Tamoxifen: From breast cancer therapy to the design of a postmenopausal prevention maintenance therapy

Clinical Oncology (1997) 9:390-394

Clinical Oncology

Original Article Tamoxifen: From Breast Cancer Therapy to the Design of a Postmenopausal Prevention Maintenance Therapy V. C. J o r d a n , J. I. M a c G r e g o r a n d D. A. T o n e t t i Robert H. Lurie Cancer Center, Northwestern University Medical School, Chicago, Illinois, USA

INTRODUCTION

Oestrogen administration, as a hormone replacement in postmenopausal women, provides benefit by reducing cardiovascular disease [1], osteoporosis [2], Alzheimer's disease [3] and postmenopausal symptoms [4]. However, oestrogen causes an increased detection of endometrial cancer [5] and there is the concern that breast cancer is not prevented [6]. In contrast tamoxifen, an antioestrogen, has revolutionized the treatment of breast cancer and provided a survival advantage for thousands of node-positive and node-negative breast cancer patients [7]. The drug is listed by the World Health Organization as an essential drug for the treatment of breast cancer and currently it is the most prescribed cancer medicine. What has been shown to be remarkable about tamoxifen is the observation that the drug lowers cholesterol [8] and it is known to reduce fatal myocardial infarction if given for at least 5 years [9]. Additionally, tamoxifen maintains bone density in postmenopausal women [10] but, like oestrogen, tamoxifen causes an increased detection of endometrial cancer [11]. Most importantly, laboratory [12] and clinical data on a reduction in contralateral breast cancer in patients [7] support the view that tamoxifen could prevent breast cancer in high-risk women. We will describe the progress that is being made in the evaluation of tamoxifen as a preventive for breast cancer and then describe the new strategy that is being implemented to discover selective oestrogen receptor modulators that could be used as prevention maintenace therapies is postmenopausal women. The goal is to retard the development of osteoporosis, coronary heart disease, and breast and endometrial cancer in women over the age of 50 years.

Correspondence and offprint requests to: Dr V. Craig Jordan, Robert H. Lurie Cancer Center, Northwestern University Medical School, Olson Pavilion 8256, 303 E. Chicago Avenue, Chicago, IL 60611, USA. *This paper has been reprinted with permission from Osteoporosis Int (1997) Suppl. 1:$52-$57, ©1997 European Foundation for Osteoporosis and the National Osteoporosis Foundation.

PROGRESS TOWARDS A PREVENTION MAINTENANCE THERAPY

Tamoxifen is being tested as an agent for the prevention of breast cancer in three large clinical trials because (1) there is clear evidence of potential efficacy, (2) there are ancillary physiological benefits and (3) the toxicities are modest compared with the development of breast cancer. In 1986, Powles and coworkers [13-16], at the Royal Marsden Hospital in London, started to recruit high-risk women who would receive either tamoxifen or placebo for up to 8 years. This Vanguard Study is now closed and 2018 women are enrolled. The group is a mixture of preand postmenopausal women who are also being evaluated for the effects of tamoxifen on bone density, circulating cholesterol and gynaecological effects [15,16]. Overall tamoxifen has a beneficial effect on bone maintenance and lowers circulating cholesterol in postmenopausal women, but in premenopausal women, as one would expect, there is a slight decrease in bone density and there is no effect on cholesterol measurements. The group has made a rigorous investigation of gynaecological changes but found very little effect from tamoxifen other than an increase in polyps [15]. The Vanguard Study has now been opened up to general recruitment throughout the United Kingdom, Australia and New Zealand. The recruitment goal is 20000 women to be randomized to tamoxifen or placebo for 5 years. In the United States and Canada, the National Surgical Adjuvant Breast and Bowel Project is completing recruitment to a study of pre- and postmenopausal high-risk women. The current design of the clinical trial is shown in Fig. 1. Indeed the volunteers have been shown to be of such high risk that the original goal of 16000 women randomized to either tamoxifen or placebo for 5 years has been reduced to 13000 women. It is believed that a definitive answer to the question of whether tamoxifen has worth for the prevention of breast cancer in high-risk women can be answered by 1999. Ancillary studies are also evaluating cardiovascular risk and the development of osteoporosis. Every woman is also being examined with annual

Tamoxifen as a Postmenopausal Prevention Maintenance Therapy

391

>60 years old - with/without risk factors 35-59 years old - with risk factors

• LCIS Placebo

• 1 o relative with breast cancer Fig. 1. NSABP-NCI trial to test the

worth of tamoxifen to prevent breast cancer in women. Women between the ages of 35 and 59 years have to present with risk factors to produce a cumulative risk equivalent to the risk for the 60-year-old woman. Recruitment of participants was completed in 1997 and results evaluating the worth of tamoxifen in preventing breast cancer will be available in 1999.

• breast biopsies RANDOMIZE 1 3 , 0 0

• atypical hyperplasia

0

~

• over 25 years old before birth of first child • no children • menarche before age 12

endometrial sampling to determine the actual change in the detection of endometrial pathologies in treatment and control groups. Finally, a study of tamoxifen as a preventive is in progress in Italy. Women over the age of 45 years, with no risk factors but who have already undergone a hysterectomy, are being recruited to determine the decrease in breast cancer with 5 years of therapy. Currently 5000 women have been randomized but the target is 20 000 volunteers. Overall, it is clear that by the year 2000 there will be adequate data to support or reject the use of tamoxifen to prevent breast cancer in high-risk women. However, the majority of breast cancer is sporadic and the affected women are usually not associated with high-risk factors. This reasoning led to the suggestion of a more generalized strategy to prevent breast cancer in postmenopausal women.

A NEW STRATEGY

It is not possible to predict precisely who will develop breast cancer or indeed when the event occurs. Based on studies in animals it appears that the carcinogenic insult occurs early in life before puberty [17], and therefore any prevention strategy later in life really prevents promotion. It is clear that a very broad strategy is required as a women's health issue if a general decrease in the incidence of breast cancer is to be achieved. To address this problem, in 1989 we suggested [18] that a new approach to the prevention of breast cancer could be achieved by developing agents to prevent osteoporosis and coronary heart disease in women. We wrote 'Important clues have been garnered about the effects of tamoxifen on bones and lipids so it is possible that derivatives could find targeted applications to retard osteoporosis or atherosclerosis. The ubiquitous application of novel compounds to prevent diseases associated with the progressive changes after menopause, may, as a side effect, significantly retard the development of breast cancer.' This was the start of a search for targeted antioestrogens to prevent diseases of the menopause in women [19-21].

Tamoxifen 20mg/day 5 years

DESIGN OF AN IDEAL TARGETED AGENT The extensive clinical and laboratory data base about tamoxifen now makes it possible to envision the properties of an ideal antioestrogen to provide the optimal clinical effects (Fig. 2). The agent should exhibit oestrogenic effects in the central nervous system (CNS) and on endothelial cells to improve mood and decrease the frequency of postmenopausal symptoms. Similarly the agent should have oestrogenlike actions in the liver to lower LDL cholesterol and raise HDL cholesterol. This effect should translate to decreased athersclerosis and coronary heart disease. It is now possible to design an agent to be free from DNA adducts in laboratory models so that there are no concerns about carcinogenesis during prolonged treatment. This is an important aspect of the design of a new agent because indefinite therapy will be required to maintain bone density and prevent osteoporosis. In contrast to the targeted oestrogenic effects of the new agent, the compound should demonstrate inhibitory effects on growth and carcinogenesis in the uterus and breast so that there will be a decreased incidence of endometrial and breast cancer. Although there are many new compounds that exhibit the majority of properties needed in an ideal targeted antioestrogen, there is important new evidence to support a rational approach to drug design. We will survey the possible mechanisms for target site specificity before we consider the current status of strategies already in clinical trial.

THE SCIENTIFIC BASIS FOR TARGETSITE-SPECIFICITY

The history of pharmacology is filled with examples of the use of drugs to elucidate the complex organization of signal transduction throughout the body. Targeted blocking drugs have helped to classify adrenergic receptors into ~ and fi (1 and 2) types and to classify histamine receptors into H-1 and H-2 types. Additionally, the cholinergic system is organized into muscarinic and nicotinic receptors based on a clear-cut pharmacological classification. With this

392

V.C. Jordan et al. Properties of Ideal Targeted Antioestrogens -

Oestrogenic effects in the central nervous system

Value of Ideal Targeted Antioestrogens ....

~

Antioestrogenic effects on breast tissue

) { t

/I ~~ i i~'' ; ; ' ~ ~ It / / ,/ ~~}~:::~" .~,. ~~" ] /

Lowering of circulating cholesterol

Absence°f ut:ii:estimulati°n / Maintenance

( / ~

deducts

A b s e n c e of D N A

, Eliminates hot flashes

o e density

(, ,

,' ," i

~ - ~

I I

. Prevention of breast cancer

/

Eliminates concerns of

I

[" developing liver tumors

I

Prevention of myocardial infarction Reduction in risk of endometrial cancer .--i Prevention of osteoporosis

Fig. 2. The design of a new target-site-specific drug to stimulate or inhibit oestrogenic responses selectively in target tissues. The novel agent will have the potential to control the development of several diseases associated with the menopause.

A B C D ~llERcgome6 [ ] AF-I t DNA I I

E Ligand/AF-2

F

I I

66 kDa 595 a.a

A B rERI] Chromosome 14 54.2 kDa 485 a . a

C

I

II 16.5%

D

E

F I 95.5%

28.9%

F

II 53.5%

Homology

Fig. 3. A comparison of the functional domains of rat ERe and the and the percentage homology with ER/L IVitellogeninA20estrogen ResponseElement I

could be located in different tissues that ultimately control whether a ligand receptor complex will be an inhibitory or stimulatory signal. These associated proteins are a topic of intense investigation [23]. Finally, the genes in a target issue may be activated or blocked specifically because a receptor ligand complex binds differentially to sites in a targeted promoter region. A raloxifene response element has been described in the promoter region of the TGF/? gene that might be responsible for differential bone stimulation [24] (Fig. 4). With all these possibilities, the actions of a targeted agent could be the result one or all mechanisms.

GGTCA CAG TGACC

IPutativeRaloxi~neResponseElement(RRE)in the TGF 93 Promoter*l -38 TGGGAGGGAGGT4TAAATTTCAGCAGAGA +[ GAAATAGAGAAAGCAGTGTGTGTGCATGTG +35 TGTGTGTGTG AGAGAGAGAGGGAGAGGAGC *75 GAGAGGGAGA GGGAGAGGGAGAGAGAGAAA +llO GGGAGGGAAGCAGAGAGTCAAGTCCAAG Fig. 4. A comparison of the consensus oestrogen response element (above) and the raloxifene response element (below) that differentially regulate raloxifene action. *RRE shown in boM face; TAT sequence shown in italics; GT sequence underlined. past experience as a guide, the unusual properties of nonsteroidal antioestrogens have raised the possibility that these compounds could be powerful tools to elucidate the organization of the oestrogenic responses throughout the body. At the subcellular level, it is now known that there is target site localization of different receptor molecules. The conventional oestrogen receptor has been recognized for 30 years, but a novel oestrogen receptor/7 (ER/7) [22] has just been described (Fig. 3). Alternatively, inhibitory or stimulatory factors

STRATEGIES TO DEVELOP A NOVEL PREVENTION MAINTAINENCE THERAPY Since there is emerging evidence to support the view that compounds can be found to initiate target-sitespecific effects selectively, clinical studies are under way to exploit current knowledge. Two approaches can be taken at this point. Toxicologically safe targetsite-specific agents are being examined in clinical trials to determine how successfully they fit the criteria described in Fig. 2. An alternative approach would be to find an agent that will selectively complement the advantageous physiological effects of oestrogen. The two approaches will briefly be described.

Target-Site-Specific Agents The pharmaceutical industry has synthesized and tested thousands of novel antioestrogens and oestrogens over the past 40 years. Numerous new

Tamoxifen as a Postmenopausal Prevention Maintenance Therapy

compounds are now being tested for the treatment of breast cancer [25], but selected agents are being developed further for the treatment of osteoporosis. Droloxifene or 3-hydroxytamoxifen (Fig. 5) maintains bone density in the ovariectomized rat [26] and is currently being tested as a treatment for osteoporosis in postmenopausal women. The drug has been tested extensively as a treatment for breast cancer [27] and there is no evidence of the formation of DNA adducts in laboratory models [28] or of the induction of tumors in rat liver [29]. Raloxifene (Fig. 5), originally named keoxifene, was initially shown to maintain bone density in ovariectomized rats [30] and to prevent rat mammary carcinogenesis [31]. Raloxifene has subsequently been studied extensively in the laboratory to confirm the actions on bone [32-34] but also to demonstrate that circulating cholesterol is reduced [32]. Perhaps of importance is the observation that raloxifene has only a modest oestrogenic action in the rodent uterus [35], and this may be an advantage in developing an agent that has a less oestrogenic effect on the growth of preexisting endometrial carcinomas. The biological effects of raloxifene in the laboratory rat are summarized in Fig. 6, and the clean toxicological profile has encouraged the international testing of raloxifene as a treatment and ultimately as a preventive of osteoporosis in postmenopausal women.

/0

N N ~ J O

~O OH HO

HO Droloxifene

Raloxifene

Fig. 5. The formulae of droloxifene and raloxifene - two compounds that not only have the potential to prevent oste0porosis but also prevent breast cancer.

Reduces Cholesterol

393

I"

+ IN(CH3)3

O-

Fig. 7. The formula of tamoxifen methiodide.

Combination Therapeutics: A Binary Approach Although the idea of selective or targeted compounds is extremely attractive, it may not be possible to mimic precisely all the beneficial actions of oestrogen in the brain. Indeed it may not immediately be possible to evaluate the actions of targeted compounds on the development of Alzheimer's disease; however, it will be possible to establish an impact on changes in mood or in menopausal symptoms that may be CNS-dependent. If the quality of life issues are too complex to resolve satisfactorily, then another strategy is possible. One approach to solve the problem would be to design an agent that has all the beneficial effects of a targeted antioestrogen in the periphery but which does not penetrate the blood-brain barrier. The simultaneous administration of postmenopausal oestrogen supplementation such as Premarin (Wyeth) would complement the prevention maintenance therapy but provide all the benefits of oestrogen in the CNS. A novel quaternized tamoxifen (Fig. 7) has recently been shown to produce tamoxifen-like effects in the periphery but not to penetrate the CNS [36]. Clearly tamoxifen may not be the ideal molecule to examine because of the potential for DNA adducts in rat liver, but the concept should be pursued with other compounds such as raloxifene. An investigation of new compounds administered in combination with oestrogen Could result in a new prevention maintenance therapy based on a combination of drugs. This binary approach would synthesize an appropriate range of oestrogenic effects in the patient.

Maintains ~ ~ D e n s i t y CONCLUSIONS

Prevents Mammary Cancer

Reduces Uterine Weight

Fig. 6. The biological actions of raloxifene in the rat.

There are now exciting opportunities for developing a new prevention maintenance therapy for postmenopausal women. These strategies hold the promise of retarding the development of osteoporosis, coronary heart disease, and breast and endometrial cancer. An understanding of the molecular events involved in the target-site-specific effects of oestrogen through a novel ERfl system or the selective activation of genes by antioestrogen through novel response

394 elements p r o v i d e s a basis for n e w drug discovery in the future. H o w e v e r , for the present, the welld o c u m e n t e d clinical effects o f oestrogen coupled with the expanding data base with t a m o x i f e n h a v e laid the foundation for the current clinical trials with raloxifene. Clinical studies with a large population o f p o s t m e n o p a u s a l w o m e n will soon establish the efficacy o f the drug to treat and prevent osteoporosis, and ancillary studies will confirm its actions in p r e v e n t i n g breast cancer and coronary heart disease. R a l o x i f e n e is the first of a series o f new agents that holds the potential to revolutionize the approach to disease prevention in the majority o f p o s t m e n o p a u s a l women.

Acknowledgements. W e

thank H e n r y M u e n z n e r for drawing the diagrams and the L y n n Sage Breast C a n c e r Foundation for supporting our program, J.I.M. is supported by D A M D 1 7 - 9 4 - J - 4 4 6 6 in our D e p a r t m e n t o f D e f e n s e Breast C a n c e r Training Program.

References 1. Grodstein F, Stampfer M. The epidemiology of coronary heart disease and estrogen replacement in postmenopausal women. Prog Cardiovasc Dis 1995;38:199-210 2. Lindsay R, Tohme JF. Oestrogen treatment of patients with established postmenopausal osteoporosis. Obstet Gynecol 1990; 76:290-5. 3. Tang M-X, Jacobs D, Stern Y, et al. Effect of oestrogen during menopause on risk and age at onset of Alzheimer's disease. Lancet 1996;348:429-432. 4. Sherwin BB. Hormones, mood, and cognitive functioning in postmenopausal women. Obstet Gynecol 1996;87:$20-6. 5. Cohen CJ, Rahaman J. Endometrial cancer: management of high risk and recurrence including the tamoxifen controversy. Cancer 1995;76:204452. 6. Steinberg KK, Thacker SB, Smith SJ, et al. A meta-analysis of the effect of estrogen replacement therapy on the risk of breast cancer. JAMA 1991;265:1985-90. 7. Early Breast Cancer Trialists' Collaborative Group. Systemic treatment of early breast cancer by hormonal, cytotoxic or immune therapy. Lancet 1992;339:1-15, 71-85. 8. Love RR, Wiebe DA, Newcomb PA, et al. Effects of tamoxifen on cardivascular risk factors in postmenopausal women. Ann Intern Med 1991;115:860-4. 9. McDonald CC, Stewart JH, for the Scottish Breast Cancer Committee. Fatal myocardial infarctions in the Scottish adjuvant tamoxifen trial. BMJ 1991;303:435-7. 10. Love RR, Mazess RB, Barden HS, Epstein S, et al. Effects of tamoxifen on bone mineral density in postmenopausal women with breast cancer. N Engl J Med 1992;326:852-6. 1i. Assikis VJ, Neven P, Jordan VC, Vergote I. A realistic clinical perspective of tamoxifen and endometrial carcinogenesis. Eur J Cancer 1996;32A:1464-6. 12. Jordan VC. A current view of tamoxifen for the treatment and prevention of breast cancer. Br J Pharmacol 1993;110:507-17. 13. Powles TJ, Hardy JR, Ashley SE, Farrington GM, et al. A pilot trial to evaluate the acute toxicity and feasibility of tamoxifen for prevention of breast cancer. Br J Cancer 1989;60:126-33. 14. Powles TJ, Tillyer CP, Jones AL, et al. Prevention of breast cancer with tamoxifen: an update on the Royal Marsden pilot program. Eur J Cancer 1990;26:680-4.

v . C . Jordan et al. 15. Powles TJ, Jones AL, Ashley SE, et al. The Royal Marsden Hospital pilot tamoxifen chemoprevention trial. Breast Cancer Res Treat 1994;31:73-82. 16. Powles TJ, Hickish T, Kanis JA, Tidy A, Ashley S. Effect of tamoxifen on bone mineral density measured by dual-energy X-ray absorptiometry in healthy premenopansal and postmenopausal women. J Clin Oncol 1996;14:78-84. 17. Jordan VC, Morrow M. An appraisal of strategies to reduce the incidence of breast cancer. Stem Cells 1993;11:252-62. 18. Lerner LJ, Jordan VC. Development of antiestrogens and their use in breast cancer (Eighth Cain Memorial award lecture). Cancer Res 1990;50:4177-89. 19. Jordan VC. Alternate antiestrogens and approaches to the prevention of breast cancer. J Cell Biochem Suppl 1995;22:51-7. 20. Tonetti DA, Jordan VC. Targeted antiestrogens to treat and prevent diseases in women. Mol Med Today 1996;2:218-23. 21. Tonetti DA, Jordan VC. Design of an ideal hormone replacement therapy for women. Mol Carcinog 1996; 17:108-111. 22. Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson J-A. Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 1996;93:5925-30. 23. Baniahamad C, Nawaz Z, Banaihmad A, Glesson MAG, Tsai M-J, O'Malley BW. Enhancement of human estrogen receptor activity by SPT6: a potential coactivator. Mol Endocrinol 1995;9:34-43. 24. Yang NN, Venugopalan M, Hardikar S, Glasebrook A. Identification of an estrogen response element activated by metabolites of 17fl-estradiol and raloxifene. Science 1996; 273:1222-4. 25. Gradishar WJ, Jordan VC. The clinical potential of new antiestrogens. J Clin Oncol 1997 (in press). 26. Ke HZ, Simmons HA, Pirie CM, Crawford DT, Thompson DD. Droloxifene, a new estrogen antagonist/agonist, prevents bone loss in ovariectomized r a t s . Endocrinology 1995;136:2435-41. 27. Raushning W, Pritchard KI. Droloxifene, a new antiestrogen: its role in metastatic breast cancer. Breast Cancer Res Treat 1994;31:83-94. 28. White INH, deMatteis F, Davies A, et al. Genotoxic potential of tamoxifen and analogues in female Fischer 344/n rats, DBA/2 and C57BL/6 mice and in human MCL-5 cells. Carcinogenesis 1992;13:2197-203. 29. Hasman M, Rattel B, Loser R, Preclinical data for droloxifene. Cancer Lett 1994;84:101-16. 30. Jordan VC, Phelps E, Lindgren JU. Effect of antiestrogens on bone in castrated and intact female rats. Breast Cancer Res Treat 1987;10:31-5. 31. Gottardis MM, Jordan VC. The antitumor action of keoxifene and tamoxifen in the N-nitrosomethylurea-induced rat mammary carcinoma model. Cancer Res 1987;47:4020-4. 32. Black LJ, Sato M, Rowley ER, et al. (1994) Raloxifene (LY139481 HC1) prevents bone loss and reduces serum cholesterol without causing uterine hypotrophy in ovariectomized rats. J Clin Invest 93:63-9. 33. Evans GL, Bryant HU, Magee D, Sato M, Turner RT. The effects of raloxifene on tibia histomorphometry in ovariectomized rats. Endocrinology 1994;134:2283-8. 34. Sato M, Kim J, Short LL, Szemenda CW, Bryant HU. Longitudinal and cross-sectional analysis of raloxifene effects on tibiae from ovariectomized rats. J Pharmacol Exp Ther 1995 ;272:1251-9. 35. Black LJ, Jones CD, Falcone JF. Antagonism of estrogen action with a new benzothiophene-derived antiestrogen. Life Sci 1983;32:1031-6. 36. Biegon A, Brewster M, Degani H, Pop E, Somjen D, Kaye AM. A permanently charged tamoxifen derivative displays anticancer activity and improved tissue selectivity in rodents. Cancer Res 1996;56:4328-31.