Synthetic DNA bending sequences increase the rate of in vitro transcription initiation at the Escherichia coli lac promoter

J. Mol.

Riol.

(1991) 219, 217-230

Synthetic DNA Bending Sequences Increase the Rate of in Vitro Transcription Initiation at the Escherichia coli ZacPromoter Marc R. Gartenberg and Donald M. Crothers Department of Chemistry, Yale liniversity New Haven, CT 06511, U.S.A. (Received 11 duly

1990; accepted 74 January

1991)

Appropriately phased DNA bending sequences replacing the CAP binding site upstream from the lac promoter increase by roughly tenfold the rate of specific transcription initiation from a superhelical promoter template in vitro; promoter occlusion results from polymerase is not responsible for t’he binding to the upstream (dA), . (dT), t racts, but this phenomenon observed phase-dependent transcriptional activity. The rates of open complex formation at bot,h PI and P2 promoters respond in a similar phase-dependent way to the synthetic curved DNA sequences. Ke?lluords:

DNA

bending;

A-tracts;

transcription:

Since the discovery of intrinsically bent DNA (Marini et al.. \982), sequence-directed and proteininduced DNA curvature has been found within the promoters of both prokaryotic and eukaryotic genomes (Lamond & Travers, 1983; Bossi & Smith, 1984; Galas et al., 1985; Deuschle et al., 1986; Gourse et al., 1986; Plaskon & Wartell, 1987; Kuhnke et al., 1987: McAllister $ Achberger, 1988; Heumann et al.. 1988). In some cases, DNA bending appears to initiation rate the transcriptional modulate (Lamond & Travers, 1983; Bossi & Smith, 1984; Gourse et al., 1986; McAllister & Achberger, 1988). Furthermore, Escherichia coli RNA polymerase induces bending at the gal and bacteriophage T7 Al promoters (Kuhnke et al., 1987; Heumann et al.. 1988) and modulates DNA bending at the Zac promoter (Zinkel & Crothers, 1991). The strongest promoters catalogued to date share in common a known bending sequence of five to six contiguous adenosines (Koo et al., 1986) centred near position - 43 (Deuschlc: et al., 1986). Bracco et aE. (1989) showed that properly phased A tract-mediated bends can functionally replace the CAP binding/ bending site in the E. coli gal promoter in vivo, paralleling the finding of McAllister & Achberger (1989), who showed that the in vivo and in vitro activity of the Ah 156 promoter from Bacillus subtilis bacteriophage SP82 is dependent on the phasing of upstream A tracts.

1 4bbreviations protein:

217 $03.00/O

supercoiled

DNA

E. coli cat’abolite activator protein (CAP?). a prototypical DNA-bending regulatory protein (Fried & Crothers, 1983; Kolb et al.? 1983; WU & Crothers, 1984; Liu-Johnson et al., 1986; Warwicker et al.; 1987; Zinkel & Crothers. 1991), stimulates transcription from the Zac promoter upon glucose starvation. An increasing body of evidence supports the theory that CAP modulates the activity of RNA polgmerase, at least in part, via protein-protein interactions (Blazy et al., 1980; Mandecki & (:aruthers, 1984; Pinkney & Hoggett, 1988; Straney t,he stabilization of rt al.. 1989); in particular, DNA- bound CAP by promoter-bound polymerase is lost when a half helical turn is inserted between the two DNA binding sites, but is partially restored with the insertion of a full helical turn (Straney et nl.. 1989). Stimulation of transcription by CAP correlates with the stabilization effect (Mandecki & Caruthers, 1984; Straney et al., 1989). At least two proposals have been advanced to explain the role of the CBP-induced bend: the energy stored in the bend may facilitate mechanical processes at some st)a,ge during the t,ranscription program (LiuJohnson et al., 1986; Zinkel & Crothers, 1991), or the bend may promote essential protein-DNA and/or protein-protein contacts that would not be stericallp feasible with a straight promoter (Wu &

1. Introduction

0022- 3836/91/1002li-14

Ear promoter:

/Y-lat.

used: CAP. catabolitr

activator

B-lactamase. 0

1991 Araclrmic

Press Limited

21X

M. R. G’artenbery and 11. M. ( ‘rotlwrcs

(Brothers, 1984). Distinguishing the influences of bending and protein-protein interactions in gene activation by CAP is clearly essential for understanding the mechanism of CAP action. Tn the work reported here, we sought t.o separate the effect of the induced bend from the influence of CAP-polymerase interactions by test,ing the abilit? of a sequence-directed bend to serve as a funct’ional substitute for the CAP site in the lac promoter in vitro. These experiments parallel those of Goodman and Nash (1989), who demonstrated that, the prot,ein-induced bend of an IHF-DNA complex required for bacteriophage L integration could be functionally replaced by both A tract-mediated and CAP-induced bends. Our hybrid promoters were created by replacement of the CAP binding site with a series of t’racts of five or six A. T base-pairs. each of which deflects the DNA helix trajectory l)y approximately 1X” at 22 “(I in Mg’+-containing buffer (Koo et al., 1990); when the tracts are repeated at approximately 1@5 base-pair intervals, substantial DNA bending results (Koo et al., 1986). A key feature of our experiments is recognition of the possibility that. competing kinet.ic* even& may occur at an active promoter. We were part.icularly concerned that polymerase binding to t,he upstream A tracts could modulate specific transcription b> occlusion of the active promoter site in a phasedependent way: unfavourably phased A tjracts might’ bind an occluding polymerase on the side of the promoter DNA that must, be available to form the productive complex, Competing reactions at. the promoter necessitate consideration of the general reaction scheme: kal1 -+ Counter-productive (1) complexes Ic, -+ Productive complexes

R+PLi

lCfpd= k + c Ic,,,

(2)

according to which RNA polymerase (R) reacts with promoter (P) wit,h a total rate constant lCfpdthat measures the rate of free promoter depletion. The rate constant lCfpdis the sum of two terms: Ic,, t’he rate constant for formation of “productive” complexes, which we define to be those bound to either the Pl or P2 promoter, as judged operationally by their ability to block restriction digestion of the promoter,

and (Clc,,,), the rate constant,

for formation of counter-productive complexes. defined as those that occlude binding to the Pl or P2 promoters; the counter-productive complexes do not inhibit restriction digestion of the promoter. We are also able to measure formation of open complexes at Pl and P2 individually by use of the abortive initiation assay. Thus, variation in transcriptional activity can result’ from an increase in the rate of productive complex formation and/or decrease in the maximum open productive complex obtainable (also referred to as maximal promoter occupancy), which can be limited by competitive

binding

of polymerase

to an adjacent

sit,c. At high

levels of promoter occupancy. polymerasr bouncl t.0 upstream cnurved DNA sequences (San, in t~fti~c4 serve as a transcriptional repressor. We measured transcriptional activit,y.

rrlativt~ rates of free promoter depletion. and maximal promoter occupancies and found that the position of the A trac:t,s modulates the rrlativc, rate of ofwn complex formation from superhelic~al templat~~h 1)~ roughly an order of magnitude, (‘onstructs that yield optimal rates bend the promoter in tht* same dire&ion as t.he former (‘AT’-DNA c.omplex. Maximum occupancy of the hybrid promoters varies in a phase-dependent manner as ~~41: probing protein-LISA ceomplexes with KblnO, revralrd an occluding polyrnerase binding site. loc*at,rd within the A traclts. which competes kineticaally for polytnerase. However. phase-dependent promotrr activation is a direct kinetic effects. and not a V(IIIS~‘~ quence of the competing occlusion process. which occurs at, a rate nearly independent of phasing of the A tracts. LastI?, by demonstrating that the transcriptional activities of Pl a.nd 1’2 protnot ers phasing. WI’ showed respond in parallel to A-t.rart. that DNA bending sequences provide a genrralizrci stimulator\- effect on transcript,ion.

2. Experimental Methods The hybrid promoters were derived from a modified la/ promoter, pwt (Qartenberg & Crothers, 1988), which was cleaved with Sty1 to replace the natural CAP binding site with oligonuleotide inserts containing 2 direct copies of the sequence A,TAGGCA,TAGGC. The position of’ the direct repeat within the insert was varied to alter the orientation of the DNA bend relative to polymerase bound at the Zac promoter (see Fig. 1 and Table 1). The recombinant plasmids were cloned. sequenced and isolated in preparative quantities by equilibrium centrifugation in C&l. Plasmid concentrations were estimated by comparison to ethidium-stained standards.

Superroiled plasmid was mixed with RXA polymerase (t,he latter kindly provided by Drs S. and I). Htraney; see the Figure legends for concentrations) in I5 111 of 50 rnM(pH 8.0). 10 rnM-MgCl,. 30 mm-Tris . HCI potassium glutamate. 0.2 m&T-dit,hiothreitol, 0-l mMEDTA, 1 mg bovine serum albumin/ml and %O units of RXAsin (Promega). Following 4 min at 37”(‘. 5 ~1 of abortive initiation assay mix was added and the rea,ctiott was incubated for an additional 30 min at 37°C. Abortive initiation assay mix is a combination of ribonurleotide. heparin. salt and buffer stock solutions premixed in a 10 : 10 : I : 4 (by vol.) ratio. Ribonucleotide stock solution contains 5 miwApA (Sigma). @125 mM-GpA (sigma), Wl mM-UTP (Pharmacia), 2 FCi of 3000 Ci [a-32P]UTP/mmol (Amersham), 75 mw-Tris . HCI (pH 80), 0.5 mm-dithiothreitol, 0.025 mM-EDTA. Heparin stock contains 1 mg heparin/ml (Invenex) in TE buffer (10 mM-Tris, 1 mM-EDTA, pH &O). Salt stock contains 0.25 M-Mgcl, and O+?Z M-potassium glutamate. Bud?{; 10 m#-Tris. HCI (pH 8.0) . conta.ins stock

Synthetic

DNA

1 mM-EDTA. For transcription from lac P2. a ribonucleotide mix containing 5 m&f-UpU (Sigma), 0.1 mM-CTP (Pharmacia) and 2 PCi of 3000 Ci [cc-32P]CTP/mmol (Amersham) was used. Abortive initiation reactions were quenched with 80% formamide/loading dye solution (Xew England Biolabs). Port’ions (15 ~1) of each reaction were loaded ont,o (w/v) polyacrylamide (acrylamide to bis. 8 M-UIW@O~~ 19 : 1, w/w) gels with non-standard TBE (90 miv-Tris. 180 mM-boric acid, 2 mM-EDTA). Empirically. it was found that this rlectrophoresis buffer provided resolution of the oligoribonucleotides produced in these experiments. Labelled molecules were detected by autoradiography and quantified by scintillation counting. (v) (‘alculation

of the relabiae rates of promoter

(3)

where P and R represent free promoter and RNA polymerasp. respectively, and ka and Zlc,,, represent, respectively. the rate constants of productive and counterproductive association when dissociation is negligible. Since the concentration of unbound polymerase is the same for all promoters in a given reaction mixture, we can combine eyns like (3) for the promoter of interest and the internal standard to obtain: (4) where ks is t,he rate constant of polymerase association to t,he internal standard promoter: P, and P, are. respectively. free lac promoter and the internal standard promoter. I’pon integration: In [ l’, 1= k;,, ln[P,] + constant or In(l-F,)=

k&.,ln(l--FE,),

(6)

where F’, and Fq correspond to the amount of abortive initiation from promoters a and s, respectively, after incubation at, a given polymerase concentration. Pu’ote that !‘, and pS are expressed as fractions of the limiting abortive initiation values reached when the polymerase (Loncentration is high. The constant k&,, the relative rate caonstant for frer promoter depletion, represents the ratio of rate constants (k,+CkJ/lc, (see the text). A double logarithmic plot of the fractions of unoccupied promoters, (1 - Fa) and (1 - ps), yields a line whose slope equals k;,,, (Brunnrr & Bujard. 1987). It is important to realize that because eqn (6) expresses the extents of reaction F= or Fs as fractions of their limiting values, any reaction that depletes free promoter contributes to k&,. even though the actual quant,ity measured is abortive initiation at Pl. This can be understood by recognizing that counterproductive reactions that occlude the promoter, reduce the plateau level of abortive transcription and, therefore. make the aJ)proach to saturation faster. (d) Restriction-protection

219

Sequences

which do not. “counter-productive” complexes, Complexes were formed in 100 mM-NaCl and 6 mM-MgCl,. After 4 min incubation at 37°C. 3 ~1 of restriction-protection assay mix was added to the react,ion. The mix contains 50 units of both EcoRI and MspI (New England Biolabs), 15 units of the Klenow fragment of DNA polymerase I (Xew England Biolabs). @6 rnM of dCTP. dGTP (Pharmacia), 3000 Ci 20 PCi of and TTP [r-32P]dATP/mmol, and enough TE buffer to bring the tot,al volume to 50 ~1. After 15 min incubation, the reaction was quenched with 15 ~1 of SOqb formamide/loading dye solution. Reaction products were separated by electrophoresis in ST/, native polyacrglamidr gels (acrylamide t,o bis 29 : 1, w/w). (e) KMnO,

depletion

These experiments were done by measuring abortive init’iation for Pl -specific transcripts as a function of polymerase concentration, with an internal standard reflecting the activity of a standard promoter. Interpretation of the raw data relies on the 2nd order rate equation:

-4 PIP = (/c,+~k,,)[RI[Pl>

Bending

assay

This is the assay used to distinguish polymerases bound at PI or P2. which block restriction digestion, from the

footprinting

The modification protocol is based on procedures described by the Gralla laboratory (Sasse-Dwight & Gralla, 1989; Meiklejohn & Gralla. 1989: *J. D. Gralla, personal communication). The concentration of supercoiled plasmid and added RPU’A polymrrase in each reaction was Il.3 nM and 010 PM. respectively. Complexes were formed in 17.5 ~1 as described for Figure 2 (without RXAsin). After 4 min incubation, plasmid was modified with 2.5 ~1 of freshly prepared @lo .v-KMnO,. After 5 min incubation at 37”C, the reaction was quenched with 1.5 ~1 of /?-mercaptoethanol. The sample was diluted to 45 ~1 with TE buffer and extracted with phenol/chloroform, and the aqueous layer was passed through a G-25 spin column and chased with 45 ~1 of TE buffer. Modifications were identified by primer extension following the Promega Bioter sequencing protocol, Modified plasmid was denatured with NaOH and precipitated. After resuspension, a specific- primer, complementing the Zac promoter template strand and priming from wild-type posit,ion -99. was annealed. Klenow fragment and nucleotide mix were added. Xucleotide mix contains 2 mM-dCTP. TTP, 7-deaza-dGTP (BoehringerMannheim), 5 PCi of 3000 Ci [ r-32P]dATP/mmol. Reactions were quenched IO mM-MgCl,, 50 mM-Nu‘aC11. with 80T0 formamide/loading dye solution and products were separated by elertrophoresis in 7 M-rlrea/8°,b polyacrylamide gels.

3. Results (a) lac promoter deriaatiws with .sequence-directed hends Tncorporation of unique restriction sites flanking the CAP binding site in the lac promoter (Gartenberg & Crothers, 1988) permits convenient replacement of the wild-type sequence with A t’ract,mediated bends. Four phased A tracts were added to each derivative, providing an overall bend estimated at 72” (Koo et al., 1990) at 22°C. The results presented by Levene et aZ. (1986) indicate that in the presence of Mg2+ the extent of bending is not strongly affected by increasing temperature in the range of 10 to 33”C, implying that the bend angle measured by Koo et al. (1990) is a reasonable guide to the bend expected in linear fragments at the temperature (37°C) at which transcription was measured. The influence of superhelicity on DNA bending is unknown. Our hybrid promot,ers differ in the position of t’he A tracts relat’ivc to the start site

/

/ sty1

site

/

site

I Figure 1. Schematic diagram of the hybrid promoter. The - 10 and - 35 regions are depicted with open boxes and the transcription start site is marked with a filled arrow. The P2 -10 is marked with a cross-hatched box and the corresponding transcription start site is marked with an open arrow. The position of the direct repeat within the insert was varied to alter the orientation of the DNA bend relative to bound polymerase; this feature is illustrated with a screw thread. Two constructs, 180” out-of-phase with one another, are shown here, the 1st with a continuous line and the 2nd with a broken line. E. coli RTU’A polymerase is represented by a stippled ellipse. of transcription; therefore, the three-dimensional configuration of the polymerase-bound promoters varies with the spacing between the two loci. Figure 1 illustrates the elements of the hybrid promoters

Sequence of the modijied

and Table 1 provides the sequences of the A-t,ract, inserts. Construct APO is noteworthy, since its A tracts are positioned to bend the promoter in nearly the same relative direction as both the original

Table 1 lac promoter and A-tract

Y Q

B -SO

f

Pwt 15

AP-2 APO

APt2 APt4

Apt6

.

-60

*

2

-50

*

-40

rh -30

CATGGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACGGTACC y *

t

*

;=

CATGGGCAGATGGAATCATCGAACTCGAAGACTAGTTGTTGCAACATGTGCACC * * * * CATGGGCAGACBBBBBBTAGGCAUUTAGGC~TAGGCAMUTGACC l l * * CATGGGCAGCgBBBBBTAGGC&$&ATAGGCIiAUMTAGGC~TGGCACC t * * * CATGGGCBBBBBBTAGGCBBBBBTAGGCBBBBBBTAGGCBCC l f * * CATGGC~TAGGC~TAGGCAM&iiATAGGCBBTGTGCACC l t * * CATGC~TAGGC~TAKX~TAGGC~TGACATGTGCACC * * * *

Apt7

CATGCgeBBBBTAGGC~TAGGCAUUATAGGCAWiATGCAACATGTGCAC * t l t

Apt10

CATGC~TAGGCBTAGGCAAAAAATAGGCAMAATGACCCTAGTGTGCACC . l * f CATGCgBBBBBTAGGCA&&&TAGGCBBBBBBTAGGCWTGG!ZACCCTAGTGTGCACC * l * t

Apt12

2 k

-20

-10

GCGCAACGCAATTAATGTGAGTTA@i+ATTAGGCACdc3+j*++; l * * * l

CTL

-70

inserts

CATGC~TAGGC~TAGGC~TAGGCf$&ATGTTGlTGCAACATGTGCACC * * * AL'+21 CATGC~TAGGCgaBBBTAGGC~TAGGCBBB APt14

l

I ;;:

"a 3

I z

+1

Synthetic DNA Bending Sequences CAP-DNA complex (Zinkel & Crothers, 1987; Gartenberg & Crothers, 1988) and the A tracts of strong phage promoters (Deuschle et aZ., 1986). The natural -35 region of the overlapping lac P2 promoter was replaced with foreign DNA in all constructs. (b) Relative ~ran~cr~~~iona~activity and A-tract positioning To test t,he influence of A tracts on transcription, we compared the activity of each hybrid promoter to the activity of an internal standard, the /I-lactamase (AMP’) promoter that resides on the same plasmid. Transcriptional activity, defined here as the level of funrtional open complex at Pl or P2 (each of which contributes to the productive complex category in eqn (1)) which is formed at a given polymerase concentration, was measured using the abortive initiation assay (Borowiec & Gralla, 1985). In this process, RNA polymerase cycles repeatedly through the synthesis of short oligoribonucleotides, usually less than nine or ten residues in length, without releasing the promoter. The level of abortive transcript that accumulates in a set time is directly proportional to the amount of open complex formed. For relatively weak promoters, such as lac and its derivatives, formation of the open complex, so-called because of the separation of DNA strands, is thought to be ratelimiting: the hierarchy of in vitro initiation frequencies approximates the ranking of open complex formation rates (McClure, 1980). For t,he glnAp2 and I,8 : UV5 promoters (Sasse-Dwight & Gralla, 1988, 1989), open complex formation is rate-limiting in vivo. Portions of a given supercoiled plasmid were mixed with a given polymerase concentration; transcription from linear fragments was too weak to detect. After a set time, further association was quenched by the addition of heparin, which seques-

221

ters unbound polymerase. Ribonucleotides were added simultaneously and the reaction mixture was incubated for an additional time for the production of abortive transcripts. In this experiment, we examined open complexes formed at 1a.c Pl; as shown below, lac P2 open complexes can be examined in an analogous fashion. To prevent elongation and ensure accurate initiation at, the + 1 site of the Zac PI promoter, only [c+~~P]UTI and ApA were provided, resulting in synthesis of radiolabelled ApApU and ApApUpU exclusively. Zac repressor strongly inhibits the synthesis of ApApUpU, demonstrating that the transcript is highly specific for the lac promoter (data not shown). The ribonucleotide mixture was supplemented with dinucleotide GpA to form radiolabelled GpApU from the #I-lactamase initiation sequence. The three oligoribonucleotides were resolved by electrophoresis in denaturing polyacrylamide gels. Note that the tetramer electrophoreses more rapidly than the trimers (Borowiec & Gralla, 1985). The results, presented in Figure 2 and again in Figure 3, clearly demonstrate a substantial sinusoidal variation in transcriptional activity with a ten base-pair period, corresponding to t,he phasing of A tracts with the helical repeat of DiKA. Constructs APO, AP+2, AP+lO and AP+12, which bend the promoter in roughly the same direction as the wild-type CAP-DNA complex, support the highest level of transcription. Minimum transcription was obtained with construct AP + 6, where the bend is 180” out-of-phase. The effect appears to be localized; transcriptional activity persists to spacer construct AP+21, but not beyond (data not shown). Although we used constructs with four phased A tracts in a majority of our experiments, we found that three A tracts assure the same transcriptional activity, two A tracts provide a decreased stimulatory effect, and one A tract provides a severely diminished but measurable signal (data not shown).

Figure 2. Relative transcriptional activity of hybrid constructs. GpApU is specific to B-lac and ApApUpU is specific to luc Pl. The supercoiled plmmid concentration was 0075 nM and that of added RNA polymerase was 67 nM. Promoter constructs are identified in Table 1.

222

21

:M. I?. (:artPnbrrg

-7

I.5 /

Spacer

0.9

length (bp)

Figure 3. Phase-dependent transcriptional properties of the hybrid promoters plotted against relative A-tract position. The 3’ adenosine of the promoter proximal A tract in APO is assigned to position 0. Relative transcriptional activity (0) is defined as the level of productive complex of hybrid promoter relative to the productive c*omplex of /I-lat. k;,, (*) is the rate constant of free promoter depletion of hybrid promoter relative to the rate caonstant of free promoter depletion of /&lat. Transcript ratio (0) corresponds to the level of hybrid promoter transcript relative to p-lar transcript at large excess of polymerase (concn - 30 nM). Maximal promoter occupa.nq (A) is the fraction of promoter uncleaved by Ms~I when saturated with polymerase.

and

D. M.

1984). Figure 4 shows that many of the promoters ykld significant levels of ubortivc> transcaript demonst.rating that. P2 is still ac:tivc*. Wikingly. thr fluctuations in P2 activity parallel thta activity data for 1’1 _ indicating that thr stimulatory c:fl&t of’ A track on transcbript’ion is generalized. antI not limit,ed to th(> 1’1 promoter. P% is displacoed from PI by 22 base-pairs, just over two t,urris of a /I-form double helix, and therefore forms a similar t hr(h+ dimensional structure when bound by polymcrascb. Tn addition, the correlated variat’ion in polymerase activit~y at PI and P2 indicates that competition with P2 is not responsible for the phase-dependent variation in PI activity. Experimental results concerning A-tract stimulat.iorl of P2 must he interpreted with caut,ion, hecause the DIVA sequence of each P2 -36 region is different due to the variable positioning of t,hr A tracts in each construct. Sequence changes in this region may modulate binding and activity of polymerase at 1’2. The natural sequence in lac: is far from chonsensus and thus inherently difficult to disable, Furthermore. several investigat’ors have identified functional - 35 regions t,hat deviate vastly from the consensus, thus reducing the cAredibility of ac+ivit,y predictions based on primary sequences alone (Horwitx & I,orh, 1988: ,Jac:quet. et al., 1989). (d) Relatiw

activity

parallels

PI

The activity of the P2 promoter was tested with the abortive initiation assay; initiation at the P2 start sit’e was detected with [E-~~P]CTP and IrpU, which form UpUpC and IJpUpCpC. CAP-cAMP inhibits the synthesis of UpUpCpC completely from t,he wild-type lac promoter, demonstrating that this t.ranscript is highly specific to P2 (Malan & McClure.

ratrs

of free

prom&r

depletiofi

Thr total rate constant for depletion of free promokr, kffpd. reflects a sum of react.ion rate constant,s for formation of productive kanscriptional complexes added to the rate constant for production

(c) 1’8 profmoter

(‘rother.v

of

the

occluding

counter-E)roductive

(1). complexes. as shown in reaction schm1r Promoters that bind polymerase with the highest forward rate constant compete most effectively for the enzyme when dissociat,ion is negtigible, as it, is under our conditions (data not shown). Thus, the relative rat’rs of free promoter depletion may be derived from competitive binding assays in which each plasmid, cont)aining both hybrid and internal standard promoters. is exposed to limiting quantities of polymrrase.

Figure 4. Transcriptional activity of lac P2. Supercoiled plasmid concentration was 0.075 nM and that of added polymerase was 6.7 nM. Zac (pwt) bound by CAP-CAMP and pGEM-2 were included as controls to demonstrate that L:pIJpCpC is specific to lac P2; without CAMP. lac P2 is active.

223

Synthetic DNA Bending Sequences Free promoter depletion is measured by the concomitant increase in open complex as measured by abortive initiation. However, the relationship between the two events is not stoichiometric because counter-productive binding also consumes free promoter, and some polymerase binds at P2. We deal with this problem by expressing the extents of reaction in terms of the fraction F= or F, of the values of abortive initiation that can be achieved at high concentrations of polymerase. It is a consequence of this approach (see Experimental Methods) that the measured rate constant for free promoter depletion reflects the sum of all reaction pathways that make the promoter unavailable for furt.her open complex formation at Pl. The relative rate constant of free promoter depletion, k&,. is expressed as:

(2)

&id = Pa + =k*)/k

where Ic, and XL,,, represent, respectively, the rate constants of productive and counter-productive complex formation at the hybrid promoter, and Ic, is the rate constant of polymerase association at the internal standard promoter. For lac, we define Ic, as the sum of the open complex formation rate constants for the overlapping and mutually exclusive polymerase binding sites PI and P2; the kinetic constants for occupany of Pl and P2 are grouped together because both block restriction digestion of the lac promoter, and are indistinguishable in the promoter occupancy assay described below. Figure 5 shows the results of two representative titrations; t,he level of abortive transcript increases to a maximum for both hybrid promot’ers and internal standard as the concentration of RNA polymerase rises. The transcriptional response to polymerase titration is initially steeper for APO than for AP+6. indicating that the former promot,er depletes more rapidly than the latter. The relative rate constant of free promoter depletion, may be obtained from the slope of a double k;,, 1 logarithmic plot of the fractions of unoccupied promoters at polymerase concentrations below saturation (Brunner & Bujard, 1987); see Figure 5(c). Hybrid promoters AP--2 through AP+6 were examined in bhis fashion and the relative rate constants appear to vary sinusoidally in parallel with the simple transcription assays described above (see Table 2 and Fig. 3). (The relative rates of additional spacer constructs must be tested to validate true sinusoidal behaviour in the depletion

kinetics.) The range of promoter depletion rate constants, however, only spans a factor of slightly less than 2. The analysis t’hat we present below shows that k;,, varies with phasing substantially less than does kH, because ki is added to a constant (phase-independent) contribution IU$,, to yield k;,,.

fe) Maknal

promoter occupancy

Upon close inspection, the gels in Figure 5 reveal another important feature: for the highest concentrat,ions of polymerase, the ratio of the Pl transcript to internal control transcript varies in a phase-dependent manner that matches the pattern of free promoter depletion (see lane 11 of Fig. 5(a)). Under conditions of large excess of polymerase. differences in the level of transcription reflect variations in maximal promoter occupancy. For the promoters examined, the range of transcript ratios spans a factor of 3, indicating that there is a signiticant phase-dependence in the maximal extent of promoter occupancy. In an in vitro transcription system with purified component)s, variation in maximal promoter OCCIIpanty may be achieved only through polvmerasemediated promoter occlusion; when dissociation is negligible. occluding polymerase binding sites reduce occupancy by mutually exclusive compet,itive association. Since Pl and P2 promoter activities vary in parallel with the phase of the inserted bending sequences, occlusion is not a consequence of P2-Pl competition. Therefore, maximal promoter occupancy must be related directly to the relative rates of productive and counter-productive complex formation, and we can express the maximal promoter occupancy in terms of the relatives rates of productive and c~ounter-produc,t,iv~~ events. or: Maximal

promoter

occupancy z MPO = k,/(ka+Ek,,,).

(3)

To distinguish between productive and counterproductive polymerase complexes. we mapped the structural occupancy of the hybrid promoters at vast excess of polymerase with a restriction-protection assay (Brunner & Bujard, 1987). Fortuitously. the lrcc promoter contains an MspI site located at posit,ion - 19; binding of polymerase to PI or P2 inhibits cleavage by the restriction endonucleasr. Success of the experiment required that counterproductive binding events do not protect) the JZspT binding site as well. Supercoiled plasmid was prebound t),y polymerase

Table 2 Characteristics of the hybrid promoters Chnstruct %ti Maximal

promoter occupancy

AP-2

APO

AP+2

AP+4

APc6

OR7

0%

0.72

0.59

0.49

02.5

w45

0.38

0.06

@O-T

AP+7

AP+lO

@I2

0.41

AP+ 12

0.44

AP+21

0.53

224

M. El. G’artrnberg

and D. M. C.‘rothers

APO

GPAPU APAPU

APAPUPU

3

4

5

6

7

8

9

10

11

(a)

0.8

0.2

0

0.2

0.4 0.6 -1n il-Fs,

0.0

I

(b)

Figure 5. Relative rate constants of free promoter depletion. (a) Polymerase titrations of competing promoters under conditions where dissociation is negligible. APO versus b-lac in the top gel and AP+6 versus p-lac in the bottom gel. Supercoiled plasmid concentration was 054 nM and that of added RNA polymerase was 267 nM in lane 11; polymerase concentration diminishes by factors of 3 in each lane preceding. Extremely high concentrations of polymerase are needed to saturate the Zac promoter derivatives, indicating that a substantial portion of the polymerase is adsorbed to non-specific sites (e.g. walls of the reaction vessel or non-Zac portions of the plasmid) and/or the polymerase preparation is only fractionally active. (b) Double logarithmic plot of the fraction of unoccupied promoters for polymerase concentrations below saturating levels. The slope equals the relative rate constants of free promoter depletion, k;,,. (0) k&, for APO; (A) k;,, for AP +“s.

Synthetic DNA Bending Sequences

225

Uncut promoter

Plasmid fragment f

Promoter fragment

82 bp promoter fragment

Figure 6. Restriction-protection assay for promoter occupancy. Slowest and fastest-migrating species correspond to the full promoter and 82 base-pair (bp) promoter fragment, respectively. The length of the full promoter fragments varies between 218 and 235 base-pairs to accommodate variable A-tract positioning. All fragments containing the phased A tracts migrate anomalously slowly as expected for substantially bent DNA molecules. Subtle changes in DNA length are not sufficient to explain the phase-dependent variation in mobility. Fragments migrating with intermediate velocity correspond to the remaining portion of the cleaved promoter and a 200 base-pair plasmid-derived fragment. For hybrids AP + 10, AP + 12 and AP + 21, these two fragments corn&ate. The concentration of supercoiled plasmid and added RNA polymerase in each reaction was 054 nM and 267 nM, respectively. and, after a specified time, a mixture of MspI and EcoRI was added. The former enzyme probes the accessibility of the MspI site, while the latter frees the lac promoter fragments from the plasmid for examination by polyacrylamide gel electrophoresis. The

Klenow

fragment

of DNA

polymerase

I and

[ol-32F’]dATP were added simultaneously with the endonucleases to post-label the EcoRI ends of the cleaved promoter fragments for the purpose of selective detection. Maximal promoter occupancy (MPO) was calculated from the ratio of uncleaved promoter, Puncut, to total promoter (PU,,,t + )). (The amount of the 82 base-pair promoter wcut82 fragment, Pcu,82, is doubled to normalize for the number of remaining 32P-labelled ends.) The slowest migrating species in Figure 6 corresponds to full-length promoter. The fastest moving species corresponds to the 82 base-pair promoter fragment, and molecules migrating with intermediate velocity represent the remaining portion of the cleaved promoter and a plasmid-derived fragment. The MspI site of some hybrid promoters is more accessible than others, supporting the earlier conclusion that the hybrid promoters saturate to different levels, even with a large excess of polymerase. The sinusoidal pattern of restriction protection parallels the pattern of maximal promoter occupancy and free promoter depletion determined by the abortive initiation assays (see Table 2 and Fig. 3). Furthermore, the correlated variation confirms that the differences in maximal promoter occupancy observed with the abortive initiation

assays are not due to mutually exclusive binding events at Pl and P2. Reznikoff and co-workers have demonstrated that competitive binding between Pl and P2 occurs only at high occupancy (Peterson & Reznikoff, 1985; Yu & Reznikoff, 1985). Expressions for the relative rates of productive (k:) and counter-productive (Ck!,,) complex formation are obtained by combining equations (2) and (3): kb = Ic,lk = (&,,)WPO), Cl& = &&,,/ks = (/&,)(l

(4)

-MPO).

(5)

With the numerical data provided in Table 2, these relationships reveal that the relative rates of productive

complex

formation

for hybrid

promoters

AP- 2 through AP+6 vary by about an order of magnitude, while the rate constants of counterproductive complex formation remain relatively unchanged (see Table 3). Clearly, the primary role of the A tracts in transcriptional stimulation is rate enhancement for formation of productive complex Table 3 Rate constants of productive and counter-productive complex formation Construct kh w,

AP-2 0.14 0.43

APO

AP+2

AP+4

0.39 0.47

0.27 045

0.04 0.55

APf6 0.03 046

b

-33

D

-11

CTL

D

5’-A

b

-33

-33

b

S-A

D

D

-11

b

-11

b

Y-A

D

-33

D

-11

AP+7

D

S-A

b

-33

AP+ 10

Figure 7. KMnO, footprints of E. roli RlYA polymerase OH thr hybrid promoters. Both protein-bound and unbound sptv’irs are shown. Position -- 1 1 of the PI - 10 ~g:l,,r, -33 of t2hr P%- 10 region and t’he 5’ end of the proximal A tract are marked wit’h arrows. Filled arrows c~~rrc~spond to a high degree. of pol~mrrasc~-tl~~~~~~r~~~~~r~t position tnodifiratior~. Empty arrows correspond to subtle or no Flol~ltlerase-deprrrtfrrlt modificat~ion. Son-sI)e
D

-33

b

-11

i5

Synthetic

DNA

and P2). complexes at Pl (i.e. open Counter-product#ive association rates are relatively insensitive to bend orientation. Attempts to measure the absolute rates of open complex formation were unsuccessful. At vast excess of polymerase, open complex formation should follow pseudo-first order kinetics; however, the reaction time-course, monitored with abortive initiation, is best fit with at least two exponentials, indicating multiple pathways for promoter depletion (data not shown). This behaviour may reflect slow dissociation of polymerase from the counterproductive complex followed by replacement wit,h productively bound polymerase. Likewise, attempts to measure kinetic parameters associated with the multiple steps leading to open complex format,ion were also unsuccessful; isomerization from polymerase bound in the closed complex to functional open complex occurs more rapidly than the detection limit of our assays (rate constant > I/l 5 s- i). Furthermore, the linearity of double logarithmic plots such as that in Figure 5(b) indicates that we have no evidence for any kinetic complexity that, deviates from the simple bimolecular rate law, equation (3), on which the analysis is based. The simplest assumption consistent with these findings is that the rate constant ka reflects the product of the initial binding constant h’, for forming closed complex multiplied by the isomerizat’ion rat’e constant k, for forming open complex in the standard model for transcription initiation. Consequently, we are unable to determine whether I$, is modulated by A tracts because they affect K, or k,, or both. (f’) In,trinsic

DXA

bending

in the lac promoter

Intrinsic curvature of the Eat promoter, originally detected by Zinkel & Crothers (1987). is demonstrated in Figure 6. There is an appreciable sinusoidal variation, with an approximately ten basepair period, in mobility of the hybrid promoter fragments as the spacing is varied between the A tracts and the rest of the molecule. Interestingly, maximal occupancy hybrids APO, AP+ 10 and AP+21 contain A tracts that add constructively to the intrinsic promoter bend, as evidenced by maximal mobility retardation. The correlated phasing of these sequence-directed bends and the former CAP-induced bend implies that binding of C!AP to wild-type Zac amplifies intrinsic promoter curvature. Furthermore, since CAP and RNA polymerase bind to the same face of the DNA helix, these results imply that the intrinsic bend of the promoter is designed to curve around the incoming polymerase. (g) Footprint&g

with KMnO,

To further elucidate binding events at the hybrid promoters, we mapped specifically bound polymerases with KMnO,, a reagent that oxidizes structurally distorted or unpaired pyrimidine bases (Hayatsu & l!t.ika, 1967; Fritzsche et al., 1987;

Bending

227

Sequences

Borowiec et al., 1987; Sasse-Dwight & Gralla, 1989). Modifications in supercoiled plasmids were detected indirectly by primer extension with the Klenow fragment of DNA polymerase I. which t,erminates directly opposite oxidized residues or one base before if the residues are modified during denaturation with alkali (Ide et uE., 1985; Clark & Beardsley. 1987). Gralla and co-workers have found that T and C nucleotides between - 11 and + 4 of the wild-type Zuc promoter become hyper-oxidizable upon strand separation by open complex formation in vitro (Sasse- Dwight & Gralla, 1989). Figure 7 shows primer extension ladders of promot,ers modified by KMnO,. The degree of polymerase-dependent. modification at sites marked with arrows corresponds well with the activity determined by abortive initiation assays (filled arrows correspond to a high degree of modification and open arrows correspond to a low degree or no modification). A control construct, CTL, supports transcription exclusively from P2 (data not shown) and is extemely reactive at position -83 of the P2 - 10 region when bound by polymerase. Similarly. i5 supports t’ranscription exclusively from Pl (Straney et ul., 1989) and is more reactive at position - 11 of the Pl - 10 region when bound by polymerase. AP+6 and AP+7: which barely support transcription from either polymerase binding site. are relatively unreactive at both - 10 regions in the presence and absence of polymerase. Most striking, a new hypersensitive site appears in these phasing constructs at the 5’ end of the proximal A tract, probably representing the association of polymerase to t#he putative occluding binding site. The relatively strong promoters APO and AP + 10 display mild enhancement of reactivity a,t this position when bound by polymerase, suggesting that the occupancy of this site may be modulat,ed by competition with A tract-mediated association t,o Pl and P2; bot,h prornoters display hvpersensitivitv at both Pl and P2. Subtle differences-in the reactivitv of the - 10 regions within each hybrid may be iniuenced by promoter occlusion, sequence changes in the -35 region of P2 and/or the dire&on of I)NA bending.

4. Discussion (a) Effects of A tracts on trunscriptiorr promoter occupancy

un,d

We have measured the rate of free promoter depletion. and have combined these data with a restriction digestion assay that distinguishes occupancy of the luc promoter from a competing occlusion event that does not block restriction digestion internal to the promoter. These results enable us to track the dependence of two rate constants, kH and =kHt,> on the phase of bent DNA sequences inserted in place of the CAP site on the Zuc promoter. Under t,he conditions of our assay, the “productive” complexes. which are those that protect the luc

promot,er and whose relative rate of’ formatiotl is measured by ki, should consist largely- of t.he open complexes at I’1 and IV. \\‘r showrtl with abortive initiatjion assays tha,t the separate rates of’ ofwrr caomplex formation at PI and I’:! show a parallel phase-dependence. From the permanganatr footprinting data, we infer that the “c:ounter-protlu(,tiv~, complexes”. whose relat:ive ratt> of formation is measured by Cki,,. COnSiSt of pOlymeraH? kJOUfld 10 the A tracts inserted adjacent, to the Inc promoter. The substant~ial sinusoidal variation in the relative rate constant kH for productive complex formation provides the most convincing evidence that. IlKA bending modulat.es t,ranscription initialt ion at the Inc promot,er. These I)NA sequences arti likely to he generalized transcription stimulators. since t,hey increase the activit,y of hoth 1’1 and 1’2 l)romoters. Tt is particula,rly striking that the c*onstructs that yield optimal association ratrl constants bend the promoter in t,ht, same relative> direction as the former (!AP--l)NA c*omplex and thr A tracts of strong phage promoters. That) this rffec+ rclsult’s from I)NA bending and not sec~nence-sF)cc:i~(, recqnition of some element in the A-tract rrgion is support’ed by t)he observation that, phased T tracts also stimulate transcription in a f)osition-tiependellt manner (dat.a not shown). Rut: and c-o-workers found earlier that A4 tract-mediated bends f’utI(.tionally replace the (‘AT’~I)NA complex in the ~101 promot’er irr GW (13racc:o et al., 1989). but the st,imulatory effect did not occur i?l citro and t>hus the? were unable to examine in more detail the sour(ae of A-t,ract stimulation. In addition to open complex formation rate r~lhanc~emcnt. the A tracts appear to participate in polymerase-mediated promoter occlusion. which caan ac,count for more than 90°0 of promoter occupancy in constru& in which t’htl activating A tracts art’ out of phase. Maxima.1 promoter occupants. rtflect,cd in the absortive init,iation transcript rat10 and quantified with restriction protection at large polymerase excess. varies sinusoidally, in phase with the variation in relative rate constants of open complex formation. The results cannot be attrihutrd to mut,uall; exclusive PI and P:! binding flvrnts. hecause t,hr activity of P2 parallels that of PI. Rat,hrr. t,he results indicate that’ an additional c*omprtitive polymerase binding event, reduces the occupancy of both natural polymerase binding sites. KYlnO, footprints corroborate this interpretation: the, 5’ end of the proximal A tract. becomes hyperreactive with the addition of polymerasc in c*onstructs that t,ranscribe from neither Pl nor I’2 efficiently. Tn support of this observation, Collis et 01. (1989) found that E. coEi RNA polymerase binds to and transcribes from A-tract DTL’A in viz?o. Our experiments show t,hat the occupancy of the competing polymerase binding sit,e is modulated by kinetic competition with the Zuc promot,er for polymerase; unlike A tract-mediated open complex fijrmation. the relative rate of forming the counterproductive complex is invariant, to the direction of IjS.4 bending.

(1)) .bfwhc~.n.ism of trcirbsc7@ion

sti~mdntiori

hy

br n f II x A

Our results show t,hat, three or f’our repeats of A-tract sequences, placed in such a phase that the! (‘ause DNA to bend around polymerase in t,hrt same direction at the (IAT’--l)NA complex that they replace, increase by about an order Of magnitude t)he rate of open complex formation at the PI + 1’2 promoters in superhelical templates, relative to constructs in which the DXA seyuences bed in the opposite direction. The results do not rigorously prove t,hat, I)NA curvature is the causative rffect for activation. but, it, is diffcult to find a plausible alt’ernativr interpretation. Since our tlxperiments refer to a purified in r:itro system. proteins other than R,SA polymerase cannot be responsibl(1. If an RKA polymerase bound t,o the A tra(:ts fac4litatrd binding of a second at the lac promoter. thr> simple> bimolecular rate law. equation (3). would not hold, and plots such as Figure 5(h) would not IJC linear. Binding does occur to the A-t)ract sequences, but) t)hr occlusion of’ the consequen(~p is competitive ot’ our promoter. not activation. Tn the remainder comments. we assume that .A tract-directed I)NA is responsible for activation of the /at bending promot,er. and seek a plausible mechanism by whic*h the actib.ating influence can he exf:rtetl. An attractive model proposed by Kuc: (1986) for the mechanism of activation suggests that bending enhancaes the favourahle wrapping of ONA around the back of the poly,merase. wht,re favourahle I)N.&protrin int,eractt.lons may occur. In this regard. it may ~JP significtant, that the 1~ promoter is intrinsically bent) toward the incoming poiyrneras~~. The influence of additional pol~ymerase contacts may be wflwbetl in thcb spatial localization 01’ A-tract stimulation; only properly phased A t ract,s within 2 I base-pairs of APO increase t.ranscriptional activity. ~~:lcAllister B Ac.hberger (I 9X9) fa.vour a similar wrapping model for their irr ~iuo ad in vitro observations on the phage SP82 Alu 156 promoter. A uniform model for the effect of bending would require favourahle upstream t,hat. analogous DNA-polyrnerase con&c& 1~ grncratetl hy (‘Al’ binding in the wild-type ternary complex. Howcbver. in contradiction. Stranry et rcl. (I 989) fi)untl t,hat removal of l)?iA up&earn from t)ht> (!A I’ binding site did not reduce (‘AI’-dependent transc4ption stimulation on linear promoters. On the other hand. Gaston it nl. (1990) provided further cJvidcnc.c: for I)NA bend-mediated (*ontact by showing t.hwt t 11~ (!AP footprint extends approximateI>tcan ljasrpairs on the upstream side when RNA polymr~rasc: is added to the yal Pl or synthetic (‘AI-‘-tlepentlrrrt mal R promoters. Tn some caases. t,he upstream contacts result,ing from bending c:ould tW IOt'iLtt'd downstream from the CAf’ sit.e. For tlxample. Rusbg et al. (1987) have identified & promot~er ul) mutations that introduce A tracts an<1 afford greater protein-DSA contact in the a~bst:~lc~~of -50, between the (‘Al’ and CAP, near position polymerase binding sites.

Synthetic DNA Bending Sequences

Figure 8. Model for A tract-directed positioning of polymerase in a super-helical domain. The intrinsic curvature of A tracts (A, and A6) favours their placement in the region of high DPU’A curvature at the end of an interwound superhelical domain. When the A tracts are properly phased relative to the promoter, the result is a structure in which DNA winds around polymerase, as shown schematically. It is proposed that this structure favours transcription initiation.

We suspect that there are important differences in the mechanism of transcription activation by DNA bends depending on whether the DNA is superhelical. It is possible that direct CAP-polymerase contacts dominate CAP-dependent stimulation on non-superhelical promoters, and that DNA bending plays an additional role in suerhelical templates. In agreement with this idea, we found that transcription from A tract-containing linear lac promoter fragments was too weak to detect, in contrast to the observations when the promoter is contained within a superhelical plasmid. However, the results presented by McAllister & Achberger (1989), who found A tract-dependent effects in linear promoters, sound a cautionary note. Clearly, a fully satisfactory unifying model remains elusive. There are logical reasons to expect that the influence of DNA bending on regulatory processes may be modulated by DNA superhelicity. Specifically, supercoiling and bending may synergistically enhance polymerase contacts by creating a defined DNA topology at the promoter site, a view also put forward by Zinkel & Crothers (1991) to explain the role of CAP-induced DNA bending in transcription activation. Examples of this interconnection include the observation by Meikeljohn $ Gralla (1989) that strengthening the Zuc promoter. either by changes in sequence or degree of supercoiling, diminishes the stimulatory potential of CAP. Figure 8 illustrates our model. We adopt the view

229

of Laundon & Griffith (1988); namely, that DNA bends localize to the ends of superhelical closedcircular molecules where large energy costs are already incurred to fold DNA back upon itself. Our hybrid promoters are likely to assume similar positions, thus coupling the intrinsic bend with supercoiling-induced curvature. RNA polymerase, represented by the ellipse, binds to the interior of a right-handed superhelical turn of DNA, represented by a ribbon. The phase of the intrinsically bent sequences determines the relative orientation of the promoter within the superhelix. According to this model, DNA superhelicity should enhance the activation effect of bending sequences. since both factors help to position the promoter at a locus in superhelical DNA that has the required DNA topology faor an active polymerase binding site. It remains an experimental challenge to distinguish this putative influence of DNA superhelical writhe from the generally acknowledged effects due to the tendency of t.orsional stress to decrease the helical twist and thereby open the promoter. This work was supported by grants GM34205 and GM21966 from t,he lu’ational Institutes of Health. We t,hank Drs David and Susan Straney for the gift of purified RiXA polymerase. References Blazy, H., Takahashi. M. & Baudras. A. (1980). ,VJol. Uiol. Rep. 6. 39-43. Borowiec. qJ. A. & &alla. *J. D. (1985). .I. &Jo!. Niol. 184, 587-598. Borowiec. tJ. A.. Zhang, L., Sasse-Dwight. S. & Gralla. ,J. D. (1987). J. Mol. Biol. 196. 101-I 11. Bossi, L. & Smith, D. M. (1984). Crll, 39. 643-652. Kracco. L.. Kotlarz, D., Kolb. A., Diekmann. S. & But. H. (1989). EMBO J. 8. 4289-4296. Brunner. M. & Bujard, H. (1987). EMBO J. 6. 3139-3144. But. H. (1986). Biochem. Sot. Trans. 14. 196-199. Busby, S.. Spassky. A. & Ghan. K. (1987). Gpnp, 57, 145-152. Clark, ,J. M. & Beardsley, G. P. (1987). Bioch~emistry, 26, .5398-5403. Collis. (1’. M., Molloy. P. L.. Both, G. W. & Drew, H. R. (1989). Nucl. Acids Res. 17, 9447-9468. Deuschle. c’., Kammerer. W.. Gentz. R,. & Hujard. H. (1986). EMBO .I. 5, 2987-2994. Fried, 41. G. c(r (‘rothers. D. M. (1983). St&. Acids RPS. 11. 141-15x. Fritzsche. E.. Hayatsu. H. Igloi, G. L.. Iada. S. & Kiissel. H. (1987). .Vucl. Acids RPS. 15. %17-,552t~ Galas, I). ,J., Eggert, M. bt Wat,erman. \I. S. (1985). .I. ,Vol. Biol. 186, 117VlP8. Gartenberg. M. R. & Crothers. I). 33. (1988). Xnture (London), 333, 824&829. Caston. K.. Bell. X.. Kolb, A.. But. H. & Busby. S. (1990). Cell, 62. 733-743. Goodman. S. D. & Eash. H, (1989). Safurr (London), 341. 251-254. Course. R. L., de Boer. H. A. & Xomura. $1. (1986). (‘rll, 44. 197-205. Hawley. D. K. & McClure. W. R. (1983). NW-~. Acids Res. 11, 2237-2255. Hayatsu. H. & I’tika. T. (1967). Hiochem. Hiophys. Rrs. Commun. 29. 556-561.

Hrumann. H.. Riwhetti. M. Hr LVerel. \1’. (l!NX). EX/N) J. 7. 4379~~4381 Horwitz. M. S. %. & I,oeh. I,. ,\. (198X). ,/. Rio/. (‘hrru 263, 147%4~14731.

.lacqurtj, Acids

M-A..

Ehrlich.

R. & IXeiss. (‘. (1989). ,Vucl.

Rrs. 17. 29X-2945.

Kolh. A.. Spassky. :I.. (:hapon. C.. Hlazy, f<. & f&u*. H. (1983). ,VucZ. Ads Res. 11. 78X-785,. Koo. H.-S.. \Yu. H.-M & Brothers. D. M. (1986). Snturu (Imdon) , 320. 50 I +X)6. Koo. H.-S.. Drak. tJ.. Rice, J. A. & (Yothrrs, I). M. (1990). Hioclxmistry, 29. 4227-4234. Kuhnkr. (>.. Fritz. H.-.I. & Ehring, R. (1987). EMHO ./. 6. fiO7-813. Larnond. A. I. 8LTrawrs. A. A. (1988). ~Vaturu (I,ondw~). 305, P48-~%50. Laundon. Cr. H. & Griffith, ,J. D. (1988). (‘~11,25, 545LS49. Lcwmr. S. I).. Wu. H.-M. & &others, I). M. (1986). Biochemistry,

25. 3988-3995.

I,iu-,lohnson, H.-N., Gartenberg, M. R. & Brothers. D. M. (19X6). Cell, 47, 995~1005. Malan. T. 1). 8: McC’lure. W. R. (1984). Cell, 39. 173S180. Mandwki, W. & (‘aruthers. M. H. (1984). Gene. 31, 26:s 267. Marini. .I. C’.. Levenr. S. D., G-others, D. M. & Englund. I’. E. (1982). Proc. Nut. Acnd. Sci., F.S.A. 79. 7664-7668.

McAllistrr. (‘. F. & Achberger. E. (:. (1988). .J. Hiol. Clrrm. 263, 11743&11749.

Edited

.Ilc~i-\llistr~r. C’. 1;. & Ac’hbrrgw~. E. ( ‘. (1!)89). ./. Biol. c ‘//wn/. 264. I0451 10456. M\ilrikeljohn. A. I,. h (iralla. .J. I). (l!N!)). J. Mol. /Cot. 207. 661 67X f’&rsou, hl. f,. K: Rrznikotf. u’. S. (1988). ,/. Xol. Ijiol. 185. 5% 545. I’inknry. M. & Hoggett. ,I. (:. (1988). Hiochun. ./. 250. X!)i

902.

Plaskon. IL. f1. & Wartell. R. M. (1987). Swl. &ids Kes. 15. ‘i&m 796. Sassr-ljwight. S. & &alla. ,J. I). (198X). Proc. A’nt. Amd. NC;.. I’.S.A. 85, 8934-8938. Saw-Dwight, 8. & &alla, ,I. D. (1989). J. Riol. (,‘hem. 264, 8074 -808 1. Stranry, I). S., Straney, S. 1%.bt Brothers. 1). M. ( 1989). J. Mol. Biol. 206. 41LFi7. IYarwic*ker. .I., Englernan. 13. I’. & Stritz. T. A. (1987). I’rokins.

2. ZSd89.

Wu. H.-M. & (Brothers. 1). M. (1984). Suture (London), 308, 509-51x Uu, X.-lf. & Reznikoff. W. S. (1985). Nucl. rtcirls &s. 13. 64Fi7P2468. Zinkel. S. S. & (Irothers. 1). M. (1987). iV&urr (London). 328. ISX-1x1. Zinkrl. S. S. & flrothers. 1). M. (1990). Biopolymers, 29. 29-38. Zinkel, S. S. & (brothers, T). M. (1991). J. Mol. Hiol. 219. %01~215.

by P. van Hipprl