Systems-based Saccharomyces cerevisiae strain design for improved squalene synthesis

Biochemical Engineering Journal 148 (2019) 37–45

Contents lists available at ScienceDirect

Biochemical Engineering Journal journal homepage: www.elsevier.com/locate/bej

Regular article

Systems-based Saccharomyces cerevisiae strain design for improved squalene synthesis Kalaivani Paramasivana,b, Punil Kumar HNc, Sarma Mutturia,b,

T

⁎

a

Microbiology and Fermentation Technology Department, CSIR-Central Food Technological Research Institute, Mysuru, India Academy of Scientific and Innovative Research, Ghaziabad, Uttar Pradesh, India c Technology Scale-up Department, CSIR-Central Food Technological Research Institute, Mysuru, India b

H I GH L IG H T S

of in-silico medium affects identification of gene knock-outs. • Composition and ADK1 were identified as deletion targets for improved squalene flux. • LYS1 ADK1Δ and POS5 (with mitochondrial signal) overexpression improves squalene. • LYS1Δ, • Fed-batch cultivation under low aerobic cultivation increased squalene to 1.9 g/L.

A R T I C LE I N FO

A B S T R A C T

Keywords: Squalene S. cerevisiae Genome-scale model LYS1 Fed-batch

Constraint-based flux balance analysis of S. cerevisiae has led to the identification of a novel gene deletion targets, LYS1 and ADK1, for enhancement of squalene flux. LYS1 deletion resulted in 2-fold improvement in squalene when compared to reference strain BY4741 with a maximum yield of 33.1 mg/g DCW. A double mutant of ADK1 and LYS1 genes has increased the squalene yield to 38 mg/g DW which is 2.38-fold higher over the control strain. Furthermore, single copies of tHMG1 and POS5 (with mitochondrial signal sequence) genes have been integrated into this double mutant in order to enhance the precursor pool and the cofactor regeneration capacity, respectively, for enhanced squalene synthesis. The improved strain, SK22 has resulted in squalene yield of 65 mg/g DW which is 4-folds higher than the control strain. Finally, the engineered strain was cultivated in a bioreactor using fed-batch strategy to improve the titer and productivity of squalene. Exponential feeding (openloop strategy) using high residual glucose (˜40–60 g/L) has increased the squalene titer to a maximum of 1.9 g/L with a yield of 0.15 g/g DCW, which is several folds higher than the shake-flask results. Redirecting the lysine synthesis by external supplementation could potentially improve squalene flux in S. cerevisiae.

1. Introduction

Synechococcus elongates, S. cerevisiae and Kluyveromyces lactis [3–13]. S. cerevisiae is a most sought cell factory for terpenoid production and has been widely used as a platform strain for bio-based production [14,15]. Owing to the GRAS status, established genetic manipulation techniques, well-understood physiology [16] and availability of genome-scale models [17], S. cerevisiae has been widely chosen as a cell factory for metabolic engineering. In the past decade, more than fifty studies have been carried out in diversified terpene production using S. cerevisiae as a cell factory and has been reviewed recently [18]. Squalene is synthesized in S. cerevisiae intracellularly using sterol metabolic pathway where the terminal compound is ergosterol. However, its accumulation inside the cell is very low (0.0008 g/g glucose) in the control strain of present study, whereas, theoretical yield

Terpenes are one of the largest class of natural products with more than 50,000 structures elucidated so far and are being used as fragrances, flavors, fuels, and pharmaceuticals. Squalene is a triterpene which has several applications such as moisturizing agent, dietary supplement, an anticancer agent, vaccine adjuvant, etc. [1]. Squalene is commercially obtained from shark liver oil and plant seed oil. However, the restrictions on shark hunting and limited production using plant sources with growing demand have prompted the development of microbial fermentation for squalene production [2]. Squalene is being produced in microbes such as Aurantiochytrium sp., Pseudozyma sp., Pediococcus acidilactici, Cyanobacteria, E. coli, Yarrowia lipolytic,

⁎

Corresponding author at: Microbiology and Fermentation Technology Department, CSIR-Central Food Technological Research Institute, Mysuru, India. E-mail address: [email protected] (S. Mutturi).

https://doi.org/10.1016/j.bej.2019.04.025 Received 5 February 2019; Received in revised form 20 April 2019; Accepted 23 April 2019 Available online 25 April 2019 1369-703X/ © 2019 Elsevier B.V. All rights reserved.

Biochemical Engineering Journal 148 (2019) 37–45

K. Paramasivan, et al.

Table 1 Primers, strains, and plasmids used in the study. Name

Description

Ref

Primers HLEU-F HLEU-R AADK1-SP BADK1-SP CADK1-SP DADK1-SP BMADK1-SP CMADK1-SP Int-FP1 Int-RP1 tHMG1-PI tHMG1-AII POS5 – SII POS5- NI

TTTCTCTGGTAAAGTCACCACACAGCATCAAATATAACAGTAATG GCCGCCAGCTGAAGCTTCGTA TAAAAAAAAGAAAAGATATTTAGAAGACATTGCGCAAGGTCATTACAGATCCGCGGCCGCATAGG GTTGTGTCTTCCTGTTTTCTCTGTT GACCATTCTAATGGATTCTGAGCTA AATTGAAGGTTGATGATGAATTGTT AAAAGCGCTTATTTCGTTATAGGTT CACTGAGGTTGGCGATGCTA TTGGATAACTGGAGCCGTGG GCAGCAGCGATCGCCCTAGGCGATTAATTAACGACGCCGGTGGCCGCTTGTAATTAAAACTTAGATTAGATTGC GCAGCAGCGATCGCTCTTAGCTAGCCGCGGTAC GCAGCATTAATTAAATGGACCAATTGGTGAAAACTGAAGTCACCA GCAGCACCTAGGTTAGGATTTAATGCAGGTGACGGACC ACGCGCCCGCGGATGTTTGTCAGGGTTAAATTGAATAAACCAGTAAA ACGCGCGCTAGCTTAATCATTATCAGTCTGTCTCTTGGTCAGCC

This This This This This This This This This This This This This This

Strains DH5α BY4741

F–endA1glnV44thi-1 recA1 relA1 gyrA96 deoR nupG purB20 φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK–mK+), λ– MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0

Y05969

BY4741; MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; YIR034c::kanMX4

SK20 SK21 SK22

BY4741; MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; YDR226w::KILEU2 BY4741; MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; YIR034c::kanMX4;YDR226w::KILEU2 BY4741; MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; YIR034c::kanMX4;YDR226w::KILEU2;X2::loxp-KIURA3-loxp- PTEF1-tHMG1- PPGK1-POS5[pCFB-TPHP], Derivative of SK21

Invitrogen EUROSCARF, SRD GmbH EUROSCARF, SRD GmbH This study This study This study

Plasmids pUG73 pCFB2188 pCFB-TPM pCFB-TPH pCFB-TPHP

loxP-flanked marker gene deletion cassette harboring Kluyvermyces lactis LEU2(KlLEU2) gene: loxP-KlLEU2-loxP Cre/Lox Yeast integrative expression vector harboring Kluyvermyces lactis URA3(KlURA3) gene: loxP-KlURA3-loxP Yeast integrative expression vector – loxP-KlURA3-loxP; PTEF1-PPGK1 Yeast integrative expression vector – loxP-KlURA3-loxP; tHMG1 < -PTEF1-PPGK1 Yeast integrative expression vector – loxP-KlURA3-loxP; tHMG1 < -PTEF1-PPGK1- > POS5.

study study study study study study study study study study study study study study

[46] [44] This study This study This study

has performed better than other existing tools for the selected cases. Deletion target(s) identified by FOCuS were implemented in the in-vivo experiments along with the integration of earlier found tHMG1 and POS5 targets to develop a stable S. cerevisiae strain for improved squalene synthesis.

(per gram glucose) could be 0.338 g/g glucose based on stoichiometry [18]. Overexpression of tHMG1 has been found to be an essential and efficient strategy to improve terpene producing precursors in S. cerevisiae [2,19–23]. From our earlier studies, it was observed that overexpression of tHMG1 and POS5 (full length with the mitochondrial signal) using dual promoter vector has significantly improved the squalene synthesis to 55 mg/g DCW [20]. tHMG1 codes for HMG-CoA reductase which catalyzes the rate limiting reaction in the ergosterol biosynthesis pathway, whereas, POS5 codes for NADH kinase and is involved in NADPH regeneration. Here, co-expression of tHMG1 and POS5 could behave as push and pull strategy [24], where the tHMG1p improves the precursor pool and the POS5p regenerates the NADPH pool required for squalene synthesis. One of the critical strategies in metabolic engineering is to scout for the gene targets in the entire genome, either for deletion or overexpression which enhances the flux of the target metabolite. Such an elaborate search mechanism has been possible by genome-scale models. The mathematical representation of genome-scale models as metabolic network aids in the simulation of flux distribution in an organism [25]. Flux balance analysis can be efficiently applied for prediction of growth-phenotypes in normal genotype [26]. The application of flux balance analysis has been extended to predict knock-out mutants by the introduction of Gene Protein Reaction (GPR) associations using tools such as Opt-knock, OptFlux, OptStrain, MOMA, Reacknock and OptForce [27–33]. In-silico strain engineering is successfully applied in the production of compounds such as 2,3-butanediol, fumaric acid, and sesquiterpenes in S. cerevisiae [34–37]. In the present study, the iMM904 genome-scale model of S. cerevisiae has been used to find the gene deletion target(s) using an in-house developed computational tool FOCuS [38]. FOCuS (Flower Pollination and Clonal Selection) is a novel gene deletion tool developed for predicting gene knockouts from genome-scale models using metaheuristic and sectioning approach [38]. It is a computationally less intensive and

2. Materials and methods 2.1. Chemicals Squalene and ergosterol standards were procured from SigmaAldrich (Bangalore, India). Other HPLC-grade chemicals were procured from SRL (Mumbai, India) and Qualigens (Mumbai, India). Gene amplifications were performed using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) and Taq polymerase (Sigma-Aldrich, Bangalore, India). The restriction endonuclease and ligase enzymes were obtained from New England Biolabs (New England Biolabs, Ipswich, MA, USA). Plasmid isolation from E. coli was performed with the GenElute Plasmid Miniprep Kit (PLN70, SigmaAldrich). QIAquick Gel Extraction Kit (#28704, Qiagen) was used for gel extraction. Column-Pure PCR Clean-Up Kit (#D509, Applied Biological Materials Inc) was used for PCR product purification. 2.2. Stoichiometric modeling The computational analysis was carried out using the ConstraintBased Reconstruction and Analysis (COBRA) Toolbox (http:// systemsbiology.ucsd.edu/downloads/COBRAToolbox/) [39,40] and the SBML Toolbox (http://sbml.org/software/sbmltoolbox/) within the MATLAB® software environment (Mathworks Inc., http://www. mathworks.com/) [41,42]. The genome-scale metabolic model Sc_iMM904 consisting of 904 genes, 1577 reactions and 1228 metabolites of S. cerevisiae were selected for calculating the flux balance 38

Biochemical Engineering Journal 148 (2019) 37–45

K. Paramasivan, et al.

temperature of 30 °C and pH of 5.5 (controlled with 2 N NaOH). The mineral salts medium as described by van Hoek et al. [48] and Verduyn et al. [49] with (NH4)2SO4, 7.5 g; KH2PO4, 3.5 g; MgSO47H2O, 0.74 g; Antifoam 289 (A-5551, Sigma-Aldrich, St. Louis, MO, USA), 0.05 mL; trace elements, 1.8 mL and vitamins, 1 mL was used in batch. The trace metal solution consisted of the following (per liter): EDTA (sodium salt), 6.0 g; CaCl2 7H2O, 1.8 g; ZnSO4 7H2O, 1.8 g; CoCl2 2H2O, 0.12 g; CuSO4 5H2O, 0.12 g; Na2MoO4 7H2O, 0.16 g; CaCl2 7H2O, 1.8 g; FeSO4 7H2O, 1.2 g; H3BO3, 0.4 g and KI, 0.04 g. The vitamin solution contained (per liter): biotin, 0.05 g; p-aminobenzoic acid, 0.2 g; nicotinic acid, 1 g; Ca-pantothenate, 1 g; pyridoxine−HCl, 1 g; thiamine−HCl, 1 g and myo-inositol, 25 g. The agitation of the reactor was set at 600 rpm, and the aeration was maintained at one vvm by sparging filtered air. The synthetic defined medium is supplemented with the auxotrophic amino acids L-leucine, 30 mg/L; L-methionine, 20 mg/L; Luracil, 20 mg/L and L-histidine, 20 mg/L. The modified synthetic medium was also supplemented with the amino acids L-phenylalanine, 50 mg/L; L-serine, 400 mg/L; L-threonine, 200 mg/L and L-glutamic acid, 100 mg/L [50]. Also, L-lysine, 30 mg/L was added in the medium for the strains harboring lys1Δ.

analysis [43]. Optimization was carried out using Gurobi MILP solver (Gurobi Optimization, Inc. Houston, TX, USA) interfaced with the COBRA toolbox. The in-silico medium used for computations is provided in Table S1. FOCuS tool was used to predict the gene knockouts from Sc_iMM904 as described in Mutturi [38]. The algorithm and its implementation is discussed in Mutturi [38]. 2.3. Plasmid construction The list of plasmids used and developed in the current study are provided in Table 1. pCfB2188 was a kind gift from Dr. Irina Borodina (Addgene plasmid #67296) [44]. The plasmid pCFB2188-TPM was constructed by cloning the promoter cassette PTEF1-PPGK1 in pCEVG1km (Addgne plasmid #46813) using AsisI, single cloning restriction site after phosphatase treatment. The resulting plasmid can be used to clone any two genes of interest which can be further integrated into the S. cerevisiae genome. tHMG1 and POS5 genes were amplified from the template DNA using the primer set tHMG1-PI, tHMG1-AII, and POS5–SII, POS5-NI, respectively. pCFB2188-TPH was constructed by cloning the tHMG1 gene in PacI and AvrII restriction sites. Further, the POS5 gene was cloned into pCFB2188-TPH to obtain pCFB2188-TPHP using the flanking restriction sites of NheI and SacII. The gene cassette loxp-KIURA3-loxp-tHMG1-PTEF1-PPGK1-POS5 along with yeast homologous regions was restriction digested with NotI enzyme for yeast integration. The plasmids were propagated in E. coli DH5α cells.

2.7. Fed-batch fermentation The fed-batch cultivation was carried out in a 5 L bioreactor vessel (Bioflo 110, New Brunswick Scientific Co. Inc., USA) with an initial working volume of 1.5 L and mineral salts medium comprising (NH4)2SO4, 20 g; KH2PO4, 10 g; MgSO4 7H2O, 2 g; trace elements, 10 mL and vitamins, 1 mL. The feed solution contained either only glucose (500 g/L) or glucose (500 g/L) followed by ethanol (500 mL/L, 99.0%). The feeding was exponential with an initial feed rate of 0.015 L/h which was increased exponentially to 0.11 L/h at the end of 15 h of elapsed time. The feeding was according to the following formula

2.4. Strain design S. cerevisiae BY4741, a derivative of S288C [45] and Y05969 (lys1Δ) obtained from EUROSCARF were used as the parent strains for generating adk1Δ and lys1Δadk1Δ strains, respectively. Disruption of ADK1 gene was performed by transforming recyclable loxp flanked leucine marker disruption cassette [46] into BY4741 and Y05969. The disruption cassette (loxP-KlLEU2-loxP) was amplified via PCR (Phusion® High-Fidelity DNA Polymerase, Finnzymes/Thermo Scientific) from the pug73 plasmid using the primers HLEU-F and HLEU-R generating 40 bp overlap regions homologous to the genomic locus to be disrupted. Yeast strains, BY4741 and Y05969 were transformed with 1–5 μg PCR product to obtain SK20 and SK21, respectively. The strains carrying the ADK1 disruption cassette were selected based on their growth at 30 °C on SD medium lacking leucine [47]. SK21 has later transformed with the restriction digested product of pCFB2188-TPH with NotI enzyme to form SK22 which harbors tHMG1 and POS5 gene (Table 1). The aliquot of the strains grown in liquid culture was mixed with glycerol to a final concentration of 40% for long-term storage at −80 °C.

μg = 0.15h−1 Xbg Cell denstity(g wet-cell/L)at the end of batch vg = 0.5 × μg (50%of specific growth rate) Vgb is volume at the end of batch growth vg glucose consumption rate(g glucose/g wet-cell/h)

F = vg Vbg Xbg e μg t The feeding was carried using an automated peristaltic pump (Reglo digital ISM831, Cole-Parmer GmbH, Germany) and was driven using an in-house developed LabVIEW- based software program. Head space oxygen and carbon dioxide gases were monitored using exit gas analyzer (Technovation Analytical Instruments Pvt. Ltd., Mumbai, India). After cultivation, the cells were harvested by centrifugation at 6000 rpm using a centrifuge. The pellets were resuspended in 0.9% NaCl solution in order to obtain a cell suspension.

2.5. Growth and cultivation conditions E. coli cells were cultivated at 37 °C and 180 rpm in LB medium (5 g/ L yeast extract, 10 g/L tryptone, 10 g/L NaCl, for solid medium 20 g/L agar) with 100 mg/L ampicillin whenever necessary. Yeast cells were grown in complex (20 g/L glucose, 10 g/L yeast extract, and 20 g/L peptone, for solid medium 20 g/L agar) and synthetic medium (20 g/L glucose, 6.7 g/L yeast nitrogen base with ammonium sulfate and without amino acids, 1 g/L amino acid mixture) adjusted to pH 5.5 with NaOH and for solid medium 20 g/L agar as per the requirement. The cultivation of E. coli for cloning experiments was carried according to Paramasivan and Sarma (2017b) [20]. All shake flask experiments were carried in triplicate, and the experimental data are represented as means ± standard deviations.

2.8. Squalene extraction and analysis The harvested cells were extracted for squalene and quantified using HPLC according to the procedure detailed in Paramasivan et al. [51]. Squalene is quantitatively represented in terms of concentration/titer (g/L) and yield- based on dry cell weight (g/g DCW). 2.9. Analysis of extracellular metabolites The supernatant was collected and filtered through 0.45 μm cellulose acetate filter (Corning Inc., Corning, NY) and stored at −20 °C until subsequent analysis. The samples were subjected to isocratic HPLC using Aminex HPX-87H column, (Bio-Rad Laboratories, Inc., USA) (particle size five μm, 300 × 7.8 mm i.d.) at 65 °C and H2SO4 as a mobile phase at a flow rate of 0.6 mL/min for glucose, ethanol and

2.6. Batch reactor cultivation Batch cultivation was carried out in a 2 L bioreactor (BioFlo 110, New Brunswick Scientific Co. Inc., USA) with a working volume of 0.7 L using 20 g/L of glucose as carbon source and maintained at a 39

Biochemical Engineering Journal 148 (2019) 37–45

K. Paramasivan, et al.

not have any significant effect on growth rate. However, the squalene content has been increased to 2-fold. Residual glucose and the extracellular metabolites (ethanol and glycerol) were measured, and the results are shown in Fig. 3a–c. The ethanol production has reached a maximum of 6.8 g/L in the wild-type strain, and the double mutant strain SK21 produced a maximum of 2.4 g/L (Fig. 3b). In all the three mutants the ethanol synthesis has lowered significantly when compared to the wild type strain (Fig. 3b). Ergosterol was found to be 30-fold higher at the end of the cultivation (90 h) when compared to the ergosterol content in the log phase (6 h) (Fig. 3d). Further, the maximum ergosterol content in the mutant strain is 5-fold higher than the maximum ergosterol content in the wild-type strain which is 3 mg/g DCW (Fig. 3d). Squalene synthesis was found to be maximum at the end of 18 h while the ergosterol synthesis was found to be higher at the end of 90 h (Figs. 2a and b; 3 d).

glycerol measurements. 3. Results 3.1. Effect of in-silico growth medium to compute knockout targets for squalene improvement In the present study in-silico gene knockouts have been computed for improving squalene in S. cerevisiae using iMM904, genome-scale model. Three different growth media classified as simple (SM, comprising glucose, oxygen and maintenance ATP), auxiliary (AM, simple medium with uracil, histidine, methionine and leucine) and complete (CM, simple medium enriched with all amino acids, vitamins and trace elements) have been used as the inputs for iMM904 to predict knockouts using flux-balance analysis studies. The medium constituents for all the three preparations are provided in Table S1. The knockouts were carried using a novel heuristic- based deletion algorithm known as FOCuS [38]. It has been found that the simple medium was unable to increase squalene fluxes beyond the capacity of the wild-type strain. However, the auxiliary and complete medium could achieve more than 77% and 89% of the theoretical maximum (TM), respectively, for all the response fluxes (cf. Table S2). The targets were observed to be URA3 in case of AM, and LYS1 and ADK1 in case of CM. Synthesis of lysine involving LYS1 gene expends NADPH, pyrimidine pathway involving URA3 gene expends ATP, whereas purine pathway involving ADK1 utilizes ATP. As sterol pathway requires several moles of ATP and NADPH, probably deletion of these identified genes and enriching the medium with the auxotrohic requirement could divert and feed these cofactors to sterol pathway. Here the targets from CM (LYS1 and ADK1) were chosen for in-vivo validation as the strain BY4741 is already uracil auxotroph (Table 1).

3.3. Effect of integrating tHMG1 and full-length POS5 on squalene synthesis In our earlier study, it was observed that overexpression of tHMG1 along with full-length POS5 episomally, improves squalene synthesis significantly in laboratory strain BY4741 [20]. In the present study, in order to generate a genetically stable S. cerevisiae strain for improved squalene, integration of tHMG1 and POS5 into double mutant SK21 was conceived. The integrated strain, referred to as SK22, was used to carry shake-flask experiments to observe squalene improvement. Hanscho et al. [50] observed that the BY series S. cerevisiae strains grow poorly in synthetic medium, and the addition of L-phenylalanine, L-serine, Lthreonine, and L-glutamic acid and inositol improves the growth of the organism significantly [50]. Hence in the current study, these components were externally added in addition to auxotrophic requirements of SK20. Totally four different media, viz., Synthetic medium (SM), synthetic medium with inositol (SMI), modified synthetic medium (MSM) containing additional amino acids, MSM with inositol (MSMI) and yeast extract-peptone (YPD) medium were used to cultivate SK22. It can be observed from Table 2 that media SM and SMI has a significant amount of residual glucose left at the end of cultivation (24 h). However, in the media MSM and MSMI with additional amino acids has not only improved biomass but also lowered the residual glucose (cf. Table 2). Amongst the all media tested, maximum squalene yield of 15.2 mg/g DCW and maximum titer 16.1 mg/L was observed using MSM in BY4741. All three strains, BY4741, SK21 and SK22, were cultivated in MSM and YPD to study the time course of squalene and ergosterol synthesis. The strain SK22 produced maximum squalene at the end of 6 h and declined after that until 18 h (Fig. 4a & b). In the case of strain SK21and BY4741, maximum squalene was observed at the end of 18 h. Among the three strains, maximum squalene of 65 mg/g DCW and 51 mg/g DCW was observed in SK22 using synthetic medium and YPD, respectively (Fig. 4a & b). Ergosterol content has increased by 14.5 folds at the end of 18 h in SK22 in comparison to SK21 using the synthetic medium (Fig. 4c & d). In summary, the fold increase in various stages of strain development starting from BY4741 up to SK22 is provided in Table 3.

3.2. Effect of ADK1 and LYS1 deletions on squalene accumulation Here, the in-silico – based identified knockouts viz., ADK1 and LYS1, are validated in in-vivo experiments. ADK1 was deleted using BY4741 as a parent strain to generate SK20 (Table 1). LYS1 deletion strain (Y05969), which is a mutant of BY4741, was obtained from EUROSCARF (SRD, GmbH) and was used as the background to delete ADK1 to obtain SK21 (Table 1). The validation for ADK1 gene deletion was carried using both gene-specific primers, and the internal primers for deletion cassette to carry out PCR reaction for the respective strains (Fig. S1). The generated yeast strains with ADK1 and LYS1 deletion have resulted in lesser biomass accumulation when compared to wildtype cells (Fig. 1a). These results are in agreement with the in-silico results, where the specific growth was lowered when the reactions governed by ADK1 and LYS1 were removed from the iMM904 during FBA studies. Experimentally, the growth of the strains was examined and compared by drop-test assays in rich medium plates containing glucose as a carbon source (Fig. 1b). Squalene was estimated up to 90 h in the wild-type and all the three mutant strains. The results are provided in Fig. 2. It has been found that the double mutant strain, SK21 produces 2.3-fold higher squalene over the wild-type strain which amounted to 38 mg/g DCW at the end of 18 h. Disruption of LYS1 did

Fig. 1. Effect of disruption of LYS1 and ADK1 on physiological parameters of yeast. Influence of gene disruption (lys1Δ, adk1Δ – SK20, lys1Δadk1Δ – SK21) in comparison to the wild type on (a) biomass formation (dry cell weight, DCW) as a function of time during glucose-phase as well as ethanol-phase (b) Drop test assay. Shown are mean values and standard deviations of three experiments.

40

Biochemical Engineering Journal 148 (2019) 37–45

K. Paramasivan, et al.

Fig. 2. Effect of disruption of LYS1 and ADK1 on squalene and ergosterol synthesis in shake flask cultivation. (a) yield of squalene (mg/g DCW), (b) squalene titer (mg/L). Shown are mean values and standard deviations of three experiments.

Fig. 3. Time course of metabolites during the growth of wild type and mutant strains (a) glucose consumption, (b) ethanol, (c) glycerol and (d) ergosterol.

(Fig. 5(d–f)). It can also be observed that there was complete consumption of glucose at the end of 24 h in case of MSM- based cultivation, however, the SM- based cultivation resulted in more than 5 g/L of residual glucose at the end 24 h. These results are in agreement with the shake-flask studies as seen in Table 2. A maximum squalene yield of 75.8 mg/g DCW and squalene titer of 71.9 mg/L was achieved at the end of 18 h (cf. Fig. 5e & f) using MSM. The net increase in squalene yield and titer in case of SK22 was observed to 2-fold and 1.3-fold when compared to SK21. Similar to SK21, the glucose level in SK22 has

3.4. Batch reactor cultivation of strain SK21 and SK22 for squalene synthesis The stably integrated strain SK22 and its chassis strain SK21 were evaluated for squalene synthesis in a batch reactor at a working volume of 0.7 L using SM and MSM synthetic media. In case of cultivation in SM, maximum squalene achieved was 39.9 mg/g DCW and 23.9 mg/L, whereas in case of MSM cultivation the squalene titer and yield were observed to be 36.6 mg/L and 57.8 mg/g DCW, respectively 41

Biochemical Engineering Journal 148 (2019) 37–45

K. Paramasivan, et al.

however, during the squalene synthesis in the fed-batch phase the ergosterol production dropped significantly (Fig. 6c). In the case of the second strategy, the dissolved oxygen was maintained within the range of 0–10% (cf. Fig. S4b). Here, during the glucose feeding phase (40–65 h) the CO2 evolution was maximum (cf. Fig. S4d) and a concomitant increase in DCW. During this period although the residual glucose was around 50 g/L, there was a sudden surge in the squalene synthesis with a maximum accumulation of 1.93 g/L and productivity of 0.036 g/L/h. In both the strategies, the squalene accumulation peaked during the active growth phase and when the residual glucose was high. Semi-anaerobic condition and glucose stress approach have proven to be an effective strategy for improved squalene synthesis.

Table 2 Effect of medium composition on OD600, residual glucose, squalene yield and titer using strain BY4741. Medium

SM SMI MSM MSMI YPD

A600

2.8 2.36 4.64 4.61 5.3

Residual glucose (g/L)

7.1 6.2 0.62 0.18 0.76

Squalene Yield (mg/g DCW)

Titer (mg/L)

12.0 11.2 15.2 6.4 8.0

6.6 7.5 16.1 5.7 7.87

SM: Synthetic medium, SMI: SM with inositol, MSM: Modified synthetic medium, MSMI: MSM with inositol and YPD: Yeast extract peptone medium. Shown are mean values and standard deviations of three experiments.

4. Discussion During the last two decades, there have been several reports on yeast platform strain development for value-added terpene production [18]. In the present study, a yeast chassis for enhanced squalene synthesis has been developed using metabolic engineering strategies. Several studies have been focused on a redirection of flux from central metabolic pathways such as pyruvate dehydrogenase bypass, TCA cycle, glyoxalate pathway and ammonium assimilation to terpenoid production [34,35,52,53]. However, this is the first report to emphasize a redirection of flux from amino acid and purine biosynthesis pathway to the terpenoid pathway. The predicted deletion target include LYS1 which is involved in the lysine biosynthesis and is one of the competing pathways for acetyl-CoA and a second target ADK1 which is involved in the conversion of AMP to ADP and purine biosynthesis pathway. From the in-silico studies, it was observed that improvement in squalene flux is predominantly due to LYS1 deletion than ADK1 deletion. The results of all reaction fluxes from iMM904 for the cases before and after LYS1 deletion are reported in Table S3. It is evident from Table S3, when LYS1 is deleted, the fluxes inside the lysine pathway have reduced to zero (0 mmol/gDW/h). This indicates, NADPH involved in the reactions carried by LYS2 and LYS9 can be utilized by other reactions. Also the reaction LYS21 and LYS20 involved in acetyl-CoA consumption is reduced to zero, indicating its diversion to other pathways (possibly to sterol synthesis). In case of control (before LYS1 deletion), these reactions have positive flux values (equal to 0.07197 mmol/gDW/h). Thus, it is speculated that LYS1 deletion improves both NADPH and acetylCoA pool that in turn could be channeled towards the ergosterol pathway. Anabolic reactions such as amino acid synthesis usually expend NADPH. Here, the deletion of LYS1 and supplementation of the medium with external lysine could perhaps redirect the NADPH into the sterol pathway, which also requires considerable NADPH [18]. ADK1 is a nonessential gene, and the adk1p maintains the equilibrium of the

reached zero at the end of 12 h, whereas, the growth is 1.5-fold higher over the SK21 strain (Fig. 5c & e). In the batch cultivations, the growth of the strains is indicated by gradual decrease in dissolved oxygen (DO) values with concatenating decrease in pH with base addition for both strains (Fig. S3a–c). In case of SK21 and SK22 grown in MSM, the sudden increase in CO2% and drop in O2% at the end of 9 h and 12 h, respectively, indicated the exhaustion of glucose (cf. Figs. S3e & f & 5 b, c).

3.5. Fed-batch cultivation of SK22 for squalene synthesis Fed-batch cultivation of SK22 was carried in order to increase the productivity, titer, and yield of squalene. Two fed-batch runs were carried based on the feeding strategy. In the first case, only glucose was used as a carbon source under the high aerobic conditions (DO > 20%), whereas in the second run glucose feeding was followed by ethanol under low aerobic conditions (0% < DO < 10%). From Fig. 6a it can be observed that the glucose was completely consumed at the end of 36 h, and the exponential glucose feeding was initiated. Active growth of biomass was observed with increasing DCW and a concomitant drop in DO (Figs. 6a & S4a). Also, it can be observed that during active growth there is continuous base addition due to which the pH profile fluctuated, and CO2 production has gradually increased (cf. Fig. S4). Squalene synthesis can be observed during the batch phase. However, during the fed-batch phase, there was a surge of its synthesis after 45 h during the active growth phase (Figs. 6 and S5). In the first fed-batch phase, a maximum of 1.17 g/L and productivity of 0.0245 g/ L/h was observed at the end of 50 h during the fed-batch soon after the consumption of accumulated glucose which peaked to 58 g/L at the end of 42 h (cf. Fig. 6a). Ergosterol accumulated before squalene synthesis,

Fig. 4. Effect of tHMG1 and POS5 gene integration on squalene and ergosterol content under synthetic and complex medium: (a) & (b) Squalene yield (mg/g DCW) as a function of time on synthetic medium (SM) and complex medium (YPD), respectively, (c) & (d) Ergosterol yield (mg/g DCW) as a function of time on synthetic defined medium and complex medium, respectively. Shown are mean values and standard deviations of three experiments.

42

Biochemical Engineering Journal 148 (2019) 37–45

K. Paramasivan, et al.

Table 3 Squalene yield and titer from various strains developed in the study. Sl. No.

Strain

Modification

Maximum squalene yield (mg/gDCW)a

Fold increase

Maximum squalene titer (mg/L)a

Fold increase

1 2 3 4 5

BY4741 lys1Δ SK20 SK21 SK22

– lys1Δ adk1Δ lys1Δadk1Δ lys1Δadk1Δ tHMG1-POS5

16.5 33.1 30 38 64.4

– 2.0 1.81 2.3 3.9

12.3 24.8 22.5 28 55.35

– 2.01 1.82 2.28 4.5

a

Shown are mean values of three independent shake flask cultivations. The standard deviation for each sample was below 5%.

secondary carbon source during fed-batch cultivation. However, squalene synthesis was not improved during ethanol phase. Also during the time course studies in both batch and fed-batch, the decrease in squalene after peaking to a maximum value could be due to its conversion to other downstream sterol products. Similar trend was observed by Mantzouridou and Tsimidou [56], where the squalene accumulation fluctuated during cultivation of S. cerevisiae AM63 and AM64 strains. For both the aeration conditions, maximum squalene accumulated during active growth phase when glucose was fed. It was observed by Hanscho et al. (2012) that when one of the essential amino acids is depleted, the cell growth is arrested at high residual glucose concentration, the cell size increases and the cells convert glucose to storage lipids [50]. This could perhaps be plausible reasoning. However, further studies are needed to understand the surge in squalene accumulation. In a study by Han et al. (2018) bacterial ispA and tHMG1 gene combined with partial inhibition of squalene epoxidase by terbinafine has increased the squalene production to 2011 ± 75 mg/L in glucosebased fed-batch cultivation [8]. However, as the genes were under control of the gal promoter, intermittent galactose was added to induce the expression in their study. Overexpression of tHMG1 and DGA1 coding for diacylglycerol acyltranferase has led to a 250-fold increase in squalene titer to a maximum of 445.6 mg/L in a nitrogen-limited and galactose-based fed-batch cultivation [5]. Similar to Han et al. (2018) the gene over-expression was carried out using an episomal plasmid under galactose promoters. Overexpression of tHMG1 and ERG10 has enhanced the squalene titer to 150 mg/L in xylose-based media by using a xylose-fermenting strain [12]. To the best of our knowledge, this is the first example of redirection of flux from the amino acid pathway and purine pathway to supply precursor and reducing equivalents respectively under aerobic or microaerobic cultivation

adenine nucleotide pool in the yeast cells. ADK1 gene deletion has shown to upregulate the phosphate utilization genes in transcriptome analysis [54]. ADK1 gene deletion increases the accumulation of the precursor molecule, adenine which in turn has shown to increase NADPH pool in the cells [55]. Hence, adk1Δ could presumably increase the activity of squalene synthase by increasing the availability of NADPH. Overall the results show that the identified genes have increased the squalene synthesis in the S. cerevisiae (cf. Table 3). When tHMG1 gene expression was combined with the expression of NADPH regenerating enzymes coded by ZWF1 and POS5 genes episomally in high copy number plasmids, the squalene was further improved which signifies that the terpene synthesis is limited by cofactor supply [20]. Hence, both tHMG1 and POS5 gene targets have been integrated into the yeast chromosome for the development of a robust strain with stable expression and enhanced product flux. To improve the biomass and lower the residual glucose in synthetic medium, additional amino acids and inositol were added as reported by Hanscho et al. (2012) [50]. The additional amino acids in the synthetic medium have significantly improved the biomass and lowered the residual glucose to zero (Table 2). This medium termed as MSM has also improved squalene when compared to complex YPD medium (cf. Table 2). According to Mantzouridou and Tsimidou (2010), semianaerobic is most amenable for squalene synthesis because the cells lose its ability to synthesize ergosterol and the downstream reactions of squalene will be ceased during the strict-anaerobic cultivation [56]. However, under strict anaerobic conditions, external ergosterol addition is necessary and could incur additional medium costs [57]. Hence, low aerobic conditions were tested by maintaining the DO in the range of 0–10%. Ethanol has proven to be one of the best carbon sources for terpene production as it improves the formation of acetyl-CoA [15,35,58]. Hence in the present study, ethanol was also used as a

Fig. 5. Batch cultivation (a & d) SK21 strain in synthetic medium (SM), (b & e) SK21 strain in modified synthetic medium (MSM), and (c & f) SK22 strain in MSM. SQ: squalene, ERG: ergosterol, DCW: dry cell weight (g/L). 43

Biochemical Engineering Journal 148 (2019) 37–45

K. Paramasivan, et al.

Fig. 6. Fed-Batch cultivation of SK22 using MSM. Time course profiles of glucose, DCW, squalene, and ergosterol; (a & c) glucose as the carbon source under high aerobic conditions, (b & d) glucose and ethanol as a carbon source under low aerobic conditions.

Appendix A. Supplementary data

conditions for the production of squalene molecule in an S. cerevisiae host strain.

Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.bej.2019.04.025.

5. Conclusion

References

Here we demonstrated the systems- based metabolic engineering of S. cerevisiae strain for squalene synthesis by four genetic interventions followed by process optimization. Stoichiometric modeling using modified in-silico medium has predicted deletion of LYS1 and ADK1 as successful targets for improved squalene flux. In-vivo validation of the in-silico predicted gene targets has proven to improve squalene synthesis in S. cerevisiae. The study describes a combined multistep strain engineering strategy to improve the precursor pool, cofactor supply and redirection of central metabolism towards squalene synthesis. The genetic perturbations, modified medium conditions, and fed-batch fermentation has synergistically improved the squalene accumulation in the yeast cells to 1937 mg/L which is several folds higher over the parent strain BY4741. This study potentially contributes to existing strategies for squalene synthesis in S. cerevisiae.

[1] E. Naziri, F. Mantzouridou, M.Z. Tsimidou, Squalene resources and uses point to the potential of biotechnology, Lipid Technol. 23 (2011) 270–273. [2] K.A.G. Donald, R.Y. Hampton, I.B. Fritz, Effects of overproduction of the catalytic domain of 3-hydroxy-3- methylglutaryl coenzyme A reductase on squalene synthesis in Saccharomyces cerevisiae, Appl. Environ. Microbiol. 63 (1997) 3341–3344. [3] M. Bittencourt, F. Raquel, G. Vendruscolo, M. Manzoni, J. Smanioto, B. Cristiano, R. De Menezes, L. Queiroz, Z. Eduardo, J. Lopes, R. Wagner, Towards a sustainable route for the production of squalene using Cyanobacteria, Waste Bio. Val. (2018) 1–8. [4] E. Drozdíková, M. Garaiová, Z. Csáky, M. Obernauerová, I. Hapala, Production of squalene by lactose-fermenting yeast Kluyveromyces lactis with reduced squalene epoxidase activity, Lett. Appl. Microbiol. 61 (2015) 77–84. [5] L. Wei, S. Kwak, J.L.S. Lane, Q. Hua, D.K.Y. Jin, Improved squalene production through increasing lipid contents in Saccharomyces cerevisiae, Biotechnol. Bioeng. 115 (2018) 1793–1800. [6] S.Y. Choi, J. Wang, H.S. Kwak, S. Lee, Y. Um, Y. Kim, S.J. Sim, J. Choi, H.M. Woo, Improvement of squalene production from CO in Synechococcus elongatus PCC 7942 by metabolic engineering and scalable production in a photobioreactor, ACS Synth. Biol. 6 (2017) 1289–1295. [7] A. Gupta, N. Sharma, Characterization of potential probiotic lactic acid bacteriaPediococcus acidilactici Ch-2 isolated from chuli– a traditional apricot product of himalayan region for the production of novel bioactive compounds with special therapeutic properties Anupama, J. Food Microbiol. Saf. Hyg. 02 (2017) 1–11. [8] J.Y. Han, S. Hwa, S. Jae, M. Song, H. Lee, E.S. Choi, High ‑ level recombinant production of squalene using selected Saccharomyces cerevisiae strains, J. Ind. Microbiol. Biotechnol. 45 (2018) 239–251. [9] Y. Huang, X. Jian, Y. Lv, K. Nian, Q. Gao, J. Chen, L. Wei, Enhanced squalene biosynthesis in Yarrowia lipolytica based on metabolically engineered acetyl-CoA metabolism, J. Biotechnol. 281 (2018) 106–114. [10] A. Katabami, L. Li, M. Iwasaki, M. Furubayashi, K. Saito, D. Umeno, Production of squalene by squalene synthases and their truncated mutants in Escherichia coli, J. Biosci. Bioeng. 119 (2015) 165–171. [11] K. Kaya, A. Nakazawa, H. Matsuura, D. Honda, I. Inouye, M.M. Watanabe, K.K. Aya, A.N. Akazawa, H.M. Atsuura, D.H. Onda, Thraustochytrid aurantiochytrium sp. 18W-13a accummulates high amounts of squalene, Biosci. Biotechnol. Biochem. 8451 (2014) 10–13. [12] S. Kwak, S.R. Kim, H. Xu, G. Zhang, S. Lane, Enhanced isoprenoid production from xylose by engineered Saccharomyces cerevisiae, Biotechnol. Bioeng. 114 (2017) 2581–2591. [13] X. Song, X. Wang, Y. Tan, Y. Feng, W. Li, Q. Cui, High production of squalene using a newly isolated yeast-like strain, J. Agric. Food Chem. 63 (2015) 8445–8451. [14] C.J. Paddon, P.J. Westfall, D.J. Pitera, K. Benjamin, K. Fisher, D. McPhee, M.D. Leavell, A. Tai, A. Main, D. Eng, D.R. Polichuk, K.H. Teoh, D.W. Reed,

Funding This study was funded by the Science and Engineering Research Board (SERB) [YSS/2014/000565]. Availability LabVIEW files and implementation procedure will be made available upon request. Acknowledgments SM acknowledges the Science and Engineering Research Board (SERB), India for funding the project [YSS/2014/000565]. KP acknowledges Department of Biotechnology India, and Department of Science and Technology (DST), India for awarding the fellowship. The Director, CSIR – Central Food Technological Research Institute (CFTRI), Mysuru, India is also acknowledged for supporting this work. 44

Biochemical Engineering Journal 148 (2019) 37–45

K. Paramasivan, et al.

[15]

[16]

[17] [18] [19]

[20]

[21]

[22]

[23]

[24]

[25]

[26] [27]

[28] [29] [30]

[31] [32]

[33]

[34]

[35] E. Gruchattka, O. Kayser, In vivo validation of in silico predicted metabolic engineering strategies in yeast: disruption of α-ketoglutarate dehydrogenase and expression of ATP-citrate lyase for terpenoid production, PLoS One 10 (2015) 1–25. [36] C.Y. Ng, M. Jung, J. Lee, M. Oh, Production of 2,3-butanediol in Saccharomyces cerevisiae by in silico aided metabolic engineering, Microb. Cell Fact. 11 (2012) 1–14. [37] G. Xu, W. Zou, X. Chen, N. Xu, L. Liu, J. Chen, Fumaric acid production in Saccharomyces cerevisiae by in-silico aided metabolic engineering, PLoS One 7 (2012) 1–10. [38] S. Mutturi, FOCuS: a metaheuristic algorithm for computing knockouts from genome-scale models for strain optimization, Mol. Biosyst. 13 (2017) 1355–1363. [39] S.A. Becker, A.M. Feist, M.L. Mo, G. Hannum, B.Ø. Palsson, M.J. Herrgard, Quantitative prediction of cellular metabolism with constraint-based models: the COBRA toolbox, Nat. Protoc. 2 (2007) 727. [40] J. Schellenberger, R. Que, R.M.T. Fleming, I. Thiele, J.D. Orth, A.M. Feist, D.C. Zielinski, A. Bordbar, N.E. Lewis, S. Rahmanian, J. Kang, D. Hyduke, B.O. Palsson, Quantitative prediction of cellular metabolism with constraint- based models: the COBRA toolbox v2.0, Nat. Protoc. 6 (2012) 1290–1307. [41] S.M. Keating, B.J. Bornstein, A. Finney, M. Hucka, SBMLToolbox: an SBML toolbox for MATLAB users, Bioinformatics 22 (2018) 1275–1277. [42] H. Schmidt, M. Jirstrand, Systems biology toolbox for MATLAB: a computational platform for research in systems biology, Bioinformatics 22 (2006) 514–515. [43] M.L. Mo, B.Ø. Palsson, M.J. Herrgård, Connecting extracellular metabolomic measurements to intracellular flux states in yeast, BMC Syst. Biol. 3 (2009) 37. [44] V. Stovicek, I. Borodina, J. Forster, CRISPR – cas system enables fast and simple genome editing of industrial Saccharomyces cerevisiae strains, Metab. Eng. Commun. 2 (2015) 13–22. [45] C.B. Brachmann, A. Davies, G.J. Cost, E. Caputo, J. Li, P. Hieter, J.D. Boeke, Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications, Yeast 14 (1998) 115–132. [46] U. Güldener, S. Heck, T. Fiedler, J. Beinhauer, J.H. Hegemann, J. Gießen, F. Straße, A new efficient gene disruption cassette for repeated use in budding yeast, Nucleic Acids Res. 24 (1996) 2519–2524. [47] D.J. Burke, D. Dawson, T. Stearns, Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual, (2000). [48] P. van Hoek, E. De Hulster, J.P. Van Dijken, J.T. Pronk, Fermentative capacity in high-cell-density fed-batch cultures of Baker’s yeast, Biotechnol. Bioeng. 68 (2000) 517–523. [49] C. Verduyn, E. Postma, W. Scheffers, J.P.V.A.N. Dijken, Effect of benzoic acid on metabolic fluxes in yeasts : a continuous-culture study on the regulation of respiration and alcoholic fermentation, Yeast 8 (1992) 501–517. [50] M. Hanscho, D.E. Ruckerbauer, N. Chauhan, H.F. Hofbauer, S. Krahulec, B. Nidetzky, S.D. Kohlwein, J. Zanghellini, K. Natter, Nutritional requirements of the BY series of Saccharomyces cerevisiae strains for optimum growth, FEMS Yeast Res. 12 (2012) 796–808. [51] K. Paramasivan, K. Rajagopal, S. Mutturi, Studies on squalene biosynthesis and the standardization of its extraction methodology from Saccharomyces cerevisiae, Appl. Biochem. Biotechnol. 187 (2018) 691–707. [52] Y. Chen, L. Daviet, M. Schalk, V. Siewers, J. Nielsen, Establishing a platform cell factory through engineering of yeast acetyl-CoA metabolism, Metab. Eng. 15 (2013) 48–54. [53] Y. Shiba, E.M. Paradise, J. Kirby, D.K. Ro, J.D. Keasling, Engineering of the pyruvate dehydrogenase bypass in Saccharomyces cerevisiae for high-level production of isoprenoids, Metab. Eng. 9 (2007) 160–168. [54] S. Gauthier, F. Coulpier, L. Jourdren, M. Merle, S. Beck, M. Konrad, B. DaignanFornier, B. Pinson, Co-regulation of yeast purine and phosphate pathways in response to adenylic nucleotide variations, Mol. Microbiol. 68 (2008) 1583–1594. [55] A. Knepper, M. Schleicher, M. Klauke, D. Weuster-Botz, Enhancement of the NAD (P)(H) pool in Saccharomyces cerevisiae, Eng. Life Sci. 8 (2008) 381–389. [56] F. Mantzouridou, M.Z. Tsimidou, Observations on squalene accumulation in Saccharomyces cerevisiae due to the manipulation of HMG2 and ERG6, FEMS Yeast Res. 10 (2010) 699–707. [57] W. Visser, W.A. Scheffers, W. Batenburg-van der Vegte, J.P. Van Dijken, Oxygen requirements of fermentative yeasts, Appl. Environ. Microbiol. 56 (1990) 3785–3792. [58] B.E. Ebert, E. Czarnotta, L.M. Blank, Physiologic and metabolic characterization of Saccharomyces cerevisiae reveals limitations in the synthesis of the triterpene squalene, FEMS Yeast Res. 18 (2018) foy077.

T. Treynor, J. Lenihan, M. Fleck, S. Bajad, G. Dang, D. Dengrove, D. Diola, G. Dorin, K.W. Ellens, S. Fickes, J. Galazzo, S.P. Gaucher, T. Geistlinger, R. Henry, M. Hepp, T. Horning, T. Iqbal, H. Jiang, L. Kizer, B. Lieu, D. Melis, N. Moss, R. Regentin, S. Secrest, H. Tsuruta, R. Vazquez, L.F. Westblade, L. Xu, M. Yu, Y. Zhang, L. Zhao, J. Lievense, P.S. Covello, J.D. Keasling, K.K. Reiling, N.S. Renninger, J.D. Newman, High-level semi-synthetic production of the potent antimalarial artemisinin, Nature 496 (2013) 528–532. P.J. Westfall, D.J. Pitera, J.R. Lenihan, D. Eng, F.X. Woolard, R. Regentin, T. Horning, H. Tsuruta, D.J. Melis, A. Owens, S. Fickes, D. Diola, K.R. Benjamin, J.D. Keasling, M.D. Leavell, D.J. McPhee, N.S. Renninger, J.D. Newman, C.J. Paddon, From the cover: PNAS plus: production of amorphadiene in yeast, and its conversion to dihydroartemisinic acid, precursor to the antimalarial agent artemisinin, Proc. Natl. Acad. Sci. U. S. A 109 (2012) E111–8. C. Auesukaree, A. Damnernsawad, M. Kruatrachue, P. Pokethitiyook, C. Boonchird, Y. Kaneko, Genome-wide identification of genes involved in tolerance to various environmental stresses in Saccharomyces cerevisiae, J. Appl. Genet. 50 (2009) 301–310. H. Lopes, I. Rocha, Genome-scale modeling of yeast: chronology, applications and critical perspectives, FEMS Yeast Res. 17 (2017). K. Paramasivan, S. Mutturi, Progress in terpene synthesis strategies through engineering of Saccharomyces cerevisiae, Crit. Rev. Biotechnol. 37 (2017) 974–989. C. Ohto, M. Muramatsu, S. Obata, E. Sakuradani, S. Shimizu, Overexpression of the gene encoding HMG-CoA reductase in Saccharomyces cerevisiae for production of prenyl alcohols, Appl. Microbiol. Biotechnol. 82 (2009) 837–845. K. Paramasivan, S. Mutturi, Regeneration of NADPH coupled with HMG-CoA reductase activity increases squalene synthesis in Saccharomyces cerevisiae, J. Agric. Food Chem. 65 (2017) 8162–8170. T. Polakowski, U. Stahl, C. Lang, Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast, Appl. Microbiol. Biotechnol. 49 (1998) 66–71. K. Tokuhiro, M. Muramatsu, C. Ohto, T. Kawaguchi, S. Obata, N. Muramoto, M. Hirai, H. Takahashi, A. Kondo, E. Sakuradani, S. Shimizu, Overproduction of geranylgeraniol by metabolically engineered Saccharomyces cerevisiae, Appl. Environ. Microbiol. 75 (2009) 5536–5543. G.L. Yan, K.R. Wen, C.Q. Duan, Enhancement of β-carotene production by overexpression of HMG-CoA reductase coupled with addition of ergosterol biosynthesis inhibitors in recombinant Saccharomyces cerevisiae, Curr. Microbiol. 64 (2012) 159–163. X. Lv, W. Xie, W. Lu, F. Guo, J. Gu, H. Yu, L. Ye, Enhanced isoprene biosynthesis in Saccharomyces cerevisiae by engineering of the native acetyl-CoA and mevalonic acid pathways with a push-pull-restrain strategy, J. Biotechnol. 186 (2014) 128–136. A.M. Feist, M.J. Herrgård, I. Thiele, J.L. Reed, Ø. Bernhard, Reconstruction of biochemical networks in microbial organisms, Nat. Rev. Microbiol. 7 (2011) 129–143. J.D. Orth, I. Thiele, B.Ø. Palsson, What is flux balance analysis? Nat. Publ. Gr. 28 (2010) 245–248. A.P. Burgard, P. Pharkya, C.D. Maranas, Optknock: a bilevel programming framework for identifying gene knockout strategies for microbial strain optimization, Biotechnol. Bioeng. 84 (2003) 647–657. E. Goncalves, I. Rocha, M. Rocha, Computational tools for strain optimization by tuning the optimal level of gene expression, AISC 154 (2012) 251–258. P. Pharkya, A.P. Burgard, C.D. Maranas, OptStrain: a computational framework for redesign of microbial production systems, Genome Res. 14 (2004) 2367–2376. S. Ranganathan, P.F. Suthers, C.D. Maranas, OptForce : an optimization procedure for identifying all genetic manipulations leading to targeted overproductions, PLoS Comput. Biol. 6 (2010) s1000744. D. Segrè, D. Vitkup, G.M. Church, Analysis of optimality in natural and perturbed metabolic networks, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 15112–15117. Z. Xu, P. Zheng, J. Sun, Y. Ma, ReacKnock : identifying reaction deletion strategies for microbial strain optimization based on genome-scale metabolic network, PLoS One 8 (2013) e72150. H. Yim, R. Haselbeck, W. Niu, C. Pujol-Baxley, A. Burgard, J. Boldt, J. Khandurina, J.D. Trawick, R.E. Osterhout, R. Stephen, J. Estadilla, S. Teisan, H.B. Schreyer, S. Andrae, T.H. Yang, S.Y. Lee, M.J. Burk, S. Van Dien, Metabolic engineering of Escherichia coli for direct production of 1,4-butanediol, Nat. Chem. Biol. 7 (2011) 445–452. M.A. Asadollahi, J. Maury, K.R. Patil, M. Schalk, A. Clark, J. Nielsen, Enhancing sesquiterpene production in Saccharomyces cerevisiae through in silico driven metabolic engineering, Metab. Eng. 11 (2009) 328–334.

45