- Email: [email protected]
TAF5L functions as transcriptional coactivator of MITF involved in the immune response of the clam Meretrix petechialis
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
TAF5L functions as transcriptional coactivator of MITF involved in the immune response of the clam Meretrix petechialis Di Wanga,c, Shujing Zhanga, Baozhong Liua,b,c,∗ a
CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao, 266071, China Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266000, China c University of Chinese Academy of Sciences, Beijing, 100049, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: TAF5L MITF Innate immunity Meretrix petechialis
TAF5L is a component of the P300/CBP-associated factor (PCAF) histone acetylase complex, which serves as a coactivator and takes part in basal transcription such as promoter recognition, complex assembly and transcription initiation. In our study, the full-length sequence of MpTAF5L was identified and characterized in the clam M. petechialis. Sequence analysis showed that the predicted MpTAF5L protein had a N-terminal TAF5-NTD2 domain and a C-terminal WD40-repeats domain. The annotation and evolutionary analysis revealed MpTAF5L had close evolutionary relationship with other invertebrate species. Tissue distribution analysis of TAF5L claimed that it was highly expressed in the mantle, adductor muscle, foot and hepatopancreas. The mRNA expression of MpTAF5L was significantly up-regulated after Vibrio parahaemolyticus challenge, indicating its involvement in the immune response of clam. Yeast two-hybrid assays verified that MpTAF5L can interact with MpMITF (a critical immune-related transcription factor), and our further research clarified this interaction depended upon the N-terminal TAF5-NTD2 domain of MpTAF5L. Moreover, the mRNA expression of MpBcl-2 (a target gene of MITF) was significantly decreased but the mRNA expression of MpMITF was not significantly changed after knockdown of MpTAF5L, which indicated the reduction of MpMITF regulating activity at the same time. These results revealed that MpTAF5L interacted with MpMITF and enhanced the activation of MpMITF, which plays roles in the immune defense against V. parahaemolyticus.
1. Introduction Compared with vertebrate, invertebrate only has an innate immune system. However, this system is complex and regulated by multiple gene networks [1–3]. Among of them, the immune-related genes play important roles in the defense of pathogen invasion. The expression of immune-related genes could be enhanced by transcription factors through recruiting a universal transcription compound to the promoter [4–6]. The microphthalmia-associated transcription factor (MITF) is a critical transcription factor, containing a bHLH-LZ structure which binds to E-box elements in the promoters of downstream genes [7,8]. In mollusk, MITF gene was first identified in the clam Meretrix petechialis [9], and the further research demonstrated the role of MITF in regulating the downstream genes in immune signaling pathways [10]. The transcription factor itself is regulated by binding to the co-activator, which is a transcriptional synergistic regulator to increase downstream genes expression. Research shows that the activation of
MITF often requires the presence of co-activators such as P300/CBP [11,12]. TAF5L is a component of the P300/CBP-associated factor (PCAF) complex [13,14]. As a member of the WD-repeat TAF5 protein family, it is related to cell cycle and spermatogenesis through the coactivation with transcription factors [15,16]. However, it is still unclear whether TAF5L can activate the transcriptional activity of MITF. Recently, a report claimed TAF5L can interact with Myc that containing the bHLH conserved domain [17]. Similarly, MITF in M. petechialis has a basic bHLHZip domain [9], thus we wonder if and how TAF5L interacts with MITF. In present study, clam M. petechialis was selected as an experimental animal to analysis the role of TAF5L (MpTAF5L) in the innate immunity of mollusk. This clam is an important commercial species [18] and we have done series of immune and genetic research in this species [19–23]. Here, we identified a MpTAF5L gene and confirmed the interaction between MpTAF5L and MpMITF in this clam. In addition, we investigated the effects of this interaction on the activation of MpMITF.
∗ Corresponding author. CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao, 266071, China. E-mail address: [email protected] (B. Liu).
https://doi.org/10.1016/j.fsi.2019.11.039 Received 29 September 2019; Received in revised form 13 November 2019; Accepted 15 November 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Please cite this article as: Di Wang, Shujing Zhang and Baozhong Liu, Fish and Shellfish Immunology, https://doi.org/10.1016/j.fsi.2019.11.039
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
performed with the MpTAF5L-5′ GSP and MpTAF5L-5′NGSP primers (Table 1). For 3′ RACE, MpTAF5L-3′ GSP and MpTAF5L-3′ NGSP were used to amplify the fragments (Table 1). The PCR reaction conditions were 94 °C for 4 min, 35 cycles of 94 °C for 20s, 68 °C for 30s, and 72 °C for 2 min, finally extension at 72 °C for 10 min cMpTAF5L-F and cMpTAF5L-R primers (Table 1) were designed to confirm the complete assembled sequence by PCR. The nucleotide sequences and protein sequences of MpTAF5L were analyzed by BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The software BioEdit was used to translate nucleotide sequence into the amino acid sequence. ORF Finder (https://www.ncbi.nlm.nih.gov/ orffinder/) applied to predict the ORF of MpTAF5L. The molecular weight (MW) of the protein was calculated using the ExPASy Server (https://web.expasy.org/protparam/). The Clustal X 2.0 and MEGA10.0 was used to produce multiple sequence alignments and a neighbor-joining (NJ) phylogenetic tree, respectively.
Our research is helpful to understand the innate immune mechanism of mollusk. 2. Materials and methods 2.1. Experimental clams and Vibrio challenge The adult clams were bought from aquatic market in Qingdao, China. These clams were acclimated in a 30 L tank with aerated seawater and fed with microalgae for one week at 25 °C. Five clams were collected and the hepatopancreas, hemocytes, mantle, foot, gill and adductor muscle were dissected separately for tissue distribution analysis of MpTAF5L. Vibrio parahaemolyticus strain (MM21) [24] was used as a pathogen for challenge assay with immersion method. In brief, clams were put in the 30 L tank with filter seawater. V. parahaemolyticus was resuspended and cultured in medium 2216E. The cultured bacteria were counted by cell-count boards and then placed into seawater to reach the final concentration of 1 × 107 CFU ml−1. The seawater and V. parahaemolyticus were renewed every day during the challenge period. Nine individuals were randomly sampled on day 0, 1, 3 and 5 after challenge, and the hepatopancreas from each individual was removed and stored at −80 °C. For RNA isolation, hepatopancreas from three clams were mixed as one replicate and three replicates were assayed at each time point.
2.3. Quantitative realtime PCR To determine the tissue distribution of MpTAF5L, and the mRNA expression changes of MpTAF5L after Vibrio challenge, quantitative realtime PCR was carried out with the specific primers listed in Table 1. The mean expression value of β-actin and EF1α were employed as the internal references to normalize the relative expression levels among samples [26]. The relative gene expression level was analyze by the 2△△CT method [27]. The PCR procedure was set as 95 °C for 30 s, then 40 cycles of 95 °C for 5 s and 60 °C for 30 s.
2.2. Molecular cloning and sequence analysis of MpTAF5L Total RNA was extracted from the tissues by using An EZNA® Total RNA Kit (Omega, USA). The quantity and quality of extracted RNA was determined using a Nanodrop ND1000 spectrophotometer (Thermo Scientific, USA) and agarose gel electrophoresis, respectively. A PrimeScript™ RT reagent Kit with a gDNA Eraser (TaKaRa, Japan) was used for the cDNA synthesized from total RNA according to the manufacturer's instructions. The SMART™ RACE cDNA Amplification Kit (Clontech, USA) applied to obtain the full-length cDNA of MpTAF5L, on the basis of EST fragments from the transcriptomic data [25]. The 5′RACE was
2.4. RNA interference (RNAi) of MpTAF5L The 500bp-fragment of MpTAF5L ORF was amplified using the T7 promoter-linked primers TAF5L-T7-F and TAF5L-T7-R (Table 1). The 500bp-fragment of EGFP ORF was amplified by EGFP-T7-F and EGFPT7-R (Table 1) using the pEGFP vector plasmid (Clontech, USA) as template. Then the PCR production purified as the template for the synthesis of the double-stranded RNA (dsRNA). The TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific, USA) applied to
Table 1 Primers used in this study. Primer
Sequence (5′-3′)
cMpTAF5L-F cMpTAF5L-R MpTAF5L 5′-GSP MpTAF5L 5′-NGSP MpTAF5L 3′-GSP MpTAF5L 3′-NGSP Actin-F Actin-R EF1α-F EF1α-R MITF-RT-F MITF-RT-R TAF5L-RT-F TAF5L-RT-R Bcl-2–RT-F Bcl-2-RT-R TAF5L-T7-F TAF5L-T7-R EGFP-T7-F EGFP-T7-R yMITF-F yMITF-R yTAF5L-F yTAF5L-R yTAF5L-TAF5-F yTAF5L-TAF5-R yTAF5L-WD40-F yTAF5L-WD40-R
GGGATTCACACGTCTATTGACA CAACTGGAAGATAGCCCAATAC GCTGGTTGAGGACTTGAAGTAA CAGCATCTGTCCTGAATTGACT TCAGGTGGTCTTGACAGTTGTA GCATTCCCTACCAAGTCAATAC TTGTCTGGTGGTTCAACTATG GACTGATTTCTTACGGATG CTGGAAGAGATGCCAAAGGT ATGTCACGCACAGCAAAACG CGAGTTTCTCAACGGCACAGT ATGCTCTTCCCTTGCTTCACC ACTGTCACTGGCTTTCTCACCA TCCGCAAGTCCCATATCCTTAT GCACAGAACGGTTGAGAA TACGGAAACAAGACAAAGCT GCGTAATACGACTCACTATAGGGGGATTCACACGTCTATTGACA GCGTAATACGACTCACTATAGGGTCATATCAGCTTTGGAGGAGA GCGTAATACGACTCACTATAGGGAGCCATACCACATTTGTAGAGG GCGTAATACGACTCACTATAGGGCGCTTTCTTCCCTTCCTTT CATG GAG GCC GAATTCGCAGATTCAGGCATTGACATAGA GCAGGTCGACGGATCCTAAGCCATAATCCATGCTATCATCGT CATGGAGGCCGAATTCGGGGATTCACACGTCTATTGACA GCAGGTCGACGGATCCCACTGGTATTGACTTGGTAGGGAAT CATGGAGGCCGAATTCGGGGATTCACACGTCTATTGACA GCAGGTCGACGGATCCCTTCTCGTCCTGTAGTCCTAATGA CATGGAGGCCGAATTCGATTTAGGCCTGTCCAGCTTGAAA GCAGGTCGACGGATCCCACTGGTATTGACTTGGTAGGGAAT
2
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
These results indicated that TAF5L might control diverse functions by binding with other proteins. Multiple sequence alignment was applied to compare the deduced amino acid sequence of MpTAF5L with proteins from other animals. As shown in Fig. 2, the sequence of MpTAF5L showed highly conserved Nterminal TAF5-NTD2 domain with other TAF5Ls. Particularly, C-terminal WD40-repeats was conserved from invertebrates to vertebrates. As expected, the clam protein shares the highest identities with other sequences from bivalve like Crassostrea gigas (45.16% identity). Moreover, MpTAF5L shared 44.7%, and 41.62% identity with Octopus bimaculoides and Branchiostoma belcheri, respectively. The result implied that these two domains had high similarities in both vertebrate and invertebrates. Previous study considered proteins containing similar domain are likely to have common binding partners and similar functions [32]. The neighbor-joining phylogenetic tree was produced to analyze the evolutionary position of MpTAF5L. It showed that TAF5Ls from vertebrates and invertebrates are clustered separately into two different branches (Fig. 3). The MpTAF5L was initially clustered with Aplysia californica, Pomacea canaliculata, Lottia gigantean, C. gigas and Lingula anatina. TAF5L from mammals, amphibians and fishes were clustered into another large branch of vertebrates. Hence, MpTAF5L has a close evolutionary relationship with other invertebrate species.
synthesized and purified dsTAF5L and dsEGFP. Nanodrop ND1000 spectrophotometer (Thermo Scientific, USA) and agarose gel electrophoresis were used for determining the quantity and integrity of dsRNA, respectively. The adult clams acclimatized for one week were used for dsTAF5L/ dsEGFP injection. The dsEGFP-injected group that serve as negative control and the dsTAF5L-injected group both contained 20 individuals. The dsRNA (dsTAF5L/dsEGFP) was mixed with PBS to a concentration of 1.5 μg/μl, and 20 μl of this mixture was injected into the hepatopancreas of each clam. The hepatopancreas of five clams in each group were dissected at 24h and 48h post-injection (hpi) for RNA extraction. Quantitative realtime PCR was used for testing the efficiency of the MpTAF5L knockdown and the mRNA expression changes of its downstream genes, MpMITF and MpBcl2. 2.5. Yeast two-hybrid assay The ORF of MpTAF5L and MpMITF were amplified by PCR using specific primers (Table 1). The DNA fragments were ligated separately into pGBKT7, resulting in fusion of the Gal4 DNA-binding domain (BD) to the N-terminus of the tested protein, and into pGADT7, fusing the Gal4 activation domain (AD) to the N-terminus of the tested protein (Takara Bio USA, Inc., Mountain View, CA, USA). These constructs were co-transformed into the yeast strain Y2H Gold. Then, the transformed cells were separately dropped on the double dropout medium (Leu and Trp were omitted from the medium, DDO) to screen out cells harboring both bait and prey vectors. To confirm the interaction of MpTAF5L and MpMITF, successively, cells were transferred from DDO to the quadruple dropout medium QDO (Leu, Trp, Ade, and His were excluded from the medium) and QDO/X/A (X-a-Gal, AbA were added to the medium QDO). Positive control yeast cells were transformed with pGBKT7-53 and pGADT7-T. Negative control yeast cells were transformed with pGBKT7- TAF5L and pGADT7-T. Furthermore, the N-terminal TAF5-NTD2 domain and the C-terminal WD40-repeats domain were deduced on the MpTAF5L protein sequence. Following the method described earlier, the sequences according to two domains of MpTAF5L were amplified by PCR using specific primers (Table 1), and then their interaction with MpMITF was detected, respectively.
3.2. Tissue distribution and expression changes of MpTAF5L after Vibrio challenge Quantitative realtime PCR was performed to examine the distribution of MpTAF5L mRNA in different tissues that often related to immune responses, movement or close contact with the external environment, such as mantle, gill, adductor muscle, foot, hepatopancreas and hemocytes [33–35]. As shown in Fig. 4a, MpTAF5L was ubiquitously and highly expressed in the mantle, adductor muscle, foot and hepatopancreas, and obviously lower expressed in the gill and hemolytics. In invertebrates, hemocytes and hepatopancreas are important immune organs [36,37]. Meanwhile MpTAF5L was highly expressed in hepatopancreas compared with that in hemocytes, hence, hepatopancreas was selected for further investigation in our research. The mRNA expression of MpTAF5L in hepatopancreas under V. parahaemolyticus immersion was investigated to further understand its potential function in the immunity of M. petechialis. The mRNA expression level of MpTAF5L was tested on days 0–5 after V. parahaemolyticus challenge. The temporal expression of MpTAF5L increased significantly on day 3 and 5 compared with that on day 0 and 1 (P < 0.05) (Fig. 4b). A previous research from our laboratory has confirmed MpMITF and MpBcl2 were associated with the clam immune defense to V. parahaemolyticus [10], and here the result suggested the expression of MpTAF5L was consistent with variation tendency of MpMITF and MpBcl2, indicating that the three genes all take part in the immune process. In addition, many research claimed that the TAF5L gene could interact with PCAF which acetylates NFκB, a transcription factor for multiple genes of immune, acute-phase and inflammatory responses [14,38,39]. These evidences prove that TAF5L does play an important role in the immune process.
2.6. Statistical analysis The data was analyzed by ANOVA using SAS 9.2 software. The difference was considered statistically significant at P˂0.05. The data presented as the means ± S.D. 3. Results and discussion 3.1. MpTAF5L sequence characterization and phylogenetic analysis The full-length sequence of the MpTAF5L gene of M. petechialis was obtained by overlapping the original EST and each RACE product. The sequence was submitted to GenBank with the accession No. MN508809. In detail, the full-length cDNA of MpTAF5L was 2507 bp with a 1767-bp open reading frame (ORF) encoding a 588-amino acid with a predicted molecular mass of 66 kDa, a 61-bp 5′-terminal untranslated region (UTR) and a 679-bp 3′-UTR including a poly-(A) tail. There are not many reports on the structure of TAF5L, but in general, TAF5 contains the conserved WD40-repeats domain, which has the function of mediating protein-protein interaction by forming a closed beta propeller structure [28–30]. Domain analysis indicated that the predicted MpTAF5L protein also contains a WD40-repeats domain at its C-terminal. In addition, a TAF5_NTD2 domain was found at the N-terminal, which is usually synthesized as a contact for TAF-TAF interactions in TAF5 (Fig. 1). However, the NTD1 domain was not observed in the MpTAF5L sequence, which was different from TAF5 of human [28,31].
3.3. MpTAF5L can interact with MpMITF Yeast two-hybrid system was performed to identify potential interaction between MpTAF5L and MpMITF in M. petechialis. In this analysis, blue colonies did not grow on QDO/X/A medium when the co-transformed with pGBKT7-TAF5L and empty pGADT7 because MpTAF5L did not auto-active the reporter gene leading to the no blue colonies growth. By contrast, blue colonies grew on the QDO/X/A medium when the Y2HGold yeast strain cotransformed with the pGBKT7-TAF5L and pGADT7-MITF, declaring MpTAF5L could interact with MpMITF thereby activating the reporter gene (Fig. 5a). According to previous reports, TAF5L is a component of the PACF complex [13], and could 3
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
Fig. 1. N-terminal TAF5-NTD2 domain and Cterminal WD40-repeats domain of MpTAF5L protein.
Fig. 2. Multiple alignments based on amino-acid sequence of MpTAF5L and TAF5Ls of other species. TAF5-NTD2 domains are marked with a blue box, while WD40 repeats domains are marked with a red box. GenBank accession numbers for involved TAF5L sequences: Acanthaster planci (XP_005109591.1), Aplysia californica (XP_005109591.1), Octopus bimaculoides (XP_014775372.1), Crassostrea gigas (XP_011434614.1), Lingula anatina (XP_013416749.1), Lottia gigantea (XP_009045899.1), Branchiostoma belcheri (XP_019628561.1), Pomacea canaliculata (PVD32553.1), Chlorocebus sabaeus (XP_007987948.1), Ornithorhynchus anatinus (XP_028903197.1). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
motif forms a propeller-like platform dedicated to protein interactions [32]. The function of WD40-repeats domain for the interaction in MpTAF5L needs further research.
interact with the Myc that contains bHLH domain [17]. As well, MITF containing bHLH domain has been verified that could connect with P300/CBP [40,41]. In present research, our results first proved the interaction between TAF5L and MITF in mollusk. Furthermore, in order to explore which domain propelled the interaction with MpMITF, the coding DNA sequences of the N-terminal TAF5_NTD2 domain and C-terminal WD40-repeats domain were ligated into the expression vector pGBKT7 and co-transformed with pGADT7MITF to the Y2HGold yeast strain, respectively. As a result, with the cotransfection of the N-terminal sequence of the MpTAF5L and MpMITF, blue plaque was detected on the QDO/X/A medium. However, with the co-transfection of the C-terminal sequence of the MpTAF5L and MpMITF, no blue plaque was observed on the QDO/X/A medium (Fig. 5b). The result confirmed that MpTAF5L interacted with MpMITF via the N-terminal TAF5_NTD2 domain. Likewise, previous studies have also implicated the N-terminal portion of TAF5 played a role in dimerization and formed a scaffold for transcription factors subunits assemble [28]. However, there was also research claimed WD-repeat
3.4. Knockdown of MpTAF5L influences the expression of target genes After confirmed the relationship between MpTAF5L and MpMITF, we want to understand the influence of this interaction on the activity of MpMITF. Thus, RNAi was performed to knock down MpTAF5L gene in this clam. McGill et al. [42] reported MITF could bind to the promoter of Bcl2 and up-regulate the expression of Bcl2, and MpBcl-2 has been shown to be a downstream target gene of MpMITF in our previous studies [10]. Therefore, the expression level of Bcl2 can reflect the regulating ability of MITF to its target genes. The efficiency of interference was determined by quantitative realtime PCR, and the results verified the mRNA expression of MpTAF5L in the dsTAF5L-injected group was significantly down-regulated at 24 hpi and 48 hpi compared to the dsEGFP-injected group (P < 0.05) (Fig. 6a). Further analysis 4
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
Fig. 3. Neighbor-joining phylogenetic tree based on TAF5L protein sequences from 12 species. Bootstrap values shown at the nodes of the tree are based on 1000 bootstrap replicates.
Fig. 4. Relative mRNA expression of MpTAF5L measured by quantitative real-time PCR. (a) Relative mRNA expression of MpTAF5L in different tissues of M. petechialis. (b) Relative mRNA expression of MpTAF5L in the hepatopancreases of M. petechialis after immersion with Vibrio. Error bars are SD. The asterisk (*) represents significant differences found when compared with day 0 (0d) (P < 0.05). Fig. 5. Yeast two-hybrid analysis of MpTAF5L binding to MpMITF. (a) Interaction between MpTAF5L protein and MpMITF. (b) Interaction of two domains from MpTAF5L and MpMITF, respectively. The cDNA sequences of indicated genes were cloned into pGBKT7 (for DNA-binding domain, BD) and pGADT7 (for activation domain, AD), respectively. Positive control yeast cells were transformed with pGBKT7-53 (the Gal4 DNA-binding domain fused with murine p53) and pGADT7-T (the Gal4 activation domain fused with SV40 large T-antigen). Negative control yeast cells were transformed with pGBKT7-TAF5L and pGADT7-T.
the downstream genes expression. Therefore, the results revealed the interaction of MpTAF5L and MpMITF can enhance the activation of MpMITF to regulate the expression of target genes, such as MpBcl-2, participating in the immune responds in this clam. Meanwhile, this
showed after MpTAF5L knocked down, the mRNA expression of MpMITF was not affected but the MpBcl2 expression decreased significantly (Fig. 6b and c). The results indicate that although the MITF transcripts has not changed, their activation is reduced for promoting
5
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
Fig. 6. Relative mRNA expression of genes in RNAi experiments by qRT-PCR. (a) Relative mRNA expression of MpTAF5L in the hepatopancreas of clams injected with dsTAF5L/dsEGFP. (b–c) Relative mRNA expression of MpMITF andMpBcl-2 in the hepatopancreas of clams injected with dsTAF5L/dsEGFP. Error bars are the SD. Asterisks (*) represent a significant difference between the dsTAF5L-injected group and dsEGFP injected group (P < 0.05).
finding also implied MpTAF5L was related to apoptosis and regulation of transcription [43]. In conclusion, MpTAF5L was identified and confirmed to involve in the immune defense against V. parahaemolyticus in the clam M. petechialis. MpTAF5L could interact with MpMITF via the N-terminal TAF5-NTD2, and enhance the activation of MpMITF to regulate the expression of downstream genes. Our finding is the first report about MpTAF5L and its interaction with MpMITF and will provide clues into the innate immune mechanism in mollusk.
[12] R. Wang, Y. He, V. Robinson, Z. Yang, P. Hessler, L.M. Lasko, et al., Targeting lineage-specific MITF pathway in human melanoma cell lines by A-485, the selective small-molecule inhibitor of p300/CBP, Mol. Cancer Ther. 17 (12) (2018) 2543–2550. [13] J.D. Cooper, D.J. Smyth, R. Bailey, F. Payne, K. Downes, L.M. Godfrey, et al., The candidate genes TAF5L, TCF7, PDCD1 , IL6 and ICAM1 cannot be excluded from having effects in type 1 diabetes, BMC Med. Genet. 8 (1) (2007) 71. [14] D.A. Chistiakov, A. Chernisheva, K.V. Savost'anov, R.I. Turakulov, T.L. Kuraeva, I.I. Dedov, et al., The TAF5L gene on chromosome 1q42 is associated with type 1 diabetes in Russian affected patients, Autoimmunity 38 (4) (2009) 283–293. [15] M.A. Hiller, C. Lin Ty Fau - Wood, M.T. Wood C Fau - Fuller, M.T. Fuller, Developmental regulation of transcription by a tissue-specific TAF homolog, Genes Dev. 15 (2001) 1021–1030. [16] B. Bell, E. Scheer, L. Tora, Identification of hTAF(II)80 delta links apoptotic signaling pathways to transcription factor TFIID function, Mol. Cell 8 (3) (2001) 591–600. [17] D. Seruggia, M. Oti, P. Tripathi, M.C. Canver, L. LeBlanc, D.C. Di Giammartino, et al., TAF5L and TAF6L maintain self-renewal of embryonic stem cells via the MYC regulatory network, Mol. Cell 74 (2019) 1097–2765. [18] B. Liu, B. Dong, B. Tang, T. Zhang, J. Xiang, Effect of stocking density on growth, settlement and survival of clam larvae, Meretrix meretrix, Aquaculture 258 (1) (2006) 344–349. [19] Q. Nie, X. Yue, B. Liu, Development of Vibrio spp. Infection resistance related SNP markers using multiplex SNaPshot genotyping method in the clam Meretrix meretrix, Fish Shellfish Immunol. 43 (2) (2015) 469–476. [20] L. Zou, B. Liu, Identification of a serum amyloid a gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish Shellfish Immunol. 43 (2) (2015) 301–309. [21] F. Jiang, X. Yue, H. Wang, B. Liu, Transcriptome profiles of the clam Meretrix petechialis hepatopancreas in response to Vibrio infection, Fish Shellfish Immunol. 62 (2017) 175–183. [22] B. Liang, F. Jiang, S. Zhang, X. Yue, H. Wang, B. Liu, Genetic variation in Vibrio resistance in the clam Meretrix petechialis under the challenge of Vibrio parahaemolyticus, Aquaculture 468 (2017) 458–463. [23] X. Yue, B. Liu, Q. Xue, An i-type lysozyme from the asiatic hard clam Meretrix meretrix potentially functioning in host immunity, Fish Shellfish Immunol. 30 (2) (2011) 550–558. [24] Y.-C. Su, C. Liu, Vibrio parahaemolyticus: a concern of seafood safety, Food Microbiol. 24 (6) (2007) 549–558. [25] J. Yu, H. Wang, X. Yue, B. Liu, Dynamic immune and metabolism response of clam Meretrix petechialis to Vibrio challenge revealed by a time series of transcriptome analysis, Fish Shellfish Immunol. 94 (2019) 17–26. [26] C. Fabioux, A. Huvet, C. Lelong, R. Robert, S. Pouvreau, J.Y. Daniel, et al., Oyster vasa-like gene as a marker of the germline cell development in Crassostrea gigas, Biochem. Biophys. Res. Commun. 320 (2) (2004) 592–598. [27] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method, Methods 25 (4) (2001) 402–408. [28] S. Bhattacharya, S. Takada, R.H. Jacobson, Structural analysis and dimerization potential of the human TAF5 subunit of TFIID, Proc. Natl. Acad. Sci. U. S. A. 104 (4) (2007) 1189–1194. [29] Y. Tao, E. Guermah M Fau - Martinez, T. Martinez E Fau - Oelgeschlager, S. Oelgeschlager T Fau - Hasegawa, R. Hasegawa S Fau - Takada, T. Takada R Fau Yamamoto, et al., Specific interactions and potential functions of human TFII100, J. Biol. Chem. 272 (10) (1997) 6714–6721. [30] V. Dubrovskaya, I. Lavigne Ac Fau - Davidson, J. Davidson I Fau - Acker, A. Acker J Fau - Staub, L. Staub A Fau - Tora, L. Tora, Distinct domains of hTAFII100 are required for functional interaction with transcription factor TFIIF beta (RAP30) and incorporation into the TFIID complex, EMBO J. 15 (14) (1996) 3702-12.
Acknowledgements This research was supported by the Marine S&T Fund of Shandong Province for Pilot National Laboratory for Marine Science and Technology (Qingdao) (No.2018SDKJ0502-1), the China Agriculture Research System (CARS-49) and the National Natural Science Foundation of China (31772845). References [1] G. Papai, P.A. Weil, P. Schultz, New insights into the function of transcription factor TFIID from recent structural studies, Curr. Opin. Genet. Dev. 21 (2) (2011) 219–224. [2] W.L. Liu, R.A. Coleman, E. Ma, P. Grob, J.L. Yang, Y. Zhang, et al., Structures of three distinct activator-TFIID complexes, Genes Dev. 23 (13) (2009) 1510–1521. [3] Z. Nagy, C. Riss A Fau - Romier, X. Romier C Fau - le Guezennec, A.R. le Guezennec X Fau - Dongre, M. Dongre Ar Fau - Orpinell, J. Orpinell M Fau - Han, et al., The human SPT20-containing SAGA complex plays a direct role in the regulation of endoplasmic reticulum stress-induced genes, Mol. Cell. Biol. 29 (6) (2009) 1649–1660. [4] L.A. Pennacchio, A. Bickmore W Fau - Dean, M.A. Dean A Fau - Nobrega, G. Nobrega Ma Fau - Bejerano, G. Bejerano, Enhancers: five essential questions, Nat. Rev. Genet. 14 (4) (2013) 288–295. [5] C.E. Brown, T. Lechner, L. Howe, J.L. Workman, The many HATs of transcription coactivators, Trends Biochem. Sci. 25 (1) (2000) 15–19. [6] M.C. Thomas, C.M. Chiang, The general transcription machinery and general cofactors, Crit. Rev. Biochem. Mol. Biol. 41 (3) (2006) 105–178. [7] T.J. Hemesath, G. Steingrimsson E Fau - McGill, M.J. McGill G Fau - Hansen, J. Hansen Mj Fau - Vaught, C.A. Vaught J Fau - Hodgkinson, H. Hodgkinson Ca Fau Arnheiter, et al., Microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family, Genes Dev. 8 (22) (1994) 2770–2780. [8] H. Zhao, M. Li, Y.I. Purwanti, R. Liu, T. Chen, Z. Li, et al., Mitf is a transcriptional activator of medaka germ genes in culture, Biochimie 94 (3) (2012) 759–767. [9] S. Zhang, X. Yue, F. Jiang, H. Wang, B. Liu, Identification of an MITF gene and its polymorphisms associated with the Vibrio resistance trait in the clam Meretrix petechialis, Fish Shellfish Immunol. 68 (2017) 466–473. [10] S. Zhang, X. Yue, J. Yu, H. Wang, B. Liu, MITF regulates downstream genes in response to Vibrio parahaemolyticus infection in the clam Meretrix petechialis, Front. Immunol. 10 (2019) 1547. [11] J. Vachtenheim, B. Sestakova, Z. Tuhackova, Inhibition of MITF transcriptional activity independent of targeting p300/CBP coactivators, Pigment Cell Res. 20 (1) (2007) 41–51.
6
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
[38] D. Brockmann, O. Lehmkühler, U. Schmücker, H. Esche, The histone acetyltransferase activity of PCAF cooperates with the brahma/SWI2-related protein BRG1 in the activation of the enhancer A of the MHC class I promoter, Gene 277 (1) (2001) 111–120. [39] J.H. Yeh, S. Spicuglia S Fau - Kumar, A. Kumar S Fau - Sanchez-Sevilla, P. SanchezSevilla A Fau - Ferrier, J. Ferrier P Fau - Imbert, J. Imbert, Control of IL-2Ralpha gene expression: structural changes within the proximal enhancer/core promoter during T-cell development, Nucleic Acids Res. 30 (9) (2002) 1944–1951. [40] S. Sato, G. Roberts K Fau - Gambino, A.Gambino G. Fau - Cook, T. Cook A Fau Kouzarides, C.R. Kouzarides T Fau - Goding, C.R. Goding, CBP/p300 as a co-factor for the microphthalmia transcription factor, Oncogene 14 (25) (1997) 3083–3092. [41] S. Yokoyama, N. Salma, D.E. Fisher, MITF pathway mutations in melanoma, Pigment Cell Melanoma Res 22 (4) (2009) 376–377. [42] G.G. McGill, M. Horstmann, H.R. Widlund, J. Du, G. Motyckova, E.K. Nishimura, et al., Bcl2 regulation by the melanocyte master regulator MITF modulates lineage survival and melanoma cell viability, Cell 109 (6) (2002) 707–718. [43] R.J. Durso, T.J. Fisher Ak Fau - Albright-Frey, J.C. Albright-Frey Tj Fau - Reese, J.C. Reese, Analysis of TAF90 mutants displaying allele-specific and broad defects in transcription, Mol. Cell. Biol. 21 (21) (2001) 7331–7344.
[31] M. Malkowska, K. Kokoszynska, L. Rychlewski, L. Wyrwicz, Structural bioinformatics of the general transcription factor TFIID, Biochimie 95 (4) (2013) 680–691. [32] T.F. Smith, C. Gaitatzes, K. Saxena, E.J. Neer, The WD repeat: a common architecture for diverse functions, Trends Biochem. Sci. 24 (5) (1999) 181–185. [33] S. Zhang, H. Wang, J. Yu, F. Jiang, X. Yue, B. Liu, Identification of a gene encoding microphthalmia-associated transcription factor and its association with shell color in the clam Meretrix petechialis, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 225 (2018) 75–83. [34] J. Sun, L. Wang, Z. Wu, S. Han, L. Wang, M. Li, et al., P38 is involved in immune response by regulating inflammatory cytokine expressions in the pacific oyster Crassostrea gigas, Dev. Comp. Immunol. 91 (2019) 108–114. [35] Y. Chen, K. Xu, J. Li, X. Wang, Y. Ye, P. Qi, Molecular characterization of complement component 3 (C3) in Mytilus coruscus improves our understanding of bivalve complement system, Fish Shellfish Immunol. 76 (2018) 41–47. [36] R. Wen, F. Li, Z. Sun, S. Li, J. Xiang, Shrimp myd88 responsive to bacteria and white spot syndrome virus, Fish Shellfish Immunol. 34 (2) (2013) 574–581. [37] C. Wang, P. Huan, X. Yue, M. Yan, B. Liu, Molecular characterization of a glutathione peroxidase gene and its expression in the selected Vibrio-resistant population of the clam Meretrix meretrix, Fish Shellfish Immunol. 30 (6) (2011) 1294–1302.
7
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
TAF5L functions as transcriptional coactivator of MITF involved in the immune response of the clam Meretrix petechialis Di Wanga,c, Shujing Zhanga, Baozhong Liua,b,c,∗ a
CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao, 266071, China Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266000, China c University of Chinese Academy of Sciences, Beijing, 100049, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: TAF5L MITF Innate immunity Meretrix petechialis
TAF5L is a component of the P300/CBP-associated factor (PCAF) histone acetylase complex, which serves as a coactivator and takes part in basal transcription such as promoter recognition, complex assembly and transcription initiation. In our study, the full-length sequence of MpTAF5L was identified and characterized in the clam M. petechialis. Sequence analysis showed that the predicted MpTAF5L protein had a N-terminal TAF5-NTD2 domain and a C-terminal WD40-repeats domain. The annotation and evolutionary analysis revealed MpTAF5L had close evolutionary relationship with other invertebrate species. Tissue distribution analysis of TAF5L claimed that it was highly expressed in the mantle, adductor muscle, foot and hepatopancreas. The mRNA expression of MpTAF5L was significantly up-regulated after Vibrio parahaemolyticus challenge, indicating its involvement in the immune response of clam. Yeast two-hybrid assays verified that MpTAF5L can interact with MpMITF (a critical immune-related transcription factor), and our further research clarified this interaction depended upon the N-terminal TAF5-NTD2 domain of MpTAF5L. Moreover, the mRNA expression of MpBcl-2 (a target gene of MITF) was significantly decreased but the mRNA expression of MpMITF was not significantly changed after knockdown of MpTAF5L, which indicated the reduction of MpMITF regulating activity at the same time. These results revealed that MpTAF5L interacted with MpMITF and enhanced the activation of MpMITF, which plays roles in the immune defense against V. parahaemolyticus.
1. Introduction Compared with vertebrate, invertebrate only has an innate immune system. However, this system is complex and regulated by multiple gene networks [1–3]. Among of them, the immune-related genes play important roles in the defense of pathogen invasion. The expression of immune-related genes could be enhanced by transcription factors through recruiting a universal transcription compound to the promoter [4–6]. The microphthalmia-associated transcription factor (MITF) is a critical transcription factor, containing a bHLH-LZ structure which binds to E-box elements in the promoters of downstream genes [7,8]. In mollusk, MITF gene was first identified in the clam Meretrix petechialis [9], and the further research demonstrated the role of MITF in regulating the downstream genes in immune signaling pathways [10]. The transcription factor itself is regulated by binding to the co-activator, which is a transcriptional synergistic regulator to increase downstream genes expression. Research shows that the activation of
MITF often requires the presence of co-activators such as P300/CBP [11,12]. TAF5L is a component of the P300/CBP-associated factor (PCAF) complex [13,14]. As a member of the WD-repeat TAF5 protein family, it is related to cell cycle and spermatogenesis through the coactivation with transcription factors [15,16]. However, it is still unclear whether TAF5L can activate the transcriptional activity of MITF. Recently, a report claimed TAF5L can interact with Myc that containing the bHLH conserved domain [17]. Similarly, MITF in M. petechialis has a basic bHLHZip domain [9], thus we wonder if and how TAF5L interacts with MITF. In present study, clam M. petechialis was selected as an experimental animal to analysis the role of TAF5L (MpTAF5L) in the innate immunity of mollusk. This clam is an important commercial species [18] and we have done series of immune and genetic research in this species [19–23]. Here, we identified a MpTAF5L gene and confirmed the interaction between MpTAF5L and MpMITF in this clam. In addition, we investigated the effects of this interaction on the activation of MpMITF.
∗ Corresponding author. CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao, 266071, China. E-mail address: [email protected] (B. Liu).
https://doi.org/10.1016/j.fsi.2019.11.039 Received 29 September 2019; Received in revised form 13 November 2019; Accepted 15 November 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Please cite this article as: Di Wang, Shujing Zhang and Baozhong Liu, Fish and Shellfish Immunology, https://doi.org/10.1016/j.fsi.2019.11.039
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
performed with the MpTAF5L-5′ GSP and MpTAF5L-5′NGSP primers (Table 1). For 3′ RACE, MpTAF5L-3′ GSP and MpTAF5L-3′ NGSP were used to amplify the fragments (Table 1). The PCR reaction conditions were 94 °C for 4 min, 35 cycles of 94 °C for 20s, 68 °C for 30s, and 72 °C for 2 min, finally extension at 72 °C for 10 min cMpTAF5L-F and cMpTAF5L-R primers (Table 1) were designed to confirm the complete assembled sequence by PCR. The nucleotide sequences and protein sequences of MpTAF5L were analyzed by BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The software BioEdit was used to translate nucleotide sequence into the amino acid sequence. ORF Finder (https://www.ncbi.nlm.nih.gov/ orffinder/) applied to predict the ORF of MpTAF5L. The molecular weight (MW) of the protein was calculated using the ExPASy Server (https://web.expasy.org/protparam/). The Clustal X 2.0 and MEGA10.0 was used to produce multiple sequence alignments and a neighbor-joining (NJ) phylogenetic tree, respectively.
Our research is helpful to understand the innate immune mechanism of mollusk. 2. Materials and methods 2.1. Experimental clams and Vibrio challenge The adult clams were bought from aquatic market in Qingdao, China. These clams were acclimated in a 30 L tank with aerated seawater and fed with microalgae for one week at 25 °C. Five clams were collected and the hepatopancreas, hemocytes, mantle, foot, gill and adductor muscle were dissected separately for tissue distribution analysis of MpTAF5L. Vibrio parahaemolyticus strain (MM21) [24] was used as a pathogen for challenge assay with immersion method. In brief, clams were put in the 30 L tank with filter seawater. V. parahaemolyticus was resuspended and cultured in medium 2216E. The cultured bacteria were counted by cell-count boards and then placed into seawater to reach the final concentration of 1 × 107 CFU ml−1. The seawater and V. parahaemolyticus were renewed every day during the challenge period. Nine individuals were randomly sampled on day 0, 1, 3 and 5 after challenge, and the hepatopancreas from each individual was removed and stored at −80 °C. For RNA isolation, hepatopancreas from three clams were mixed as one replicate and three replicates were assayed at each time point.
2.3. Quantitative realtime PCR To determine the tissue distribution of MpTAF5L, and the mRNA expression changes of MpTAF5L after Vibrio challenge, quantitative realtime PCR was carried out with the specific primers listed in Table 1. The mean expression value of β-actin and EF1α were employed as the internal references to normalize the relative expression levels among samples [26]. The relative gene expression level was analyze by the 2△△CT method [27]. The PCR procedure was set as 95 °C for 30 s, then 40 cycles of 95 °C for 5 s and 60 °C for 30 s.
2.2. Molecular cloning and sequence analysis of MpTAF5L Total RNA was extracted from the tissues by using An EZNA® Total RNA Kit (Omega, USA). The quantity and quality of extracted RNA was determined using a Nanodrop ND1000 spectrophotometer (Thermo Scientific, USA) and agarose gel electrophoresis, respectively. A PrimeScript™ RT reagent Kit with a gDNA Eraser (TaKaRa, Japan) was used for the cDNA synthesized from total RNA according to the manufacturer's instructions. The SMART™ RACE cDNA Amplification Kit (Clontech, USA) applied to obtain the full-length cDNA of MpTAF5L, on the basis of EST fragments from the transcriptomic data [25]. The 5′RACE was
2.4. RNA interference (RNAi) of MpTAF5L The 500bp-fragment of MpTAF5L ORF was amplified using the T7 promoter-linked primers TAF5L-T7-F and TAF5L-T7-R (Table 1). The 500bp-fragment of EGFP ORF was amplified by EGFP-T7-F and EGFPT7-R (Table 1) using the pEGFP vector plasmid (Clontech, USA) as template. Then the PCR production purified as the template for the synthesis of the double-stranded RNA (dsRNA). The TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific, USA) applied to
Table 1 Primers used in this study. Primer
Sequence (5′-3′)
cMpTAF5L-F cMpTAF5L-R MpTAF5L 5′-GSP MpTAF5L 5′-NGSP MpTAF5L 3′-GSP MpTAF5L 3′-NGSP Actin-F Actin-R EF1α-F EF1α-R MITF-RT-F MITF-RT-R TAF5L-RT-F TAF5L-RT-R Bcl-2–RT-F Bcl-2-RT-R TAF5L-T7-F TAF5L-T7-R EGFP-T7-F EGFP-T7-R yMITF-F yMITF-R yTAF5L-F yTAF5L-R yTAF5L-TAF5-F yTAF5L-TAF5-R yTAF5L-WD40-F yTAF5L-WD40-R
GGGATTCACACGTCTATTGACA CAACTGGAAGATAGCCCAATAC GCTGGTTGAGGACTTGAAGTAA CAGCATCTGTCCTGAATTGACT TCAGGTGGTCTTGACAGTTGTA GCATTCCCTACCAAGTCAATAC TTGTCTGGTGGTTCAACTATG GACTGATTTCTTACGGATG CTGGAAGAGATGCCAAAGGT ATGTCACGCACAGCAAAACG CGAGTTTCTCAACGGCACAGT ATGCTCTTCCCTTGCTTCACC ACTGTCACTGGCTTTCTCACCA TCCGCAAGTCCCATATCCTTAT GCACAGAACGGTTGAGAA TACGGAAACAAGACAAAGCT GCGTAATACGACTCACTATAGGGGGATTCACACGTCTATTGACA GCGTAATACGACTCACTATAGGGTCATATCAGCTTTGGAGGAGA GCGTAATACGACTCACTATAGGGAGCCATACCACATTTGTAGAGG GCGTAATACGACTCACTATAGGGCGCTTTCTTCCCTTCCTTT CATG GAG GCC GAATTCGCAGATTCAGGCATTGACATAGA GCAGGTCGACGGATCCTAAGCCATAATCCATGCTATCATCGT CATGGAGGCCGAATTCGGGGATTCACACGTCTATTGACA GCAGGTCGACGGATCCCACTGGTATTGACTTGGTAGGGAAT CATGGAGGCCGAATTCGGGGATTCACACGTCTATTGACA GCAGGTCGACGGATCCCTTCTCGTCCTGTAGTCCTAATGA CATGGAGGCCGAATTCGATTTAGGCCTGTCCAGCTTGAAA GCAGGTCGACGGATCCCACTGGTATTGACTTGGTAGGGAAT
2
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
These results indicated that TAF5L might control diverse functions by binding with other proteins. Multiple sequence alignment was applied to compare the deduced amino acid sequence of MpTAF5L with proteins from other animals. As shown in Fig. 2, the sequence of MpTAF5L showed highly conserved Nterminal TAF5-NTD2 domain with other TAF5Ls. Particularly, C-terminal WD40-repeats was conserved from invertebrates to vertebrates. As expected, the clam protein shares the highest identities with other sequences from bivalve like Crassostrea gigas (45.16% identity). Moreover, MpTAF5L shared 44.7%, and 41.62% identity with Octopus bimaculoides and Branchiostoma belcheri, respectively. The result implied that these two domains had high similarities in both vertebrate and invertebrates. Previous study considered proteins containing similar domain are likely to have common binding partners and similar functions [32]. The neighbor-joining phylogenetic tree was produced to analyze the evolutionary position of MpTAF5L. It showed that TAF5Ls from vertebrates and invertebrates are clustered separately into two different branches (Fig. 3). The MpTAF5L was initially clustered with Aplysia californica, Pomacea canaliculata, Lottia gigantean, C. gigas and Lingula anatina. TAF5L from mammals, amphibians and fishes were clustered into another large branch of vertebrates. Hence, MpTAF5L has a close evolutionary relationship with other invertebrate species.
synthesized and purified dsTAF5L and dsEGFP. Nanodrop ND1000 spectrophotometer (Thermo Scientific, USA) and agarose gel electrophoresis were used for determining the quantity and integrity of dsRNA, respectively. The adult clams acclimatized for one week were used for dsTAF5L/ dsEGFP injection. The dsEGFP-injected group that serve as negative control and the dsTAF5L-injected group both contained 20 individuals. The dsRNA (dsTAF5L/dsEGFP) was mixed with PBS to a concentration of 1.5 μg/μl, and 20 μl of this mixture was injected into the hepatopancreas of each clam. The hepatopancreas of five clams in each group were dissected at 24h and 48h post-injection (hpi) for RNA extraction. Quantitative realtime PCR was used for testing the efficiency of the MpTAF5L knockdown and the mRNA expression changes of its downstream genes, MpMITF and MpBcl2. 2.5. Yeast two-hybrid assay The ORF of MpTAF5L and MpMITF were amplified by PCR using specific primers (Table 1). The DNA fragments were ligated separately into pGBKT7, resulting in fusion of the Gal4 DNA-binding domain (BD) to the N-terminus of the tested protein, and into pGADT7, fusing the Gal4 activation domain (AD) to the N-terminus of the tested protein (Takara Bio USA, Inc., Mountain View, CA, USA). These constructs were co-transformed into the yeast strain Y2H Gold. Then, the transformed cells were separately dropped on the double dropout medium (Leu and Trp were omitted from the medium, DDO) to screen out cells harboring both bait and prey vectors. To confirm the interaction of MpTAF5L and MpMITF, successively, cells were transferred from DDO to the quadruple dropout medium QDO (Leu, Trp, Ade, and His were excluded from the medium) and QDO/X/A (X-a-Gal, AbA were added to the medium QDO). Positive control yeast cells were transformed with pGBKT7-53 and pGADT7-T. Negative control yeast cells were transformed with pGBKT7- TAF5L and pGADT7-T. Furthermore, the N-terminal TAF5-NTD2 domain and the C-terminal WD40-repeats domain were deduced on the MpTAF5L protein sequence. Following the method described earlier, the sequences according to two domains of MpTAF5L were amplified by PCR using specific primers (Table 1), and then their interaction with MpMITF was detected, respectively.
3.2. Tissue distribution and expression changes of MpTAF5L after Vibrio challenge Quantitative realtime PCR was performed to examine the distribution of MpTAF5L mRNA in different tissues that often related to immune responses, movement or close contact with the external environment, such as mantle, gill, adductor muscle, foot, hepatopancreas and hemocytes [33–35]. As shown in Fig. 4a, MpTAF5L was ubiquitously and highly expressed in the mantle, adductor muscle, foot and hepatopancreas, and obviously lower expressed in the gill and hemolytics. In invertebrates, hemocytes and hepatopancreas are important immune organs [36,37]. Meanwhile MpTAF5L was highly expressed in hepatopancreas compared with that in hemocytes, hence, hepatopancreas was selected for further investigation in our research. The mRNA expression of MpTAF5L in hepatopancreas under V. parahaemolyticus immersion was investigated to further understand its potential function in the immunity of M. petechialis. The mRNA expression level of MpTAF5L was tested on days 0–5 after V. parahaemolyticus challenge. The temporal expression of MpTAF5L increased significantly on day 3 and 5 compared with that on day 0 and 1 (P < 0.05) (Fig. 4b). A previous research from our laboratory has confirmed MpMITF and MpBcl2 were associated with the clam immune defense to V. parahaemolyticus [10], and here the result suggested the expression of MpTAF5L was consistent with variation tendency of MpMITF and MpBcl2, indicating that the three genes all take part in the immune process. In addition, many research claimed that the TAF5L gene could interact with PCAF which acetylates NFκB, a transcription factor for multiple genes of immune, acute-phase and inflammatory responses [14,38,39]. These evidences prove that TAF5L does play an important role in the immune process.
2.6. Statistical analysis The data was analyzed by ANOVA using SAS 9.2 software. The difference was considered statistically significant at P˂0.05. The data presented as the means ± S.D. 3. Results and discussion 3.1. MpTAF5L sequence characterization and phylogenetic analysis The full-length sequence of the MpTAF5L gene of M. petechialis was obtained by overlapping the original EST and each RACE product. The sequence was submitted to GenBank with the accession No. MN508809. In detail, the full-length cDNA of MpTAF5L was 2507 bp with a 1767-bp open reading frame (ORF) encoding a 588-amino acid with a predicted molecular mass of 66 kDa, a 61-bp 5′-terminal untranslated region (UTR) and a 679-bp 3′-UTR including a poly-(A) tail. There are not many reports on the structure of TAF5L, but in general, TAF5 contains the conserved WD40-repeats domain, which has the function of mediating protein-protein interaction by forming a closed beta propeller structure [28–30]. Domain analysis indicated that the predicted MpTAF5L protein also contains a WD40-repeats domain at its C-terminal. In addition, a TAF5_NTD2 domain was found at the N-terminal, which is usually synthesized as a contact for TAF-TAF interactions in TAF5 (Fig. 1). However, the NTD1 domain was not observed in the MpTAF5L sequence, which was different from TAF5 of human [28,31].
3.3. MpTAF5L can interact with MpMITF Yeast two-hybrid system was performed to identify potential interaction between MpTAF5L and MpMITF in M. petechialis. In this analysis, blue colonies did not grow on QDO/X/A medium when the co-transformed with pGBKT7-TAF5L and empty pGADT7 because MpTAF5L did not auto-active the reporter gene leading to the no blue colonies growth. By contrast, blue colonies grew on the QDO/X/A medium when the Y2HGold yeast strain cotransformed with the pGBKT7-TAF5L and pGADT7-MITF, declaring MpTAF5L could interact with MpMITF thereby activating the reporter gene (Fig. 5a). According to previous reports, TAF5L is a component of the PACF complex [13], and could 3
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
Fig. 1. N-terminal TAF5-NTD2 domain and Cterminal WD40-repeats domain of MpTAF5L protein.
Fig. 2. Multiple alignments based on amino-acid sequence of MpTAF5L and TAF5Ls of other species. TAF5-NTD2 domains are marked with a blue box, while WD40 repeats domains are marked with a red box. GenBank accession numbers for involved TAF5L sequences: Acanthaster planci (XP_005109591.1), Aplysia californica (XP_005109591.1), Octopus bimaculoides (XP_014775372.1), Crassostrea gigas (XP_011434614.1), Lingula anatina (XP_013416749.1), Lottia gigantea (XP_009045899.1), Branchiostoma belcheri (XP_019628561.1), Pomacea canaliculata (PVD32553.1), Chlorocebus sabaeus (XP_007987948.1), Ornithorhynchus anatinus (XP_028903197.1). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
motif forms a propeller-like platform dedicated to protein interactions [32]. The function of WD40-repeats domain for the interaction in MpTAF5L needs further research.
interact with the Myc that contains bHLH domain [17]. As well, MITF containing bHLH domain has been verified that could connect with P300/CBP [40,41]. In present research, our results first proved the interaction between TAF5L and MITF in mollusk. Furthermore, in order to explore which domain propelled the interaction with MpMITF, the coding DNA sequences of the N-terminal TAF5_NTD2 domain and C-terminal WD40-repeats domain were ligated into the expression vector pGBKT7 and co-transformed with pGADT7MITF to the Y2HGold yeast strain, respectively. As a result, with the cotransfection of the N-terminal sequence of the MpTAF5L and MpMITF, blue plaque was detected on the QDO/X/A medium. However, with the co-transfection of the C-terminal sequence of the MpTAF5L and MpMITF, no blue plaque was observed on the QDO/X/A medium (Fig. 5b). The result confirmed that MpTAF5L interacted with MpMITF via the N-terminal TAF5_NTD2 domain. Likewise, previous studies have also implicated the N-terminal portion of TAF5 played a role in dimerization and formed a scaffold for transcription factors subunits assemble [28]. However, there was also research claimed WD-repeat
3.4. Knockdown of MpTAF5L influences the expression of target genes After confirmed the relationship between MpTAF5L and MpMITF, we want to understand the influence of this interaction on the activity of MpMITF. Thus, RNAi was performed to knock down MpTAF5L gene in this clam. McGill et al. [42] reported MITF could bind to the promoter of Bcl2 and up-regulate the expression of Bcl2, and MpBcl-2 has been shown to be a downstream target gene of MpMITF in our previous studies [10]. Therefore, the expression level of Bcl2 can reflect the regulating ability of MITF to its target genes. The efficiency of interference was determined by quantitative realtime PCR, and the results verified the mRNA expression of MpTAF5L in the dsTAF5L-injected group was significantly down-regulated at 24 hpi and 48 hpi compared to the dsEGFP-injected group (P < 0.05) (Fig. 6a). Further analysis 4
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
Fig. 3. Neighbor-joining phylogenetic tree based on TAF5L protein sequences from 12 species. Bootstrap values shown at the nodes of the tree are based on 1000 bootstrap replicates.
Fig. 4. Relative mRNA expression of MpTAF5L measured by quantitative real-time PCR. (a) Relative mRNA expression of MpTAF5L in different tissues of M. petechialis. (b) Relative mRNA expression of MpTAF5L in the hepatopancreases of M. petechialis after immersion with Vibrio. Error bars are SD. The asterisk (*) represents significant differences found when compared with day 0 (0d) (P < 0.05). Fig. 5. Yeast two-hybrid analysis of MpTAF5L binding to MpMITF. (a) Interaction between MpTAF5L protein and MpMITF. (b) Interaction of two domains from MpTAF5L and MpMITF, respectively. The cDNA sequences of indicated genes were cloned into pGBKT7 (for DNA-binding domain, BD) and pGADT7 (for activation domain, AD), respectively. Positive control yeast cells were transformed with pGBKT7-53 (the Gal4 DNA-binding domain fused with murine p53) and pGADT7-T (the Gal4 activation domain fused with SV40 large T-antigen). Negative control yeast cells were transformed with pGBKT7-TAF5L and pGADT7-T.
the downstream genes expression. Therefore, the results revealed the interaction of MpTAF5L and MpMITF can enhance the activation of MpMITF to regulate the expression of target genes, such as MpBcl-2, participating in the immune responds in this clam. Meanwhile, this
showed after MpTAF5L knocked down, the mRNA expression of MpMITF was not affected but the MpBcl2 expression decreased significantly (Fig. 6b and c). The results indicate that although the MITF transcripts has not changed, their activation is reduced for promoting
5
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
Fig. 6. Relative mRNA expression of genes in RNAi experiments by qRT-PCR. (a) Relative mRNA expression of MpTAF5L in the hepatopancreas of clams injected with dsTAF5L/dsEGFP. (b–c) Relative mRNA expression of MpMITF andMpBcl-2 in the hepatopancreas of clams injected with dsTAF5L/dsEGFP. Error bars are the SD. Asterisks (*) represent a significant difference between the dsTAF5L-injected group and dsEGFP injected group (P < 0.05).
finding also implied MpTAF5L was related to apoptosis and regulation of transcription [43]. In conclusion, MpTAF5L was identified and confirmed to involve in the immune defense against V. parahaemolyticus in the clam M. petechialis. MpTAF5L could interact with MpMITF via the N-terminal TAF5-NTD2, and enhance the activation of MpMITF to regulate the expression of downstream genes. Our finding is the first report about MpTAF5L and its interaction with MpMITF and will provide clues into the innate immune mechanism in mollusk.
[12] R. Wang, Y. He, V. Robinson, Z. Yang, P. Hessler, L.M. Lasko, et al., Targeting lineage-specific MITF pathway in human melanoma cell lines by A-485, the selective small-molecule inhibitor of p300/CBP, Mol. Cancer Ther. 17 (12) (2018) 2543–2550. [13] J.D. Cooper, D.J. Smyth, R. Bailey, F. Payne, K. Downes, L.M. Godfrey, et al., The candidate genes TAF5L, TCF7, PDCD1 , IL6 and ICAM1 cannot be excluded from having effects in type 1 diabetes, BMC Med. Genet. 8 (1) (2007) 71. [14] D.A. Chistiakov, A. Chernisheva, K.V. Savost'anov, R.I. Turakulov, T.L. Kuraeva, I.I. Dedov, et al., The TAF5L gene on chromosome 1q42 is associated with type 1 diabetes in Russian affected patients, Autoimmunity 38 (4) (2009) 283–293. [15] M.A. Hiller, C. Lin Ty Fau - Wood, M.T. Wood C Fau - Fuller, M.T. Fuller, Developmental regulation of transcription by a tissue-specific TAF homolog, Genes Dev. 15 (2001) 1021–1030. [16] B. Bell, E. Scheer, L. Tora, Identification of hTAF(II)80 delta links apoptotic signaling pathways to transcription factor TFIID function, Mol. Cell 8 (3) (2001) 591–600. [17] D. Seruggia, M. Oti, P. Tripathi, M.C. Canver, L. LeBlanc, D.C. Di Giammartino, et al., TAF5L and TAF6L maintain self-renewal of embryonic stem cells via the MYC regulatory network, Mol. Cell 74 (2019) 1097–2765. [18] B. Liu, B. Dong, B. Tang, T. Zhang, J. Xiang, Effect of stocking density on growth, settlement and survival of clam larvae, Meretrix meretrix, Aquaculture 258 (1) (2006) 344–349. [19] Q. Nie, X. Yue, B. Liu, Development of Vibrio spp. Infection resistance related SNP markers using multiplex SNaPshot genotyping method in the clam Meretrix meretrix, Fish Shellfish Immunol. 43 (2) (2015) 469–476. [20] L. Zou, B. Liu, Identification of a serum amyloid a gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish Shellfish Immunol. 43 (2) (2015) 301–309. [21] F. Jiang, X. Yue, H. Wang, B. Liu, Transcriptome profiles of the clam Meretrix petechialis hepatopancreas in response to Vibrio infection, Fish Shellfish Immunol. 62 (2017) 175–183. [22] B. Liang, F. Jiang, S. Zhang, X. Yue, H. Wang, B. Liu, Genetic variation in Vibrio resistance in the clam Meretrix petechialis under the challenge of Vibrio parahaemolyticus, Aquaculture 468 (2017) 458–463. [23] X. Yue, B. Liu, Q. Xue, An i-type lysozyme from the asiatic hard clam Meretrix meretrix potentially functioning in host immunity, Fish Shellfish Immunol. 30 (2) (2011) 550–558. [24] Y.-C. Su, C. Liu, Vibrio parahaemolyticus: a concern of seafood safety, Food Microbiol. 24 (6) (2007) 549–558. [25] J. Yu, H. Wang, X. Yue, B. Liu, Dynamic immune and metabolism response of clam Meretrix petechialis to Vibrio challenge revealed by a time series of transcriptome analysis, Fish Shellfish Immunol. 94 (2019) 17–26. [26] C. Fabioux, A. Huvet, C. Lelong, R. Robert, S. Pouvreau, J.Y. Daniel, et al., Oyster vasa-like gene as a marker of the germline cell development in Crassostrea gigas, Biochem. Biophys. Res. Commun. 320 (2) (2004) 592–598. [27] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method, Methods 25 (4) (2001) 402–408. [28] S. Bhattacharya, S. Takada, R.H. Jacobson, Structural analysis and dimerization potential of the human TAF5 subunit of TFIID, Proc. Natl. Acad. Sci. U. S. A. 104 (4) (2007) 1189–1194. [29] Y. Tao, E. Guermah M Fau - Martinez, T. Martinez E Fau - Oelgeschlager, S. Oelgeschlager T Fau - Hasegawa, R. Hasegawa S Fau - Takada, T. Takada R Fau Yamamoto, et al., Specific interactions and potential functions of human TFII100, J. Biol. Chem. 272 (10) (1997) 6714–6721. [30] V. Dubrovskaya, I. Lavigne Ac Fau - Davidson, J. Davidson I Fau - Acker, A. Acker J Fau - Staub, L. Staub A Fau - Tora, L. Tora, Distinct domains of hTAFII100 are required for functional interaction with transcription factor TFIIF beta (RAP30) and incorporation into the TFIID complex, EMBO J. 15 (14) (1996) 3702-12.
Acknowledgements This research was supported by the Marine S&T Fund of Shandong Province for Pilot National Laboratory for Marine Science and Technology (Qingdao) (No.2018SDKJ0502-1), the China Agriculture Research System (CARS-49) and the National Natural Science Foundation of China (31772845). References [1] G. Papai, P.A. Weil, P. Schultz, New insights into the function of transcription factor TFIID from recent structural studies, Curr. Opin. Genet. Dev. 21 (2) (2011) 219–224. [2] W.L. Liu, R.A. Coleman, E. Ma, P. Grob, J.L. Yang, Y. Zhang, et al., Structures of three distinct activator-TFIID complexes, Genes Dev. 23 (13) (2009) 1510–1521. [3] Z. Nagy, C. Riss A Fau - Romier, X. Romier C Fau - le Guezennec, A.R. le Guezennec X Fau - Dongre, M. Dongre Ar Fau - Orpinell, J. Orpinell M Fau - Han, et al., The human SPT20-containing SAGA complex plays a direct role in the regulation of endoplasmic reticulum stress-induced genes, Mol. Cell. Biol. 29 (6) (2009) 1649–1660. [4] L.A. Pennacchio, A. Bickmore W Fau - Dean, M.A. Dean A Fau - Nobrega, G. Nobrega Ma Fau - Bejerano, G. Bejerano, Enhancers: five essential questions, Nat. Rev. Genet. 14 (4) (2013) 288–295. [5] C.E. Brown, T. Lechner, L. Howe, J.L. Workman, The many HATs of transcription coactivators, Trends Biochem. Sci. 25 (1) (2000) 15–19. [6] M.C. Thomas, C.M. Chiang, The general transcription machinery and general cofactors, Crit. Rev. Biochem. Mol. Biol. 41 (3) (2006) 105–178. [7] T.J. Hemesath, G. Steingrimsson E Fau - McGill, M.J. McGill G Fau - Hansen, J. Hansen Mj Fau - Vaught, C.A. Vaught J Fau - Hodgkinson, H. Hodgkinson Ca Fau Arnheiter, et al., Microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family, Genes Dev. 8 (22) (1994) 2770–2780. [8] H. Zhao, M. Li, Y.I. Purwanti, R. Liu, T. Chen, Z. Li, et al., Mitf is a transcriptional activator of medaka germ genes in culture, Biochimie 94 (3) (2012) 759–767. [9] S. Zhang, X. Yue, F. Jiang, H. Wang, B. Liu, Identification of an MITF gene and its polymorphisms associated with the Vibrio resistance trait in the clam Meretrix petechialis, Fish Shellfish Immunol. 68 (2017) 466–473. [10] S. Zhang, X. Yue, J. Yu, H. Wang, B. Liu, MITF regulates downstream genes in response to Vibrio parahaemolyticus infection in the clam Meretrix petechialis, Front. Immunol. 10 (2019) 1547. [11] J. Vachtenheim, B. Sestakova, Z. Tuhackova, Inhibition of MITF transcriptional activity independent of targeting p300/CBP coactivators, Pigment Cell Res. 20 (1) (2007) 41–51.
6
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
D. Wang, et al.
[38] D. Brockmann, O. Lehmkühler, U. Schmücker, H. Esche, The histone acetyltransferase activity of PCAF cooperates with the brahma/SWI2-related protein BRG1 in the activation of the enhancer A of the MHC class I promoter, Gene 277 (1) (2001) 111–120. [39] J.H. Yeh, S. Spicuglia S Fau - Kumar, A. Kumar S Fau - Sanchez-Sevilla, P. SanchezSevilla A Fau - Ferrier, J. Ferrier P Fau - Imbert, J. Imbert, Control of IL-2Ralpha gene expression: structural changes within the proximal enhancer/core promoter during T-cell development, Nucleic Acids Res. 30 (9) (2002) 1944–1951. [40] S. Sato, G. Roberts K Fau - Gambino, A.Gambino G. Fau - Cook, T. Cook A Fau Kouzarides, C.R. Kouzarides T Fau - Goding, C.R. Goding, CBP/p300 as a co-factor for the microphthalmia transcription factor, Oncogene 14 (25) (1997) 3083–3092. [41] S. Yokoyama, N. Salma, D.E. Fisher, MITF pathway mutations in melanoma, Pigment Cell Melanoma Res 22 (4) (2009) 376–377. [42] G.G. McGill, M. Horstmann, H.R. Widlund, J. Du, G. Motyckova, E.K. Nishimura, et al., Bcl2 regulation by the melanocyte master regulator MITF modulates lineage survival and melanoma cell viability, Cell 109 (6) (2002) 707–718. [43] R.J. Durso, T.J. Fisher Ak Fau - Albright-Frey, J.C. Albright-Frey Tj Fau - Reese, J.C. Reese, Analysis of TAF90 mutants displaying allele-specific and broad defects in transcription, Mol. Cell. Biol. 21 (21) (2001) 7331–7344.
[31] M. Malkowska, K. Kokoszynska, L. Rychlewski, L. Wyrwicz, Structural bioinformatics of the general transcription factor TFIID, Biochimie 95 (4) (2013) 680–691. [32] T.F. Smith, C. Gaitatzes, K. Saxena, E.J. Neer, The WD repeat: a common architecture for diverse functions, Trends Biochem. Sci. 24 (5) (1999) 181–185. [33] S. Zhang, H. Wang, J. Yu, F. Jiang, X. Yue, B. Liu, Identification of a gene encoding microphthalmia-associated transcription factor and its association with shell color in the clam Meretrix petechialis, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 225 (2018) 75–83. [34] J. Sun, L. Wang, Z. Wu, S. Han, L. Wang, M. Li, et al., P38 is involved in immune response by regulating inflammatory cytokine expressions in the pacific oyster Crassostrea gigas, Dev. Comp. Immunol. 91 (2019) 108–114. [35] Y. Chen, K. Xu, J. Li, X. Wang, Y. Ye, P. Qi, Molecular characterization of complement component 3 (C3) in Mytilus coruscus improves our understanding of bivalve complement system, Fish Shellfish Immunol. 76 (2018) 41–47. [36] R. Wen, F. Li, Z. Sun, S. Li, J. Xiang, Shrimp myd88 responsive to bacteria and white spot syndrome virus, Fish Shellfish Immunol. 34 (2) (2013) 574–581. [37] C. Wang, P. Huan, X. Yue, M. Yan, B. Liu, Molecular characterization of a glutathione peroxidase gene and its expression in the selected Vibrio-resistant population of the clam Meretrix meretrix, Fish Shellfish Immunol. 30 (6) (2011) 1294–1302.
7