- Email: [email protected]
Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
YFSIM3316_proof ■ 17 February 2015 ■ 1/8
Fish & Shellfish Immunology xxx (2015) 1e8
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Q4
Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes
Q3
M. Makesh a, b, *, Ponnerassery S. Sudheesh a, Kenneth D. Cain a a b
Q2
Department of Fish and Wildlife Sciences, College of Natural Resources, University of Idaho, Moscow, ID 83844-1136, USA Aquatic Environment and Health Management Division, Central Institute of Fisheries Education, Versova, Mumbai 400061, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 September 2014 Received in revised form 2 February 2015 Accepted 3 February 2015 Available online xxx
Teleosts possess three immunoglobulin (Ig) heavy chain isotypes viz., IgM, IgT and IgD and all three isotypes are reported in rainbow trout. The expression of these Ig isotypes in response to different immunization routes was investigated and results provide a better understanding of the role these Igs in different tissues. Rainbow trout (Oncorhynchus mykiss) were immunized with an attenuated Flavobacterium psychrophilum strain, 259-93-B.17 grown under iron limiting conditions, by intraperitoneal, anal intubation and immersion routes. Serum, gill mucus, skin mucus and intestinal mucus samples were collected at 0, 3, 7, 14, 28, 42 and 56 days post immunization by sacrificing four fish from each treatment group and the unimmunized control group, and the IgM levels were estimated by an enzyme linked immunosorbent assay (ELISA). In addition, blood, gill, skin and intestinal tissue samples were collected for Ig gene expression studies. The secretory IgM, IgD and IgT gene expression levels in these tissues were estimated by reverse transcription quantitative real time PCR (RT-qPCR). Levels of IgM in serum, gill and skin mucus increased significantly by 28 days after immunization in the intraperitoneally immunized group, while no significant increase in IgM level was observed in fish groups immunized by other routes. Secretory IgD and IgT expression levels were significantly upregulated in gills of fish immunized by the immersion route. Similarly, secretory IgT and IgD were upregulated in intestines of fish immunized by anal intubation route. The results confirm mucosal association of IgT and suggest that IgD may also be specialized in mucosal immunity and contribute to immediate protection to the fish at mucosal surfaces. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Rainbow trout Oncorhynchus mykiss Systemic and mucosal immune response IgM IgT IgD
1. Introduction Aquaculture of salmonid species is a high value fish production activity in Europe, North America, Chile, Japan, Australia and other parts of the world. Bacterial cold water disease (CWD) and rainbow trout fry syndrome (RTFS) caused by Flavobacterium psychrophilum are major diseases very often resulting in severe production and economic losses in salmonid aquaculture facilities, especially those producing rainbow trout Oncorhynchus mykiss (Walbaum), coho salmon Oncorhynchus kisutch (Walbaum) and steelhead [1,2]. Trout farming often suffers substantial economic loss due to problems
* Corresponding author. Aquatic Environment and Health Management Division, Central Institute of Fisheries Education, Versova, Mumbai 400061, India. Tel.: þ91 22 2636 1446; fax: þ91 22 2636 1573. E-mail address: [email protected] (M. Makesh).
associated with CWD epizootics including high mortality, increased susceptibility to other diseases, use of chemotherapeutants, high costs of treatment and skeletal deformities resulting in quality reduction in recovering fish [1]. Despite tremendous efforts, a vaccine to control CWD is yet to be approved and available. A major constraint to the development of an efficacious CWD vaccine is our inadequate understanding of the innate and adaptive immune responses of the host fish to the pathogen, especially at the mucosal surfaces. Immunoglobulins (Igs) comprised of heavy and light chain molecules, are the mediators of adaptive immunity in fish and other vertebrates. Mammals have five different heavy chain isotypes of Ig namely IgM, IgG, IgA, IgD and IgE each with distinct functions while teleosts were long considered to have only two Ig isotypes, IgM and IgD. Teleosts were thought to lack specialized mucosal antibodies equivalent to IgA of mammals. However, recent
http://dx.doi.org/10.1016/j.fsi.2015.02.003 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 2/8
2
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
discovery of other isotypes viz. IgT/IgZ [3,4] and IgM-IgZ chimera [5], the functions of which are not fully characterized, has thrown open the research to elucidate the role of these newly discovered Ig isotypes. IgM is the most ancient and the only isotype functionally conserved in all jawed vertebrates (reviewed by Flajnik [6]). Serum IgM, a pentamer in mammals, birds and cartilaginous fish, is secreted as a tetramer in teleosts [7] in response to infections. IgM is considered to protect the fish against pathogens both systemically and at mucosal surfaces [8]. Recent studies provide evidence that IgD is also a primordial antibody isotype present in all jawed vertebrates including elasmobranchs [9], acipenseriformes [10], and teleosts except birds [11] and some mammalian species. Among teleosts, IgD is reported in almost all species examined including channel catfish (Ictalurus punctatus) [12], Atlantic salmon (Salmo salar) [13], Atlantic cod (Gadus morhua) [14], Atlantic halibut (Hippoglossus hippoglossus) [15], Japanese flounder (Paralichthys olivaceus) [16], fugu (Takifugu rubripes) [17], grass carp (Ctenopharyngodon idella) [18], threespined stickleback (Gasterosteus aculeatus) [19,20], and rainbow trout (O. mykiss) [21]. IgD exists as multiple structural variants and splice forms exist in different vertebrates. Teleost IgD is characterized by long chimeric molecules consisting of repeated domains compared to shorter hinge containing molecules in mammals [22]. It is monomeric [21] and is found as membrane bound on B cells as well as a secreted form [23]. In humans, IgD secreted by IgDþ cells in the upper respiratory mucosa mediate mucosal immunity by binding to respiratory pathogens. In addition, IgD activated basophils trigger innate antimicrobial response. Binding of IgD to channel catfish granulocytes has been reported [24], and this function is believed to be evolutionarily conserved. However, the exact function of IgD in teleost is not clearly understood. Another antibody isotype, IgT is the latest antibody class discovered in vertebrate species [25]. The IgT or its equivalent (IgZ) is reported in many teleosts including Zebrafish (Danio rerio) [4], common carp (Cyprinus carpio) [5], fugu (T. rubripes) [26], rainbow trout (O. mykiss) [3], grass carp (C. idella) [18], three-spined stickleback (G. aculeatus) [19], and Atlantic salmon (S. salar) [27]. Most of these species possess more than one subclass of IgT [28]. Evidences show that IgT is involved in gut [29] and gill [30] mucosal immunity. The finding has challenged the paradigm that the specialization of immunoglobulin isotypes into mucosal and systemic arose during tetrapod evolution [28]. IgT is expressed as a monomer in serum and as a tetramer in gut mucus [29]. All the three Ig isotypes (IgM, IgD and IgT) are expressed both as membrane bound and secretory form [21,23,28]. Measurement of IgM, IgD and IgT expression in teleosts will improve our understanding of the role of these immunoglobulins in combating invading pathogens not only through the systemic circulation, but at specific mucosal surfaces as well. A live attenuated strain of F. psychrophilum (259-93-B.17) has been developed at the Department of Fish and Wildlife Sciences at the University of Idaho [31]. The efficacy of this vaccine has been improved by growing the bacteria under iron limiting conditions and has recently been shown to provide significant protection against CWD in coho salmon [32]. A deeper understanding of the immune response of fish to F. psychrophilum especially at the mucosal surfaces, which is the natural route of infection is important for further fine tuning the efficacy of the CWD vaccine and for better health management of farmed salmonids. The expression of different immunoglobulin isotypes of fish in response to infection and vaccination is not fully understood. In this study the expression of all three isotypes of Ig was characterized in blood and different mucosal organs following immunization with F. psychrophilum by different routes.
2. Materials and methods 2.1. Experimental animals Rainbow trout (O. mykiss) (mean weight 35 g) were procured from the University of Idaho's Aquaculture Research Institute (ARI) and were maintained in 500 L tanks with continuous aeration in a flow through water system supplied with dechlorinated municipal water maintained at 15 ± 1 C. The fish were fed a commercial pellet feed (Rangen EXTR 450 1/16) at 1% of body weight divided into two equal doses. All experimental procedures with live fish were carried out with prior approval from the Institutional Animal Care and Use Committee, University of Idaho (IACUC # 2012-30). 2.2. Bacteria A live attenuated vaccine strain of F. psychrophilum, 259-93-B.17 [31] maintained at Department of Fish and Wildlife Sciences, College of Natural Resources, University of Idaho, Moscow, USA was used for immunizing the fish. 2.3. Culture of F. psychrophilum Glycerol stocks of F. psychrophilum strain 259-93-B.17 were revived by inoculating in to tryptone yeast extract salts broth (TYES; 0.4% tryptone, 0.04% yeast extract, 0.05% MgSO4, 0.05% CaCl2, pH 7.2) and incubated at 15 C shaking at 80 rpm. Once visible turbidity was observed in the broth, the culture was streaked on TYES agar (1.5% agar in TYES broth) and incubated at 15 C. The vaccine strain F. psychrophilum 259-93-B.17 was grown under iron limited condition (B.17-ILM) in TYES broth in the presence of an iron chelator, 20 ,20 Bipyridine (50 mM) under shaking conditions at 15 C for 4 days. Bulk culture was produced by inoculating a single colony of F. psychrophilum in TYES broth containing 20 ,20 Bipyridine in 10 mL and scaled up to produce the desired volume of culture. The bacterial cells were pelleted by centrifuging at 5000 g for 20 min at 4 C. The cells were washed twice in phosphate buffered saline (PBS), finally resuspended in desired volume of PBS and stored at 4 C. The colony forming units (CFU) in the culture was estimated by standard plate count method. The plate count of the vaccine strain, F. psychrophilum B.17-ILM obtained was 3 108 CFU mL1. 2.4. Immunization Fishes were divided into four groups and were immunized with F. psychrophilum B.17-ILM as shown in Table 1. Fishes were anaesthetized with tricaine methanesulfonate (100 mg L1) before immunization. Intraperitoneal (IP) injection was administered using tuberculin syringe and anal intubation (AI) was done using a micropipette attached with a 200 mL microtip and bacteria were administered into the hind gut. A 100 mL dose of the stock culture containing 3 107 CFU was used to immunize each fish by IP and AI Table 1 Table showing different treatment groups, route and dose of immunization of rainbow trout. Group
Number of fish immunized
Route of immunization
Dose
A
55
Nil
B C D
40 40 40
Unimmunized control Intraperitoneal Anal intubation Bath
3.0 107 CFU fish1 in 100 mL 3.0 107 CFU fish1 in 100 mL 3.0 106 CFU mL1 water for 1 h
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 3/8
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
route. For bath immunization the stock culture was diluted 1:100 in the rearing water and the fish were held for 1 h with aeration. The control group was maintained without immunization. 2.5. Sampling Fish were sampled prior to immunization (0 day) and then divided into four groups and immunized. Subsequently, fish were sampled at 3, 7, 14, 28, 42 and 56 days post-immunization (DPI). The following samples were collected from four fish from each group at each time point. For all sampling, fish were anesthetized using tricaine methanesulfonate. 2.5.1. Whole blood Whole blood was collected from the caudal vein using a 5 mL syringe and needle. Part of the blood was immediately mixed with equal volume of Alsever's solution (0.1 M Dextrose, 70 mM NaCl, 30 mM Sodium citrate; pH 7.2) in a 15 mL centrifuge tube for separation of lymphocytes and the rest of the blood was allowed to clot at room temperature and stored at 4 C for serum separation. For lymphocyte separation, the RBCs were lysed following the protocol of Crippen et al. [33] with modifications. Nine millilitres of sterile distilled water was added to one millilitre of blood and mixed gently for 20 s. One millilitre of 10X PBS was added to the tube and mixed immediately. The tube was allowed to stand on ice for 10 min. The cell debris and nuclear material precipitated and the clear supernatant containing the leukocytes, which is rich in lymphocytes, were transferred to another tube using a serological pipet and centrifuged at 750 g for 10 min at 4 C. The pelleted cells were washed twice in PBS by centrifuging at 750 g for 10 min at 4 C and stored in RNAlater® (Life Technologies, USA). Serum was separated from clotted blood by centrifuging at 4000 g for 5 min at 4 C. The separated serum was stored at 20 C. 2.5.2. Gill mucus Gill mucus was collected using a sterile cotton swab by rubbing gently over the gills on both the sides of the fish and vortexed thoroughly in a microcentrifuge tube containing 0.2 mL of PBS and protease inhibitor cocktail (Sigma, USA). The cotton swab was squeezed with a pair of forceps to collect the adsorbed liquid. The mucus samples were centrifuged at 10,000 g for 5 min at 4 C and the supernatant was stored at 20 C. 2.5.3. Skin mucus The skin mucus was collected following the method of Valdenegro-Vega et al. [34] with minor modifications. The fish was placed inside a polythene bag containing 0.5 mL of PBS and protease inhibitor cocktail and rubbed gently. The mucus samples were collected in a microcentrifuge tube and were centrifuged at 10,000 g for 5 min at 4 C. The supernatant was stored at 20 C. 2.5.4. Intestinal mucus For collecting the intestinal mucus, approximately 2 cm length of hind gut was excised and the gut contents were removed by striping with a pair of forceps. The mucus was collected in a microcentrifuge tube containing 0.2 mL of PBS with protease inhibitor cocktail by stripping with a pair of forceps. The samples were vortexed briefly and centrifuged at 10,000 g for 10 min at 4 C. The supernatants were separated and stored at 20 C. 2.5.5. Tissues Gill, skin (about 2 cm2 on the lateral side) and intestine (about 2 cm of hind gut) samples were collected in RNAlater® and stored at 20 C until processed.
3
2.6. Enzyme linked immunosorbent assay (ELISA) The serum, gill mucus, skin mucus, and intestinal mucus IgM level were assessed by ELISA following the protocol described by LaFrentz et al. [35] with modifications. The 96 well ELISA plates were coated with 100 mL of inactivated F. psychrophilum B.17-ILM (containing 1 108 CFU mL1 before inactivation) in bicarbonate buffer (pH 9.6) and incubated overnight at 4 C. On the following day the plates were washed three times with PBS containing 0.05% Tween 20 (PBST) and the samples were added to the first well in the column and serially diluted two fold in PBST containing 0.02% sodium azide. The initial dilution of the samples were 1:200 for serum, 1:8 for gill mucus, undiluted for skin mucus and intestinal mucus samples. Positive and negative rainbow trout serum controls were also included in each plate. The plates were incubated at 15 C overnight. The plates were washed three times in PBST and mouse monoclonal antibody (MAb 1.14) [36] against trout IgM was added at a dilution of 1:400 containing 0.1% non-fat dry milk at 100 mL well1. The plates were incubated for 1 h at room temperature (RT) followed by three washings with PBST. The plates were incubated with 100 mL well1 of goat anti-mouse Ig HRP conjugate (Bio-rad, USA) diluted 1:4000 in PBS containing 0.1% non-fat dry milk for 1 h at RT. The plates were washed 3 times with PBS and 50 mL ABTS peroxidase substrate (KPL Inc., USA) was added. The plates were incubated at RT for 15 min in the dark and the reaction was stopped by adding 50 mL of 1% SDS solution and the plates were read at 405 nm in an ELISA plate reader (Biotek, USA). The antibody titre in serum was determined as the reciprocal of the highest dilution of the serum having twice the OD of the negative controls. For gill, intestinal and skin mucus samples the OD values of the initial dilution were used as such for analysis as reference negative and positive controls were not available. The serum IgD level was assessed by ELISA using the same protocol described above using an initial dilution of 1:50. The secondary antibody, the mouse monoclonal anti-trout IgD antibody was kindly provided by Dr. John Hansen, WFRC-USGS Biological Resources Division through the U. S. Veterinary Immunological Reagent Network (http://www.umass. edu/vetimm/trout/index.html). The plates were read at 405 nm in an ELISA plate reader and the OD values of the initial dilutions were used for the analysis. All the data was further subjected to one way analysis of variance using SPSS 16.0 software. The ELISA titres were considered statistically significant if p values were <0.05. 2.7. Reverse transcription quantitative real-time PCR (RT-qPCR) 2.7.1. RNA extraction The leukocytes stored in RNAlater were transferred to lysis buffer and the cells were lysed by repeated pipetting. Other tissues viz. gills, skin and intestine were transferred to lysis buffer and homogenized using a tissue homogenizer (Retsch, USA). Total RNA was extracted from tissue lysate using Pure Link RNA mini kit (Life Technologies, USA) following the manufacturers protocol. The RNA was eluted using 30 mL of nuclease free water and was quantified using Nanodrop (ND-1000) spectrophotometer. 2.7.2. cDNA synthesis The genomic DNA contamination in the isolated RNA was removed by digesting the DNA using RNase-Free DNase (1 U/535 ng of RNA) (Promega, USA) and incubating for 30 min at 37 C. The reaction was stopped by adding stop solution (1 mL/10 mL) and incubating for 10 min at 65 C. The resulting RNA was used for cDNA synthesis. Reverse transcription of 375 ng of DNA free RNA samples was carried out in a total volume of 15 mL using Superscript VILO cDNA synthesis kit (Life Technologies, USA) following the
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 4/8
4
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
manufacturer's instructions. The cDNA synthesized was used for RT-qPCR. 2.7.3. RT-qPCR RT-qPCR was carried out using SYBR select master mix (Life Technologies, USA) in ABI 7500 Fast Real-time PCR system (Applied Biosystems, USA). The primer sequences used for amplification of secretory IgM (sIgM), secretory IgD (sIgD) and secretory IgT (sIgT) and the reference gene elongation factor-1a (EF-1a) are given in Table 2. The reaction mix consisted of 5 mL of SYBR Green select master mix (2X), 10 pmol each of forward and reverse primer and cDNA equivalent to 25 ng of RNA. The thermal profile consisted of 50 C for 2 min, 95 C for 2 min followed by 40 cycles of 95 C for 3 s and 60 C for 30 s. The default melt curve cycle was used to analyze the melt curve of the amplified products. For each sample three replicate wells were used. The threshold cycle value (Ct value) was determined using the automatic settings of the ABI 7500 Fast Realtime PCR system. The expression of sIgM, sIgT and sIgD was normalized to the expression of EF-1a. The fold change in expression of the immunoglobulin genes compared to the 0 DPI sample was calculated according to 2DDCT method [37]. The data was further subjected to one way analysis of variance using SPSS 16.0 software. The expression levels were considered statistically significant if p values were <0.05. 3. Results 3.1. ELISA The average serum, gill mucus, skin mucus, and intestinal mucus IgM levels for samples collected at different time points after vaccination are given in Fig. 1. The serum IgM level was significantly elevated in fish immunized by the IP route by 28 DPI and reached a peak at 42 DPI. The serum IgM level in groups vaccinated by other routes did not differ significantly. A similar trend was observed for gill mucus and skin mucus IgM levels. However, no increase in IgM levels in intestinal mucus was observed for any of the groups. No significant increase in serum IgD level at any time point in any group was observed. 3.2. RT-qPCR The normal expression of IgM, IgT and IgD in lymphocytes, gill, skin and intestine of rainbow trout before immunization (0 day) is given in Fig. 2. IgM expression was highest in lymphocytes followed by intestine, gill and skin, and was significantly higher than IgT and IgD in all the tissues. The relative expression of IgT and IgD was much less compared to IgM. The relative expression of IgM, IgT and IgD in lymphocytes, gill, skin and intestine normalized against EF-1a is represented graphically in Figs. 3e6 respectively. IgM expression in different tissues depended on the route of immunization. The peak IgM expression Fig. 1. Mean IgM levels ± SEM (n ¼ 4) in serum, gill, skin and intestinal mucus for samples collected at 0, 3, 7, 14, 28, 42 and 56 days post-immunization in rainbow trout immunized with Flavobacterium psychrophilum by different routes.
Table 2 Details of primers used in RT-qPCR. Primer
Sequence
Amplicon size
Reference
sIgM F sIgM R sIgT F sIgT R sIgD F sIgD R EF-1a F EF-1a R
AAGAAAGCCTACAAGAGGGAGA CGTCAACAAGCCAAGCCACTA CAGACAACAGCACCTCACCTA GAGTCAATAAGAAGACACAACGA TGGCACACCAGGATTTGAC TCAGAATTGAGTGAACGGACAGACA GGCAAGAAACTTGAGGATGC ACAGTCTGCCTCATGTCACG
157
[29]
115
[29]
120
[21]
149
[52]
was observed at 7 DPI in the lymphocytes in the IP immunized group and in gills and skin in bath immunized group while the peak IgM expression in intestine was observed at 28 DPI in the AI group. The peak IgT expression was observed at 3 DPI in lymphocytes and intestine in the AI group and in gills in the bath immunized group. The peak IgT expression in skin was much delayed and was observed at 42 DPI in the bath immunized group.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 5/8
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
5
The peak IgD expression in lymphocytes was observed at 14 DPI in the AI group and at 3 DPI in gills and intestine in the bath immunized group and AI group, respectively. The peak IgD expression in skin was observed only by 42 DPI in the AI group. 4. Discussion The mucosal surfaces of fish are in continuous contact with commensals, opportunistic and obligate pathogens and hence immunity at the mucosal surface is thought to play an important role in protecting the fish from pathogens. In the present study, IP immunization alone resulted in significant IgM production in serum and in gill and skin mucus while other routes of immunization did not result in significant anti-F. psychrophilum IgM production. This is in contrast to previous studies [31,32,38] showing antibody production following immersion delivery. The reason for the lack of specific antibodies in fish following immersion or AI routes is unclear but could be related to dose delivered and the use of larger fish in this study. The lack of IgM in the intestinal mucus could also be due to the strong proteolytic environment in the gut mucus [39] which could degrade the secreted Igs. Valdenegro-Vega et al. [34] too reported higher antibody response in serum and skin mucus in IP immunized Atlantic salmon and not in fish immunized by anal intubation and immersion routes with dinitrophenol and fluorescein isothiocyanate each conjugated with keyhole limpet hemocyanin. Although it is reported that IgM is produced locally at the mucosal surfaces [40], stimulation of the mucosal surface by bath immunization did not elicit a significant increase in IgM secretion in mucus while IP immunization resulted in increase in gill and skin mucus IgM. Further, the timing of increase in gill and skin mucus IgM corresponds with the increase in serum IgM. Hence it is hypothesized that in addition to local production of IgM, a portion of the IgM present in the mucus may be derived from blood. IgM from blood may be transported to the mucus passively [41] or through the polymeric Ig receptors (pIgR) found in all mucosal surfaces and liver which specifically binds to teleost IgM and IgT [29,42e45]. However Swan et al. [46] postulated that systemically stimulated B cells following IP immunization migrate to mucosal tissues where they produce antibodies locally. No significant IgD antibody titres were observed in serum of fish in the various groups at any time points by ELISA. This is not unexpected and is likely due to the low level of IgD in serum [23]. However, the secreted IgD levels in mucus samples were not tested.
Fig. 3. Mean fold change in expression of sIgM, sIgT and sIgD ± standard error (n ¼ 4) in lymphocytes of rainbow trout at different time points after immunization by different routes. Unimmunized fish (0 day) were used as control.
Fig. 2. Normal expression (0 day) of sIgM, sIgT and sIgD in lymphocytes, gill, skin and intestine of rainbow trout normalized against EF-1a. Data represents mean absolute values (±SEM) (n ¼ 4). Different letters over bars with in a tissue indicate significant difference in their expression (p < 0.05).
Basal IgM expression was significantly higher in all the tissues tested compared to IgT and IgD as also reported earlier [16,47,48]. The immunization route influenced the IgM transcript production in tissues. Tissues that were directly exposed to the bacterin, depending upon the immunization route, expressed the highest amount of IgM transcripts. However, this did not translate into IgM secretion. Although bath immunization and AI routes produced the highest expression of IgM transcripts in gill, skin and intestine, none of these routes resulted in any significant increase in secreted IgM in the mucus of gill, skin and intestines. Lack of correlation between gene expression at transcript level and protein level has been reported in yeast [49] and for complement factors C4 and C5 in rainbow trout [50]. Further, antibody (IgM) production in serum and mucus occurred much latter at 28 DPI (peaking at 42 DPI) while peak IgM transcripts were observed at 7 DPI. Such time lag in antibody secretion compared to transcript production has also been reported in zebra fish, where IgM was detected at 28 days posthatch while mRNA transcripts were observed at 7e10 days posthatch [51]. The peak IgM transcripts were observed in blood from IP immunized fish, in gills and skin in bath immunized fish and in
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 6/8
6
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
intestines from the AI fish suggesting that IgM plays a role in both systemic and mucosal immunity. IgT and IgD genes were upregulated in gills significantly at 3 DPI in bath immunized group indicating that IgT and IgD are involved in gill mucosal immunity. The increase in IgD expression in gills was about 347 fold followed by IgT (~53 fold) in fish from the immersion immunized group. Since expression was significantly higher in bath immunized fish as early as 3 DPI, it is hypothesized that the IgT and IgD producing B lymphocytes are present locally and this resulted in increased expression of these Igs upon stimulation by bath vaccination. This is contrary to the findings of Tian et al. [47], where IgD positive cells were not found in gills and intestine of mandarin fish, Siniperca chuatsi by in situ hybridization. However in humans, the IgDþ B lymphocytes comprises of 20e25% of upper respiratory tract mucosal B cells while only about 3% are found in peripheral blood [22]. Furthermore human IgDþ B cells recognize Gramnegative respiratory bacteria and their products [24]. It is very likely that teleost gills are populated with more IgD positive cells and stimulation by F. psychrophilum vaccination resulted in increased IgD transcripts. A similar trend was observed in the intestines of AI fish where IgT and IgD transcripts were upregulated about 8 and 20 fold at 3 DPI indicating these antibodies may play an important role in gut immunity. However, IgT and IgD expression in skin was very late and suggests that IgT and IgD secreting B cells
may be lacking in the skin. Such late upregulation could be due to subsequent migration of IgT and IgD secreting B cells to skin, but this has not been confirmed. Among all the three Ig transcripts, IgT and IgD were upregulated as early as 3 DPI especially in gills and intestine while the peak IgM transcripts were observed only by 7 DPI suggesting that IgT and IgD might contribute to immediate protection to the host at mucosal surfaces against the invading pathogens. Although the relative basal expression of IgD was lowest followed by IgT among the three Igs, the quantum of increase in expression was the highest for IgD followed by IgT in all the three mucosal tissues tested indicating a role for these two antibodies in mucosal immunity. Further, the peak IgT and IgD expression in all the tissues were observed only in bath immunized and anal intubation groups suggesting that these two Igs are specialized in mucosal immunity. Although IgT is reported to play a role in gut immunity [29], this is believed to be the first report describing IgD involvement in mucosal immunity in teleosts. This provides further evidence that systemic and mucosal immunity are compartmentalized to some level in teleosts. Although IP immunization results in IgM production both systemically and at mucosal surfaces, indicating IP route may be the ideal route of immunization, the significant upregulation of IgD and IgT transcripts at mucosal
Fig. 4. Mean fold change in expression of sIgM, sIgT and sIgD ± standard error (n ¼ 4) in gills of rainbow trout at different time points after immunization by different routes. Unimmunized fish (0 day) were used as control.
Fig. 5. Mean fold change in expression of sIgM, sIgT and sIgD ± standard error (n ¼ 4) in skin of rainbow trout at different time points after immunization by different routes. Unimmunized fish (0 day) were used as control.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 7/8
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
7
acknowledges the Indian Council of Agricultural Research and Dr. W.S. Lakra, Director, CIFE for the support. References
Fig. 6. Mean fold change in expression of sIgM, sIgT and sIgD ± standard error (n ¼ 4) in intestine of rainbow trout at different time points after immunization by different routes. Unimmunized fish (0 day) were used as control.
tissues following exposure to antigen implies that bath vaccination and anal intubation methods should be given due attention as these methods seem to offer protection to the fish at mucosal surfaces, which are the natural routes for pathogen entry. Quantification of secreted IgD and IgT at the mucosal surfaces and challenge studies are required to confirm the findings. In conclusion, this study demonstrates that IgM plays a role in both systemic and mucosal immunity in teleosts. Furthermore, IgT and IgD genes were found to be significantly upregulated in gills and intestine in bath immunized and AI groups suggesting that these two antibody isotypes are specialized to mucosal sites. Such mucosal antibodies may offer early protection against invading pathogens at mucosal surfaces. Evidence from this study suggests that teleost adaptive immunity is at least partially compartmentalized into systemic and mucosal components similar to mammals.
Acknowledgment The first author acknowledges the funding provided by Department of Biotechnology, Govt. of India (Grant No. BT/IN/DBTCREST Awards/20/MM/2012-13). The first author also
[1] Nematollahi A, Decostere A, Pasmans F, Haesebrouck F. Flavobacterium psychrophilum infections in salmonid fish. J Fish Dis 2003;26:563e74. [2] Barnes ME, Brown ML. A review of Flavobacterium psychrophilum biology, clinical signs, and bacterial cold water disease prevention and treatment. Open Fish Sci J 2011;4:40e8. [3] Hansen JD, Landis ED, Phillips RB. Discovery of a unique Ig heavy-chain isotype (IgT) in rainbow trout: implications for a distinctive B cell developmental pathway in teleost fish. Proc Natl Acad Sci 2005;102:6919e24. [4] Danilova N, Bussmann J, Jekosch K, Steiner LA. The immunoglobulin heavychain locus in zebrafish: identification and expression of a previously unknown isotype, immunoglobulin Z. Nat Immunol 2005;6:295e302. [5] Savan R, Aman A, Nakao M, Watanuki H, Sakai M. Discovery of a novel immunoglobulin heavy chain gene chimera from common carp (Cyprinus carpio L.). Immunogenetics 2005;57:458e63. [6] Flajnik MF. Comparative analyses of immunoglobulin genes: surprises and portents. Nat Rev Immunol 2002;2:688e98. [7] Acton RT, Weinheimer PF, Hall SJ, Niedermeier W, Shelton E, Bennett JC. Tetrameric immune macroglobulins in three orders of bony fishes. Proc Natl Acad Sci 1971;68:107e11. [8] Salinas I, Zhang Y, Sunyer JO. Mucosal immunoglobulins and B cells of teleost fish. Dev Comp Immunol 2011;35:1346e65. [9] Ohta Y, Flajnik M. IgD, like IgM, is a primordial immunoglobulin class perpetuated in most jawed vertebrates. Proc Natl Acad Sci 2006;103: 10723e8. [10] Zhu L, Yan Z, Feng M, Peng D, Guo Y, Hu X, et al. Identification of sturgeon IgD bridges the evolutionary gap between elasmobranchs and teleosts. Dev Comp Immunol 2014;42:138e47. €m L, Zhao Y. The immunoglobulin d gene in jawed [11] Sun Y, Wei Z, Hammarstro vertebrates: a comparative overview. Dev Comp Immunol 2011;35:975e81. NE, Miller NW, Clem LW, Pasquier LD, Warr GW. A novel [12] Wilson M, Bengte chimeric Ig heavy chain from a teleost fish shares similarities to IgD. Proc Natl Acad Sci 1997;94:4593e7. [13] Hordvik I, Thevarajan J, Samdal I, Bastani N, Krossøy B. Molecular cloning and phylogenetic analysis of the Atlantic salmon immunoglobulin D gene. Scand J Immunol 1999;50:202e10. [14] Stenvik J, Jorgensen TO. Immunoglobulin D (IgD) of Atlantic cod has a unique structure. Immunogenetics 2000;51:452e61. [15] Hordvik I. Identification of a novel immunoglobulin d transcript and comparative analysis of the genes encoding IgD in Atlantic salmon and Atlantic halibut. Mol Immunol 2002;39:85e91. [16] Hirono I, Nam BH, Enomoto J, Uchino K, Aoki T. Cloning and characterisation of a cDNA encoding Japanese flounder Paralichthys olivaceus IgD. Fish Shellfish Immunol 2003;15:63e70. [17] Saha NR, Suetake H, Kikuchi K, Suzuki Y. Fugu immunoglobulin D: a highly unusual gene with unprecedented duplications in its constant region. Immunogenetics 2004;56:438e47. [18] Xiao FS, Wang YP, Yan W, Chang MX, Yao WJ, Xu QQ, et al. Ig heavy chain genes and their locus in grass carp Ctenopharyngodon idella. Fish Shellfish Immunol 2010;29:594e9. [19] Gambon-Deza F, Sanchez-Espinel C, Magadan-Mompo S. Presence of an unique IgT on the IGH locus in three-spined stickleback fish (Gasterosteus aculeatus) and the very recent generation of a repertoire of VH genes. Dev Comp Immunol 2010;34:114e22. [20] Bao Y, Wang T, Guo Y, Zhao Z, Li N, Zhao Y. The immunoglobulin gene loci in the teleost Gasterosteus aculeatus. Fish Shellfish Immunol 2010;28:40e8. [21] Ramirez-Gomez F, Greene W, Rego K, Hansen JD, Costa G, Kataria P, et al. Discovery and characterization of secretory IgD in rainbow trout: secretory IgD is produced through a novel splicing mechanism. J Immunol 2012;188: 1341e9. [22] Edholm E, Bengten E, Wilson M. Insights into the function of IgD. Dev Comp Immunol 2011;35:1309e16. [23] Bengten E, Quiniou SM, Stuge TB, Katagiri T, Miller NW, Clem LW, et al. The IgH locus of the channel catfish, Ictalurus punctatus, contains multiple constant region gene sequences: different genes encode heavy chains of membrane and secreted IgD. J Immunol 2002;169:2488e97. [24] Chen K, Xu W, Wilson M, He B, Miller NW, Bengten E, et al. Immunoglobulin D enhances immune surveillance by activating antimicrobial, proinflammatory and B cell-stimulating programs in basophils. Nat Immunol 2009;10:889e98. [25] Flajnik MF. All GOD's creatures got dedicated mucosal immunity. Nat Immunol 2010;11:777e9. [26] Savan R, Aman A, Sato K, Yamaguchi R, Sakai M. Discovery of a new class of immunoglobulin heavy chain from fugu. Eur J Immunol 2005;35:3320e31. [27] Tadiso TM, Lie KK, Hordvik I. Molecular cloning of IgT from Atlantic salmon, and analysis of the relative expression of t, m and d in different tissues. Vet Immunol Immunopathol 2011;139:17e26. [28] Zhang YA, Salinas I, Sunyer JO. Recent findings on the structure and function of teleost IgT. Fish Shellfish Immunol 2011;31:627e34.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32
YFSIM3316_proof ■ 17 February 2015 ■ 8/8
8
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
[29] Zhang YA, Salinas I, Li J, Parra D, Bjork S, Xu Z, et al. IgT, a primitive immunoglobulin class specialized in mucosal immunity. Nat Immunol 2010;11: 827e35. [30] Heinecke RD, Chettri JK, Buchmann K. Adaptive and innate immune molecules in developing rainbow trout, Oncorhynchus mykiss eggs and larvae: expression of genes and occurrence of effector molecules. Fish Shellfish Immunol 2014;38:25e33. [31] LaFrentz BR, LaPatra SE, Call DR, Cain KD. Isolation of rifampicin resistant Flavobacterium psychrophilum strains and their potential as live attenuated vaccine candidates. Vaccine 2008;26:5582e9. [32] Long A, Fehringer TR, Swain MA, LaFrentz BR, Call DR, Cain KD. Enhanced efficacy of an attenuated Flavobacterium psychrophilum strain cultured under iron-limited conditions. Fish Shellfish Immunol 2013;35:1477e82. [33] Crippen TL, Bootland LM, Leong JC, Fitzpatrick MS, Schreck CB, Vella AT. Analysis of salmonid leukocytes purified by hypotonic lysis of erythrocytes. J Aquat Anim Health 2001;13:234e45. [34] Valdenegro-Vega VA, Crosbie P, Vincent B, Cain KD, Nowak BF. Effect of immunization route on mucosal and systemic immune response in Atlantic salmon (Salmo salar). Vet Immunol Immunopathol 2013;151:113e23. [35] LaFrentz BR, LaPatra SE, Jones GR, Congleton JL, Sun B, Cain KD. Characterization of serum and mucosal antibody responses and relative per cent survival in rainbow trout, Oncorhynchus mykiss (Walbaum), following immunization and challenge with Flavobacterium psychrophilum. J Fish Dis 2002;25:703e13. [36] DeLuca D, Wilson M, Warr GW. Lymphocyte heterogeneity in the trout, Salmo gairdneri, defined with monoclonal antibodies to IgM. Eur J Immunol 1983;13: 546e51. [37] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:2002e7. [38] Xu Z, Chen CF, Mao ZJ, Zhu WY. Detection of serum and mucosal antibody production and antibody secreting cells (ASCs) in large yellow croaker (Pseudosciaena crocea) following vaccination with Vibrio harveyi via different routes. Aquaculture 2009;287:243e7. [39] Hatten F, Fredriksen A, Hordvik I, Endresen C. Presence of IgM in cutaneous mucus, but not in gut mucus of Atlantic salmon, Salmo salar. Serum IgM is rapidly degraded when added to gut mucus. Fish Shellfish Immunol 2001;11: 257e68. [40] Coscia MR, Simoniello P, Giacomelli S, Oreste U, Motta CM. Investigation of immunoglobulins in skin of the Antarctic teleost Trematomus bernacchii. Fish Shellfish Immunol 2014;39:206e14.
[41] Cain KD, Jones DR, Raison RL. Characterisation of mucosal and systemic immune responses in rainbow trout (Oncorhynchus mykiss) using surface plasmon resonance. Fish Shellfish Immunol 2000;10:651e66. [42] Hamuro K, Suetake H, Saha NR, Kikuchi K, Suzuki Y. A teleost polymeric Ig receptor exhibiting two Ig-like domains transports tetrameric IgM into the skin. J Immunol 2007;178:5682e9. [43] Rombout JHWM, van der Tuin SJL, Yang G, Schopman N, Mroczek A, Hermsen T, et al. Expression of the polymeric immunoglobulin receptor (pIgR) in mucosal tissues of common carp (Cyprinus carpio L.). Fish Shellfish Immunol 2008;24:620e8. [44] Tadiso TM, Sharma A, Hordvik I. Analysis of polymeric immunoglobulin receptor and CD300-like molecules from Atlantic salmon. Mol Immunol 2011;49:462e73. [45] Xu G, Zhan W, Ding B, Sheng X. Molecular cloning and expression analysis of polymeric immunoglobulin receptor in flounder (Paralichthys olivaceus). Fish Shellfish Immunol 2013;35:653e60. [46] Swan CM, Lindstrom NM, Cain KD. Identification of a localized mucosal immune response in rainbow trout, Oncorhynchus mykiss (Walbaum), following immunization with a protein-hapten antigen. J Fish Dis 2008;31:383e93. [47] Tian J, Sun B, Luo Y, Zhang Y, Nie P. Distribution of IgM, IgD and IgZ in mandarin fish, Siniperca chuatsi lymphoid tissues and their transcriptional changes after Flavobacterium columnare stimulation. Aquaculture 2009;288: 14e21. [48] Ryo S, Wijdeven RHM, Tyagi A, Hermsen T, Kono T, Karunasagar I, et al. Common carp have two subclasses of bonyfish specific antibody IgZ showing differential expression in response to infection. Dev Comp Immunol 2010;34: 1183e90. [49] Gygi SP, Rochon Y, Franza BR, Aebersold R. Correlation between protein and mRNA abundance in yeast. Mol Cell Biol 1999;19:1720e30. [50] Løvoll M, Kilvik T, Boshra H, Bøgwald J, Sunyer JO, Dalmo RA. Maternal transfer of complement components C3-1, C3-3, C3-4, C4, C5, C7, Bf, and Df to offspring in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2006;58: 168e79. [51] Lam SH, Chua HL, Gong Z, Lam TJ, Sin YM. Development and maturation of the immune system in zebrafish, Danio rerio: a gene expression profiling, in situ hybridization and immunological study. Dev Comp Immunol 2004;28:9e28. [52] Martin E, Trichet VV, Legrand-Frossi C, Frippiat J. Comparison between intestinal and non-mucosal immune functions of rainbow trout, Oncorhynchus mykiss. Fish Shellfish Immunol 2012;33:1258e68.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64
YFSIM3316_proof ■ 17 February 2015 ■ 1/8
Fish & Shellfish Immunology xxx (2015) 1e8
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Q4
Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes
Q3
M. Makesh a, b, *, Ponnerassery S. Sudheesh a, Kenneth D. Cain a a b
Q2
Department of Fish and Wildlife Sciences, College of Natural Resources, University of Idaho, Moscow, ID 83844-1136, USA Aquatic Environment and Health Management Division, Central Institute of Fisheries Education, Versova, Mumbai 400061, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 September 2014 Received in revised form 2 February 2015 Accepted 3 February 2015 Available online xxx
Teleosts possess three immunoglobulin (Ig) heavy chain isotypes viz., IgM, IgT and IgD and all three isotypes are reported in rainbow trout. The expression of these Ig isotypes in response to different immunization routes was investigated and results provide a better understanding of the role these Igs in different tissues. Rainbow trout (Oncorhynchus mykiss) were immunized with an attenuated Flavobacterium psychrophilum strain, 259-93-B.17 grown under iron limiting conditions, by intraperitoneal, anal intubation and immersion routes. Serum, gill mucus, skin mucus and intestinal mucus samples were collected at 0, 3, 7, 14, 28, 42 and 56 days post immunization by sacrificing four fish from each treatment group and the unimmunized control group, and the IgM levels were estimated by an enzyme linked immunosorbent assay (ELISA). In addition, blood, gill, skin and intestinal tissue samples were collected for Ig gene expression studies. The secretory IgM, IgD and IgT gene expression levels in these tissues were estimated by reverse transcription quantitative real time PCR (RT-qPCR). Levels of IgM in serum, gill and skin mucus increased significantly by 28 days after immunization in the intraperitoneally immunized group, while no significant increase in IgM level was observed in fish groups immunized by other routes. Secretory IgD and IgT expression levels were significantly upregulated in gills of fish immunized by the immersion route. Similarly, secretory IgT and IgD were upregulated in intestines of fish immunized by anal intubation route. The results confirm mucosal association of IgT and suggest that IgD may also be specialized in mucosal immunity and contribute to immediate protection to the fish at mucosal surfaces. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Rainbow trout Oncorhynchus mykiss Systemic and mucosal immune response IgM IgT IgD
1. Introduction Aquaculture of salmonid species is a high value fish production activity in Europe, North America, Chile, Japan, Australia and other parts of the world. Bacterial cold water disease (CWD) and rainbow trout fry syndrome (RTFS) caused by Flavobacterium psychrophilum are major diseases very often resulting in severe production and economic losses in salmonid aquaculture facilities, especially those producing rainbow trout Oncorhynchus mykiss (Walbaum), coho salmon Oncorhynchus kisutch (Walbaum) and steelhead [1,2]. Trout farming often suffers substantial economic loss due to problems
* Corresponding author. Aquatic Environment and Health Management Division, Central Institute of Fisheries Education, Versova, Mumbai 400061, India. Tel.: þ91 22 2636 1446; fax: þ91 22 2636 1573. E-mail address: [email protected] (M. Makesh).
associated with CWD epizootics including high mortality, increased susceptibility to other diseases, use of chemotherapeutants, high costs of treatment and skeletal deformities resulting in quality reduction in recovering fish [1]. Despite tremendous efforts, a vaccine to control CWD is yet to be approved and available. A major constraint to the development of an efficacious CWD vaccine is our inadequate understanding of the innate and adaptive immune responses of the host fish to the pathogen, especially at the mucosal surfaces. Immunoglobulins (Igs) comprised of heavy and light chain molecules, are the mediators of adaptive immunity in fish and other vertebrates. Mammals have five different heavy chain isotypes of Ig namely IgM, IgG, IgA, IgD and IgE each with distinct functions while teleosts were long considered to have only two Ig isotypes, IgM and IgD. Teleosts were thought to lack specialized mucosal antibodies equivalent to IgA of mammals. However, recent
http://dx.doi.org/10.1016/j.fsi.2015.02.003 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 2/8
2
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
discovery of other isotypes viz. IgT/IgZ [3,4] and IgM-IgZ chimera [5], the functions of which are not fully characterized, has thrown open the research to elucidate the role of these newly discovered Ig isotypes. IgM is the most ancient and the only isotype functionally conserved in all jawed vertebrates (reviewed by Flajnik [6]). Serum IgM, a pentamer in mammals, birds and cartilaginous fish, is secreted as a tetramer in teleosts [7] in response to infections. IgM is considered to protect the fish against pathogens both systemically and at mucosal surfaces [8]. Recent studies provide evidence that IgD is also a primordial antibody isotype present in all jawed vertebrates including elasmobranchs [9], acipenseriformes [10], and teleosts except birds [11] and some mammalian species. Among teleosts, IgD is reported in almost all species examined including channel catfish (Ictalurus punctatus) [12], Atlantic salmon (Salmo salar) [13], Atlantic cod (Gadus morhua) [14], Atlantic halibut (Hippoglossus hippoglossus) [15], Japanese flounder (Paralichthys olivaceus) [16], fugu (Takifugu rubripes) [17], grass carp (Ctenopharyngodon idella) [18], threespined stickleback (Gasterosteus aculeatus) [19,20], and rainbow trout (O. mykiss) [21]. IgD exists as multiple structural variants and splice forms exist in different vertebrates. Teleost IgD is characterized by long chimeric molecules consisting of repeated domains compared to shorter hinge containing molecules in mammals [22]. It is monomeric [21] and is found as membrane bound on B cells as well as a secreted form [23]. In humans, IgD secreted by IgDþ cells in the upper respiratory mucosa mediate mucosal immunity by binding to respiratory pathogens. In addition, IgD activated basophils trigger innate antimicrobial response. Binding of IgD to channel catfish granulocytes has been reported [24], and this function is believed to be evolutionarily conserved. However, the exact function of IgD in teleost is not clearly understood. Another antibody isotype, IgT is the latest antibody class discovered in vertebrate species [25]. The IgT or its equivalent (IgZ) is reported in many teleosts including Zebrafish (Danio rerio) [4], common carp (Cyprinus carpio) [5], fugu (T. rubripes) [26], rainbow trout (O. mykiss) [3], grass carp (C. idella) [18], three-spined stickleback (G. aculeatus) [19], and Atlantic salmon (S. salar) [27]. Most of these species possess more than one subclass of IgT [28]. Evidences show that IgT is involved in gut [29] and gill [30] mucosal immunity. The finding has challenged the paradigm that the specialization of immunoglobulin isotypes into mucosal and systemic arose during tetrapod evolution [28]. IgT is expressed as a monomer in serum and as a tetramer in gut mucus [29]. All the three Ig isotypes (IgM, IgD and IgT) are expressed both as membrane bound and secretory form [21,23,28]. Measurement of IgM, IgD and IgT expression in teleosts will improve our understanding of the role of these immunoglobulins in combating invading pathogens not only through the systemic circulation, but at specific mucosal surfaces as well. A live attenuated strain of F. psychrophilum (259-93-B.17) has been developed at the Department of Fish and Wildlife Sciences at the University of Idaho [31]. The efficacy of this vaccine has been improved by growing the bacteria under iron limiting conditions and has recently been shown to provide significant protection against CWD in coho salmon [32]. A deeper understanding of the immune response of fish to F. psychrophilum especially at the mucosal surfaces, which is the natural route of infection is important for further fine tuning the efficacy of the CWD vaccine and for better health management of farmed salmonids. The expression of different immunoglobulin isotypes of fish in response to infection and vaccination is not fully understood. In this study the expression of all three isotypes of Ig was characterized in blood and different mucosal organs following immunization with F. psychrophilum by different routes.
2. Materials and methods 2.1. Experimental animals Rainbow trout (O. mykiss) (mean weight 35 g) were procured from the University of Idaho's Aquaculture Research Institute (ARI) and were maintained in 500 L tanks with continuous aeration in a flow through water system supplied with dechlorinated municipal water maintained at 15 ± 1 C. The fish were fed a commercial pellet feed (Rangen EXTR 450 1/16) at 1% of body weight divided into two equal doses. All experimental procedures with live fish were carried out with prior approval from the Institutional Animal Care and Use Committee, University of Idaho (IACUC # 2012-30). 2.2. Bacteria A live attenuated vaccine strain of F. psychrophilum, 259-93-B.17 [31] maintained at Department of Fish and Wildlife Sciences, College of Natural Resources, University of Idaho, Moscow, USA was used for immunizing the fish. 2.3. Culture of F. psychrophilum Glycerol stocks of F. psychrophilum strain 259-93-B.17 were revived by inoculating in to tryptone yeast extract salts broth (TYES; 0.4% tryptone, 0.04% yeast extract, 0.05% MgSO4, 0.05% CaCl2, pH 7.2) and incubated at 15 C shaking at 80 rpm. Once visible turbidity was observed in the broth, the culture was streaked on TYES agar (1.5% agar in TYES broth) and incubated at 15 C. The vaccine strain F. psychrophilum 259-93-B.17 was grown under iron limited condition (B.17-ILM) in TYES broth in the presence of an iron chelator, 20 ,20 Bipyridine (50 mM) under shaking conditions at 15 C for 4 days. Bulk culture was produced by inoculating a single colony of F. psychrophilum in TYES broth containing 20 ,20 Bipyridine in 10 mL and scaled up to produce the desired volume of culture. The bacterial cells were pelleted by centrifuging at 5000 g for 20 min at 4 C. The cells were washed twice in phosphate buffered saline (PBS), finally resuspended in desired volume of PBS and stored at 4 C. The colony forming units (CFU) in the culture was estimated by standard plate count method. The plate count of the vaccine strain, F. psychrophilum B.17-ILM obtained was 3 108 CFU mL1. 2.4. Immunization Fishes were divided into four groups and were immunized with F. psychrophilum B.17-ILM as shown in Table 1. Fishes were anaesthetized with tricaine methanesulfonate (100 mg L1) before immunization. Intraperitoneal (IP) injection was administered using tuberculin syringe and anal intubation (AI) was done using a micropipette attached with a 200 mL microtip and bacteria were administered into the hind gut. A 100 mL dose of the stock culture containing 3 107 CFU was used to immunize each fish by IP and AI Table 1 Table showing different treatment groups, route and dose of immunization of rainbow trout. Group
Number of fish immunized
Route of immunization
Dose
A
55
Nil
B C D
40 40 40
Unimmunized control Intraperitoneal Anal intubation Bath
3.0 107 CFU fish1 in 100 mL 3.0 107 CFU fish1 in 100 mL 3.0 106 CFU mL1 water for 1 h
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 3/8
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
route. For bath immunization the stock culture was diluted 1:100 in the rearing water and the fish were held for 1 h with aeration. The control group was maintained without immunization. 2.5. Sampling Fish were sampled prior to immunization (0 day) and then divided into four groups and immunized. Subsequently, fish were sampled at 3, 7, 14, 28, 42 and 56 days post-immunization (DPI). The following samples were collected from four fish from each group at each time point. For all sampling, fish were anesthetized using tricaine methanesulfonate. 2.5.1. Whole blood Whole blood was collected from the caudal vein using a 5 mL syringe and needle. Part of the blood was immediately mixed with equal volume of Alsever's solution (0.1 M Dextrose, 70 mM NaCl, 30 mM Sodium citrate; pH 7.2) in a 15 mL centrifuge tube for separation of lymphocytes and the rest of the blood was allowed to clot at room temperature and stored at 4 C for serum separation. For lymphocyte separation, the RBCs were lysed following the protocol of Crippen et al. [33] with modifications. Nine millilitres of sterile distilled water was added to one millilitre of blood and mixed gently for 20 s. One millilitre of 10X PBS was added to the tube and mixed immediately. The tube was allowed to stand on ice for 10 min. The cell debris and nuclear material precipitated and the clear supernatant containing the leukocytes, which is rich in lymphocytes, were transferred to another tube using a serological pipet and centrifuged at 750 g for 10 min at 4 C. The pelleted cells were washed twice in PBS by centrifuging at 750 g for 10 min at 4 C and stored in RNAlater® (Life Technologies, USA). Serum was separated from clotted blood by centrifuging at 4000 g for 5 min at 4 C. The separated serum was stored at 20 C. 2.5.2. Gill mucus Gill mucus was collected using a sterile cotton swab by rubbing gently over the gills on both the sides of the fish and vortexed thoroughly in a microcentrifuge tube containing 0.2 mL of PBS and protease inhibitor cocktail (Sigma, USA). The cotton swab was squeezed with a pair of forceps to collect the adsorbed liquid. The mucus samples were centrifuged at 10,000 g for 5 min at 4 C and the supernatant was stored at 20 C. 2.5.3. Skin mucus The skin mucus was collected following the method of Valdenegro-Vega et al. [34] with minor modifications. The fish was placed inside a polythene bag containing 0.5 mL of PBS and protease inhibitor cocktail and rubbed gently. The mucus samples were collected in a microcentrifuge tube and were centrifuged at 10,000 g for 5 min at 4 C. The supernatant was stored at 20 C. 2.5.4. Intestinal mucus For collecting the intestinal mucus, approximately 2 cm length of hind gut was excised and the gut contents were removed by striping with a pair of forceps. The mucus was collected in a microcentrifuge tube containing 0.2 mL of PBS with protease inhibitor cocktail by stripping with a pair of forceps. The samples were vortexed briefly and centrifuged at 10,000 g for 10 min at 4 C. The supernatants were separated and stored at 20 C. 2.5.5. Tissues Gill, skin (about 2 cm2 on the lateral side) and intestine (about 2 cm of hind gut) samples were collected in RNAlater® and stored at 20 C until processed.
3
2.6. Enzyme linked immunosorbent assay (ELISA) The serum, gill mucus, skin mucus, and intestinal mucus IgM level were assessed by ELISA following the protocol described by LaFrentz et al. [35] with modifications. The 96 well ELISA plates were coated with 100 mL of inactivated F. psychrophilum B.17-ILM (containing 1 108 CFU mL1 before inactivation) in bicarbonate buffer (pH 9.6) and incubated overnight at 4 C. On the following day the plates were washed three times with PBS containing 0.05% Tween 20 (PBST) and the samples were added to the first well in the column and serially diluted two fold in PBST containing 0.02% sodium azide. The initial dilution of the samples were 1:200 for serum, 1:8 for gill mucus, undiluted for skin mucus and intestinal mucus samples. Positive and negative rainbow trout serum controls were also included in each plate. The plates were incubated at 15 C overnight. The plates were washed three times in PBST and mouse monoclonal antibody (MAb 1.14) [36] against trout IgM was added at a dilution of 1:400 containing 0.1% non-fat dry milk at 100 mL well1. The plates were incubated for 1 h at room temperature (RT) followed by three washings with PBST. The plates were incubated with 100 mL well1 of goat anti-mouse Ig HRP conjugate (Bio-rad, USA) diluted 1:4000 in PBS containing 0.1% non-fat dry milk for 1 h at RT. The plates were washed 3 times with PBS and 50 mL ABTS peroxidase substrate (KPL Inc., USA) was added. The plates were incubated at RT for 15 min in the dark and the reaction was stopped by adding 50 mL of 1% SDS solution and the plates were read at 405 nm in an ELISA plate reader (Biotek, USA). The antibody titre in serum was determined as the reciprocal of the highest dilution of the serum having twice the OD of the negative controls. For gill, intestinal and skin mucus samples the OD values of the initial dilution were used as such for analysis as reference negative and positive controls were not available. The serum IgD level was assessed by ELISA using the same protocol described above using an initial dilution of 1:50. The secondary antibody, the mouse monoclonal anti-trout IgD antibody was kindly provided by Dr. John Hansen, WFRC-USGS Biological Resources Division through the U. S. Veterinary Immunological Reagent Network (http://www.umass. edu/vetimm/trout/index.html). The plates were read at 405 nm in an ELISA plate reader and the OD values of the initial dilutions were used for the analysis. All the data was further subjected to one way analysis of variance using SPSS 16.0 software. The ELISA titres were considered statistically significant if p values were <0.05. 2.7. Reverse transcription quantitative real-time PCR (RT-qPCR) 2.7.1. RNA extraction The leukocytes stored in RNAlater were transferred to lysis buffer and the cells were lysed by repeated pipetting. Other tissues viz. gills, skin and intestine were transferred to lysis buffer and homogenized using a tissue homogenizer (Retsch, USA). Total RNA was extracted from tissue lysate using Pure Link RNA mini kit (Life Technologies, USA) following the manufacturers protocol. The RNA was eluted using 30 mL of nuclease free water and was quantified using Nanodrop (ND-1000) spectrophotometer. 2.7.2. cDNA synthesis The genomic DNA contamination in the isolated RNA was removed by digesting the DNA using RNase-Free DNase (1 U/535 ng of RNA) (Promega, USA) and incubating for 30 min at 37 C. The reaction was stopped by adding stop solution (1 mL/10 mL) and incubating for 10 min at 65 C. The resulting RNA was used for cDNA synthesis. Reverse transcription of 375 ng of DNA free RNA samples was carried out in a total volume of 15 mL using Superscript VILO cDNA synthesis kit (Life Technologies, USA) following the
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 4/8
4
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
manufacturer's instructions. The cDNA synthesized was used for RT-qPCR. 2.7.3. RT-qPCR RT-qPCR was carried out using SYBR select master mix (Life Technologies, USA) in ABI 7500 Fast Real-time PCR system (Applied Biosystems, USA). The primer sequences used for amplification of secretory IgM (sIgM), secretory IgD (sIgD) and secretory IgT (sIgT) and the reference gene elongation factor-1a (EF-1a) are given in Table 2. The reaction mix consisted of 5 mL of SYBR Green select master mix (2X), 10 pmol each of forward and reverse primer and cDNA equivalent to 25 ng of RNA. The thermal profile consisted of 50 C for 2 min, 95 C for 2 min followed by 40 cycles of 95 C for 3 s and 60 C for 30 s. The default melt curve cycle was used to analyze the melt curve of the amplified products. For each sample three replicate wells were used. The threshold cycle value (Ct value) was determined using the automatic settings of the ABI 7500 Fast Realtime PCR system. The expression of sIgM, sIgT and sIgD was normalized to the expression of EF-1a. The fold change in expression of the immunoglobulin genes compared to the 0 DPI sample was calculated according to 2DDCT method [37]. The data was further subjected to one way analysis of variance using SPSS 16.0 software. The expression levels were considered statistically significant if p values were <0.05. 3. Results 3.1. ELISA The average serum, gill mucus, skin mucus, and intestinal mucus IgM levels for samples collected at different time points after vaccination are given in Fig. 1. The serum IgM level was significantly elevated in fish immunized by the IP route by 28 DPI and reached a peak at 42 DPI. The serum IgM level in groups vaccinated by other routes did not differ significantly. A similar trend was observed for gill mucus and skin mucus IgM levels. However, no increase in IgM levels in intestinal mucus was observed for any of the groups. No significant increase in serum IgD level at any time point in any group was observed. 3.2. RT-qPCR The normal expression of IgM, IgT and IgD in lymphocytes, gill, skin and intestine of rainbow trout before immunization (0 day) is given in Fig. 2. IgM expression was highest in lymphocytes followed by intestine, gill and skin, and was significantly higher than IgT and IgD in all the tissues. The relative expression of IgT and IgD was much less compared to IgM. The relative expression of IgM, IgT and IgD in lymphocytes, gill, skin and intestine normalized against EF-1a is represented graphically in Figs. 3e6 respectively. IgM expression in different tissues depended on the route of immunization. The peak IgM expression Fig. 1. Mean IgM levels ± SEM (n ¼ 4) in serum, gill, skin and intestinal mucus for samples collected at 0, 3, 7, 14, 28, 42 and 56 days post-immunization in rainbow trout immunized with Flavobacterium psychrophilum by different routes.
Table 2 Details of primers used in RT-qPCR. Primer
Sequence
Amplicon size
Reference
sIgM F sIgM R sIgT F sIgT R sIgD F sIgD R EF-1a F EF-1a R
AAGAAAGCCTACAAGAGGGAGA CGTCAACAAGCCAAGCCACTA CAGACAACAGCACCTCACCTA GAGTCAATAAGAAGACACAACGA TGGCACACCAGGATTTGAC TCAGAATTGAGTGAACGGACAGACA GGCAAGAAACTTGAGGATGC ACAGTCTGCCTCATGTCACG
157
[29]
115
[29]
120
[21]
149
[52]
was observed at 7 DPI in the lymphocytes in the IP immunized group and in gills and skin in bath immunized group while the peak IgM expression in intestine was observed at 28 DPI in the AI group. The peak IgT expression was observed at 3 DPI in lymphocytes and intestine in the AI group and in gills in the bath immunized group. The peak IgT expression in skin was much delayed and was observed at 42 DPI in the bath immunized group.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 5/8
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
5
The peak IgD expression in lymphocytes was observed at 14 DPI in the AI group and at 3 DPI in gills and intestine in the bath immunized group and AI group, respectively. The peak IgD expression in skin was observed only by 42 DPI in the AI group. 4. Discussion The mucosal surfaces of fish are in continuous contact with commensals, opportunistic and obligate pathogens and hence immunity at the mucosal surface is thought to play an important role in protecting the fish from pathogens. In the present study, IP immunization alone resulted in significant IgM production in serum and in gill and skin mucus while other routes of immunization did not result in significant anti-F. psychrophilum IgM production. This is in contrast to previous studies [31,32,38] showing antibody production following immersion delivery. The reason for the lack of specific antibodies in fish following immersion or AI routes is unclear but could be related to dose delivered and the use of larger fish in this study. The lack of IgM in the intestinal mucus could also be due to the strong proteolytic environment in the gut mucus [39] which could degrade the secreted Igs. Valdenegro-Vega et al. [34] too reported higher antibody response in serum and skin mucus in IP immunized Atlantic salmon and not in fish immunized by anal intubation and immersion routes with dinitrophenol and fluorescein isothiocyanate each conjugated with keyhole limpet hemocyanin. Although it is reported that IgM is produced locally at the mucosal surfaces [40], stimulation of the mucosal surface by bath immunization did not elicit a significant increase in IgM secretion in mucus while IP immunization resulted in increase in gill and skin mucus IgM. Further, the timing of increase in gill and skin mucus IgM corresponds with the increase in serum IgM. Hence it is hypothesized that in addition to local production of IgM, a portion of the IgM present in the mucus may be derived from blood. IgM from blood may be transported to the mucus passively [41] or through the polymeric Ig receptors (pIgR) found in all mucosal surfaces and liver which specifically binds to teleost IgM and IgT [29,42e45]. However Swan et al. [46] postulated that systemically stimulated B cells following IP immunization migrate to mucosal tissues where they produce antibodies locally. No significant IgD antibody titres were observed in serum of fish in the various groups at any time points by ELISA. This is not unexpected and is likely due to the low level of IgD in serum [23]. However, the secreted IgD levels in mucus samples were not tested.
Fig. 3. Mean fold change in expression of sIgM, sIgT and sIgD ± standard error (n ¼ 4) in lymphocytes of rainbow trout at different time points after immunization by different routes. Unimmunized fish (0 day) were used as control.
Fig. 2. Normal expression (0 day) of sIgM, sIgT and sIgD in lymphocytes, gill, skin and intestine of rainbow trout normalized against EF-1a. Data represents mean absolute values (±SEM) (n ¼ 4). Different letters over bars with in a tissue indicate significant difference in their expression (p < 0.05).
Basal IgM expression was significantly higher in all the tissues tested compared to IgT and IgD as also reported earlier [16,47,48]. The immunization route influenced the IgM transcript production in tissues. Tissues that were directly exposed to the bacterin, depending upon the immunization route, expressed the highest amount of IgM transcripts. However, this did not translate into IgM secretion. Although bath immunization and AI routes produced the highest expression of IgM transcripts in gill, skin and intestine, none of these routes resulted in any significant increase in secreted IgM in the mucus of gill, skin and intestines. Lack of correlation between gene expression at transcript level and protein level has been reported in yeast [49] and for complement factors C4 and C5 in rainbow trout [50]. Further, antibody (IgM) production in serum and mucus occurred much latter at 28 DPI (peaking at 42 DPI) while peak IgM transcripts were observed at 7 DPI. Such time lag in antibody secretion compared to transcript production has also been reported in zebra fish, where IgM was detected at 28 days posthatch while mRNA transcripts were observed at 7e10 days posthatch [51]. The peak IgM transcripts were observed in blood from IP immunized fish, in gills and skin in bath immunized fish and in
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 6/8
6
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
intestines from the AI fish suggesting that IgM plays a role in both systemic and mucosal immunity. IgT and IgD genes were upregulated in gills significantly at 3 DPI in bath immunized group indicating that IgT and IgD are involved in gill mucosal immunity. The increase in IgD expression in gills was about 347 fold followed by IgT (~53 fold) in fish from the immersion immunized group. Since expression was significantly higher in bath immunized fish as early as 3 DPI, it is hypothesized that the IgT and IgD producing B lymphocytes are present locally and this resulted in increased expression of these Igs upon stimulation by bath vaccination. This is contrary to the findings of Tian et al. [47], where IgD positive cells were not found in gills and intestine of mandarin fish, Siniperca chuatsi by in situ hybridization. However in humans, the IgDþ B lymphocytes comprises of 20e25% of upper respiratory tract mucosal B cells while only about 3% are found in peripheral blood [22]. Furthermore human IgDþ B cells recognize Gramnegative respiratory bacteria and their products [24]. It is very likely that teleost gills are populated with more IgD positive cells and stimulation by F. psychrophilum vaccination resulted in increased IgD transcripts. A similar trend was observed in the intestines of AI fish where IgT and IgD transcripts were upregulated about 8 and 20 fold at 3 DPI indicating these antibodies may play an important role in gut immunity. However, IgT and IgD expression in skin was very late and suggests that IgT and IgD secreting B cells
may be lacking in the skin. Such late upregulation could be due to subsequent migration of IgT and IgD secreting B cells to skin, but this has not been confirmed. Among all the three Ig transcripts, IgT and IgD were upregulated as early as 3 DPI especially in gills and intestine while the peak IgM transcripts were observed only by 7 DPI suggesting that IgT and IgD might contribute to immediate protection to the host at mucosal surfaces against the invading pathogens. Although the relative basal expression of IgD was lowest followed by IgT among the three Igs, the quantum of increase in expression was the highest for IgD followed by IgT in all the three mucosal tissues tested indicating a role for these two antibodies in mucosal immunity. Further, the peak IgT and IgD expression in all the tissues were observed only in bath immunized and anal intubation groups suggesting that these two Igs are specialized in mucosal immunity. Although IgT is reported to play a role in gut immunity [29], this is believed to be the first report describing IgD involvement in mucosal immunity in teleosts. This provides further evidence that systemic and mucosal immunity are compartmentalized to some level in teleosts. Although IP immunization results in IgM production both systemically and at mucosal surfaces, indicating IP route may be the ideal route of immunization, the significant upregulation of IgD and IgT transcripts at mucosal
Fig. 4. Mean fold change in expression of sIgM, sIgT and sIgD ± standard error (n ¼ 4) in gills of rainbow trout at different time points after immunization by different routes. Unimmunized fish (0 day) were used as control.
Fig. 5. Mean fold change in expression of sIgM, sIgT and sIgD ± standard error (n ¼ 4) in skin of rainbow trout at different time points after immunization by different routes. Unimmunized fish (0 day) were used as control.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3316_proof ■ 17 February 2015 ■ 7/8
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
7
acknowledges the Indian Council of Agricultural Research and Dr. W.S. Lakra, Director, CIFE for the support. References
Fig. 6. Mean fold change in expression of sIgM, sIgT and sIgD ± standard error (n ¼ 4) in intestine of rainbow trout at different time points after immunization by different routes. Unimmunized fish (0 day) were used as control.
tissues following exposure to antigen implies that bath vaccination and anal intubation methods should be given due attention as these methods seem to offer protection to the fish at mucosal surfaces, which are the natural routes for pathogen entry. Quantification of secreted IgD and IgT at the mucosal surfaces and challenge studies are required to confirm the findings. In conclusion, this study demonstrates that IgM plays a role in both systemic and mucosal immunity in teleosts. Furthermore, IgT and IgD genes were found to be significantly upregulated in gills and intestine in bath immunized and AI groups suggesting that these two antibody isotypes are specialized to mucosal sites. Such mucosal antibodies may offer early protection against invading pathogens at mucosal surfaces. Evidence from this study suggests that teleost adaptive immunity is at least partially compartmentalized into systemic and mucosal components similar to mammals.
Acknowledgment The first author acknowledges the funding provided by Department of Biotechnology, Govt. of India (Grant No. BT/IN/DBTCREST Awards/20/MM/2012-13). The first author also
[1] Nematollahi A, Decostere A, Pasmans F, Haesebrouck F. Flavobacterium psychrophilum infections in salmonid fish. J Fish Dis 2003;26:563e74. [2] Barnes ME, Brown ML. A review of Flavobacterium psychrophilum biology, clinical signs, and bacterial cold water disease prevention and treatment. Open Fish Sci J 2011;4:40e8. [3] Hansen JD, Landis ED, Phillips RB. Discovery of a unique Ig heavy-chain isotype (IgT) in rainbow trout: implications for a distinctive B cell developmental pathway in teleost fish. Proc Natl Acad Sci 2005;102:6919e24. [4] Danilova N, Bussmann J, Jekosch K, Steiner LA. The immunoglobulin heavychain locus in zebrafish: identification and expression of a previously unknown isotype, immunoglobulin Z. Nat Immunol 2005;6:295e302. [5] Savan R, Aman A, Nakao M, Watanuki H, Sakai M. Discovery of a novel immunoglobulin heavy chain gene chimera from common carp (Cyprinus carpio L.). Immunogenetics 2005;57:458e63. [6] Flajnik MF. Comparative analyses of immunoglobulin genes: surprises and portents. Nat Rev Immunol 2002;2:688e98. [7] Acton RT, Weinheimer PF, Hall SJ, Niedermeier W, Shelton E, Bennett JC. Tetrameric immune macroglobulins in three orders of bony fishes. Proc Natl Acad Sci 1971;68:107e11. [8] Salinas I, Zhang Y, Sunyer JO. Mucosal immunoglobulins and B cells of teleost fish. Dev Comp Immunol 2011;35:1346e65. [9] Ohta Y, Flajnik M. IgD, like IgM, is a primordial immunoglobulin class perpetuated in most jawed vertebrates. Proc Natl Acad Sci 2006;103: 10723e8. [10] Zhu L, Yan Z, Feng M, Peng D, Guo Y, Hu X, et al. Identification of sturgeon IgD bridges the evolutionary gap between elasmobranchs and teleosts. Dev Comp Immunol 2014;42:138e47. €m L, Zhao Y. The immunoglobulin d gene in jawed [11] Sun Y, Wei Z, Hammarstro vertebrates: a comparative overview. Dev Comp Immunol 2011;35:975e81. NE, Miller NW, Clem LW, Pasquier LD, Warr GW. A novel [12] Wilson M, Bengte chimeric Ig heavy chain from a teleost fish shares similarities to IgD. Proc Natl Acad Sci 1997;94:4593e7. [13] Hordvik I, Thevarajan J, Samdal I, Bastani N, Krossøy B. Molecular cloning and phylogenetic analysis of the Atlantic salmon immunoglobulin D gene. Scand J Immunol 1999;50:202e10. [14] Stenvik J, Jorgensen TO. Immunoglobulin D (IgD) of Atlantic cod has a unique structure. Immunogenetics 2000;51:452e61. [15] Hordvik I. Identification of a novel immunoglobulin d transcript and comparative analysis of the genes encoding IgD in Atlantic salmon and Atlantic halibut. Mol Immunol 2002;39:85e91. [16] Hirono I, Nam BH, Enomoto J, Uchino K, Aoki T. Cloning and characterisation of a cDNA encoding Japanese flounder Paralichthys olivaceus IgD. Fish Shellfish Immunol 2003;15:63e70. [17] Saha NR, Suetake H, Kikuchi K, Suzuki Y. Fugu immunoglobulin D: a highly unusual gene with unprecedented duplications in its constant region. Immunogenetics 2004;56:438e47. [18] Xiao FS, Wang YP, Yan W, Chang MX, Yao WJ, Xu QQ, et al. Ig heavy chain genes and their locus in grass carp Ctenopharyngodon idella. Fish Shellfish Immunol 2010;29:594e9. [19] Gambon-Deza F, Sanchez-Espinel C, Magadan-Mompo S. Presence of an unique IgT on the IGH locus in three-spined stickleback fish (Gasterosteus aculeatus) and the very recent generation of a repertoire of VH genes. Dev Comp Immunol 2010;34:114e22. [20] Bao Y, Wang T, Guo Y, Zhao Z, Li N, Zhao Y. The immunoglobulin gene loci in the teleost Gasterosteus aculeatus. Fish Shellfish Immunol 2010;28:40e8. [21] Ramirez-Gomez F, Greene W, Rego K, Hansen JD, Costa G, Kataria P, et al. Discovery and characterization of secretory IgD in rainbow trout: secretory IgD is produced through a novel splicing mechanism. J Immunol 2012;188: 1341e9. [22] Edholm E, Bengten E, Wilson M. Insights into the function of IgD. Dev Comp Immunol 2011;35:1309e16. [23] Bengten E, Quiniou SM, Stuge TB, Katagiri T, Miller NW, Clem LW, et al. The IgH locus of the channel catfish, Ictalurus punctatus, contains multiple constant region gene sequences: different genes encode heavy chains of membrane and secreted IgD. J Immunol 2002;169:2488e97. [24] Chen K, Xu W, Wilson M, He B, Miller NW, Bengten E, et al. Immunoglobulin D enhances immune surveillance by activating antimicrobial, proinflammatory and B cell-stimulating programs in basophils. Nat Immunol 2009;10:889e98. [25] Flajnik MF. All GOD's creatures got dedicated mucosal immunity. Nat Immunol 2010;11:777e9. [26] Savan R, Aman A, Sato K, Yamaguchi R, Sakai M. Discovery of a new class of immunoglobulin heavy chain from fugu. Eur J Immunol 2005;35:3320e31. [27] Tadiso TM, Lie KK, Hordvik I. Molecular cloning of IgT from Atlantic salmon, and analysis of the relative expression of t, m and d in different tissues. Vet Immunol Immunopathol 2011;139:17e26. [28] Zhang YA, Salinas I, Sunyer JO. Recent findings on the structure and function of teleost IgT. Fish Shellfish Immunol 2011;31:627e34.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32
YFSIM3316_proof ■ 17 February 2015 ■ 8/8
8
M. Makesh et al. / Fish & Shellfish Immunology xxx (2015) 1e8
[29] Zhang YA, Salinas I, Li J, Parra D, Bjork S, Xu Z, et al. IgT, a primitive immunoglobulin class specialized in mucosal immunity. Nat Immunol 2010;11: 827e35. [30] Heinecke RD, Chettri JK, Buchmann K. Adaptive and innate immune molecules in developing rainbow trout, Oncorhynchus mykiss eggs and larvae: expression of genes and occurrence of effector molecules. Fish Shellfish Immunol 2014;38:25e33. [31] LaFrentz BR, LaPatra SE, Call DR, Cain KD. Isolation of rifampicin resistant Flavobacterium psychrophilum strains and their potential as live attenuated vaccine candidates. Vaccine 2008;26:5582e9. [32] Long A, Fehringer TR, Swain MA, LaFrentz BR, Call DR, Cain KD. Enhanced efficacy of an attenuated Flavobacterium psychrophilum strain cultured under iron-limited conditions. Fish Shellfish Immunol 2013;35:1477e82. [33] Crippen TL, Bootland LM, Leong JC, Fitzpatrick MS, Schreck CB, Vella AT. Analysis of salmonid leukocytes purified by hypotonic lysis of erythrocytes. J Aquat Anim Health 2001;13:234e45. [34] Valdenegro-Vega VA, Crosbie P, Vincent B, Cain KD, Nowak BF. Effect of immunization route on mucosal and systemic immune response in Atlantic salmon (Salmo salar). Vet Immunol Immunopathol 2013;151:113e23. [35] LaFrentz BR, LaPatra SE, Jones GR, Congleton JL, Sun B, Cain KD. Characterization of serum and mucosal antibody responses and relative per cent survival in rainbow trout, Oncorhynchus mykiss (Walbaum), following immunization and challenge with Flavobacterium psychrophilum. J Fish Dis 2002;25:703e13. [36] DeLuca D, Wilson M, Warr GW. Lymphocyte heterogeneity in the trout, Salmo gairdneri, defined with monoclonal antibodies to IgM. Eur J Immunol 1983;13: 546e51. [37] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:2002e7. [38] Xu Z, Chen CF, Mao ZJ, Zhu WY. Detection of serum and mucosal antibody production and antibody secreting cells (ASCs) in large yellow croaker (Pseudosciaena crocea) following vaccination with Vibrio harveyi via different routes. Aquaculture 2009;287:243e7. [39] Hatten F, Fredriksen A, Hordvik I, Endresen C. Presence of IgM in cutaneous mucus, but not in gut mucus of Atlantic salmon, Salmo salar. Serum IgM is rapidly degraded when added to gut mucus. Fish Shellfish Immunol 2001;11: 257e68. [40] Coscia MR, Simoniello P, Giacomelli S, Oreste U, Motta CM. Investigation of immunoglobulins in skin of the Antarctic teleost Trematomus bernacchii. Fish Shellfish Immunol 2014;39:206e14.
[41] Cain KD, Jones DR, Raison RL. Characterisation of mucosal and systemic immune responses in rainbow trout (Oncorhynchus mykiss) using surface plasmon resonance. Fish Shellfish Immunol 2000;10:651e66. [42] Hamuro K, Suetake H, Saha NR, Kikuchi K, Suzuki Y. A teleost polymeric Ig receptor exhibiting two Ig-like domains transports tetrameric IgM into the skin. J Immunol 2007;178:5682e9. [43] Rombout JHWM, van der Tuin SJL, Yang G, Schopman N, Mroczek A, Hermsen T, et al. Expression of the polymeric immunoglobulin receptor (pIgR) in mucosal tissues of common carp (Cyprinus carpio L.). Fish Shellfish Immunol 2008;24:620e8. [44] Tadiso TM, Sharma A, Hordvik I. Analysis of polymeric immunoglobulin receptor and CD300-like molecules from Atlantic salmon. Mol Immunol 2011;49:462e73. [45] Xu G, Zhan W, Ding B, Sheng X. Molecular cloning and expression analysis of polymeric immunoglobulin receptor in flounder (Paralichthys olivaceus). Fish Shellfish Immunol 2013;35:653e60. [46] Swan CM, Lindstrom NM, Cain KD. Identification of a localized mucosal immune response in rainbow trout, Oncorhynchus mykiss (Walbaum), following immunization with a protein-hapten antigen. J Fish Dis 2008;31:383e93. [47] Tian J, Sun B, Luo Y, Zhang Y, Nie P. Distribution of IgM, IgD and IgZ in mandarin fish, Siniperca chuatsi lymphoid tissues and their transcriptional changes after Flavobacterium columnare stimulation. Aquaculture 2009;288: 14e21. [48] Ryo S, Wijdeven RHM, Tyagi A, Hermsen T, Kono T, Karunasagar I, et al. Common carp have two subclasses of bonyfish specific antibody IgZ showing differential expression in response to infection. Dev Comp Immunol 2010;34: 1183e90. [49] Gygi SP, Rochon Y, Franza BR, Aebersold R. Correlation between protein and mRNA abundance in yeast. Mol Cell Biol 1999;19:1720e30. [50] Løvoll M, Kilvik T, Boshra H, Bøgwald J, Sunyer JO, Dalmo RA. Maternal transfer of complement components C3-1, C3-3, C3-4, C4, C5, C7, Bf, and Df to offspring in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2006;58: 168e79. [51] Lam SH, Chua HL, Gong Z, Lam TJ, Sin YM. Development and maturation of the immune system in zebrafish, Danio rerio: a gene expression profiling, in situ hybridization and immunological study. Dev Comp Immunol 2004;28:9e28. [52] Martin E, Trichet VV, Legrand-Frossi C, Frippiat J. Comparison between intestinal and non-mucosal immune functions of rainbow trout, Oncorhynchus mykiss. Fish Shellfish Immunol 2012;33:1258e68.
Please cite this article in press as: Makesh M, et al., Systemic and mucosal immune response of rainbow trout to immunization with an attenuated Flavobacterium psychrophilum vaccine strain by different routes, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/ j.fsi.2015.02.003
33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64