. Immunol. 128(5), 1022–1030. Valenta, R., Kraft, D., 2002. From allergen structure to new forms of allergen-specific immunotherapy. Curr. Opin. Immunol. 14 (6), 718–727. Valenta, R., Linhart, B., Swoboda, I., Niederberger, V., 2011. Recombinant allergens for allergen-specific immunotherapy: 10 years anniversary of immunotherapy with recombinant allergens. Allergy 66, 775–783. Vrtala, S., 2008. From allergen genes to new forms of allergy diagnosis and treatment. Allergy 63, 299–309. Wang, Z., Zhang, Z., Zhao, Z., Wieslander, G., Norback, D., Kreft, I., 2004. Purification and characterization of a 24 kDa protein from tartary buckwheat seeds. Biosci. Biotechnol. Biochem. 68, 1409–1413. Wang, Z., Wang, L., Chang, W., Li, Y., Zhang, Z., Wieslander, G., Norback, D., 2006. Cloning, expression, and identification of immunological activity of an allergenic protein in tartary buckwheat. Biosci. Biotechnol. Biochem. 70, 1195–1199. Wieslander, G., 1996. Review on buckwheat allergy. Allergy 51, 661–665. Zhang, X., Yuan, J., Cui, X., Wang, Z., 2008. Molecular cloning, recombinant expression, and immunological characterization of a novel allergen from tartary buckwheat. J. Agric. Food Chem. 56, 10947–10953.
Contents lists available at SciVerse ScienceDirect
Food and Chemical Toxicology journal homepage: www.elsevier.com/locate/foodchemtox
Synthesis of hypoallergenic derivatives of the major allergen Fag t 1 from tartary buckwheat via sequence restructuring Zhenhuang Yang, Yuying Li, Chen Li, Zhuanhua Wang ⇑ Key Laboratory of Chemical Biology and Molecular Engineering of Ministry of Education, Institute of Biotechnology, Shanxi University, Taiyuan 030006, PR China
a r t i c l e
i n f o
Article history: Received 30 September 2011 Accepted 7 March 2012 Available online 17 March 2012 Keywords: Tartary buckwheat allergy Fag t 1 Cupin superfamily Recombinant hypoallergens Immunotherapy
a b s t r a c t Fag t 1, a legumin-type protein, is the major allergen in tartary buckwheat. In the current study, three recombinant derivatives of Fag t 1, designated as Fag t 1-rs1, Fag t 1-rs2, and Fag t 1-rs3, were constructed via rational design and genetic engineering. However, because of the loss of their native-like folds, the Fag t 1 derivatives failed to bind IgE, and their allergenic activities were reduced. The recombinant hypoallergenic variants are promising vaccine candidates for specific immunotherapy of buckwheat allergy. The unfolding of the Fag t 1 structure reduced its high resistance to gastrointestinal proteolysis and strongly reduced its IgE reactivity. The derivatives showed a more than 90% reduction in allergenic activity compared with rFag t 1. These results suggest that the structure-dependent stability of 11S seed storage proteins is directly related to digestive stability and allergenic potential. Therefore, the destruction of the native conformation is the appropriate strategy to reduce the allergenicity of the cupin family food allergens. Ó 2012 Elsevier Ltd. All rights reserved.
1. Introduction Food allergies are a growing concern in many countries, where the percentage of the population exhibiting clinical food allergies has rapidly increased over the past few decades (Sicherer and Sampson, 2006). Now food allergy was a clinician’s criteria for including sera in a serum bank (Ballmer-Weber and Fernández-Rivas, 2008), and approaches to risk assessment in food allergy were reported (Madsen et al., 2009). Buckwheat hypersensitivity frequently occurs in Japan, Korea, and other Asian countries. As an IgE-mediated abnormal response, buckwheat hypersensitivity is similar to allergies caused by soybean and peanuts (Wieslander, 1996). Previously, Wang et al. (2004) isolated and identified the major allergen Fag t 1 (TBa) from tartary buckwheat (Fagopyrum tataricum), and the recombinant Fag t 1 (rFag t 1), which exhibits the structural and allergenic properties of natural Fag t 1, has been expressed in Escherichia coli (Wang et al., 2006). Fag t 1 belongs to the cupin superfamily as an 11S legumin-type protein, similar to peanut arachin (Ara h 3, 4) and soybean glycinin. The cupin and prolamin superfamilies and the protein families of the plant defense system are the most widespread groups of plant proteins that contain allergens. The cupin superfamily includes allergic seed storage proteins of the vicilin
⇑ Corresponding author. Address: Institute of Biotechnology, Shanxi University, No. 92 Wucheng Road, Taiyuan 030006, Shanxi Province, PR China. Tel.: +86 351 7019371; fax: +86 351 7011499. E-mail address: [email protected] (Z. Wang). 0278-6915/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fct.2012.03.039
and legumin types present in soybeans, peanuts, and tree nuts (Breiteneder and Radauer, 2004). Knowledge of plant genes and protein structures provides the foundation to understanding the biochemical processes that produce food allergy. To date, the genetic codes of the most important allergens have been deciphered, and recombinant allergens equivalent to their natural counterparts have been produced for diagnosis and immunotherapy (Valenta et al., 2011). Allergen-specific immunotherapy (SIT) represents the only disease-modifying treatment for IgE-mediated allergies. During the past decade, SIT clinical trials have been conducted using synthetic peptides containing T-cell epitopes, which are purified recombinant allergen derivatives modified via genetic engineering to reduce their allergenic activity (Larche et al., 2006). A large panel of genetically modified allergens with reduced allergenic activities has been characterized to improve the safety of immunotherapy and explore allergen-specific prevention strategies. Hypoallergenic proteins with reduced IgE antibody-binding capacities are considered novel allergen vaccines that reduce the frequency of adverse reactions during SIT (Vrtala, 2008). Biotechnology offers the prospect of producing low-IgE binding variants of allergens that can be used as vaccines to build immunotolerance in sensitive individuals (Herman and Burks, 2011). In the current study, we report the rational design as well as the structural and immunologic characterization of three recombinant hypoallergenic Fag t 1 derivatives without chemical denaturation steps. These derivatives were prepared via reassembly of the complete Fag t 1 sequence within single molecules using
2676
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
overlap extension polymerase chain reaction (PCR). The aim of our research was to identify the hypoallergenic molecules that can be used as alternative vaccines for successful immunotherapy. 2. Materials and methods 2.1. Sera and allergen preparation The sera of five patients (Table 1) with a history of respiratory, dermatologic, or gastrointestinal symptoms occurring within 1 h following ingestion of buckwheat were obtained from the Blood Center of Taiyuan, China. Healthy sera from volunteers not allergic to buckwheat food were used as the negative control. Natural Fag t 1 and rFag t 1 were prepared as previously described (Wang et al., 2004; Wang et al., 2006). The purified nFag t 1 was reduced, alkylated (R/A), and subsequently dialyzed against phosphate-buffered saline (PBS) buffer to unfold the protein structure. Fag t 1 was denatured in 5 M urea and 150 mM Tris–HCl (pH 8.5), reduced with 28 mM dithiothreitol at 50 °C for 45 min, and alkylated by adding iodoacetamide to a final concentration of 50 mM at room temperature to disrupt its tertiary structure. 2.2. Sequence analysis and molecular modeling A three-dimensional (3D) model for the Fag t 1 was constructed via comparative modeling of the protein sequences submitted to the SWISS-MODEL workstation using PyMOL. The molecular modeling was based on the X-ray-solved Cupin structure for the almond Pru1 protein (PDB code 3fz3), which is available in the Protein Data Bank (PDB). The InterProScan software was used to locate the protein sequences and identify the domain signatures and their potential protein families. The MHC class II binding regions in the antigen sequence were predicted using the MHC class II binding peptide prediction server, which is helpful in locating promiscuous binding regions for vaccine candidate selection (Singh and Raghava, 2001). 2.3. Preparation of Fag t 1 derivatives
Fig. 1. Hypoallergenic Fag t 1 derivatives. (A) Construction scheme of the Fag t 1 derivatives. The amino acids at the borders of the protein segments are indicated. (B) SDS–PAGE of the purified rFag t 1 and rFag t 1 derivatives. M, Molecular mass markers (kD); lane 1: rFag t 1; lane 2: rFag t 1-rs1; lane 3: rFag t 1-rs2; lane 4: rFag t 1-rs3.
Table 2 Primers for preparation of hypoallergenic derivatives. Primer no
Nucleotide sequence
P1
AT GGATCC GTATTCGACGACAACGTG BamHI TTGCTCCAATCCAACTATGGAGAAACG
P2 P3 P4 P5 P6
DNA genes were generated via overlap extension PCR based on the Fag t 1 sequence, producing three different recombinant Fag t 1 derivatives (Fig. 1A). The restructured Fag t 1 #1 (Fag t 1-rs1) consisted of two amino acid (aa) fragments, aa 91–195 and 1–90; the restructured Fag t 1 #2 (Fag t 1-rs2) consisted of three fragments, aa 141–195, 1–90, and 91–140; and Fag t 1 #3 (Fag t 1-rs3) consisted of four fragments, aa 51–90, 141–195, 1–50, and 91–140. The correct sequence and integrity of the open reading frames of all chimeras were confirmed via DNA sequence analysis. Finally, the PCR products were digested and ligated between the BamH I and Hind III multi-cloning sites into the pET-32 m expression vector. The primers used are listed in Table 2. All constructs were transformed into the E. coli strain BL21 (DE3). The expression of fusion proteins was induced by adding 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) in a lysogeny broth (LB) liquid medium. The recombinant proteins were purified using a HisTrap HP (5 ml) column (Amersham Biosciences, Sweden) in an ÄKTA purifier system (GE Healthcare, USA). 2.4. Electrophoresis and Western blotting 12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) was performed following the method of Laemmli (1970). The proteins were stained with Coomassie Brilliant Blue or detected via Western blotting, as previously described (Wang et al., 2006). For the detection of IgG-binding activity, rabbit antiFag t 1 antibodies and HRP-labeled goat anti-rabbit IgG were used as primary or secondary antibodies. An enhanced chemiluminescent (ECL) detection system (Amersham Biosciences, Sweden) was then used according to the manufacturer’s instructions.
P7 P8 P9 P10 P11
AT AAGCTT TTAACTCTTTCCTTCGTCTCC HindIII TTCTCCATAGTTGGATTGGAGCAAGCG AT GGATCC GTGTTGAGGGCGATC BamHI AT GGATCC CAC GTC GTC CTC TAC BamHI CGCCCTCAACACACTCTTTCCTTCGTC GAAGGAAAGAGTGTGTTGAGGGCGATC GTCGTCGAATACTTGGGCGCTAAGTTG CTTAGCGCCCAAGTATTCGACGACAAC AT AAGCTT TTACGAAGTCCTACCGGC HindIII
Restriction enzyme sites are underlined.
corded at the far UV range using a protein concentration of 0.3 mg/ml in PBS buffer at room temperature. The buffer scans were recorded under the same conditions and subtracted from the protein spectra before further analysis.
2.6. Protease digestion All protein samples were adjusted with the digestion buffer to pH 2.0 using 0.1 M HCl and subsequently digested with pepsin. Protease treatment was performed for 1, 5, 30, and 120 min at 37 °C. The reaction was stopped by increasing the pH to 7.5 using 1 M NaOH. For trypsin digestion, the allergens were dissolved in simulated duodenal buffer (50 mM Tris–HCl, 20 mM CaCl2, pH 8.0). Trypsin (10 lg) was added to the assay mixture, which was then incubated for 1, 5, 30, and 120 min at 37 °C. The reactions were stopped by placing the tube in a boiling water bath for 10 min. Controls without the enzyme were prepared with the digestion buffer, and bovine serum albumin (BSA) was used as the positive control.
2.7. Rabbit immunization and measurement of antibody production 2.5. Circular dichroism (CD) analysis CD spectral measurements were performed on an MOS-450 spectropolarimeter (Bio-Logic, Grenoble, France) at a scan speed of 100 nm/min, with three accumulations. The secondary structure of Fag t 1 and its derivatives (195–250 nm) were re-
Antibodies were produced as described by Campana et al. (2010), using three New Zealand rabbits by mixing purified rFag t 1 (0.5 mg/kg) to an equal volume of Freund’s adjuvant (Sigma Aldrich, St. Louis, MO). Serum IgG antibody levels were determined by ELISA assay with different dilutions, controls were performed with
Table 1 Characterization of sera from patients with positive IgE binding to buckwheat. Serum No.
Immediate hypersensitivity reaction
Sex
Age
Buckwheat-specific IgE levels(kU/L)
Major diagnosis
1 2 3 4 5
Positive Positive Positive Positive Positive
F F M F M
22 40 46 38 16
18.5 17.2 42.3 16.4 25.1
Buckwheat allergy and severe atopic dermatitis Buckwheat and elm pollen allergy Food allergy and allergic rhinitis Buckwheat and acarid allergy Food allergy and bronchial asthma
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
2677
Table 3 The HLA-DR binding regions of Fag t 1 predicted by ProPred.
The HLA-DR binding regions are shaded, the first amino acid of each region is in bold.
normal rabbit antibodies. Western blots were used to determine the rabbit antiserum specificity. The Local Care Use of Animals Committee approved the animal handling and experimental procedures. 2.8. ELISA and immunodot blotting ELISA was performed to detect the IgE/IgG-binding activity of Fag t 1 and its derivatives as previously described (Zhang et al., 2008). Serum samples and rabbit anti-Fag t 1 antibodies were added as the primary antibody respectively. HRP-conjugated mouse anti-human IgE or HRP-labeled goat anti-rabbit IgG was added as the secondary antibody, and then reacted with chromogen and o-phenylene diamine. Immunoblotting analysis was performed to test the specific IgE-binding and IgG-binding capacity of Fag t 1 and its derivatives. Two-microliter aliquots containing 1 mg purified nFag t 1, R/A Fag t 1, rFag t 1, each of the rFag t 1 derivatives, and BSA (as the negative control) were dotted onto a nitrocellulose (NC) membrane and blocked with PBS (pH 7.5) containing 5% skim milk. NC strips were incubated with sera from five individuals with buckwheat allergy, two individuals without allergy, rabbit anti-Fag t 1 antibodies or buffer without the addition of serum. Membrane incubation with the secondary antibody was performed using HRP-conjugated mouse anti-human IgE or HRP-labeled goat anti-rabbit IgG. The bound human IgE was detected via incubation with the colorimetric substrate 3,30 -diaminobenzidine (Boster Biotech, Wuhan, China), and the colors on the membranes were allowed to develop. The membranes were washed with copious amounts of PBS containing 0.1% Tween 20 after each step throughout the protocol. 2.9. Statistical analysis All experiments were conducted in triplicate, and data are expressed as mean ± S.D. Statistical differences were determined via one-way ANOVA followed by the Student–Newman–Keuls method (significance level, P < 0.05) using the SigmaStat 3.1 software (Systat Software Inc., San Jose, CA).
3. Results 3.1. Construction and characterization of Fag t 1 derivatives A 3D model of Fag t 1 was constructed and an InterProScan sequence search was performed to understand the Fag t 1 protein structure and epitope mapping. The InterProScan results predicted Fag t 1 as an 11-S seed storage protein belonging to the Cupin superfamily (RmlC type). In previous studies, the epitope mapping of Fag t 1 revealed the presence of several possible IgE-binding epitopes in the allergen (Ren et al., 2010). And potential T-cell epitopes were predicted by ProPred Server. There are 51 HLA-DR alleles belonging to nine serological specificities encoded by DRB1 and DRB5 genes covers more than 90% of MHC Class II molecules expressed on Antigen Presenting Cells. The server performs analysis for each of these alleles independently and computes the binding strength of all the peptide regions. The complete sequence of Fag t 1 was analyzed for HLA-DR binding prediction by using this virtual matrix-based prediction program at a threshold value of 3.0, the results are listed in Table 3. Three different recombinant Fag t 1 derivatives were constructed based on these studies. Fag t 1-rs1 was constructed by reassembling the hypoallergenic aa fragments 1–90 and 91–195 within one molecule as a tail-to-head construct, as previously described. The other two derivatives, Fag t 1-rs2 and Fag t 1-rs3, were prepared by reassembling aa 1–195, which contains four peptides (aa fragments 1–50, 51–90, 91–140, and 141–195). Given the pos-
sibility that aa fragments 1–90 and 91–195 may regain their allergenic activities, each fragment was broken into two pieces, and a mosaic molecule was constructed from these pieces. The proteins were expressed as 36 kDa His-tagged fusion proteins, with a final yield of 6 mg/L bacterial culture. Each of the recombinant proteins can be purified from the inclusion body fraction of the bacteria via Ni2+ affinity chromatography to more than 95% purity (Fig. 1B). The secondary structural elements of Fag t 1 and its derivatives were analyzed using CD spectroscopy. The spectra of the derivatives were completely different from those of the natural allergens, especially that of Fag t 1-rs3. The Fag t 1 spectra presented a large negative minimum at around 222 nm and a positive peak between 190 and 210 nm, indicating a typical b-sheet dominant structure. On the other hand, the spectra of the recombinant derivatives shifted toward a random coil conformation, reaching an almost completely unfolded state (Fig. 2).
3.2. Unfolded Fag t 1 reduces resistance to gastrointestinal digestion R/A Fag t 1 exhibited the same apparent molecular mass of 24 kDa compared with nFag t 1 on SDS–PAGE (Fig. 3A). The structural integrity and stability of both samples against gastrointestinal digestion were investigated. The CD spectrum of R/A Fag t 1 reveals a typically unfolded protein, showing specific features of the cupin family protein containing a b-sheet, with a minimum peak at 222 nm (Fig. 3B). Both nFag t 1 and R/A Fag t 1 were susceptible to proteolysis by pepsin, and the samples were insoluble at pH 2.0. However, in the subsequent proteolysis, nFag t 1 remained intact for at least 2 h after trypsin treatment, whereas R/A Fag t 1 was completely degraded after 10 min (Fig. 3C). Therefore, the resistance of unfolded Fag t 1 to gastrointestinal proteolysis was dramatically reduced. The enzymatic digestion of Fag t 1 derivatives was also detected
Fig. 2. Far-UV CD spectra of the rFag t 1 and rFag t 1 derivatives.
2678
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
4. Discussion With the application of recombinant DNA technology in allergen characterization, Recombinant allergens and allergen derivatives have also been successfully used for diagnostic (Valenta and Kraft, 2002). Recombinant allergens have become available for safe allergy vaccines, some hybrid allergen proteins have been created for combination vaccines, consisting of the most important epitopes or polypeptides but lack the IgE reactivity of the native allergens (Larche et al., 2006). Clinical studies from immunotherapy trials using recombinant allergens or recombinant hypoallergenic derivatives have recently become available (Cromwell et al., 2011). Generally, these studies demonstrate that such treatment is safe, induces an IgG1 response, and reduces IgE levels against the corresponding natural allergens. Several hypoallergenic derivatives that reduce allergenicity have been reported by González-Rioja et al. (2007), Reese et al. (2007), Campana et al. (2010), and Toda et al. (2011) in previous studies. Fragment, oligomer, mutant, hybrid, mosaic and unfolded protein are the commonly used types of recombinant hypoallergenic allergen derivatives. Reese et al. (2007) have reported that the destruction of the native conformation, rather than oligomerization, is the appropriate strategy to reduce the allergenicity of Bet v 1-homologous food allergens. The unfolded state of allergens has been observed in recombinant hypoallergens (González-Rioja et al., 2007), and Toda et al. (2011) have reported the unfolded Pru p 3 Fig. 3. Unfolded Fag t 1 and digestive stability analysis. (A) SDS–PAGE and Coomassie staining of nFag t 1 (lane 1) and after treatment using R/A (lane 2). (B) CD spectra of nFag t 1 and R/A Fag t 1. (C) The trypsin digestion of nFag t 1 and R/A Fag t 1 was analyzed via SDS–PAGE. The protein in H2O was used as the control (lane 1). The reaction was stopped after 1 min (lane 2), 5 min (lane 3), 30 min (lane 4), and 120 min (lane 5). (D) Trypsin digestion of the rFag t 1 and rFag t 1 derivatives. The reactions were stopped after 10 min. lane 1: rFag t 1; lane 2: rFag t 1-rs1; lane 3: rFag t 1-rs2; lane 4: rFag t 1-rs3.
after trypsin treatment (Fig. 3D), confirming that the derivatives do not possess the cupin dominant structure of Fag t 1.
3.3. Reduced IgE binding of Fag t 1 derivatives We further determined whether the three derivatives exhibited reduced binding with serum-specific IgE from patients with buckwheat allergy compared to native allergens. In a indirect ELISA using five sera from buckwheat-sensitized patients, the Fag t 1 derivatives and R/A Fag t 1 displayed a very weak IgE binding reactivity compared with natural Fag t 1 or rFag t 1 (P < .001; Fig. 4A). The IgG reactivity was conducted through ELISA with rabbit anti-Fag t 1 antibodies. The results confirm the recognition of the three derivatives by antibodies against rFag t 1 (Fig. 4B), suggesting that the polyclonal IgG antibodies recognize more epitopes than IgE, particularly the linear epitopes. Further analysis of IgE/IgG reactivity was conducted through immunodot and Western blotting. None of the five patients with buckwheat allergy exhibited any detectable IgE reactivity to R/A Fag t 1 or rFag t 1-rs3; however, they showed IgE binding to nFag t 1 and rFag t 1 (Fig. 5A, 1–5). No IgE reactivity to the control protein BSA was detected. The serum IgE from individuals without the allergy and the buffer showed no reactivity to any of the proteins (Fig. 5A, 6–8). The presence of rFag t 1 and rFag t 1 derivatives on the membrane was confirmed by testing with rabbit anti-rFag t 1 antibodies (Fig. 5A, 9 and 10). The NC-blotted rFag t 1 and rFag t 1 derivatives reacted with the polyclonal rabbit antibodies against rFag t 1 (Fig. 5B). The rabbit preimmune serum did not exhibit any binding (data not shown).
Fig. 4. IgE/IgG-binding to rFag t 1 and rFag t 1 derivatives. ELISA assay was conducted using the sera of patients (A) for IgE-binding activity and using rabbit anti-rFag t 1 antibodies; and (B) for IgG-binding activity of rFag t 1 and rFag t 1 derivatives. The results are expressed as the mean ± SD of three independent experiments.
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
2679
Fig. 5. (A) Dot blot immunoscreening of Fag t 1 and its derivatives. The NC-dotted nFag t 1, R/A Fag t 1, rFag t 1, rFag t 1-rs1, rFag t 1-rs2, rFag t 1-rs3, and BSA were exposed to sera from patients with buckwheat allergy (1–5), individuals without allergy (6–7), buffer (8), or anti-rFag t 1 antibodies (9–10). The bound IgE and rabbit IgG antibodies were detected and visualized via autoradiography. (B) IgG Western blotting of rFag t 1 and rFag t 1 derivatives. IgG reactivity of rFag t 1 (lane 1), rFag t 1-rs1 (lane 2), rFag t 1-rs2 (lane 3), and rFag t 1-rs3 (lane 4) with rabbit anti-Bet v 1 antibodies.
shows reduced allergenicity and antigenicity and preserves T-cell immunogenicity. Hypoallergenic proteins are related to the loss of natural conformation. As Zhang et al. (2008) reported the b-sheets and random coils in the cupin structure of Fag t 1 play significant roles in the allergic reaction. In our rational design of recombinant derivatives, the destruction of the native conformation was an important factor that was considered. Fag t 1 belongs to the 11S globulins (legumins) of the cupin superfamily and represents the conserved barrel domain of the family, which is built from tight b-sheet packing. The structural integrity and stability of the proteins were investigated via endolysosomal digestion, and the secondary structural elements were analyzed using CD spectroscopy. The 11S globulin of glycinin is susceptible to proteolysis by pepsin, although it is slightly soluble or insoluble between pH 3.5 and 6.5. However, even following proteolysis (with trypsin or chymotrypsin), the quaternary structure of the native protein is largely retained (Mills et al., 2002). To investigate the effect of the structural integrity on gastrointestinal digestion, R/A Fag t 1 was generated as a typically unfolded protein. The unfolded cupin protein lost its resistance to trypsin digestion. In contrast to native Fag t 1, the high resistance of the Fag t 1 derivatives to trypsin proteolysis was reduced, and their structures almost completely unfolded. It is seems that the unfolding of Fag t 1 abrogates its IgE reactivity and allergenic potency because of the destruction of the cupin domain. The analysis of the secondary structures of the derivatives via CD shows an almost total loss of the secondary structures, indicating the destruction of the conformational B-cell epitopes present in native allergens. In the current study, the three derivatives exhibited greatly reduced IgE reactivities; this result was also observed for R/A Fag t 1. Some linear epitopes not affected by structural changes may be responsible for the residual IgE-binding activity. The current principal approach to allergen alteration, as described by Larche et al. (2006), is to modify the B-cell epitopes to prevent IgE binding and effector cell activation while preserving the T-cell epitopes to retain the tolerance induction capacity. T-cell epitopes are usually short, linear amino acid sequences independent of the native conformation, and they possess low ability to crosslink IgE and activate effector cells. The ProPred analysis of Fag t 1 (195 aa) showed that more than 10 regions are located by 51 HLA-DR alleles, and each of those peptides are less than 12 aa. Most of the regions could bind >50% alleles and were considered as T-cell epitopes. Mustafa et al. (2005) evaluated the predicted peptides for recognition by T cells and reported it’s useful in predicting T-cell epitopes of Ag85B. The analysis could help us to prevent the disruption of potential T-cell epitopes in the design of the reassembled molecules. The ProPred analysis of Fag t 1
derivatives showed the binding regions are just the same to nFag t 1. We believe the strategy of mosaic molecules was achieved by destruction of conformational B cell epitopes and preservation of linear T cell epitopes. And this strategy may have several advantages over the allergen fragments. The mosaic strategy allows treatment with a single reassembled molecule, it’s easier to produce and purify one defined molecule instead of several fragments. As a promising vaccine, it’s more stable and cost-effective than chemical modified allergens. The reassembled molecules may represent a better way to prepare modified allergens for use as vaccines. Mosaic molecules with reduced IgE binding activity but retain T-cell reactivity, have been reported in previous studies (Mothes-Luksch et al., 2008; Ball et al., 2009). Therefore, the use of a structurally intact allergen in its natural conformation to induce a strong response from blocking antibodies may no longer be necessary (Reese et al., 2007). Although the induction of T-cell tolerance has not been confirmed at the present time for the results of preclinical study are unavailable. It is undoubted that the recombinant allergens with disrupted IgE epitopes and preserved dominant T-cell epitopes can be used as vaccine prototypes for SIT. 5. Conclusions In the present study, we constructed three recombinant hypoallergenic derivatives of the major tartary buckwheat allergen, Fag t 1, via rational molecular reassembly to obtain potential candidates for buckwheat allergy vaccines. The derivatives were constructed based on the MHC-binding region predictions, structural analyzes, 3D molecular modeling, and epitope mapping. Using Fag t 1 as a model for food allergens, we demonstrated that the structuredependent stability of the 11S seed storage proteins is directly related to its digestive stability and allergenic potential. The results indicate that the destruction of the native conformation of the cupin superfamily allergens is the appropriate strategy to reduce their allergenicity for the development of novel vaccine candidate. Conflict of Interest The authors declare that there are no conflicts of interest. Acknowledgments This work was supported by the Grants from the National Natural Science Foundation of China (30970611 and 31171659), the Science and Technology Committee of Shanxi Province (20100321101), and the Science and Technology Committee of Taiyuan (100622).
2680
Z. Yang et al. / Food and Chemical Toxicology 50 (2012) 2675–2680
References Ball, T., Linhart, B., Sonneck, K., Blatt, K., Herrmann, H., Valent, P., Stoecklinger, A., Lupinek, C., Thalhamer, J., Fedorov, A.A., Almo, S.C., Valenta, R., 2009. Reducing allergenicity by altering allergen fold: a mosaic protein of Phl p 1 for allergy vaccination. Allergy 64 (4), 569–580. Ballmer-Weber, B.K., Fernández-Rivas, M., 2008. Food allergy: a clinician’s criteria for including sera in a serum bank. Food Chem. Toxicol. 46 (Suppl 10), S2–S5. Breiteneder, H., Radauer, C., 2004. A classification of plant food allergens. J. Allergy Clin. Immunol. 113 (5), 821–830. Campana, R., Vrtala, S., Maderegger, B., Jertschin, P., Stegfellner, G., Swoboda, I., Focke-Tejkl, M., Blatt, K., Gieras, A., Zafred, D., Neubauer, A., Valent, P., Keller, W., Spitzauer, S., Valenta, R., 2010. Hypoallergenic derivatives of the major birch pollen allergen Bet v 1 obtained by rational sequence reassembly. J. Allergy Clin. Immunol. 126 (5), 1024–1031. Cromwell, O., Häfner, D., Nandy, A., 2011. Recombinant allergens for specific immunotherapy. J. Allergy Clin. Immunol. 127 (4), 865–872. González-Rioja, R., Ibarrola, I., Arilla, M.C., Ferrer, A., Mir, A., Andreu, C., Martínez, A., Asturias, J.A., 2007. Genetically engineered hybrid proteins from Parietaria judaica pollen for allergen-specific immunotherapy. J. Allergy Clin. Immunol. 120 (3), 602–609. Herman, E.M., Burks, A.W., 2011. The impact of plant biotechnology on food allergy. Curr. Opin. Biotechnol. 22 (2), 224–230. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Larche, M., Akdis, C.A., Valenta, R., 2006. Immunological mechanisms of allergenspecific immunotherapy. Nat. Rev. Immunol. 6, 761–771. Madsen, C.B., Hattersley, S., Buck, J., Gendel, S.M., Houben, G.F., Hourihane, J.O., Mackie, A., Mills, E.N., Nørhede, P., Taylor, S.L., Crevel, R.W., 2009. Approaches to risk assessment in food allergy: report from a workshop ‘‘developing a framework for assessing the risk from allergenic foods’’. Food Chem. Toxicol. 47 (2), 480–489. Mills, E.N., Jenkins, J., Marigheto, N., Belton, P.S., Gunning, A.P., Morris, V.J., 2002. Allergens of the cupin superfamily. Biochem. Soc. Trans. 30 (Pt 6), 925–929. Mothes-Luksch, N., Stumvoll, S., Linhart, B., Focke, M., Krauth, M.T., Hauswirth, A., Valent, P., Verdino, P., Pavkov, T., Keller, W., Grote, M., Valenta, R., 2008. Disruption of allergenic activity of the major grass pollen allergen Phl p 2 by reassembly as a mosaic protein. J. Immunol. 181 (7), 4864–4873.
Mustafa, A.S., Abal, A.T., Shaban, F., El-Shamy, A.M., Amoudy, H.A., 2005. HLA-DR binding prediction and experimental evaluation of T-cell epitopes of mycolyltransferase 85B (Ag85B), a major secreted antigen of Mycobacterium tuberculosis. Med. Princ. Pract. 14 (3), 140–146. Reese, G., Ballmer-Weber, B.K., Wangorsch, A., Randow, S., Vieths, S., 2007. Allergenicity and antigenicity of wild-type and mutant, monomeric, and dimeric carrot major allergen Dau c 1: destruction of conformation, not oligomerization, is the roadmap to save allergen vaccines. J. Allergy Clin. Immunol. 119 (4), 944–951. Ren, X., Zhang, X., Li, Y., Wang, Z., 2010. Epitope mapping and immunological characterization of a major allergen TBa in tartary buckwheat. Biotechnol. Lett. 32 (9), 1317–1324. Sicherer, S.H., Sampson, H.A., 2006. Food allergy. J. Allergy Clin. Immunol. 117, S470–S475. Singh, H., Raghava, G.P.S., 2001. ProPred: Prediction of HLA-DR binding sites. Bioinformatics 17 (12), 1236–1237. Toda, M., Reese, G., Gadermaier, G., Schulten, V., Lauer, I., Egger, M., Briza, P., Randow, S., Wolfheimer, S., Kigongo, V., Del Mar San Miguel Moncin, M., Fötisch, K., Bohle, B., Vieths, S., Scheurer, S., 2011. Protein unfolding strongly modulates the allergenicity and immunogenicity of Pru p 3, the major peach allergen. J. Allergy Clin. Immunol. 128(5), 1022–1030. Valenta, R., Kraft, D., 2002. From allergen structure to new forms of allergen-specific immunotherapy. Curr. Opin. Immunol. 14 (6), 718–727. Valenta, R., Linhart, B., Swoboda, I., Niederberger, V., 2011. Recombinant allergens for allergen-specific immunotherapy: 10 years anniversary of immunotherapy with recombinant allergens. Allergy 66, 775–783. Vrtala, S., 2008. From allergen genes to new forms of allergy diagnosis and treatment. Allergy 63, 299–309. Wang, Z., Zhang, Z., Zhao, Z., Wieslander, G., Norback, D., Kreft, I., 2004. Purification and characterization of a 24 kDa protein from tartary buckwheat seeds. Biosci. Biotechnol. Biochem. 68, 1409–1413. Wang, Z., Wang, L., Chang, W., Li, Y., Zhang, Z., Wieslander, G., Norback, D., 2006. Cloning, expression, and identification of immunological activity of an allergenic protein in tartary buckwheat. Biosci. Biotechnol. Biochem. 70, 1195–1199. Wieslander, G., 1996. Review on buckwheat allergy. Allergy 51, 661–665. Zhang, X., Yuan, J., Cui, X., Wang, Z., 2008. Molecular cloning, recombinant expression, and immunological characterization of a novel allergen from tartary buckwheat. J. Agric. Food Chem. 56, 10947–10953.