- Email: [email protected]
Tales of tails: Brachyury and the T-box genes
Biochimica et Biophysica Acta 1333 Ž1997. F73–F84
Tales of tails: Brachyury and the T-box genes Amy I. Kavka ) , Jeremy B.A. Green
1
Dana-Farber Cancer Institute, 44 Binney Street Room B455, Boston, MA 02215, USA Received 27 March 1997; accepted 15 May 1997
Contents 1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.1. Cloning Brachyury . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F73 F74
2. Brachyury expression and induction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F75
3. Brachyury encodes a transcription factor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F77
4. Cellular functions of Brachyury . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F78
5. The T-box gene family . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F80
6. T-box genes in mouse . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F80
7. T-box genes in Xenopus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F81
8. Other T-box genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F82
9. Tailpiece . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F83
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F83
1. Introduction A mouse with a heritable short tail has paved the way for the discovery of an important new family of DNA binding proteins. This Brachyury Žliterally,
)
Corresponding author. Fax: q1 617 3758279. E-mail: [email protected] 1 E-mail: [email protected]
short tail. mouse has been studied extensively since its appearance in the scientific literature in 1927. The gene responsible for the short tail, Brachyury, has since been shown to be an important player in the process of gastrulation, during which the three embryonic germ layers, ectoderm, endoderm, and mesoderm become delineated. More specifically, Brachyury is expressed in and is necessary for establishing the mesoderm, particularly the caudal component of the axial mesoderm, and when the gene is
0304-419Xr97r$32.00 q 1997 Elsevier Science B.V. All rights reserved. PII S 0 3 0 4 - 4 1 9 X Ž 9 7 . 0 0 0 1 6 - 4
F74
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
absent embryos simply do not form structures caudal to the forelimb. This gene, originally identified in mouse, is now found to be important in the differentiation of specific mesoderm populations in species as diverse as fruit flies, sea urchins, nematode worms, zebrafish, frogs, chickens, and humans. Brachyury genes encode transcription factors and thus may be responsible for the coordinate expression of a number of genes involved in the process of cell differentiation. Recently, relatives of Brachyury have been isolated. These relatives are known as T-box genes because of sequence similarity in their DNA binding domains, or T-boxes. The extent of the T-box gene family and their functions, some similar to Brachyury and some quite divergent, are only now coming to light. Research in Brachyury and its relatives is thus at a turning point: rapid progress in the understanding of the molecular and cellular role of the original Brachyury can begin to be applied to a whole class of family members. This review will summarize the history of Brachyury Žthough the reader is directed to excellent accounts in previous reviews w1–7x., outline the most recent progress in its analysis and finally provide an introduction and overview of the T-box gene family of genes currently known. The cloning of the mouse Brachyury or T gene after decades of classical genetic analysis has opened up the process of mesoderm formation to molecular analysis. The Brachyury protein has been shown to be a DNA-binding transcription factor, but thus far no transcriptional targets have been identified. Brachyury mRNA overexpression is sufficient to elicit mesodermal characters in cells and expression of eFGF, but whether its normal role is to modulate differentiation or to specify cell movements or cell surface characteristics remains an open question. Very similar genes, probably direct homologues of mouse Brachyury, have been identified in both vertebrate and invertebrate species. More distantly related genes that share homology in the DNA-binding domain, or T-box, have also been identified. Diverse expression patterns in early embryos, including differential hind-versus-forelimb expression, suggest important roles for a number of genes in developmental specification and pattern formation. The Brachyury or T gene must now be considered the eponymous member of an increasingly recognized and important gene family.
1.1. Cloning Brachyury Brachyury was first identified as a tail length mutation in mouse by a group of Parisian researchers conducting an X-ray mutagenesis screen of heritable traits in mice w8x. Since its creation, the original Brachyury mutation, also known as T for ‘tail’, has been extensively characterized w9,10x and other alleles have been identified, some with a similar phenotype to the initial T mutation, and others with more severe phenotypes. The names T and Brachyury are used interchangeably for the same gene. The classical Brachyury mutation manifests itself by causing short or kinked tails in heterozygous animals. Mice homozygous for T die in utero around 10 days post coitum Ždpc., with distinctive truncations of the body axis. These T r T embryos appear to have little to no notochord and have somites only up to the level of the fore limb, at which point the embryo becomes truncated, forming no trunk or tail. The cause of embryonic death does not appear to be linked to this shortened axis; rather it is thought to be a result of a defect in the allantois, which does not form a placental connection w11x. Embryos thus die of lack of nutrient near the end of the 10th day of gestation. Some sixty years after the Brachyury mutation was generated, the gene responsible was identified by positional cloning w2,12x, reviewed in w3,4,13x. Brachyury was found to encode a novel 436 amino acid polypeptide with 6 potential N-linked glycosylation sites, an abundance of serine and proline residues, and no obvious signal sequences or membrane spanning regions. The Brachyury protein has since been shown to bind DNA and activate transcription Ž see below.. The original T mutation was found to be a large deletion yielding essentially a null mutant; while the more severe alleles contained insertions, small deletions, or frameshifts resulting in altered proteins with corresponding altered activities w2x. The locus containing Brachyury, namely the Trt-complex, is a large 15 cM locus containing the H2 complex as well as two other genes which appear to either interact with or produce similar phenotypes to the original T mutation, small t Ž t . and Brachyury the second Ž T2 . w14x, respectively. Subsequent to Brachyury being cloned in the mouse, genes with significant sequence identity and thus considered homologues were identified in Xeno-
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
F75
pus Ž Xbra. w15x, zebrafish Ž Zf-T or Ntl . w16x, chicken Ž Ch-T . w17,18x, Drosophila Ž Trg . w19x, echinoderms Ž Hp-Ta. w20x, amphioxus Ž AmBra. w21x, two types of ascidians Ž As-T, Ci-Bra. w22,23x, and humans w24x. Cloning the zebrafish Brachyury homologue, Zf-T w16x, confirmed suspicions that a known zebrafish mutant, No tail Ž Ntl . , was actually a mutation in the zebrafish Brachyury gene w25x.
2. Brachyury expression and induction The expression pattern of mouse Brachyury protein is consistent with what is known about the mutant phenotypes. In mice, both Brachyury mRNA and protein are initially detectable at 6.5–7 dpc in the mesoderm and primitive ectoderm cells near the primitive streak and in the notochord as it is laid down ŽFig. 1.. Brachyury expression persists in and around the primitive streak throughout gastrulation. As cells destined to become paraxial mesoderm migrate away from the streak and differentiate, they cease to express Brachyury, but notochord Žaxial mesoderm. cells continue to express Brachyury through the end of gastrulation, even as the notochord cells form mucosal cells in the intervertebral discs w26,27x. Thus the cells most affected by the Brachyury mutation, namely posterior axial mesoderm, are the cells which express Brachyury during gastrulation. The timing and location of Brachyury expression is remarkably consistent in mouse, Xenopus, zebrafish, and chick embryos Ž Fig. 1. . The Xenopus Brachyury homologue, Xbra, for example, is expressed in a distinctive ring around the blastopore during the early stages of gastrulation w15x. As in the mouse, as mesoderm cells migrate through the blastopore, they cease to express Xbra, with the exception of the notochord and the most posterior cells of the tail, which continue to express Xbra throughout neurula and tailbud stages w7,15,28x. The zebrafish Zf-T or Ntl gene is similarly expressed first in the cells of the dorsal margin of the blastula, then in the cells of the future germ ring, and finally in the cells of the notochord w16x. The chick Brachyury gene, Ch-T, like mouse T, is found in and around the cells of the primitive streak, and as gastrulation proceeds, it becomes restricted to the notochord and the more posterior mesoderm w17x.
Fig. 1. Brachyury expression patterns and Brachyury mutants are similar across species. Expression patterns in mouse ŽA–C., Xenopus ŽD–F., and zebrafish ŽG–H. are shown. In ŽA, D, G., dorsal is to the right, ventral to the left, anterior up and posterior down. In this schematic of an ed7.5 mouse gastrula ŽA., Brachyury is detectable in the primitive streak and notochordal plate. In a tailbud stage Xenopus ŽD., Brachyury is expressed around the blastopore Žposterior. and in the involuting chordal mesoderm. A similar staining pattern is seen in the zebrafish embryo ŽG. at 100% epiboly. In later stage embryos ŽB, E, H., Brachyury expression becomes restricted to the tail and posterior domain of the notochord. Embryos lacking functional Brachyury ŽC, F, I. lack posterior structures. The mouse homozygous Brachyury mutant lacks structures posterior to the limb bud ŽC.; the Xenopus dominant inhibition of Brachyury has a shortened body axis ŽF.; and the zebrafish No tail mutant has a truncated tail and body axis ŽI..
The expression patterns of Brachyury are notably conserved amongst vertebrates, with expression present early in the mesoderm and becoming restricted to the axial mesoderm and posterior, less differentiated mesoderm. Expression differs somewhat in the urochordates, echinoderms, and insects. These genes have diverged greatly in sequence from the mouse Brachyury, but they retain a region of DNA known as the T-box Žsee below. which is largely identical to a region of the archetypal Brachyury gene ŽFig. 2., and they are thus considered homologous. We shall
F76
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
Fig. 2. Comparison of the amino acid sequences of the DNA binding domains of Brachyury homologues. Identical amino acids are boxed in black and conservative substitutions are in descending shades of gray. m-T s mouse T, the prototypic Brachyury w2x; Xbra s Xenopus Brachyury w15x; Ch-T s chick T w17,18x; Ntl s zebrafish No Tail Žalso zebrafish T or Zf-T . w16x; AmBra-1s amphioxus Brachyury w21x; Dr-Trgs Drosophila T-related gene Žalso brachyenteron or byn. w19x; As-T s ascidian T w22x. Lineup was made using the prettybox program of the extended GCG package.
refer to these close relatives as T- genes, though only now is the degree of functional conservation over these large evolutionary distances being tested. The ascidians Halocynthia roretzi and Cionia intestinalis have retained the expression of Brachyury in the notochord, but neither expresses Brachyury in the mesenchyme w22,23,29x. The sea urchin expresses its Brachyury gene in the tip of the invaginating archenteron and in the secondary mesenchyme cells w30x. The most divergent expression pattern appears to be found in insects. In Drosophila, the T-related gene Ž Trg . w19x also termed brachyenteron Ž byn. w31x, is initially expressed during embryo cellularization in the primordia of the hindgut and the anal pads, and continues to be expressed in these tissues as they mature w19,32x. Trgrbyn is necessary for the proper formation of the hindgut and anal pads w19x, and for maintenance of gene expression in the anal pads w31x. The divergent expression patterns of Brachyury expression in non-vertebrates allows for interesting speculations about the evolution of chordates w20,33x and the evolution of the notochord w20,32x. Xenopus has proved a useful testing ground for questions of Brachyury regulation. A large body of literature exists on the soluble factors which can, in Xenopus, mimic the process of mesoderm induction which occurs during gastrulation. Many of these mesoderm-inducing factors were shown able to in-
duce Xenopus Brachyury Ž Xbra. expression as they induced axial-type mesoderm. When isolated and cultured alone, the cells of the roof of the Xenopus blastocoel, known as the ‘animal cap’ cells, form undifferentiated ectoderm. These same cells cultured in the presence of activin, a member of the TGF-b family, can differentiate into axial mesoderm and express mesoderm-specific genes in a dose-dependent manner w34x. Brachyury is one of the genes which can be induced by activin, and it is induced rapidly, in a translation-independent manner w15x. Similar assays have shown that Brachyury expression can also be induced in Xenopus by the TGF-b family members Vg1 and BMP4, and expression can be both induced and maintained by FGF w7,15,35–37x. Likewise, inhibiting either activin or FGF signaling in embryos by injecting dominant negative receptor constructs inhibits Brachyury expression in these embryos w37–39x. Similar findings of activin’s ability to induce both axial mesoderm and Brachyury expression have been shown in chick, whereby activin ectopically applied to the early blastoderm can cause a second primitive streak to form with corresponding Chick T Ž Ch-T . expression w17x; and in zebrafish, whereby both activin and FGF can induce Ntl expression in zebrafish animal pole explants w6,16x. Interestingly, Brachyury expression can actually induce the synthesis of an embryonic form of FGF,
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
eFGF, in Xenopus explants w37,40x. Thus it has been proposed that Xbra and eFGF are both members of what has been termed an ‘autocatalytic maintenance loop’ w37x. In Drosophila, Brachyury expression has been shown to be dependent on the zygotic genes tailless Ž tll . and huckebein Ž hkb ., which specify the posterior pole of the embryo w19x. In Xenopus, Brachyury expression has been shown to be dependent on the mesoderm inducing factors FGF and activin w15,37– 39,41x. Despite this accumulated information, the mechanisms which direct activation of Brachyury have thus far been elusive. Recently, however, an element responsible for directing notochord-specific expression of Brachyury has been identified in the ascidian Cionia intestinalis w23x. A notochord-specific enhancer element, in the 5X flanking sequence to the Cionia Brachyury gene Ci-Bra, was shown to contain distinct repression and activation elements. The repression elements repress expression in non-notochord lineages, and the activator region directs expression in the notochord. The activator region, notably, contains two possible Suppresser of Hairless Ž Su(H). binding sites, one which closely matches the conserved recognition sequence, and a second, sub-optimal site. This raises the interesting possibility that notochord-specific expression of Ci-Bra is linked to the Notch signaling pathway. In Drosophila, activation of this pathway through the Notch receptor translocates SuŽ H . from the cytoplasm to the nucleus, where it binds to conserved Su(H) recognition sequences ŽFor review, see w42x.. Thus activation of Notch might lead to transcription of Brachyury in the notochord. Expression in the paraxial, as opposed to axial, mesoderm may be under separate control, since the Cionia intestinalis Ci-Bra w23x and Halocynthia roretzi As-T w43x genes are not expressed in paraxial mesoderm, and a second gene, AsT2, with sequence similarity to Brachyury has been identified in Halocynthia roretzi which is expressed in the paraxial mesoderm w44x. These expression of these two Ascidian genes together make up the two domains of Brachyury expression observed in Cephalochordates and Vertebrates. Whether or not the Brachyury genes of these higher order organisms will also contain SuŽ H . sites, and whether Brachyury transcription can be activated by SuŽ H . or by Notch begs investigation.
F77
3. Brachyury encodes a transcription factor Soon after Brachyury was cloned, indirect evidence began to accumulate indicating that it might play a role in transcriptional regulation. Aside from weak similarities to the transcription factor MyoD w13x and the proto-oncogene rel w45x, the DNA sequence did not yield any apparent protein motifs such as secretory signals or transmembrane domains. Brachyury acted cell-autonomously, and was thus unlikely to be a secreted factor w46x. Brachyury protein was found to localize to the nucleus w16,26,47x, and introduction of Brachyury mRNA into Xenopus animal caps induced transcription of mesodermspecific genes w48x. Possibly most telling was the discovery of a region of sequence similarity between mouse Brachyury and the Drosophila optomotorblind Žomb. protein w49x. This region of the omb protein was shown able to bind a non-specific mixture of calf thymus DNA, whereas other regions of the protein could not w49x. Brachyury’s ability to bind DNA was demonstrated directly by Kispert and Herrmann w50x, who mixed in vitro synthesized Brachyury protein with a mixture of random oligonucleotides flanked with defined primer sites, immunoprecipitate with an anti-T antibody, and amplified the bound sequence. Gel shift analysis proved that Brachyury bound to a consensus 20 base pair internally palindromic site, TGACACCTAGGTGTGAAATT, and DNase 1 footprinting confirmed the binding. Deletion analysis of the Brachyury protein identified the N-terminal 229 amino acids as necessary for strong DNA binding, with residues 18–229 critical for any DNA binding. Despite the palindromic nature of the binding site, Brachyury did not require dimerization to bind DNA w50x. Not only can Brachyury bind to specific DNA sequences, but studies using mouse w5x, frog and zebrafish w51x Brachyury proteins show that once bound to its consensus sequence, Brachyury can trans-activate transcription of reporter genes in vitro. Kispert and colleagues w52x co-transfected a CAT reporter construct containing the palindromic Brachyury binding site into both HeLa and Cos7 cells and found transcriptional activation. To dissect which region of Brachyury was responsible for transcriptional activation, these researchers used two sys-
F78
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
tems for co-transfection, the Brachyury binding siterCAT construct, and also a yeast GAL4 upstream activating sequence ŽUAS.rCAT reporter construct, whereby the yeast GAL4 DNA binding domain was fused the to various lengths of the non-DNA binding domain of Brachyury, and co-transfected with the GAL4 UASrCAT construct. The yeast GAL4 system allowed these researchers to relatively precisely map the two sites which caused transcriptional activation and two which caused repression within the 206 amino acids C-terminal of the Brachyury DNA binding domain, as well as a region necessary for the nuclear localization of Brachyury. A similar mapping of the activation domain of Xenopus Brachyury ŽXbra. and zebrafish Brachyury ŽNtl. was carried by Conlon and colleagues w51x, who also identified an activation domain 3X to the DNA binding domain of Brachyury. These researchers went on to engineer a fusion protein which replaced the identified activation domains of Xbra and Ntl with the repressor domain from the engrailed protein Ž En r .. They injected the mRNA coding for the fusion into Xenopus and zebrafish, respectively. These BrachyuryrEn r constructs were able to mimic the zebrafish Brachyury mutant, No tail, and cause a phenocopy of a Brachyury mutant in Xenopus, with notochord present only anteriorly, if at all, and a posterior truncation as might be expected from the known mouse and zebrafish Brachyury mutants. This result firmly established a link between Brachyury’s ability to activate transcription with its ability to induce posterior notochord and trunk structures in the developing embryo. A further finding of this study was the effect of the ‘dominant negative’ XbrarEn r construct on endogenous Brachyury expression in Xenopus. The repressing Xbra construct caused a disruption in normal Brachyury expression in the developing embryo, but interestingly, this disruption was only observed in the dorsal domain of Brachyury expression, not in the ventral mesoderm. This implies that Brachyury is subject to autoregulation on the dorsal side, but the ventral domain of Brachyury expression is controlled by some other means. This could mean that the dorsal and ventral domains of Brachyury expression have different functions, despite the apparent continuity and similar timing between them. Possible autoregulation of Brachyury expression
has been demonstrated independently by Rao w53x. When he injected a truncated Xbra construct lacking what is now known to be the activation domain, he observed a functional inhibition of wild-type Xbra, in that it could no longer induce mesoderm in animal caps. This study also demonstrated that overexpression of this truncated construct induces neuralization, but this may be a non-specific effect of expressing large quantities Ž3–6 ng. of the Xbra DNA binding domain.
4. Cellular functions of Brachyury There appear to be three schools of thought as to how Brachyury functions to allow posterior development in the embryo. One theory is that Brachyury directs the differentiation of posterior mesoderm. Evidence which supports this claim can be found in the fact that Brachyury is an immediate early response gene to the mesoderm inducing factors activin and FGF w15x. Activin can induce Brachyury in a dose dependent manner w34x, independent of new transcription w15x. FGF can also induce Brachyury, and Brachyury’s ability to induce mesoderm in animal caps is dependent on an intact FGF signaling pathway w37,40x. Embryos that are made mutant for Brachyury bear a resemblance to embryos injected with the dominant negative FGF receptor, XFD w39x, or embryos with a disturbed MAP kinase pathway, known to be downstream components of the FGF mesoderm-inductive signal. More directly, injection of Brachyury mRNA into Xenopus embryos increases the amount of mesoderm formed w48x. Ectopic expression of Brachyury in Xenopus animal caps causes caps to elongate and express mesodermspecific genes in a dose-dependent manner w48,54x. These results are consistent with and predicted by a Brachyury-FGF maintenance loop w37,40x, mentioned above. Another interpretation of Brachyury function is that Brachyury controls the particular cell movements known as convergent extension that take place during the formation of notochord. This idea, proposed by Yamada w55x, is based mostly on circumstantial evidence. Brachyury is expressed in the region that convergent extension of the axial mesoderm is taking place. The expression of Brachyury in
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
Xenopus persists until stage 37 w15x, apparently when the last convergent extension movement is finished w55x. Most convincing, increasing the number of Brachyury genes in transgenic mice increases the degree of convergent extension and thus axial elongation observed w12,56x. A more inclusive theory does not limit Brachyury function to controlling convergent extension movements, rather, it allows for Brachyury control of a variety of cell movements. A purely morphometric study which followed cell numbers and distribution in TrT mouse embryos concluded that Brachyury mutants showed anomalies in cell migration, with cells derived from the epiblast becoming stuck in the primitive streak region w57x. These findings were supported by chimeric studies which also found cells becoming ‘stuck’, though after they had ingressed through the primitive streak. When chimeras are made between wildtype mice and TrT mutant embryonic stem Ž ES. cells, the TrT cells colonize the embryo
F79
preferentially at the tail end w1,58x. Further study of Brachyury- deficient cell behavior in a wild-type background using a lacZ gene trap demonstrated that the T deficient cells gather progressively at the midline just ventral to the primitive streak, forming a ‘wedge’ of TrT cells w59x. These cells adhere closely to one another and appear to physically prevent formation of a normal tail. The inappropriate migration of these cells may be due to altered cell surface properties; TrT ES cells are found in clumps throughout the embryo and are rarely interspersed with wild type cells w59x. Other studies support the idea that the surface of Brachyury deficient cells is altered. Scanning electron microscopy has demonstrated differences in the extracellular matrix of TrT embryos w60x, and aggregation studies have shown differences in the adhesive properties of T-deficient cells w61x. Which of these theories accounts for the function of Brachyury? Perhaps the truth lies in a synthesis of
Fig. 3. Dendrogram indicating the degrees of relatedness over the entire amino acid sequences of the T-box genes entered in Genbank at this writing. Am s amphioxus; Ce s C. elegans; Ch s chicken; Dr s Drosophila; Hp s Hemicentrotus pulcherrimus Žsea urchin.; Hu s human; Mo s mouse; Nw s newt; X s Xenopus; Zf s zebrafish ŽRefs. w2,15–19,21,22,30,65–68,70,72–77,79,80,82x..
F80
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
the three, for they are not mutually exclusive. Cell differentiation can certainly cause changes in cell surface properties which can subsequently cause specific cell migration behaviors and movements. For example, the dorsal mesoderm inducing factor activin elicits both cell fate changes and several characteristic cell movements as well as Brachyury expression w62–64x What one group terms ‘axial mesoderm induction’ may be identical to another group’s ‘convergent extension behavior’ and another’s ‘cell surface anomaly.’ Thus the transcription factor Brachyury probably activates a series of genes which result in the formation of axial mesoderm through a differentiation program that includes changes in cell surface and cell migration patterns. The definitive answer to the question ‘What does the Brachyury protein do?’ will only emerge when we know its targets. Thus far no direct transcriptional targets of Brachyury have been identified. Until the time we know the molecular interactions involved, we are unlikely to find a satisfactory explanation for Brachyury function in development.
5. The T-box gene family The first T-box gene to be identified that was not a homologue of Brachyury itself was the Drosophila omb gene, essential for optic lobe development w65x. Since that time, at least twenty-five genes that contain a region of homology to the DNA binding domain of Brachyury have been described. Outside the DNA binding domain, or T-box, these genes bear less sequence similarity to Brachyury than the Tgenes, but some bear similarities to one another. The dendrogram in Fig. 3 shows the degree of amino acid similarity over the entire length of these genes. As many of these genes are only newly identified, much of what is known of them is descriptive, namely where and when they are expressed. Studies in mouse have revealed interesting tissue-specific localization for a number of T-box containing genes, described below, indicating possible involvement in brain development and in hindlimbrforelimb specification. Work in Xenopus has produced information on both overexpression and inhibition of expression of some T-box genes, showing some of them to be important in the processes of gastrulation and embryonic pat-
terning Žsee below.. In humans, a genetic linkage study has found a human disease to be the result of a mutation in a T-box gene. This diverse family of genes are similar only in that all appear to be involved in processes of development, from gastrulation to organogenesis.
6. T-box genes in mouse At this writing, seven T-box containing genes, in addition to Brachyury, have been identified in the mouse, termed Tbx1 through Tbx6, and Tbr-1. Two pairs of these genes, Tbx2 and 3, and Tbx4 and 5, have significant sequence similarity to one another, and one of each pair maps to identical positions on mouse chromosomes 11 Ž Tbx 2 and 4 . and 5 Ž Tbx3 and 5 ., indicating that the genes may have arisen from a common ancestral gene that first underwent a tandem duplication, then a second duplication as a gene cluster, and finally a dispersion of each cluster to different chromosomes w66x. These gene pairs overlap significantly in their patterns of expression, but each gene also shows areas of unique expression w67,68x. Tbx 2 and 3 are both expressed in the forebrain and facial regions near the various developing placodes, and later in the limb buds and myotomes w67,68x. Tbx 3 is expressed earlier than Tbx 2, at 3.5 dpc in the inner cell mass and later in the extraembryonic membranes. Tbx2 is expressed earlier than Tbx3 in the otic and optic vesicles and later it is uniquely expressed in the developing pinnae of the ear. Tbx4 and 5 are expressed in the allantois, although Tbx 5 expression there is transient, and in the developing heart, with slightly different distributions. The genes differ in their expression in the developing eye Ž Tbx5 only., genital papillae Ž Tbx4 only., and perhaps surprisingly, fore- and hind- limb buds, which express Tbx5 and Tbx4, respectively w67,69x. The restricted expression of Tbx 5 and Tbx4 in the forelimb and hindlimb raises the intriguing possibility that the genes are involved in differential limb specification during embryogenesis w69x. Tbx1 is first detectable at 7.5 dpc in the anterior embryonic mesoderm, rostral to the node. Later expression is found in head regions including the pharyngeal region and otic vesicle, and also in a segmented pattern along the spinal column w67,68x. T-
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
brain-1 Ž Tbr-1. also has a unique distribution amongst T-box genes. Tbr-1 is expressed only in post-mitotic cells of the developing and adult telencephalon. It is expressed in a rostral to caudal gradient in the subplate of the neocortex, suggesting that it may play a role in patterning the cortex. Since Tbr-1 is not expressed in the dividing cells of the ventricular zone, it is thought not to be involved in the regional specification of the brain; rather it is thought to be important in the control of differentiation w70x. Only one of the mouse T-box genes in addition to Brachyury is expressed exclusively in the mesoderm during gastrulation. Tbx6 expression overlaps that of Brachyury in the primitive streak and tail bud, although Tbx6 is notably not expressed in the node and notochord. Tbx6 expression also begins later than Brachyury, and extends to the more lateral presomitic paraxial mesoderm. Tbx6 is not initially affected by the absence of Brachyury in TrT embryos, but Tbx6 expression is severely downregulated in TrT embryos at the time the TrT phenotype becomes apparent, at 8.5 dpc. Thus Brachyury may be necessary to maintain rather than initiate Tbx6 expression w71x. Although no mouse T-box knockouts have yet been generated, a mutation in the human homologue of the mouse Tbx-5 gene has recently been shown responsible for Holt-Oram syndrome, a developmental disorder which affects the heart and upper limb w72x. This loss-of-function mutation is remarkably consistent with what is known of the mouse Tbx5 gene expression; indeed, Tbx5 expression in heart and limb is also found in human embryos w72x. Given the powerful knock-out techniques available in the mouse system, information on loss-of-function mutants for the remaining T-box genes will no doubt soon be available.
7. T-box genes in Xenopus In Xenopus, five T-box containing genes have thus far been identified, four of which are nearly identical in sequence and expression pattern. Antipodean Ž Apod . w73x, Brat w74x, VegT w75x, and Xombi w76x are all expressed in the vegetal cortex during oogenesis. Transcripts remain vegetal until the time of gastrulation, when expression overlaps that of Brachyury in the marginal zone, although unlike
F81
Xbra, these T-box genes are excluded from the notochord, similar to the expression pattern observed for the mouse Tbx-6 gene. Mesodermal expression becomes restricted to posterior ventral and lateral mesoderm as gastrulation proceeds, and by tailbud stage expression is undetectable, except in the case of Veg-T, where expression is observed late in a subset of sensory neurons in the dorsal-lateral region of the neural tube. Like Xbra, the genes Apod, Brat, VegT, and Xombi can induce the expression of mesoderm markers, including Xbra, in an animal cap assay. While Xbra cannot induce the expression of dorsal mesodermal markers, these other genes can if expressed at high doses. Overexpressed T-box genes can induce expression of genes normally expressed in the organizer region such as Goosecoid Ž Gsc ., and in the case of Brat, Chordin Ž Chd . and Xlim-1 w74x. Although these genes can induce Xbra expression, at least one of these genes, Apod, cannot be induced by Xbra w73x. Animal cap expression of any of the four genes induces mesoderm and muscle formation, and Brat can induce formation of endoderm w74x. Overexpression of Xombi in the ventral region of a Xenopus embryo caused cells to begin invaginating, forming what appeared to be a secondary dorsal lip of the blastopore w76x; while overexpression of Veg-T on the ventral side caused formation of a secondary axis, lacking anterior structures w75x. The only apparent difference in these four genes, apart from slight variations in amino acid sequence, is in their response to mesoderm-inducing factors. While Apod, Brat and Xombi can be induced by members of the TGF-b superfamily like activin, Vg-1, and BMP4; only Xombi and Brat can be induced by FGF signaling w74,76x. When a dominant negative FGF receptor construct, XFD, is injected into embryos, Apod expression is unaffected w73x, whereas Xombi expression is notably downregulated by this same construct w76x. The four genes are likely to all be transcription factors, and it was demonstrated that Veg-T can localize to the nucleus and that its putative activation domain can activate transcription in a yeast one hybrid system w75x. Inhibition of Brat’s ability to activate transcription using an Bratrengrailed repressor fusion protein construct has dramatic effects on embryonic development w74x. Dorsal injection of Bratren r mRNA inhibits dorsal
F82
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
lip formation and subsequent head and trunk development, while ventral injection inhibits ventral lip formation and subsequent tail, trunk, and ventral development w74x. Thus at least one of these genes appears to be essential for mesoderm development. It will be interesting to find out whether these extremely similar genes are alleles of the same genetic locus, different alternatively spliced transcripts from the same gene, or if they in fact represent distinct T-box genes which have overlapping expression patterns and perhaps slightly different functions. The remaining T-box containing gene found in Xenopus, Eomesodermin Ž Eomes . w77x, has an amino acid sequence and expression pattern distinct from Xbra and the four similar genes Apod, Brat, VegT and Xombi. Eomes is not expressed in the oocyte; rather expression can be detected only slightly before Xbra, during the time mesoderm is just being formed in the embryo. During gastrulation, Eomes is expressed in a gradient throughout the marginal zone, with the highest levels of Eomes transcript localized dorsally and the lowest levels localized ventrally. This pattern of expression raises the interesting possibility that Eomes may be involved in dorsalrventral patterning in the early embryo. Overexpression of Eomes in ventral blastomeres can cause formation of a secondary axis in a dose-dependent manner. Eomes expression in animal cap assays induces the same array of mesoderm tissues and mesoderm specific genes as the above mentioned T-box genes, and Xbra does not induce Eomes expression w77x. Inhibition of Eomes using a Eomesren r fusion protein leads to arrested development during gastrulation, and targeting the fusion protein to dorsal blastomeres blocks axis formation w77x. Eomesren r does not inhibit Xbra expression and has little effect on its own expression, which is interesting considering an Xbraren r fusion protein inhibits Xbra expression significantly, especially in the dorsal domain of expression, and also increases Eomes expression slightly. What is the relationship between Xbra and these other T-box genes? All seem to be important in the process of mesoderm formation, and their expression patterns overlap in places during gastrulation. These genes can induce Xbra expression, but not vice-versa. The functions of Xbra and the other genes appear to be distinct: Xbra cannot rescue embryos injected with dominant-repressing forms of Brat or Eomes. It
is likely that these genes do interact during gastrulation and the formation of mesoderm, but fortuitous co-localization and sequence similarity do not necessarily imply functional redundancy.
8. Other T-box genes T-box genes continue to be identified at a rapid pace. As genes are identified in a range of different species, they generally share sequence similarity to one of the known mouse or frog genes and often share tissue-specific expression patterns. Two T-box genes in addition to Brachyury itself have been identified in chick. Ch-TbxT is extremely similar in amino acid sequence to the prototypic Ch-T and in some places has an overlapping domain of expression. Ch-TbxT is expressed mostly in the dorsal axial mesoderm, reminiscent of the Xenopus Eomes, rather than throughout the axial mesoderm like Ch-T. Ch-TbxT also has an domain of expression which is extended relative to Ch-T: it is expressed in an anterior domain, including the prechordal plate. This observation raises the possibility that ChTbxT may extend T function to the anterior axis, and perhaps be important in the formation of anterior notochord, a process which is independent of T function w18x. ChTbx6L is so named because its sequence is similar to the mouse Tbx6 gene. Like mouse Tbx6, Ch-Tbx6L is expressed in the paraxial mesoderm and presumptive somitic cells, and excluded from the notochord. It becomes rapidly downregulated in this presomitic mesoderm once somites are formed w18x. A number of T-box genes in the urodele have recently been identified w78x. One of these genes, NÕTbox1, appears to be the newt homologue of the mouse and human Tbx5 gene, and is important in distinction of forelimb and hindlimb, and in limb development and regeneration in general w78x. A second T-box containing gene, AsT2 Ždescribed above. has been isolated from the ascidian Halocynthia roretzi and appears to complement the Brachyury orthologue As-T w44x. The human T-box genes that have been identified are homologues in sequence and expression pattern to the mouse T-box genes Tbr-1 w70x, Tbx2 w79x, and Tbx5 w72x. A number of C. elegans T-box containing genes which bear little resemblance to other T-box genes have been identi-
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
fied w80x, some as a product of the C. elegans genome project, but little has been published describing their possible function.
9. Tailpiece When one considers the direction of Brachyury research, two questions loom large, namely, what regulates Brachyury and T-box genes, and what do they in turn regulate? The first question is likely to be answered in the near future using readily available technologies like one-hybrid screens, as has been successfully employed by Chen and colleagues to identify FAST-1 as a transcriptional activator of Mix.1 w81x. The second question may prove a more difficult challenge. Two targets have already been identified, eFGF and Brachyury itself, though neither has been shown to be a direct target. Finding targets for transcription factors is in some ways a technological bottleneck; witness the slow progress made in the search for targets of HOX genes. It is possible that classical genetic suppresser and enhancer screens in Drosophila or perhaps, given the new mutants, zebrafish, will prove an effective tool in uncovering Brachyury targets. Alternatively, given the right computer search engine, it is conceivable that knowledge of the sequence of a Brachyury favored binding site combined with the accumulating genomic sequence databases will yield a target. However, a caveat to any ‘genome crunching’ is that sequence correspondence is only a prelude to functional analysis. As for the future of research on the T-box genes, the next interesting question is simply ‘what will the knockout mutants look like?’
References w1x R.S.P. Beddington, P. Rashbass, V. Wilson, Development supplement Ž1992. 157–165. w2x B.G. Herrmann, S. Labeit, A. Poustka, T.R. King, H. Lerach, Nature 343 Ž1990. 617–622. w3x B.G. Herrmann, Sem. Dev. Biol. 6 Ž1995. 385–394. w4x B.G. Herrmann, A. Kispert, Trends Genet. 10 Ž1994. 280– 286. w5x A. Kispert, Sem. Dev. Biol. 6 Ž1995. 395–403. w6x S. Schulte-Merker, Sem. Dev. Biol. 6 Ž1995. 411–416.
F83
w7x J.C. Smith, V. Cunliffe, M.-A.J. O’Reilly, S. SchulteMerker, M. Umbhauer, Sem. Dev. Biol. 6 Ž1995. 405–410. w8x N. Dobrovolskaia-Zavadskaia, C.R. Sceances Soc. Biol. 97 Ž1927. 114–116. w9x P. Chesley, J. Exp. Zool. 70 Ž1935. 429–435. w10x H. Gruneberg, J. Embryol. Exp. Morphol. 6 Ž1958. 424–443. w11x S. Gluecksohn-Shoenheimer, Proc. Natl. Acad. Sci. USA 30 Ž1944. 134–140. w12x D. Stott, A. Kispert, B.G. Herrmann, Genes Dev. 7 Ž1993. 197–203. w13x K. Willison, Trends Genet. 6 Ž1990. 104–105. w14x G.M. Rennebeck, E. Lader, Q. Chen, R.A. Bohm, Z.S. Cai, C. Faust, T. Magnuson, L.R. Pease, K. Artzt, Dev. Biol. 172 Ž1995. 206–217. w15x J.C. Smith, B.M.J. Price, J.B.A. Green, D. Weigel, B.G. Herrmann, Cell 67 Ž1991. 79–87. w16x S. Schulte-Merker, R.K. Ho, B.G. Herrmann, C. NussleinVolhard, Development 116 Ž1992. 1021–1032. w17x A. Kispert, H. Ortner, H. Cooke, B.G. Herrmann, Dev. Biol. 168 Ž1995. 406–415. w18x V. Knezevic, R. DeSanto, S. Mackem, Development 124 Ž1997. 411–419. w19x A. Kispert, B.G. Herrmann, M. Leptin, R. Reuter, Genes Dev. 8 Ž1994. 2137–2150. w20x H. Yasuo, Y. Harada, N. Satoh, Sem. Dev. Biol. 6 Ž1995. 417–425. w21x P.W. Holland, B. Koschorz, L.Z. Holland, B.G. Herrmann, Development 121 Ž1995. 4283–4291. w22x H. Yasuo, N. Satoh, Dev. Growth Differ. 36 Ž1994. 9–18. w23x J.C. Corbo, M. Levine, R.W. Zeller, Development 124 Ž1997. 589–602. w24x Y.H. Edwards, W. Putt, K.M. Lekoape, D. Stott, M. Fox, D.A. Hopkinson, J. Sowden, Genome Res. 6 Ž1996. 226– 233. w25x S. Schulte-Merker, F.J.M. van Eeden, M.E. Halpern, C.B. Kimmel, C. Nusslein-Volhard, Development 120 Ž1994. 1009–1015. w26x A. Kispert, B.G. Herrmann, Dev. Biol. 161 Ž1994. 179–193. w27x D.G. Wilkinson, S. Bhatt, B.G. Herrmann, Nature 343 Ž1990. 657–659. w28x L.K. Gont, H. Steinbeisser, B. Blumberg, E.M. DeRobertis, Development 119 Ž1993. 991–1004. w29x H. Yasuo, N. Satoh, Nature 364 Ž1993. 582–583. w30x Y. Harada, H. Yasuo, N. Satoh, Development 121 Ž1995. 2747–2754. w31x J.B. Singer, R. Harbecke, T. Kusch, R. Reuter, J.A. Lengyel, Development 122 Ž1996. 3707–3718. w32x R. Reuter, Sem. Dev. Biol. 6 Ž1995. 427–435. w33x B.G. Herrmann, Sem. Dev. Biol. 6 Ž1995. 381–384. w34x J.B.A. Green, H.V. New, J.C. Smith, Cell 71 Ž1992. 731– 739. w35x S. Schulte-Merker, J.C. Smith, L. Dale, EMBO J. 15 Ž1994. 3533–3541. w36x J.M. Graff, R.S. Thies, J.J. Song, A.J. Celeste, D.A. Melton, Cell 79 Ž1994. 169–179.
F84
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
w37x H.V. Isaacs, M.E. Pownall, J.M. Slack, EMBO J. 13 Ž1994. 4469–4481. w38x A. Hemmati-Brivanlou, D.A. Melton, Nature 359 Ž1992. 609–614. w39x E. Amaya, T.H. Musci, M. Kirschner, Cell 66 Ž1991. 257– 270. w40x S. Schulte-Merker, J.C. Smith, Curr. Biol. 5 Ž1995. 62–67. w41x H.V. New, A.I. Kavka, J.C. Smith, J.B.A. Green, Mech. Dev. 61 Ž1997. 175–186. w42x S. Artavanis-Tsakonas, K. Matsuno, M.E. Fortini, Science 268 Ž1995. 225–232. w43x Y. Nakatani, H. Yasuo, N. Satoh, H. Nishida, Development 122 Ž1996. 2023–2031. w44x H. Yasuo, M. Kobayashi, Y. Shimauchi, N. Satoh, Dev. Biol. 180 Ž1996. 773–779. w45x F. Perrin-Schmitt, Biochim. Biophys. Acta 1171 Ž1992. 129–131. w46x P. Rashbass, L.A. Cooke, B.G. Herrmann, R.S.P. Beddington, Nature 353 Ž1991. 348–351. w47x V. Cunliffe, J.C. Smith, EMBO J. 13 Ž1994. 349–359. w48x V. Cunliffe, J.C. Smith, Nature 358 Ž1992. 427–430. w49x G.O. Pflugfelder, H. Roth, B. Pieck, Biochem. Biophys. Res. Commun. 186 Ž1992. 918–925. w50x A. Kispert, B.G. Herrmann, EMBO J. 2 Ž1993. 3211–3220. w51x F.L. Conlon, S.G. Sedgwick, K.M. Weston, J.C. Smith, Development 122 Ž1996. 2427–2435. w52x A. Kispert, B. Koschorz, B.G. Herrmann, EMBO J. 14 Ž1995. 4763–4772. w53x Y. Rao, Genes Dev. 8 Ž1994. 939–947. w54x M.-A.J. O’Reilly, J.C. Smith, V. Cunliffe, Development 121 Ž1995. 1351–1359. w55x T. Yamada, Development 120 Ž1994. 3051–3062. w56x K.O. Yanagisawa, Jpn. J. Genet. 65 Ž1990. 287–297. w57x K.O. Yanagisawa, H. Fujimoto, H. Urushihara, Dev. Biol. 87 Ž1981. 242–248. w58x V. Wilson, P. Rashbass, R.S.P. Beddington, Development 117 Ž1993. 1321–1331. w59x V. Wilson, L. Manson, W.C. Skarnes, R.S.P. Beddington, Development 121 Ž1995. 877–556. w60x R.J. Jacobs-Cohen, M. Spiegelman, D. Bennett, Differentiation 25 Ž1983. 48–55. w61x K.O. Yanagisawa, H. Fujimoto, J. Embryol. Exp. Morphol. 40 Ž1977. 277–283. w62x J.C. Smith, K. Symes, R.O. Hynes, D. DeSimone, Development 108 Ž1990. 229–238. w63x K. Symes, M. Yaqoob, J.C. Smith, Development 104 Ž1988. 609–618.
w64x K. Symes, C. Yordan, M. Mercola, Development 120 Ž1990. 2339–2346. w65x G.O. Pflugfelder, H. Roth, B. Poeck, S. Kerscher, H. Schwarz, B. Jonschker, M. Heisenberg, Proc. Natl. Acad. Sci. USA 89 Ž1992. 1199–1203. w66x S.I. Agulnik, N. Garvey, S. Hancock, I. Ruvinsky, D.L. Chapman, I. Agulnik, R. Bollag, V. Papaioannou, L.M. Silver, Genetics 144 Ž1996. 249–254. w67x D.L. Chapman, N. Garvey, S. Hancock, M. Alexiou, S.I. Agulnik, J. Gibson-Brown, J. Cebra-Thomas, R. Bollag, L.M. Silver, V.E. Papaioannou, Dev. Dynamics 206 Ž1996. 379–390. w68x R.J. Bollag, Siegfried, J.A. Cebra-Thomas, N. Garvey, E.M. Davison, L.M. Silver, Nature Genet. 7 Ž1994. 383-389. w69x J.J. Gibson-Brown, S.I. Agulnik, D. Chapman, M. Alexiou, N. Garvey, L.M. Silver, V.E. Papaioannou, Mech. Dev. 56 Ž1996. 93–101. w70x A. Bulfone, S.M. Smiga, K. Shimamura, A. Peterson, L. Puelles, J.L.R. Rubenstein, Neuron 15 Ž1995. 63–78. w71x D.L. Chapman, I. Agulnik, S. Hancock, L.M. Silver, V.E. Papaioannou, Dev. Biol. 180 Ž1996. 534–542. w72x Q.Y. Li, R.A. Newbury-Ecob, J.A. Terrett, D.I. Wilson, A.R.J. Curtis, C.H. Yi, T. Gebuhr, P.J. Bullen, S.C. Robson, T. Strachan, D. Bonnet, S. Lyonnet, I.D. Young, J.A. Raeburn, A. Buckler, D.J. Law, J.D. Brook, Nature Genet. 15 Ž1997. 21–29. w73x F. Stennard, G. Carnac, J.B. Gurdon, Development 122 Ž1996. 4179–4188. w74x M.E. Horb, G.H. Thomsen, Development 124 Ž1997. 1689– 1698. w75x J. Zhang, M.L. King, Development 122 Ž1996. 4119–4129. w76x K.D. Lustig, K.L. Kroll, E.E. Sun, M.W. Kirschner, Development 122 Ž1996. 4001–4012. w77x K. Ryen, N. Garrett, A. Mitchell, J.B. Gurdon, Cell 87 Ž1996. 989–1000. w78x H.-G. Simon, R. Kittappa, P.A. Khan, C. Tsilfidis, R.A. Liversage, S. Oppenheimer, Development 124 Ž1997. 1355– 1366. w79x C. Campbell, K. Goodrich, G. Casey, B. Beatty, Genomics 28 Ž1995. 255–260. w80x S.I. Agulnik, R.J. Bollag, L.M. Silver, Genomics 25 Ž1995. 214–219. w81x X. Chen, M.J. Rubock, M. Whitman, Nature 383 Ž1996. 691–696. w82x B. Hug, V. Walter, D.J. Grunwald, Dev. Biol. Ž1997. in press.
Tales of tails: Brachyury and the T-box genes Amy I. Kavka ) , Jeremy B.A. Green
1
Dana-Farber Cancer Institute, 44 Binney Street Room B455, Boston, MA 02215, USA Received 27 March 1997; accepted 15 May 1997
Contents 1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.1. Cloning Brachyury . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F73 F74
2. Brachyury expression and induction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F75
3. Brachyury encodes a transcription factor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F77
4. Cellular functions of Brachyury . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F78
5. The T-box gene family . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F80
6. T-box genes in mouse . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F80
7. T-box genes in Xenopus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F81
8. Other T-box genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F82
9. Tailpiece . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F83
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
F83
1. Introduction A mouse with a heritable short tail has paved the way for the discovery of an important new family of DNA binding proteins. This Brachyury Žliterally,
)
Corresponding author. Fax: q1 617 3758279. E-mail: [email protected] 1 E-mail: [email protected]
short tail. mouse has been studied extensively since its appearance in the scientific literature in 1927. The gene responsible for the short tail, Brachyury, has since been shown to be an important player in the process of gastrulation, during which the three embryonic germ layers, ectoderm, endoderm, and mesoderm become delineated. More specifically, Brachyury is expressed in and is necessary for establishing the mesoderm, particularly the caudal component of the axial mesoderm, and when the gene is
0304-419Xr97r$32.00 q 1997 Elsevier Science B.V. All rights reserved. PII S 0 3 0 4 - 4 1 9 X Ž 9 7 . 0 0 0 1 6 - 4
F74
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
absent embryos simply do not form structures caudal to the forelimb. This gene, originally identified in mouse, is now found to be important in the differentiation of specific mesoderm populations in species as diverse as fruit flies, sea urchins, nematode worms, zebrafish, frogs, chickens, and humans. Brachyury genes encode transcription factors and thus may be responsible for the coordinate expression of a number of genes involved in the process of cell differentiation. Recently, relatives of Brachyury have been isolated. These relatives are known as T-box genes because of sequence similarity in their DNA binding domains, or T-boxes. The extent of the T-box gene family and their functions, some similar to Brachyury and some quite divergent, are only now coming to light. Research in Brachyury and its relatives is thus at a turning point: rapid progress in the understanding of the molecular and cellular role of the original Brachyury can begin to be applied to a whole class of family members. This review will summarize the history of Brachyury Žthough the reader is directed to excellent accounts in previous reviews w1–7x., outline the most recent progress in its analysis and finally provide an introduction and overview of the T-box gene family of genes currently known. The cloning of the mouse Brachyury or T gene after decades of classical genetic analysis has opened up the process of mesoderm formation to molecular analysis. The Brachyury protein has been shown to be a DNA-binding transcription factor, but thus far no transcriptional targets have been identified. Brachyury mRNA overexpression is sufficient to elicit mesodermal characters in cells and expression of eFGF, but whether its normal role is to modulate differentiation or to specify cell movements or cell surface characteristics remains an open question. Very similar genes, probably direct homologues of mouse Brachyury, have been identified in both vertebrate and invertebrate species. More distantly related genes that share homology in the DNA-binding domain, or T-box, have also been identified. Diverse expression patterns in early embryos, including differential hind-versus-forelimb expression, suggest important roles for a number of genes in developmental specification and pattern formation. The Brachyury or T gene must now be considered the eponymous member of an increasingly recognized and important gene family.
1.1. Cloning Brachyury Brachyury was first identified as a tail length mutation in mouse by a group of Parisian researchers conducting an X-ray mutagenesis screen of heritable traits in mice w8x. Since its creation, the original Brachyury mutation, also known as T for ‘tail’, has been extensively characterized w9,10x and other alleles have been identified, some with a similar phenotype to the initial T mutation, and others with more severe phenotypes. The names T and Brachyury are used interchangeably for the same gene. The classical Brachyury mutation manifests itself by causing short or kinked tails in heterozygous animals. Mice homozygous for T die in utero around 10 days post coitum Ždpc., with distinctive truncations of the body axis. These T r T embryos appear to have little to no notochord and have somites only up to the level of the fore limb, at which point the embryo becomes truncated, forming no trunk or tail. The cause of embryonic death does not appear to be linked to this shortened axis; rather it is thought to be a result of a defect in the allantois, which does not form a placental connection w11x. Embryos thus die of lack of nutrient near the end of the 10th day of gestation. Some sixty years after the Brachyury mutation was generated, the gene responsible was identified by positional cloning w2,12x, reviewed in w3,4,13x. Brachyury was found to encode a novel 436 amino acid polypeptide with 6 potential N-linked glycosylation sites, an abundance of serine and proline residues, and no obvious signal sequences or membrane spanning regions. The Brachyury protein has since been shown to bind DNA and activate transcription Ž see below.. The original T mutation was found to be a large deletion yielding essentially a null mutant; while the more severe alleles contained insertions, small deletions, or frameshifts resulting in altered proteins with corresponding altered activities w2x. The locus containing Brachyury, namely the Trt-complex, is a large 15 cM locus containing the H2 complex as well as two other genes which appear to either interact with or produce similar phenotypes to the original T mutation, small t Ž t . and Brachyury the second Ž T2 . w14x, respectively. Subsequent to Brachyury being cloned in the mouse, genes with significant sequence identity and thus considered homologues were identified in Xeno-
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
F75
pus Ž Xbra. w15x, zebrafish Ž Zf-T or Ntl . w16x, chicken Ž Ch-T . w17,18x, Drosophila Ž Trg . w19x, echinoderms Ž Hp-Ta. w20x, amphioxus Ž AmBra. w21x, two types of ascidians Ž As-T, Ci-Bra. w22,23x, and humans w24x. Cloning the zebrafish Brachyury homologue, Zf-T w16x, confirmed suspicions that a known zebrafish mutant, No tail Ž Ntl . , was actually a mutation in the zebrafish Brachyury gene w25x.
2. Brachyury expression and induction The expression pattern of mouse Brachyury protein is consistent with what is known about the mutant phenotypes. In mice, both Brachyury mRNA and protein are initially detectable at 6.5–7 dpc in the mesoderm and primitive ectoderm cells near the primitive streak and in the notochord as it is laid down ŽFig. 1.. Brachyury expression persists in and around the primitive streak throughout gastrulation. As cells destined to become paraxial mesoderm migrate away from the streak and differentiate, they cease to express Brachyury, but notochord Žaxial mesoderm. cells continue to express Brachyury through the end of gastrulation, even as the notochord cells form mucosal cells in the intervertebral discs w26,27x. Thus the cells most affected by the Brachyury mutation, namely posterior axial mesoderm, are the cells which express Brachyury during gastrulation. The timing and location of Brachyury expression is remarkably consistent in mouse, Xenopus, zebrafish, and chick embryos Ž Fig. 1. . The Xenopus Brachyury homologue, Xbra, for example, is expressed in a distinctive ring around the blastopore during the early stages of gastrulation w15x. As in the mouse, as mesoderm cells migrate through the blastopore, they cease to express Xbra, with the exception of the notochord and the most posterior cells of the tail, which continue to express Xbra throughout neurula and tailbud stages w7,15,28x. The zebrafish Zf-T or Ntl gene is similarly expressed first in the cells of the dorsal margin of the blastula, then in the cells of the future germ ring, and finally in the cells of the notochord w16x. The chick Brachyury gene, Ch-T, like mouse T, is found in and around the cells of the primitive streak, and as gastrulation proceeds, it becomes restricted to the notochord and the more posterior mesoderm w17x.
Fig. 1. Brachyury expression patterns and Brachyury mutants are similar across species. Expression patterns in mouse ŽA–C., Xenopus ŽD–F., and zebrafish ŽG–H. are shown. In ŽA, D, G., dorsal is to the right, ventral to the left, anterior up and posterior down. In this schematic of an ed7.5 mouse gastrula ŽA., Brachyury is detectable in the primitive streak and notochordal plate. In a tailbud stage Xenopus ŽD., Brachyury is expressed around the blastopore Žposterior. and in the involuting chordal mesoderm. A similar staining pattern is seen in the zebrafish embryo ŽG. at 100% epiboly. In later stage embryos ŽB, E, H., Brachyury expression becomes restricted to the tail and posterior domain of the notochord. Embryos lacking functional Brachyury ŽC, F, I. lack posterior structures. The mouse homozygous Brachyury mutant lacks structures posterior to the limb bud ŽC.; the Xenopus dominant inhibition of Brachyury has a shortened body axis ŽF.; and the zebrafish No tail mutant has a truncated tail and body axis ŽI..
The expression patterns of Brachyury are notably conserved amongst vertebrates, with expression present early in the mesoderm and becoming restricted to the axial mesoderm and posterior, less differentiated mesoderm. Expression differs somewhat in the urochordates, echinoderms, and insects. These genes have diverged greatly in sequence from the mouse Brachyury, but they retain a region of DNA known as the T-box Žsee below. which is largely identical to a region of the archetypal Brachyury gene ŽFig. 2., and they are thus considered homologous. We shall
F76
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
Fig. 2. Comparison of the amino acid sequences of the DNA binding domains of Brachyury homologues. Identical amino acids are boxed in black and conservative substitutions are in descending shades of gray. m-T s mouse T, the prototypic Brachyury w2x; Xbra s Xenopus Brachyury w15x; Ch-T s chick T w17,18x; Ntl s zebrafish No Tail Žalso zebrafish T or Zf-T . w16x; AmBra-1s amphioxus Brachyury w21x; Dr-Trgs Drosophila T-related gene Žalso brachyenteron or byn. w19x; As-T s ascidian T w22x. Lineup was made using the prettybox program of the extended GCG package.
refer to these close relatives as T- genes, though only now is the degree of functional conservation over these large evolutionary distances being tested. The ascidians Halocynthia roretzi and Cionia intestinalis have retained the expression of Brachyury in the notochord, but neither expresses Brachyury in the mesenchyme w22,23,29x. The sea urchin expresses its Brachyury gene in the tip of the invaginating archenteron and in the secondary mesenchyme cells w30x. The most divergent expression pattern appears to be found in insects. In Drosophila, the T-related gene Ž Trg . w19x also termed brachyenteron Ž byn. w31x, is initially expressed during embryo cellularization in the primordia of the hindgut and the anal pads, and continues to be expressed in these tissues as they mature w19,32x. Trgrbyn is necessary for the proper formation of the hindgut and anal pads w19x, and for maintenance of gene expression in the anal pads w31x. The divergent expression patterns of Brachyury expression in non-vertebrates allows for interesting speculations about the evolution of chordates w20,33x and the evolution of the notochord w20,32x. Xenopus has proved a useful testing ground for questions of Brachyury regulation. A large body of literature exists on the soluble factors which can, in Xenopus, mimic the process of mesoderm induction which occurs during gastrulation. Many of these mesoderm-inducing factors were shown able to in-
duce Xenopus Brachyury Ž Xbra. expression as they induced axial-type mesoderm. When isolated and cultured alone, the cells of the roof of the Xenopus blastocoel, known as the ‘animal cap’ cells, form undifferentiated ectoderm. These same cells cultured in the presence of activin, a member of the TGF-b family, can differentiate into axial mesoderm and express mesoderm-specific genes in a dose-dependent manner w34x. Brachyury is one of the genes which can be induced by activin, and it is induced rapidly, in a translation-independent manner w15x. Similar assays have shown that Brachyury expression can also be induced in Xenopus by the TGF-b family members Vg1 and BMP4, and expression can be both induced and maintained by FGF w7,15,35–37x. Likewise, inhibiting either activin or FGF signaling in embryos by injecting dominant negative receptor constructs inhibits Brachyury expression in these embryos w37–39x. Similar findings of activin’s ability to induce both axial mesoderm and Brachyury expression have been shown in chick, whereby activin ectopically applied to the early blastoderm can cause a second primitive streak to form with corresponding Chick T Ž Ch-T . expression w17x; and in zebrafish, whereby both activin and FGF can induce Ntl expression in zebrafish animal pole explants w6,16x. Interestingly, Brachyury expression can actually induce the synthesis of an embryonic form of FGF,
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
eFGF, in Xenopus explants w37,40x. Thus it has been proposed that Xbra and eFGF are both members of what has been termed an ‘autocatalytic maintenance loop’ w37x. In Drosophila, Brachyury expression has been shown to be dependent on the zygotic genes tailless Ž tll . and huckebein Ž hkb ., which specify the posterior pole of the embryo w19x. In Xenopus, Brachyury expression has been shown to be dependent on the mesoderm inducing factors FGF and activin w15,37– 39,41x. Despite this accumulated information, the mechanisms which direct activation of Brachyury have thus far been elusive. Recently, however, an element responsible for directing notochord-specific expression of Brachyury has been identified in the ascidian Cionia intestinalis w23x. A notochord-specific enhancer element, in the 5X flanking sequence to the Cionia Brachyury gene Ci-Bra, was shown to contain distinct repression and activation elements. The repression elements repress expression in non-notochord lineages, and the activator region directs expression in the notochord. The activator region, notably, contains two possible Suppresser of Hairless Ž Su(H). binding sites, one which closely matches the conserved recognition sequence, and a second, sub-optimal site. This raises the interesting possibility that notochord-specific expression of Ci-Bra is linked to the Notch signaling pathway. In Drosophila, activation of this pathway through the Notch receptor translocates SuŽ H . from the cytoplasm to the nucleus, where it binds to conserved Su(H) recognition sequences ŽFor review, see w42x.. Thus activation of Notch might lead to transcription of Brachyury in the notochord. Expression in the paraxial, as opposed to axial, mesoderm may be under separate control, since the Cionia intestinalis Ci-Bra w23x and Halocynthia roretzi As-T w43x genes are not expressed in paraxial mesoderm, and a second gene, AsT2, with sequence similarity to Brachyury has been identified in Halocynthia roretzi which is expressed in the paraxial mesoderm w44x. These expression of these two Ascidian genes together make up the two domains of Brachyury expression observed in Cephalochordates and Vertebrates. Whether or not the Brachyury genes of these higher order organisms will also contain SuŽ H . sites, and whether Brachyury transcription can be activated by SuŽ H . or by Notch begs investigation.
F77
3. Brachyury encodes a transcription factor Soon after Brachyury was cloned, indirect evidence began to accumulate indicating that it might play a role in transcriptional regulation. Aside from weak similarities to the transcription factor MyoD w13x and the proto-oncogene rel w45x, the DNA sequence did not yield any apparent protein motifs such as secretory signals or transmembrane domains. Brachyury acted cell-autonomously, and was thus unlikely to be a secreted factor w46x. Brachyury protein was found to localize to the nucleus w16,26,47x, and introduction of Brachyury mRNA into Xenopus animal caps induced transcription of mesodermspecific genes w48x. Possibly most telling was the discovery of a region of sequence similarity between mouse Brachyury and the Drosophila optomotorblind Žomb. protein w49x. This region of the omb protein was shown able to bind a non-specific mixture of calf thymus DNA, whereas other regions of the protein could not w49x. Brachyury’s ability to bind DNA was demonstrated directly by Kispert and Herrmann w50x, who mixed in vitro synthesized Brachyury protein with a mixture of random oligonucleotides flanked with defined primer sites, immunoprecipitate with an anti-T antibody, and amplified the bound sequence. Gel shift analysis proved that Brachyury bound to a consensus 20 base pair internally palindromic site, TGACACCTAGGTGTGAAATT, and DNase 1 footprinting confirmed the binding. Deletion analysis of the Brachyury protein identified the N-terminal 229 amino acids as necessary for strong DNA binding, with residues 18–229 critical for any DNA binding. Despite the palindromic nature of the binding site, Brachyury did not require dimerization to bind DNA w50x. Not only can Brachyury bind to specific DNA sequences, but studies using mouse w5x, frog and zebrafish w51x Brachyury proteins show that once bound to its consensus sequence, Brachyury can trans-activate transcription of reporter genes in vitro. Kispert and colleagues w52x co-transfected a CAT reporter construct containing the palindromic Brachyury binding site into both HeLa and Cos7 cells and found transcriptional activation. To dissect which region of Brachyury was responsible for transcriptional activation, these researchers used two sys-
F78
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
tems for co-transfection, the Brachyury binding siterCAT construct, and also a yeast GAL4 upstream activating sequence ŽUAS.rCAT reporter construct, whereby the yeast GAL4 DNA binding domain was fused the to various lengths of the non-DNA binding domain of Brachyury, and co-transfected with the GAL4 UASrCAT construct. The yeast GAL4 system allowed these researchers to relatively precisely map the two sites which caused transcriptional activation and two which caused repression within the 206 amino acids C-terminal of the Brachyury DNA binding domain, as well as a region necessary for the nuclear localization of Brachyury. A similar mapping of the activation domain of Xenopus Brachyury ŽXbra. and zebrafish Brachyury ŽNtl. was carried by Conlon and colleagues w51x, who also identified an activation domain 3X to the DNA binding domain of Brachyury. These researchers went on to engineer a fusion protein which replaced the identified activation domains of Xbra and Ntl with the repressor domain from the engrailed protein Ž En r .. They injected the mRNA coding for the fusion into Xenopus and zebrafish, respectively. These BrachyuryrEn r constructs were able to mimic the zebrafish Brachyury mutant, No tail, and cause a phenocopy of a Brachyury mutant in Xenopus, with notochord present only anteriorly, if at all, and a posterior truncation as might be expected from the known mouse and zebrafish Brachyury mutants. This result firmly established a link between Brachyury’s ability to activate transcription with its ability to induce posterior notochord and trunk structures in the developing embryo. A further finding of this study was the effect of the ‘dominant negative’ XbrarEn r construct on endogenous Brachyury expression in Xenopus. The repressing Xbra construct caused a disruption in normal Brachyury expression in the developing embryo, but interestingly, this disruption was only observed in the dorsal domain of Brachyury expression, not in the ventral mesoderm. This implies that Brachyury is subject to autoregulation on the dorsal side, but the ventral domain of Brachyury expression is controlled by some other means. This could mean that the dorsal and ventral domains of Brachyury expression have different functions, despite the apparent continuity and similar timing between them. Possible autoregulation of Brachyury expression
has been demonstrated independently by Rao w53x. When he injected a truncated Xbra construct lacking what is now known to be the activation domain, he observed a functional inhibition of wild-type Xbra, in that it could no longer induce mesoderm in animal caps. This study also demonstrated that overexpression of this truncated construct induces neuralization, but this may be a non-specific effect of expressing large quantities Ž3–6 ng. of the Xbra DNA binding domain.
4. Cellular functions of Brachyury There appear to be three schools of thought as to how Brachyury functions to allow posterior development in the embryo. One theory is that Brachyury directs the differentiation of posterior mesoderm. Evidence which supports this claim can be found in the fact that Brachyury is an immediate early response gene to the mesoderm inducing factors activin and FGF w15x. Activin can induce Brachyury in a dose dependent manner w34x, independent of new transcription w15x. FGF can also induce Brachyury, and Brachyury’s ability to induce mesoderm in animal caps is dependent on an intact FGF signaling pathway w37,40x. Embryos that are made mutant for Brachyury bear a resemblance to embryos injected with the dominant negative FGF receptor, XFD w39x, or embryos with a disturbed MAP kinase pathway, known to be downstream components of the FGF mesoderm-inductive signal. More directly, injection of Brachyury mRNA into Xenopus embryos increases the amount of mesoderm formed w48x. Ectopic expression of Brachyury in Xenopus animal caps causes caps to elongate and express mesodermspecific genes in a dose-dependent manner w48,54x. These results are consistent with and predicted by a Brachyury-FGF maintenance loop w37,40x, mentioned above. Another interpretation of Brachyury function is that Brachyury controls the particular cell movements known as convergent extension that take place during the formation of notochord. This idea, proposed by Yamada w55x, is based mostly on circumstantial evidence. Brachyury is expressed in the region that convergent extension of the axial mesoderm is taking place. The expression of Brachyury in
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
Xenopus persists until stage 37 w15x, apparently when the last convergent extension movement is finished w55x. Most convincing, increasing the number of Brachyury genes in transgenic mice increases the degree of convergent extension and thus axial elongation observed w12,56x. A more inclusive theory does not limit Brachyury function to controlling convergent extension movements, rather, it allows for Brachyury control of a variety of cell movements. A purely morphometric study which followed cell numbers and distribution in TrT mouse embryos concluded that Brachyury mutants showed anomalies in cell migration, with cells derived from the epiblast becoming stuck in the primitive streak region w57x. These findings were supported by chimeric studies which also found cells becoming ‘stuck’, though after they had ingressed through the primitive streak. When chimeras are made between wildtype mice and TrT mutant embryonic stem Ž ES. cells, the TrT cells colonize the embryo
F79
preferentially at the tail end w1,58x. Further study of Brachyury- deficient cell behavior in a wild-type background using a lacZ gene trap demonstrated that the T deficient cells gather progressively at the midline just ventral to the primitive streak, forming a ‘wedge’ of TrT cells w59x. These cells adhere closely to one another and appear to physically prevent formation of a normal tail. The inappropriate migration of these cells may be due to altered cell surface properties; TrT ES cells are found in clumps throughout the embryo and are rarely interspersed with wild type cells w59x. Other studies support the idea that the surface of Brachyury deficient cells is altered. Scanning electron microscopy has demonstrated differences in the extracellular matrix of TrT embryos w60x, and aggregation studies have shown differences in the adhesive properties of T-deficient cells w61x. Which of these theories accounts for the function of Brachyury? Perhaps the truth lies in a synthesis of
Fig. 3. Dendrogram indicating the degrees of relatedness over the entire amino acid sequences of the T-box genes entered in Genbank at this writing. Am s amphioxus; Ce s C. elegans; Ch s chicken; Dr s Drosophila; Hp s Hemicentrotus pulcherrimus Žsea urchin.; Hu s human; Mo s mouse; Nw s newt; X s Xenopus; Zf s zebrafish ŽRefs. w2,15–19,21,22,30,65–68,70,72–77,79,80,82x..
F80
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
the three, for they are not mutually exclusive. Cell differentiation can certainly cause changes in cell surface properties which can subsequently cause specific cell migration behaviors and movements. For example, the dorsal mesoderm inducing factor activin elicits both cell fate changes and several characteristic cell movements as well as Brachyury expression w62–64x What one group terms ‘axial mesoderm induction’ may be identical to another group’s ‘convergent extension behavior’ and another’s ‘cell surface anomaly.’ Thus the transcription factor Brachyury probably activates a series of genes which result in the formation of axial mesoderm through a differentiation program that includes changes in cell surface and cell migration patterns. The definitive answer to the question ‘What does the Brachyury protein do?’ will only emerge when we know its targets. Thus far no direct transcriptional targets of Brachyury have been identified. Until the time we know the molecular interactions involved, we are unlikely to find a satisfactory explanation for Brachyury function in development.
5. The T-box gene family The first T-box gene to be identified that was not a homologue of Brachyury itself was the Drosophila omb gene, essential for optic lobe development w65x. Since that time, at least twenty-five genes that contain a region of homology to the DNA binding domain of Brachyury have been described. Outside the DNA binding domain, or T-box, these genes bear less sequence similarity to Brachyury than the Tgenes, but some bear similarities to one another. The dendrogram in Fig. 3 shows the degree of amino acid similarity over the entire length of these genes. As many of these genes are only newly identified, much of what is known of them is descriptive, namely where and when they are expressed. Studies in mouse have revealed interesting tissue-specific localization for a number of T-box containing genes, described below, indicating possible involvement in brain development and in hindlimbrforelimb specification. Work in Xenopus has produced information on both overexpression and inhibition of expression of some T-box genes, showing some of them to be important in the processes of gastrulation and embryonic pat-
terning Žsee below.. In humans, a genetic linkage study has found a human disease to be the result of a mutation in a T-box gene. This diverse family of genes are similar only in that all appear to be involved in processes of development, from gastrulation to organogenesis.
6. T-box genes in mouse At this writing, seven T-box containing genes, in addition to Brachyury, have been identified in the mouse, termed Tbx1 through Tbx6, and Tbr-1. Two pairs of these genes, Tbx2 and 3, and Tbx4 and 5, have significant sequence similarity to one another, and one of each pair maps to identical positions on mouse chromosomes 11 Ž Tbx 2 and 4 . and 5 Ž Tbx3 and 5 ., indicating that the genes may have arisen from a common ancestral gene that first underwent a tandem duplication, then a second duplication as a gene cluster, and finally a dispersion of each cluster to different chromosomes w66x. These gene pairs overlap significantly in their patterns of expression, but each gene also shows areas of unique expression w67,68x. Tbx 2 and 3 are both expressed in the forebrain and facial regions near the various developing placodes, and later in the limb buds and myotomes w67,68x. Tbx 3 is expressed earlier than Tbx 2, at 3.5 dpc in the inner cell mass and later in the extraembryonic membranes. Tbx2 is expressed earlier than Tbx3 in the otic and optic vesicles and later it is uniquely expressed in the developing pinnae of the ear. Tbx4 and 5 are expressed in the allantois, although Tbx 5 expression there is transient, and in the developing heart, with slightly different distributions. The genes differ in their expression in the developing eye Ž Tbx5 only., genital papillae Ž Tbx4 only., and perhaps surprisingly, fore- and hind- limb buds, which express Tbx5 and Tbx4, respectively w67,69x. The restricted expression of Tbx 5 and Tbx4 in the forelimb and hindlimb raises the intriguing possibility that the genes are involved in differential limb specification during embryogenesis w69x. Tbx1 is first detectable at 7.5 dpc in the anterior embryonic mesoderm, rostral to the node. Later expression is found in head regions including the pharyngeal region and otic vesicle, and also in a segmented pattern along the spinal column w67,68x. T-
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
brain-1 Ž Tbr-1. also has a unique distribution amongst T-box genes. Tbr-1 is expressed only in post-mitotic cells of the developing and adult telencephalon. It is expressed in a rostral to caudal gradient in the subplate of the neocortex, suggesting that it may play a role in patterning the cortex. Since Tbr-1 is not expressed in the dividing cells of the ventricular zone, it is thought not to be involved in the regional specification of the brain; rather it is thought to be important in the control of differentiation w70x. Only one of the mouse T-box genes in addition to Brachyury is expressed exclusively in the mesoderm during gastrulation. Tbx6 expression overlaps that of Brachyury in the primitive streak and tail bud, although Tbx6 is notably not expressed in the node and notochord. Tbx6 expression also begins later than Brachyury, and extends to the more lateral presomitic paraxial mesoderm. Tbx6 is not initially affected by the absence of Brachyury in TrT embryos, but Tbx6 expression is severely downregulated in TrT embryos at the time the TrT phenotype becomes apparent, at 8.5 dpc. Thus Brachyury may be necessary to maintain rather than initiate Tbx6 expression w71x. Although no mouse T-box knockouts have yet been generated, a mutation in the human homologue of the mouse Tbx-5 gene has recently been shown responsible for Holt-Oram syndrome, a developmental disorder which affects the heart and upper limb w72x. This loss-of-function mutation is remarkably consistent with what is known of the mouse Tbx5 gene expression; indeed, Tbx5 expression in heart and limb is also found in human embryos w72x. Given the powerful knock-out techniques available in the mouse system, information on loss-of-function mutants for the remaining T-box genes will no doubt soon be available.
7. T-box genes in Xenopus In Xenopus, five T-box containing genes have thus far been identified, four of which are nearly identical in sequence and expression pattern. Antipodean Ž Apod . w73x, Brat w74x, VegT w75x, and Xombi w76x are all expressed in the vegetal cortex during oogenesis. Transcripts remain vegetal until the time of gastrulation, when expression overlaps that of Brachyury in the marginal zone, although unlike
F81
Xbra, these T-box genes are excluded from the notochord, similar to the expression pattern observed for the mouse Tbx-6 gene. Mesodermal expression becomes restricted to posterior ventral and lateral mesoderm as gastrulation proceeds, and by tailbud stage expression is undetectable, except in the case of Veg-T, where expression is observed late in a subset of sensory neurons in the dorsal-lateral region of the neural tube. Like Xbra, the genes Apod, Brat, VegT, and Xombi can induce the expression of mesoderm markers, including Xbra, in an animal cap assay. While Xbra cannot induce the expression of dorsal mesodermal markers, these other genes can if expressed at high doses. Overexpressed T-box genes can induce expression of genes normally expressed in the organizer region such as Goosecoid Ž Gsc ., and in the case of Brat, Chordin Ž Chd . and Xlim-1 w74x. Although these genes can induce Xbra expression, at least one of these genes, Apod, cannot be induced by Xbra w73x. Animal cap expression of any of the four genes induces mesoderm and muscle formation, and Brat can induce formation of endoderm w74x. Overexpression of Xombi in the ventral region of a Xenopus embryo caused cells to begin invaginating, forming what appeared to be a secondary dorsal lip of the blastopore w76x; while overexpression of Veg-T on the ventral side caused formation of a secondary axis, lacking anterior structures w75x. The only apparent difference in these four genes, apart from slight variations in amino acid sequence, is in their response to mesoderm-inducing factors. While Apod, Brat and Xombi can be induced by members of the TGF-b superfamily like activin, Vg-1, and BMP4; only Xombi and Brat can be induced by FGF signaling w74,76x. When a dominant negative FGF receptor construct, XFD, is injected into embryos, Apod expression is unaffected w73x, whereas Xombi expression is notably downregulated by this same construct w76x. The four genes are likely to all be transcription factors, and it was demonstrated that Veg-T can localize to the nucleus and that its putative activation domain can activate transcription in a yeast one hybrid system w75x. Inhibition of Brat’s ability to activate transcription using an Bratrengrailed repressor fusion protein construct has dramatic effects on embryonic development w74x. Dorsal injection of Bratren r mRNA inhibits dorsal
F82
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
lip formation and subsequent head and trunk development, while ventral injection inhibits ventral lip formation and subsequent tail, trunk, and ventral development w74x. Thus at least one of these genes appears to be essential for mesoderm development. It will be interesting to find out whether these extremely similar genes are alleles of the same genetic locus, different alternatively spliced transcripts from the same gene, or if they in fact represent distinct T-box genes which have overlapping expression patterns and perhaps slightly different functions. The remaining T-box containing gene found in Xenopus, Eomesodermin Ž Eomes . w77x, has an amino acid sequence and expression pattern distinct from Xbra and the four similar genes Apod, Brat, VegT and Xombi. Eomes is not expressed in the oocyte; rather expression can be detected only slightly before Xbra, during the time mesoderm is just being formed in the embryo. During gastrulation, Eomes is expressed in a gradient throughout the marginal zone, with the highest levels of Eomes transcript localized dorsally and the lowest levels localized ventrally. This pattern of expression raises the interesting possibility that Eomes may be involved in dorsalrventral patterning in the early embryo. Overexpression of Eomes in ventral blastomeres can cause formation of a secondary axis in a dose-dependent manner. Eomes expression in animal cap assays induces the same array of mesoderm tissues and mesoderm specific genes as the above mentioned T-box genes, and Xbra does not induce Eomes expression w77x. Inhibition of Eomes using a Eomesren r fusion protein leads to arrested development during gastrulation, and targeting the fusion protein to dorsal blastomeres blocks axis formation w77x. Eomesren r does not inhibit Xbra expression and has little effect on its own expression, which is interesting considering an Xbraren r fusion protein inhibits Xbra expression significantly, especially in the dorsal domain of expression, and also increases Eomes expression slightly. What is the relationship between Xbra and these other T-box genes? All seem to be important in the process of mesoderm formation, and their expression patterns overlap in places during gastrulation. These genes can induce Xbra expression, but not vice-versa. The functions of Xbra and the other genes appear to be distinct: Xbra cannot rescue embryos injected with dominant-repressing forms of Brat or Eomes. It
is likely that these genes do interact during gastrulation and the formation of mesoderm, but fortuitous co-localization and sequence similarity do not necessarily imply functional redundancy.
8. Other T-box genes T-box genes continue to be identified at a rapid pace. As genes are identified in a range of different species, they generally share sequence similarity to one of the known mouse or frog genes and often share tissue-specific expression patterns. Two T-box genes in addition to Brachyury itself have been identified in chick. Ch-TbxT is extremely similar in amino acid sequence to the prototypic Ch-T and in some places has an overlapping domain of expression. Ch-TbxT is expressed mostly in the dorsal axial mesoderm, reminiscent of the Xenopus Eomes, rather than throughout the axial mesoderm like Ch-T. Ch-TbxT also has an domain of expression which is extended relative to Ch-T: it is expressed in an anterior domain, including the prechordal plate. This observation raises the possibility that ChTbxT may extend T function to the anterior axis, and perhaps be important in the formation of anterior notochord, a process which is independent of T function w18x. ChTbx6L is so named because its sequence is similar to the mouse Tbx6 gene. Like mouse Tbx6, Ch-Tbx6L is expressed in the paraxial mesoderm and presumptive somitic cells, and excluded from the notochord. It becomes rapidly downregulated in this presomitic mesoderm once somites are formed w18x. A number of T-box genes in the urodele have recently been identified w78x. One of these genes, NÕTbox1, appears to be the newt homologue of the mouse and human Tbx5 gene, and is important in distinction of forelimb and hindlimb, and in limb development and regeneration in general w78x. A second T-box containing gene, AsT2 Ždescribed above. has been isolated from the ascidian Halocynthia roretzi and appears to complement the Brachyury orthologue As-T w44x. The human T-box genes that have been identified are homologues in sequence and expression pattern to the mouse T-box genes Tbr-1 w70x, Tbx2 w79x, and Tbx5 w72x. A number of C. elegans T-box containing genes which bear little resemblance to other T-box genes have been identi-
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
fied w80x, some as a product of the C. elegans genome project, but little has been published describing their possible function.
9. Tailpiece When one considers the direction of Brachyury research, two questions loom large, namely, what regulates Brachyury and T-box genes, and what do they in turn regulate? The first question is likely to be answered in the near future using readily available technologies like one-hybrid screens, as has been successfully employed by Chen and colleagues to identify FAST-1 as a transcriptional activator of Mix.1 w81x. The second question may prove a more difficult challenge. Two targets have already been identified, eFGF and Brachyury itself, though neither has been shown to be a direct target. Finding targets for transcription factors is in some ways a technological bottleneck; witness the slow progress made in the search for targets of HOX genes. It is possible that classical genetic suppresser and enhancer screens in Drosophila or perhaps, given the new mutants, zebrafish, will prove an effective tool in uncovering Brachyury targets. Alternatively, given the right computer search engine, it is conceivable that knowledge of the sequence of a Brachyury favored binding site combined with the accumulating genomic sequence databases will yield a target. However, a caveat to any ‘genome crunching’ is that sequence correspondence is only a prelude to functional analysis. As for the future of research on the T-box genes, the next interesting question is simply ‘what will the knockout mutants look like?’
References w1x R.S.P. Beddington, P. Rashbass, V. Wilson, Development supplement Ž1992. 157–165. w2x B.G. Herrmann, S. Labeit, A. Poustka, T.R. King, H. Lerach, Nature 343 Ž1990. 617–622. w3x B.G. Herrmann, Sem. Dev. Biol. 6 Ž1995. 385–394. w4x B.G. Herrmann, A. Kispert, Trends Genet. 10 Ž1994. 280– 286. w5x A. Kispert, Sem. Dev. Biol. 6 Ž1995. 395–403. w6x S. Schulte-Merker, Sem. Dev. Biol. 6 Ž1995. 411–416.
F83
w7x J.C. Smith, V. Cunliffe, M.-A.J. O’Reilly, S. SchulteMerker, M. Umbhauer, Sem. Dev. Biol. 6 Ž1995. 405–410. w8x N. Dobrovolskaia-Zavadskaia, C.R. Sceances Soc. Biol. 97 Ž1927. 114–116. w9x P. Chesley, J. Exp. Zool. 70 Ž1935. 429–435. w10x H. Gruneberg, J. Embryol. Exp. Morphol. 6 Ž1958. 424–443. w11x S. Gluecksohn-Shoenheimer, Proc. Natl. Acad. Sci. USA 30 Ž1944. 134–140. w12x D. Stott, A. Kispert, B.G. Herrmann, Genes Dev. 7 Ž1993. 197–203. w13x K. Willison, Trends Genet. 6 Ž1990. 104–105. w14x G.M. Rennebeck, E. Lader, Q. Chen, R.A. Bohm, Z.S. Cai, C. Faust, T. Magnuson, L.R. Pease, K. Artzt, Dev. Biol. 172 Ž1995. 206–217. w15x J.C. Smith, B.M.J. Price, J.B.A. Green, D. Weigel, B.G. Herrmann, Cell 67 Ž1991. 79–87. w16x S. Schulte-Merker, R.K. Ho, B.G. Herrmann, C. NussleinVolhard, Development 116 Ž1992. 1021–1032. w17x A. Kispert, H. Ortner, H. Cooke, B.G. Herrmann, Dev. Biol. 168 Ž1995. 406–415. w18x V. Knezevic, R. DeSanto, S. Mackem, Development 124 Ž1997. 411–419. w19x A. Kispert, B.G. Herrmann, M. Leptin, R. Reuter, Genes Dev. 8 Ž1994. 2137–2150. w20x H. Yasuo, Y. Harada, N. Satoh, Sem. Dev. Biol. 6 Ž1995. 417–425. w21x P.W. Holland, B. Koschorz, L.Z. Holland, B.G. Herrmann, Development 121 Ž1995. 4283–4291. w22x H. Yasuo, N. Satoh, Dev. Growth Differ. 36 Ž1994. 9–18. w23x J.C. Corbo, M. Levine, R.W. Zeller, Development 124 Ž1997. 589–602. w24x Y.H. Edwards, W. Putt, K.M. Lekoape, D. Stott, M. Fox, D.A. Hopkinson, J. Sowden, Genome Res. 6 Ž1996. 226– 233. w25x S. Schulte-Merker, F.J.M. van Eeden, M.E. Halpern, C.B. Kimmel, C. Nusslein-Volhard, Development 120 Ž1994. 1009–1015. w26x A. Kispert, B.G. Herrmann, Dev. Biol. 161 Ž1994. 179–193. w27x D.G. Wilkinson, S. Bhatt, B.G. Herrmann, Nature 343 Ž1990. 657–659. w28x L.K. Gont, H. Steinbeisser, B. Blumberg, E.M. DeRobertis, Development 119 Ž1993. 991–1004. w29x H. Yasuo, N. Satoh, Nature 364 Ž1993. 582–583. w30x Y. Harada, H. Yasuo, N. Satoh, Development 121 Ž1995. 2747–2754. w31x J.B. Singer, R. Harbecke, T. Kusch, R. Reuter, J.A. Lengyel, Development 122 Ž1996. 3707–3718. w32x R. Reuter, Sem. Dev. Biol. 6 Ž1995. 427–435. w33x B.G. Herrmann, Sem. Dev. Biol. 6 Ž1995. 381–384. w34x J.B.A. Green, H.V. New, J.C. Smith, Cell 71 Ž1992. 731– 739. w35x S. Schulte-Merker, J.C. Smith, L. Dale, EMBO J. 15 Ž1994. 3533–3541. w36x J.M. Graff, R.S. Thies, J.J. Song, A.J. Celeste, D.A. Melton, Cell 79 Ž1994. 169–179.
F84
A.I. KaÕka, J.B.A. Green r Biochimica et Biophysica Acta 1333 (1997) F73–F84
w37x H.V. Isaacs, M.E. Pownall, J.M. Slack, EMBO J. 13 Ž1994. 4469–4481. w38x A. Hemmati-Brivanlou, D.A. Melton, Nature 359 Ž1992. 609–614. w39x E. Amaya, T.H. Musci, M. Kirschner, Cell 66 Ž1991. 257– 270. w40x S. Schulte-Merker, J.C. Smith, Curr. Biol. 5 Ž1995. 62–67. w41x H.V. New, A.I. Kavka, J.C. Smith, J.B.A. Green, Mech. Dev. 61 Ž1997. 175–186. w42x S. Artavanis-Tsakonas, K. Matsuno, M.E. Fortini, Science 268 Ž1995. 225–232. w43x Y. Nakatani, H. Yasuo, N. Satoh, H. Nishida, Development 122 Ž1996. 2023–2031. w44x H. Yasuo, M. Kobayashi, Y. Shimauchi, N. Satoh, Dev. Biol. 180 Ž1996. 773–779. w45x F. Perrin-Schmitt, Biochim. Biophys. Acta 1171 Ž1992. 129–131. w46x P. Rashbass, L.A. Cooke, B.G. Herrmann, R.S.P. Beddington, Nature 353 Ž1991. 348–351. w47x V. Cunliffe, J.C. Smith, EMBO J. 13 Ž1994. 349–359. w48x V. Cunliffe, J.C. Smith, Nature 358 Ž1992. 427–430. w49x G.O. Pflugfelder, H. Roth, B. Pieck, Biochem. Biophys. Res. Commun. 186 Ž1992. 918–925. w50x A. Kispert, B.G. Herrmann, EMBO J. 2 Ž1993. 3211–3220. w51x F.L. Conlon, S.G. Sedgwick, K.M. Weston, J.C. Smith, Development 122 Ž1996. 2427–2435. w52x A. Kispert, B. Koschorz, B.G. Herrmann, EMBO J. 14 Ž1995. 4763–4772. w53x Y. Rao, Genes Dev. 8 Ž1994. 939–947. w54x M.-A.J. O’Reilly, J.C. Smith, V. Cunliffe, Development 121 Ž1995. 1351–1359. w55x T. Yamada, Development 120 Ž1994. 3051–3062. w56x K.O. Yanagisawa, Jpn. J. Genet. 65 Ž1990. 287–297. w57x K.O. Yanagisawa, H. Fujimoto, H. Urushihara, Dev. Biol. 87 Ž1981. 242–248. w58x V. Wilson, P. Rashbass, R.S.P. Beddington, Development 117 Ž1993. 1321–1331. w59x V. Wilson, L. Manson, W.C. Skarnes, R.S.P. Beddington, Development 121 Ž1995. 877–556. w60x R.J. Jacobs-Cohen, M. Spiegelman, D. Bennett, Differentiation 25 Ž1983. 48–55. w61x K.O. Yanagisawa, H. Fujimoto, J. Embryol. Exp. Morphol. 40 Ž1977. 277–283. w62x J.C. Smith, K. Symes, R.O. Hynes, D. DeSimone, Development 108 Ž1990. 229–238. w63x K. Symes, M. Yaqoob, J.C. Smith, Development 104 Ž1988. 609–618.
w64x K. Symes, C. Yordan, M. Mercola, Development 120 Ž1990. 2339–2346. w65x G.O. Pflugfelder, H. Roth, B. Poeck, S. Kerscher, H. Schwarz, B. Jonschker, M. Heisenberg, Proc. Natl. Acad. Sci. USA 89 Ž1992. 1199–1203. w66x S.I. Agulnik, N. Garvey, S. Hancock, I. Ruvinsky, D.L. Chapman, I. Agulnik, R. Bollag, V. Papaioannou, L.M. Silver, Genetics 144 Ž1996. 249–254. w67x D.L. Chapman, N. Garvey, S. Hancock, M. Alexiou, S.I. Agulnik, J. Gibson-Brown, J. Cebra-Thomas, R. Bollag, L.M. Silver, V.E. Papaioannou, Dev. Dynamics 206 Ž1996. 379–390. w68x R.J. Bollag, Siegfried, J.A. Cebra-Thomas, N. Garvey, E.M. Davison, L.M. Silver, Nature Genet. 7 Ž1994. 383-389. w69x J.J. Gibson-Brown, S.I. Agulnik, D. Chapman, M. Alexiou, N. Garvey, L.M. Silver, V.E. Papaioannou, Mech. Dev. 56 Ž1996. 93–101. w70x A. Bulfone, S.M. Smiga, K. Shimamura, A. Peterson, L. Puelles, J.L.R. Rubenstein, Neuron 15 Ž1995. 63–78. w71x D.L. Chapman, I. Agulnik, S. Hancock, L.M. Silver, V.E. Papaioannou, Dev. Biol. 180 Ž1996. 534–542. w72x Q.Y. Li, R.A. Newbury-Ecob, J.A. Terrett, D.I. Wilson, A.R.J. Curtis, C.H. Yi, T. Gebuhr, P.J. Bullen, S.C. Robson, T. Strachan, D. Bonnet, S. Lyonnet, I.D. Young, J.A. Raeburn, A. Buckler, D.J. Law, J.D. Brook, Nature Genet. 15 Ž1997. 21–29. w73x F. Stennard, G. Carnac, J.B. Gurdon, Development 122 Ž1996. 4179–4188. w74x M.E. Horb, G.H. Thomsen, Development 124 Ž1997. 1689– 1698. w75x J. Zhang, M.L. King, Development 122 Ž1996. 4119–4129. w76x K.D. Lustig, K.L. Kroll, E.E. Sun, M.W. Kirschner, Development 122 Ž1996. 4001–4012. w77x K. Ryen, N. Garrett, A. Mitchell, J.B. Gurdon, Cell 87 Ž1996. 989–1000. w78x H.-G. Simon, R. Kittappa, P.A. Khan, C. Tsilfidis, R.A. Liversage, S. Oppenheimer, Development 124 Ž1997. 1355– 1366. w79x C. Campbell, K. Goodrich, G. Casey, B. Beatty, Genomics 28 Ž1995. 255–260. w80x S.I. Agulnik, R.J. Bollag, L.M. Silver, Genomics 25 Ž1995. 214–219. w81x X. Chen, M.J. Rubock, M. Whitman, Nature 383 Ž1996. 691–696. w82x B. Hug, V. Walter, D.J. Grunwald, Dev. Biol. Ž1997. in press.