- Email: [email protected]
Tanshinone I protects mice from aristolochic acid I-induced kidney injury by induction of CYP1A
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/etap
Tanshinone I protects mice from aristolochic acid I-induced kidney injury by induction of CYP1A Chenchen Feng, Xiaofeng Xie, Mengjun Wu, Chunzhu Li, Man Gao, Mingxia Liu, Xinming Qi ∗ , Jin Ren ∗∗ Center for Drug Safety Evaluation and Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences; Graduate School of the Chinese Academy of Sciences, Shanghai 201203, China
a r t i c l e
i n f o
a b s t r a c t
Article history:
Hepatic CYP1A especially CYP1A2 plays an important role in the reduction of aristolochic
Received 11 April 2013
acid I (AAI) nephrotoxicity. In this study, we investigated the effects of tanshinone I, a strong
Received in revised form
inducer of Cyp1a, on the nephrotoxicity induced by AAI. Histopathology and blood bio-
19 July 2013
chemistry assays showed that tanshinone I could reduce AAI-induced acute kidney injury.
Accepted 26 July 2013
Pharmacokinetics analysis revealed that tanshinone I markedly decreased AUC of AAI in
Available online 6 August 2013
plasma and the content of AAI in both liver and kidney, indicating the enhancement of AAI metabolism. Real-time PCR and Western blot analysis confirmed that tanshinone I
Keywords:
effectively increased the mRNA and protein levels of hepatic CYP1A1 and CYP1A2 in vivo.
Aristolochic acid
Luciferase assay showed that tanshinone I strongly increased the transcriptional activity of
Kidney injury
CYP1A1 and CYP1A2 in the similar extent. In summary, our data suggested that tanshinone
Tanshinone I
I facilitated the metabolism of AAI and prevented AAI-induced kidney injury by induction
CYP1A
of hepatic CYP1A 1/2 in vivo. © 2013 Elsevier B.V. All rights reserved.
1.
Introduction
Aristolochic acid (AA) is a mixture of structurally related nitrophenanthrene carboxylic acids derived from Aristolochia species. AA has gained increasing attention worldwide since the first case of nephropathy was reported in Belgium; this nephropathy is now known as aristolochic acid nephropathy (AAN). Recently, AA has also been reported to cause the so-called Balkan endemic nephropathy (BEN), affecting more than 25,000 inhabitants in certain rural areas of the Balkans in Europe (Grollman et al., 2007).
Previously, we demonstrated that inactivation of hepatic cytochrome P450 enzymes (CYP450s) impairs the metabolism of aristolochic acid I (AAI), the major nephrotoxic constituent of AA, and increases the severity of AAI-induced kidney injury in mice. CYP1A1 and 1A2 are responsible for oxidative detoxication to 8-hydroxyaristolochic acid (AAIa) (Arlt et al., 2011; Stiborova et al., 2012). CYP1A2-deficient mice are more sensitive to AAI-induced kidney injury compared to wild-type controls (Rosenquist et al., 2010). The induction of CYP1A by 3-methylcholanthrene (3-MC) and -naphthoflavone (BNF) facilitates the disposal of AAI in the kidneys and protect mice from AAI-induced nephrotoxicity (Xiao et al., 2009; Xue et al.,
∗ Corresponding author at: Center for Drug Safety Evaluation and Research, Shanghai Institute of Materia Medica, 501 Haike Road, Shanghai 201203, China. Tel.: +86 (21)20231000x1303. ∗∗ Corresponding author at: Center for Drug Safety Evaluation and Research, Shanghai Institute of Materia Medica, 501 Haike Road, Shanghai 201203, China. E-mail addresses: [email protected], [email protected] (X. Qi), [email protected] (J. Ren). 1382-6689/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.etap.2013.07.017
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
2.2.
851
Cell lines culture and treatment
Human hepatocellular carcinoma cell line HepG2 (ATCC, Manassas, VA, USA) were maintained in DMEM high glucose with 10% heat inactivated fetal bovine serum (FBS), and 1% antibiotic-antimycotic solution (Invitrogen, Carlsbad, CA, USA) at 37 ◦ C in a humidified atmosphere of 95% air and 5% CO2 . HepG2 cells were treated with tanshinone I (1, 5, or 10 M) for 24 h after pGL4.10-X1/2 plasmid (1 g) transfection. BNF (10 M) was used as a positive control.
2.3.
Fig. 1 – Structure of aristolochic acid I (A), 8-OH aristolochic acid (B) and tanshinone I (C).
2008). However, 3-MC is a known carcinogen (Stiborova et al., 2005), and BNF is genotoxic (Hodek et al., 2011) and has the potential to promote liver tumors (Hayashi et al., 2012). Recent research shows that tanshinone I (Fig. 1) has a strong inducible ability on CYP1A in vitro (Zhang et al., 2011). Tanshinone I, contained in a wide range of herbal medicines, is widely used in Asian and the western populations. Here, we investigated the effects of tanshinone I on the nephrotoxicity, metabolism, and disposition of AAI in mice, and further explored the mechanism for this protective effect.
2.
Materials and methods
2.1.
Chemicals
AAI and DMSO were purchased from Sigma (St. Louis, MO, USA). Tanshinone I was purchased from Zelang (Nanjing, China), and BNF was purchased from Merck (Hohenbrunn, Germany). Other chemicals were commercially available and purchased as reagent grade from Sinopharm (Shanghai, China). The standard for AAIa was a generous gift from Dr, Minghua Xu (Shanghai Institute of Materia Medica).
Animal experiments
Male C57BL/6 mice (6–7 weeks old, 20–22 g) were obtained from Shanghai Laboratory Animal Center. All animal experiments were approved by the Shanghai Animal Care and Use Committee (Certificate No. SCXK [Shanghai] 2002-0010). All animals were feed in SPF animal room of Shanghai Institute of Materia Medica. After a 3 days’ adapting period, all animals were divided into groups. The temperature was 22 ± 1 ◦ C. The humidity was 55 ± 5%. The photoperiod is 12 h a cycle. There were less than 7 mice in every cage. Mice were divided into 10 groups (n = 4 in each group) as follows (Fig. 2): (A) acute toxicity tests were conducted with the following groups of mice: the control group (receiving corn oil via i.p. injection for 4 days), the AAI group (receiving 10 mg/kg AAI via i.p. injection on day 4), and the tanshinone I (30 or 60 mg/kg) + AAI group (receiving tanshinone I daily for 3 days followed by a single i.p. injection of 10 mg/kg AAI on day 4). (B) Induction tests were conducted with the following groups of mice: the control group (receiving corn oil via i.p. injection for 3 days), the tanshinone I group (receiving 60 or 120 mg/kg tanshinone I daily for 3 days). (C) Pharmacokinetic assays were conducted with the following groups of mice: the control group (receiving corn oil via i.p. injection for 3 days) with an i.p. injection of AAI (10 mg/kg) on day 4 and the tanshinone I group (60 or 120 mg/kg tanshinone I daily for 3 days) with an i.p. injection of AAI (10 mg/kg) on day 4. Blood samples for concentration–time curve were collected by tail bleeding at the indicated time points after injection of AAI. Tissues for drug distribution were collected at half hour after injection of AAI. Blood and liver tissues were collected and stored at −80 ◦ C (less than a week) before they were tested.
2.4.
Histopathology and blood biochemistry assays
Nephrotoxicity induced by AAI was determined with animal experiments in this study. Histopathology and blood biochemistry assays (Serum urea nitrogen (BUN) and creatinine (CRE)) were used to detect the extent of lesion in kidney after tanshinone I and AAI being treated. The levels of BUN and CRE were measured by an automatic HITACHI Clinical Analyzer Model 7080 (Hitachi, Tokyo, Japan). Kidneys collected at the indicated time points were fixed in 10% formalin solution for 16 h, and then embedded in paraffin for sectioning into 5-mthick sections. Sections were stained with hematoxylin and eosin (H&E) using standard pathology procedures and evaluated by a pathologist as described previously (Xue et al., 2011).
852
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
Table 1 – Primers for real-time PCR. Primer
Sequence (5 –3 )
Cyp1a1
Forward: GACCCTTACAAGTATTTGGTCGT Reverse: GGTATCCAGAGCCAGTAACCT
Cyp1a2
Forward: CCAGGTGGTGGAATCGGTG Reverse: TCTTAAACCTCTTGAGGGCCG
gapdh
Forward: GGCTACACTGAGGACCAGGTT Reverse: TGCTGTAGCCGTATTCATTGTC
Corp., Milford, MA). The detection conditions were set to 70% absolute methanol and 30% acetic acid (0.1% in H2 O), 0.8 mL min−1 , UV 250 nm (Xiao et al., 2008). Separations were carried out using an Ultimate XB-C18 reverse phase column (250 mm × 4.6 mm i.d., 5-Micron, Welth materials, Shanghai, China), protected with a security guard cartridge (Gemini C18, 4 mm × 2.0 mm i.d.). For AAI, the linear ranges of the calibration curves were 0–100 g/mL in the plasma, liver, and kidneys, the regression equations were y = 94.193x + 2.8756 (r2 = 0.9945), y = 38.261x − 1.2753 (r2 = 0.9688), and y = 80.334x + 1.7436 (r2 = 0.9987), respectively, where y is the peak area and x is the concentration of the analyte. Other testing conditions refer to Xiao et al. (2008).
2.7. Fig. 2 – Animal treatment protocols. Mice were divided into 10 groups (n = 4 mice in each group). Blood samples for concentration–time curve were collected by tail bleeding at the indicated time points after injection of AAI. Tissues for drug distribution were collected at half hour after injection of AAI.
2.5. Detection of AAI and its major metabolites in the blood, liver, and kidneys For the determination of plasma AAI concentrations, blood samples were collected by tail bleeding at the indicated time points (5, 10, 30, 60, 90, and 120 min) after a single intraperitoneal (i.p.) injection of 10 mg/kg AAI (Fig. 1C). Blood samples (40 L each) were collected in heparin-coated capillaries and mixed with 50 L saline. The samples were spun at 3000 × g for 10 min at 4 ◦ C. Tissue samples were homogenized in saline and spun at 14,000 × g for 10 min, and the supernatants were then mixed with 100 g/mL (final concentration) indomethacin (internal standard, IS) and 2 volumes of methanol and spun again at 14,000 × g for 5 min to remove precipitated proteins. Aliquots of the final supernatants were analyzed and quantified for the levels of AAI and its metabolite AAIa by high-performance liquid chromatography (HPLC), as described below.
2.6.
HPLC analysis
The quantification of AAI and its metabolites in the samples was performed on an e2695-2998 HPLC system (Waters
RNA isolation and real-time RT-PCR
Total RNA was isolated using a UNIQ-10 column and TRIZOL Total RNA Isolation Kit (Sangon, Shanghai, China). One microgram of total RNA was used for reverse transcription in a reaction volume of 20 L using Cloned AMV Reverse Transcriptase (Invitrogen, Carlsbad, CA). Two microliters of cDNA were used for real time PCR using TaKaRa Ex Taq RT-PCR Version 2.1 kit (TaKaRa, Shiga, Japan). Gene-specific PCR primers for cyp1a1, cyp1a2, and gapdh are listed in Table 1, and PCR signals were detected with a DNA Engine Opticon 2 Continuous Fluorescence Detection System (Bio-Rad, Hercules, CA, USA). PCR was monitored for 45 cycles sing an annealing temperature of 60 ◦ C. At the end of the PCR cycles, melt curve analysis and 2% agar electrophoresis was performed to assess the purity of the PCR products. Negative control reactions (no template) were routinely included to monitor potential contamination of reagents. Relative amounts of cyp1a1 and cyp1a2 mRNA were normalized to that of gapdh mRNA.
2.8.
Protein isolation and Western blotting analysis
The concentration of protein extracts from mouse hepatic microsomes was determined using a BCA kit (Pierce, Rockford, IL, USA), and 20 g protein lysates were separated on 10% SDA-PAGE gels followed by transfer to nitrocellulose membranes. Western blotting analysis was performed as previously described (Yan et al., 2006), and the signal was detected using an ECL system (Millipore, Billerica, MA, USA). Antibodies used in this study included anti-mouse cyp1a1 (1:4000, Santa Cruz), anti-mouse cyp1a2 (1:20,000, Millipore), and anti-Cpr (1:8000, Millipore).
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
853
Fig. 3 – Effects of tanshinone I on AAI nephrotoxicity. Blood samples were collected to obtain serum for measurement of BUN (A) and CRE (B). (C) Kidneys were collected to perform H&E staining. Arrowheads, tubular dilation; stars, tubular necrosis and granular casts; pound sign, hyaline cast; arrows, mineralization. Scale bar, 100 m. Data are expressed as the mean ± SD (n = 5). **P < 0.01, ***P < 0.001 versus the AAI group by one-way ANOVA.
2.9.
Plasmid construction
Human CYP1A1 and CYP1A2 have a head-to-head 5 flanking region comprising approximately 27-kb DNA segments (from +1 of the CYP1A1 gene to +835 of the CYP1A2 gene). The constructed plasmids contained xenobiotic response elements (XREs) from the CYP1A enhancer in transcriptional activation (Bresnick et al., 1995; Ueda et al., 2006; Wataru Sato et al., 2010). We chose 2 regions, one named X1 (+1 to −2867 of CYP1A1) containing 6 XRE binding locations near CYP1A1, and the other named X2 (−21,148 to −24,409 of CYP1A1) containing 1 XRE binding location near CYP1A2. Gene-specific PCR primers for X1 and X2 were as follows: X1 forward, 5 ACCTGAGCTCGCTAGCGATCCAGAGGGAAGAGA AAA-3 and
reverse, 5 -CCGGATTGCCAAGCTTTGCACATTGATTCTTGA CTC-3 ; X2 forward, 5 -ACCTGAGCTCGCTAGCGGGTACCCTTGAGAAAGGAA-3 and reverse, 5 -CCGGATTGCCAAGCTTTACCTGTAGAGGCAGGTGCT-3 . Each segment was amplified by PCR with Takara LA Taq or Primestar (Takara Bio, Kyoto, Japan) and was cloned into the pGL4.10 vector (Invitrogen, Carlsbad, CA). All joints in the constructs were confirmed by sequencing (Sangon, Shanghai, China).
2.10.
Luciferase assay
HepG2 cells were seeded at a density of 1.0 × 105 cells/mL in 6-well plates to achieve ∼50% confluence the next day and were then transfected with pGL4.10-X1/2 plasmids using
854
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
Table 2 – Comparison of pharmacokinetic parameters between mice in the AAI and tanshinone I + AAI groups. Groups
Cmax (g/mL)
Tmax (min)
AAI Tan I (60 mg/kg) + AAI Tan I (120 mg/kg) + AAI
14.35 ± 0.32 13.00 ± 1.63 10.43 ± 1.98
10.00 ± 0 10.00 ± 0 8.7 ± 2.5
AUC (min g/mL) 805.73 ± 9.89 707.59 ± 30.07** 633.10 ± 14.92***
t1/2 (min) 51.17 ± 0.15 57.82 ± 4.70 70.03 ± 18.86
Values are expressed as the mean ± SD (n = 4). P < 0.01. ∗∗∗ P < 0.001 versus the AAI group. ∗∗
Lipofectamine 2000 (Invitrogen, Carlsbad, CA). At 12 h after transfection, cells were incubated with the indicated tanshinone I (1, 5, and 10 M), BNF (10 M) or DMSO vehicle (0.1%) for additional 24 h. Thereafter, cells were collected and further assayed for firefly luciferase activity, which was normalized to the activity of renilla luciferase, using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) and a Biotek Synergy 4 Microplate reader (Biotek, Vermont, USA). The results are presented as the ratio of luminescence of treated cell samples to control samples and are given as the mean ± SD of 3 individual transfections.
2.11.
Statistical analysis
The differences between each group were expressed as the mean ± SD. Statistical significance was assessed by Student’s
Fig. 5 – Levels of AAI and its major metabolite AAIa in liver and kidney. Tissue samples from mice were collected at 30 min after AAI injection to determine the levels of AAI (A) and AAIa (B). Data are expressed as the mean ± SD (n = 4). **P < 0.01, ***P < 0.001 versus the AAI group.
t-test and one-way ANOVA followed by a Tukey post hoc test. Differences were considered statistically significant if the Pvalue was less than 0.05.
3.
Results
3.1. Tanshinone I protects mice from AAI-induced acute kidney injury Fig. 4 – Levels of AAI and its major metabolite AAIa in the plasma. Blood samples were collected from mice at the indicated time points after AAI injection (10 mg/kg). Plasma levels of AAI (A) and AAIa (B) were measured by HPLC. Data are expressed as the mean ± SD (n = 4). *P < 0.05, **P < 0.01, ***P < 0.001 versus the AAI group.
Consistent to the previous reports (Xiao et al., 2009; Xue et al., 2008), the levels of serum BUN and CRE in mice were dramatically increased by a single dose of AAI injection after 7 days (Fig. 3A and B). Tanshinone I pretreatment significantly reduced the increase of serum BUN and CRE induced by AAI (Fig. 3A and B). Extensive tubular necrosis, tubular dilation and
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
855
Fig. 6 – Tanshinone I increased the mRNA and protein levels of CYP1A1 and CYP1A2 in the mouse liver. Mice were treated with tanshinone I (60, 120 mg/kg) for 3 days. mRNA levels of CYP1A2 (A) and CYP1A1 (C) were determined by real-time PCR and normalized to the expression of gapdh. Liver microsomes were extracted and separated by SDS-PAGE. Protein levels of CYP1A2 (B) and CYP1A1 (D) were normalized to the expression of cytochrome P450 reductase (CPR). Data are expressed as the mean ± SD (n = 5). *P < 0.05, ***P < 0.001 versus the control group.
massive granular and hyaline cast were observed in the kidneys by histopathological examinations at 7 day after a single dose of AAI injection (Fig. 3C). Kidneys from mice in the tanshinone I-pretreated group displayed fewer lesions (Fig. 3C).
3.2.
Tanshinone I enhances the metabolism of AAI
We next studied the pharmacokinetics of AAI and its metabolites after tanshinone I treatment. AAIa is the major metabolite of AAI oxidative metabolism by CYP1A. Tanshinone I pretreatment markedly decreased the exposure level of AAI in mice as indicated by much lower value of the area under the curve (AUC) of AAI in tanshinone I +AAI group than that in AAI group following a single i.p. of AAI at 10 mg/kg (Fig. 4A, Table 2). Simultaneously, the level of AAIa, the major metabolite of AAI, was higher in plasma of the tanshinone I pretreated group than that in AAI group (Fig. 4B).
3.3.
Tanshinone I reduces the renal distribution of AAI
To examine whether the change in pharmacokinetics of AAI upon tanshinone I pretreatment was due to the change in the tissue distribution of AAI, the levels of AAI and AAIa in liver and kidney were measured by HPLC. Thirty minutes after a single i.p. of AAI at 10 mg/kg, the level of AAI in kidney was higher than that in liver, while the level of AAIa had an opposite result. Tanshinone I pretreatment resulted in reduction in
the level of AAI (Fig. 5A) and AAIa (Fig. 5B) in both liver and kidney.
3.4. Tanshinone I induces the expression of hepatic Cyp1a1 and Cyp1a2 We examined the expression of CYP1A after tanshinone I treatment in vivo. In tanshinone I pretreated mice, mRNA and protein levels of Cyp1a1 (Fig. 6C and D) and Cyp1a2 (Fig. 6A and B) were dose-dependently increased in the liver.
3.5. Role of CYP1A promoter in CYP1A induction by tanshinone I Mammalian CYP1A and CYP1B genes (encoding cytochrome P450 1A1, 1A2, and 1B1, respectively) are regulated mostly by aromatic hydrocarbon receptor (AhR) (Nebert et al., 2004). Upon ligand binding, AhR forms a heterodimer with the AhR nuclear translocator (ARNT), and the AhR-ARNT complex binds to specific xenobiotic response elements (XREs) and activates CYP1A and CYP1B gene expression (Bock et al., 1998; Pollenz et al., 1996). Two pGL4.10 luciferase plasmids containing X1 (+1 to −2867 of CYP1A1) and X2 (−21,148 to −24,409 of CYP1A1; Fig. 7A) segments were transfected into HepG2 cells to investigate the effects of tanshinone I. Treatment with either tanshinone I
856
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
Fig. 7 – Effects of tanshinone I on the AhR-mediated activation of different segments of the CYP1A promoter in HepG2 cells. (A) Location of 2 inset segments, X1 and X2. (B) Effects of tanshinone I and BNF on the luciferase activity of pGL4.10-X1. (C) Effects of tanshinone I and BNF on the luciferase activity of pGL4.10-X2. Luciferase activity was determined by firefly luciferase (FL) activity normalized to renilla luciferase (RL) activity. The results are expressed as the activity relative to that of the vehicle control. Each value is expressed as the mean ± SD *P < 0.05, ***P < 0.001 versus the plasmid only group.
increased Cyp1a1 and Cyp1a2 expression in vivo (Fig. 6) and similarly promoted CYP1A1 and CYP1A2 transcriptional activity in luciferase assay (Fig. 7). Together, our data strongly suggested that CYP1A induction was responsible for the protective effects of tanshinone I against AAI-induced toxicity. CYP1A2 is the major CYP1A enzyme expressed in livers of humans and mice. After tanshinone I treatment, the mRNA level of CYP1A2 is much higher than that of CYP1A1. Besides, Thomas et al. found that CYP1A2 is more efficient than CYP1A1 in the detoxification of AAI (Rosenquist et al., 2010). Taken together, our results suggested that Cyp1a2 play a major role in AA detoxification by tanshinone I. The formation of AAIa, the major metabolite of AAI detoxification, should be increased after the induction of CYP1A in the liver. However, in our study, while AAI was decreased after tanshinone I pretreatment, AAIa was also decreased in the liver. AAIa can be eliminated from the body by undergoing a phase II conjugation, like UDP-glucuronosyltransferase (UGT) (Chan et al., 2007). As studied, UGT is activated through the AhR pathway, which also functions in tanshinone I-induced CYP1A induction (Bock and Bock-Hennig, 2010; Chan et al., 2007; Yanagiba, 2010). Thus, potential induction of UGT by tanshinone I may contribute to the decrease of AAIa in the liver. Tanshinone I largely increased Cyp1a expression in mice liver, meanwhile CYP1A is highly conserved between human and mouse, suggesting that tanshinone I may have a same effect on human body. There are no relevant reports about the toxicity or carcinogenicity of tanshinone I and therefore tanshinone I may be a better choice for the early prevention of AA-induced injury in the clinical practice. Over all, our study demonstrated that tanshinone I protected mice from aristolochic acid I-induced kidney injury through CYP1A induction. This study will be helpful for the clinical use of drugs containing AA and optimization of herb formulae. However, it is critical for healthcare providers to minimize the risk of using herbal drugs containing AA and to ensure that taking such drugs is as safe as possible.
Conflict of interest Nothing declared.
Funding or BNF (positive control) increased the luciferase activity in HepG2 (Fig. 7B and C).
4.
Key projects of national science and technology pillar program [2012ZX09301001-006, 2012zx09302003].
Discussion
Human CYP1A1 and CYP1A2 are the most important enzymes involved in the detoxification of AAI (Arlt et al., 2011; Sistkova et al., 2008). In this study, tanshinone I prevented the kidney injury induced by AAI (Fig. 3) through decreasing AAI content in the kidney (Figs. 4 and 5). Tanshinone I obviously
Acknowledgements The authors wish to thank the students and other staff in Dr. Jin Ren’s laboratory as well as Gui-Hua Huang and Hua Sheng for technical assistance.
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.etap. 2013.07.017.
references
Arlt, V.M., Levova, K., Barta, F., Shi, Z.Q., Evans, J.D., Frei, E., Schmeiser, H.H., Nebert, D.W., Phillips, D.H., Stiborova, M., 2011. Role of P450 1A1 and P450 1A2 in bioactivation versus detoxication of the renal carcinogen aristolochic acid i: studies in Cyp1a1(−/−), Cyp1a2(−/−), and Cyp1a1/1a2(−/−) mice. Chemical Research in Toxicology 24, 1710–1719. Bock, K.W., Bock-Hennig, B.S., 2010. UDP-glucuronosyltransferases (UGTs): from purification of Ah-receptor-inducible UGT1A6 to coordinate regulation of subsets of CYPs, UGTs, and ABC transporters by nuclear receptors. Drug Metabolism Reviews 42, 6–13. Bock, K.W., et al., 1998. AH receptor-controlled transcriptional regulation and function of rat and human UDP glucuronosyltransferase isoforms. Advances in Enzyme Regulation 38, 207–222. Bresnick, I.C., et al., 1995. Regulation of the constitutive expression of the human CYP1A2 gene: cis elements and their interaction with proteins. Molecular Pharmacology 47, 677–685. Chan, W., Luo, H.B., Zheng, Y.F., Cheng, Y.K., Cai, Z.W., 2007. Investigation of the metabolism and reductive activation of carcinogenic aristolochic acids in rats. Drug Metabolism and Disposition: The Biological Fate of Chemicals 35, 866–874. Nebert, Daniel W., et al., 2004. Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. Journal of Biological Chemistry 279, 23850–23947. Grollman, A.P., Shibutani, S., Moriya, M., Miller, F., Wu, L., Moll, U., Suzuki, N., Fernandes, A., Rosenquist, T., Medverec, Z., Jakovina, K., Brdar, B., Slade, N., Turesky, R.J., Goodenough, A.K., Rieger, R., Vukelic, M., Jelakovic, B., 2007. Aristolochic acid and the etiology of endemic (Balkan) nephropathy. Proceedings of the National Academy of Sciences of the United States of America 104, 12129–12134. Hayashi, H., Taniai, E., Morita, R., Yafune, A., Suzuki, K., Shibutani, M., Mitsumori, K., 2012. Threshold dose of liver tumor promoting effect of beta-naphthoflavone in rats. Journal of Toxicological Sciences 37, 517–526. Hodek, P., Krizkova, J., Frei, E., Singh, R., Arlt, V.M., Stiborova, M., 2011. Impact of beta-naphthoflavone on genotoxicity of food-derived carcinogens. Neuroendocrinology Letters 32 (Suppl. 1), 25–34. Pollenz, R.S., et al., 1996. The aryl-hydrocarbon receptor nuclear translocator protein is rapidly depleted in hepatic and nonhepatic culture cells exposed to 2,3,7,8-tetrachlordibenzo-p-dioxin. Molecular Pharmacology 49, 391.
857
Rosenquist, T.A., Einolf, H.J., Dickman, K.G., Wang, L., Smith, A., Grollman, A.P., 2010. Cytochrome P450 1A2 detoxicates aristolochic acid in the mouse. Drug Metabolism and Disposition: The Biological Fate of Chemicals 38, 761–768. Sistkova, J., Hudecek, J., Hodek, P., Frei, E., Schmeiser, H.H., Stiborova, M., 2008. Human cytochromes P450 1A1 and 1A2 participate in detoxication of carcinogenic aristolochic acid. Neuroendocrinology Letters 29, 733–737. Stiborova, M., Frei, E., Hodek, P., Wiessler, M., Schmeiser, H.H., 2005. Human hepatic and renal microsomes, cytochromes P450 1A1/2, NADPH: cytochrome P450 reductase and prostaglandin H synthase mediate the formation of aristolochic acid-DNA adducts found in patients with urothelial cancer. International Journal of Cancer 113, 189–197. Stiborova, M., Levova, K., Barta, F., Shi, Z., Frei, E., Schmeiser, H.H., Nebert, D.W., Phillips, D.H., Arlt, V.M., 2012. Bioactivation versus detoxication of the urothelial carcinogen aristolochic acid I by human cytochrome P450 1A1 and 1A2. Toxicological Sciences 125, 345–358. Ueda, R., Iketaki, H., Nagata, K., Kimura, S., Gonzalez, F.J., Kusano, K., Yoshimura, T., Yamazoe, Y., 2006. A common regulatory region functions bidirectionally in transcriptional activation of the human CYP1A1 and CYP1A2 genes. Molecular Pharmacology 69, 1924–1930. Wataru Sato, H.S., et al., 2010. Construction of a system that simulaneously evaluates CYP1A1 and CYP1A2 induction in a stable human-derived cell line using a dual reporter plasmid. Drug Metabolism and Pharmacokinetics 25, 180–189. Xiao, Y., Ge, M., Xue, X., Wang, C., Wang, H., Wu, X., Li, L., Liu, L., Qi, X., Zhang, Y., Li, Y., Luo, H., Xie, T., Gu, J., Ren, J., 2008. Hepatic cytochrome P450s metabolize aristolochic acid and reduce its kidney toxicity. Kidney International 73, 1231–1239. Xiao, Y., Xue, X., Wu, Y.F., Xin, G.Z., Qian, Y., Xie, T.P., Gong, L.K., Ren, J., 2009. Beta-naphthoflavone protects mice from aristolochic acid-I-induced acute kidney injury in a CYP1A dependent mechanism. Acta Pharmacologica Sinica 30, 1559–1565. Xue, X., Gong, L.K., Maeda, K., Luan, Y., Qi, X.M., Sugiyama, Y., Ren, J., 2011. Critical role of organic anion transporters 1 and 3 in kidney accumulation and toxicity of aristolochic acid I. Molecular Pharmacology 8, 2183–2192. Xue, X., Xiao, Y., Zhu, H., Wang, H., Liu, Y., Xie, T., Ren, J., 2008. Induction of P450 1A by 3-methylcholanthrene protects mice from aristolochic acid-I-induced acute renal injury. Nephrology, Dialysis, Transplantation 23, 3074–3081. Yan, C., Xin-Ming, Q., Li-Kun, G., Lin-Lin, L., Fang-Ping, C., Ying, X., et al., 2006. Tetrandrine-induced apoptosis in rat primary hepatocytes is initiated from mitochondria: caspases and endonuclease G (Endo G) pathway. Toxicology 218, 1–16. Yanagiba, Y., 2010. Octachlorostyrene induces cytochrome P450, UDP-glucuronosyltransferase, and sulfotransferase via the aryl hydrocarbon receptor and constitutive androstane receptor. Toxicology Letters 196, S107-S107. Zhang, R., Sun, J., Ma, L., Wu, X., Pan, G., Hao, H., Zhou, F.A., Liu, J., Ai, C., Shang, H., Gao, L., Peng, H., Wan, Y., Wu, P., Wang, H.G., 2011. Induction of cytochromes P450 1A1 and 1A2 by tanshinones in human HepG2 hepatoma cell line. Toxicology and Applied Pharmacology 252, 18–27.
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/etap
Tanshinone I protects mice from aristolochic acid I-induced kidney injury by induction of CYP1A Chenchen Feng, Xiaofeng Xie, Mengjun Wu, Chunzhu Li, Man Gao, Mingxia Liu, Xinming Qi ∗ , Jin Ren ∗∗ Center for Drug Safety Evaluation and Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences; Graduate School of the Chinese Academy of Sciences, Shanghai 201203, China
a r t i c l e
i n f o
a b s t r a c t
Article history:
Hepatic CYP1A especially CYP1A2 plays an important role in the reduction of aristolochic
Received 11 April 2013
acid I (AAI) nephrotoxicity. In this study, we investigated the effects of tanshinone I, a strong
Received in revised form
inducer of Cyp1a, on the nephrotoxicity induced by AAI. Histopathology and blood bio-
19 July 2013
chemistry assays showed that tanshinone I could reduce AAI-induced acute kidney injury.
Accepted 26 July 2013
Pharmacokinetics analysis revealed that tanshinone I markedly decreased AUC of AAI in
Available online 6 August 2013
plasma and the content of AAI in both liver and kidney, indicating the enhancement of AAI metabolism. Real-time PCR and Western blot analysis confirmed that tanshinone I
Keywords:
effectively increased the mRNA and protein levels of hepatic CYP1A1 and CYP1A2 in vivo.
Aristolochic acid
Luciferase assay showed that tanshinone I strongly increased the transcriptional activity of
Kidney injury
CYP1A1 and CYP1A2 in the similar extent. In summary, our data suggested that tanshinone
Tanshinone I
I facilitated the metabolism of AAI and prevented AAI-induced kidney injury by induction
CYP1A
of hepatic CYP1A 1/2 in vivo. © 2013 Elsevier B.V. All rights reserved.
1.
Introduction
Aristolochic acid (AA) is a mixture of structurally related nitrophenanthrene carboxylic acids derived from Aristolochia species. AA has gained increasing attention worldwide since the first case of nephropathy was reported in Belgium; this nephropathy is now known as aristolochic acid nephropathy (AAN). Recently, AA has also been reported to cause the so-called Balkan endemic nephropathy (BEN), affecting more than 25,000 inhabitants in certain rural areas of the Balkans in Europe (Grollman et al., 2007).
Previously, we demonstrated that inactivation of hepatic cytochrome P450 enzymes (CYP450s) impairs the metabolism of aristolochic acid I (AAI), the major nephrotoxic constituent of AA, and increases the severity of AAI-induced kidney injury in mice. CYP1A1 and 1A2 are responsible for oxidative detoxication to 8-hydroxyaristolochic acid (AAIa) (Arlt et al., 2011; Stiborova et al., 2012). CYP1A2-deficient mice are more sensitive to AAI-induced kidney injury compared to wild-type controls (Rosenquist et al., 2010). The induction of CYP1A by 3-methylcholanthrene (3-MC) and -naphthoflavone (BNF) facilitates the disposal of AAI in the kidneys and protect mice from AAI-induced nephrotoxicity (Xiao et al., 2009; Xue et al.,
∗ Corresponding author at: Center for Drug Safety Evaluation and Research, Shanghai Institute of Materia Medica, 501 Haike Road, Shanghai 201203, China. Tel.: +86 (21)20231000x1303. ∗∗ Corresponding author at: Center for Drug Safety Evaluation and Research, Shanghai Institute of Materia Medica, 501 Haike Road, Shanghai 201203, China. E-mail addresses: [email protected], [email protected] (X. Qi), [email protected] (J. Ren). 1382-6689/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.etap.2013.07.017
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
2.2.
851
Cell lines culture and treatment
Human hepatocellular carcinoma cell line HepG2 (ATCC, Manassas, VA, USA) were maintained in DMEM high glucose with 10% heat inactivated fetal bovine serum (FBS), and 1% antibiotic-antimycotic solution (Invitrogen, Carlsbad, CA, USA) at 37 ◦ C in a humidified atmosphere of 95% air and 5% CO2 . HepG2 cells were treated with tanshinone I (1, 5, or 10 M) for 24 h after pGL4.10-X1/2 plasmid (1 g) transfection. BNF (10 M) was used as a positive control.
2.3.
Fig. 1 – Structure of aristolochic acid I (A), 8-OH aristolochic acid (B) and tanshinone I (C).
2008). However, 3-MC is a known carcinogen (Stiborova et al., 2005), and BNF is genotoxic (Hodek et al., 2011) and has the potential to promote liver tumors (Hayashi et al., 2012). Recent research shows that tanshinone I (Fig. 1) has a strong inducible ability on CYP1A in vitro (Zhang et al., 2011). Tanshinone I, contained in a wide range of herbal medicines, is widely used in Asian and the western populations. Here, we investigated the effects of tanshinone I on the nephrotoxicity, metabolism, and disposition of AAI in mice, and further explored the mechanism for this protective effect.
2.
Materials and methods
2.1.
Chemicals
AAI and DMSO were purchased from Sigma (St. Louis, MO, USA). Tanshinone I was purchased from Zelang (Nanjing, China), and BNF was purchased from Merck (Hohenbrunn, Germany). Other chemicals were commercially available and purchased as reagent grade from Sinopharm (Shanghai, China). The standard for AAIa was a generous gift from Dr, Minghua Xu (Shanghai Institute of Materia Medica).
Animal experiments
Male C57BL/6 mice (6–7 weeks old, 20–22 g) were obtained from Shanghai Laboratory Animal Center. All animal experiments were approved by the Shanghai Animal Care and Use Committee (Certificate No. SCXK [Shanghai] 2002-0010). All animals were feed in SPF animal room of Shanghai Institute of Materia Medica. After a 3 days’ adapting period, all animals were divided into groups. The temperature was 22 ± 1 ◦ C. The humidity was 55 ± 5%. The photoperiod is 12 h a cycle. There were less than 7 mice in every cage. Mice were divided into 10 groups (n = 4 in each group) as follows (Fig. 2): (A) acute toxicity tests were conducted with the following groups of mice: the control group (receiving corn oil via i.p. injection for 4 days), the AAI group (receiving 10 mg/kg AAI via i.p. injection on day 4), and the tanshinone I (30 or 60 mg/kg) + AAI group (receiving tanshinone I daily for 3 days followed by a single i.p. injection of 10 mg/kg AAI on day 4). (B) Induction tests were conducted with the following groups of mice: the control group (receiving corn oil via i.p. injection for 3 days), the tanshinone I group (receiving 60 or 120 mg/kg tanshinone I daily for 3 days). (C) Pharmacokinetic assays were conducted with the following groups of mice: the control group (receiving corn oil via i.p. injection for 3 days) with an i.p. injection of AAI (10 mg/kg) on day 4 and the tanshinone I group (60 or 120 mg/kg tanshinone I daily for 3 days) with an i.p. injection of AAI (10 mg/kg) on day 4. Blood samples for concentration–time curve were collected by tail bleeding at the indicated time points after injection of AAI. Tissues for drug distribution were collected at half hour after injection of AAI. Blood and liver tissues were collected and stored at −80 ◦ C (less than a week) before they were tested.
2.4.
Histopathology and blood biochemistry assays
Nephrotoxicity induced by AAI was determined with animal experiments in this study. Histopathology and blood biochemistry assays (Serum urea nitrogen (BUN) and creatinine (CRE)) were used to detect the extent of lesion in kidney after tanshinone I and AAI being treated. The levels of BUN and CRE were measured by an automatic HITACHI Clinical Analyzer Model 7080 (Hitachi, Tokyo, Japan). Kidneys collected at the indicated time points were fixed in 10% formalin solution for 16 h, and then embedded in paraffin for sectioning into 5-mthick sections. Sections were stained with hematoxylin and eosin (H&E) using standard pathology procedures and evaluated by a pathologist as described previously (Xue et al., 2011).
852
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
Table 1 – Primers for real-time PCR. Primer
Sequence (5 –3 )
Cyp1a1
Forward: GACCCTTACAAGTATTTGGTCGT Reverse: GGTATCCAGAGCCAGTAACCT
Cyp1a2
Forward: CCAGGTGGTGGAATCGGTG Reverse: TCTTAAACCTCTTGAGGGCCG
gapdh
Forward: GGCTACACTGAGGACCAGGTT Reverse: TGCTGTAGCCGTATTCATTGTC
Corp., Milford, MA). The detection conditions were set to 70% absolute methanol and 30% acetic acid (0.1% in H2 O), 0.8 mL min−1 , UV 250 nm (Xiao et al., 2008). Separations were carried out using an Ultimate XB-C18 reverse phase column (250 mm × 4.6 mm i.d., 5-Micron, Welth materials, Shanghai, China), protected with a security guard cartridge (Gemini C18, 4 mm × 2.0 mm i.d.). For AAI, the linear ranges of the calibration curves were 0–100 g/mL in the plasma, liver, and kidneys, the regression equations were y = 94.193x + 2.8756 (r2 = 0.9945), y = 38.261x − 1.2753 (r2 = 0.9688), and y = 80.334x + 1.7436 (r2 = 0.9987), respectively, where y is the peak area and x is the concentration of the analyte. Other testing conditions refer to Xiao et al. (2008).
2.7. Fig. 2 – Animal treatment protocols. Mice were divided into 10 groups (n = 4 mice in each group). Blood samples for concentration–time curve were collected by tail bleeding at the indicated time points after injection of AAI. Tissues for drug distribution were collected at half hour after injection of AAI.
2.5. Detection of AAI and its major metabolites in the blood, liver, and kidneys For the determination of plasma AAI concentrations, blood samples were collected by tail bleeding at the indicated time points (5, 10, 30, 60, 90, and 120 min) after a single intraperitoneal (i.p.) injection of 10 mg/kg AAI (Fig. 1C). Blood samples (40 L each) were collected in heparin-coated capillaries and mixed with 50 L saline. The samples were spun at 3000 × g for 10 min at 4 ◦ C. Tissue samples were homogenized in saline and spun at 14,000 × g for 10 min, and the supernatants were then mixed with 100 g/mL (final concentration) indomethacin (internal standard, IS) and 2 volumes of methanol and spun again at 14,000 × g for 5 min to remove precipitated proteins. Aliquots of the final supernatants were analyzed and quantified for the levels of AAI and its metabolite AAIa by high-performance liquid chromatography (HPLC), as described below.
2.6.
HPLC analysis
The quantification of AAI and its metabolites in the samples was performed on an e2695-2998 HPLC system (Waters
RNA isolation and real-time RT-PCR
Total RNA was isolated using a UNIQ-10 column and TRIZOL Total RNA Isolation Kit (Sangon, Shanghai, China). One microgram of total RNA was used for reverse transcription in a reaction volume of 20 L using Cloned AMV Reverse Transcriptase (Invitrogen, Carlsbad, CA). Two microliters of cDNA were used for real time PCR using TaKaRa Ex Taq RT-PCR Version 2.1 kit (TaKaRa, Shiga, Japan). Gene-specific PCR primers for cyp1a1, cyp1a2, and gapdh are listed in Table 1, and PCR signals were detected with a DNA Engine Opticon 2 Continuous Fluorescence Detection System (Bio-Rad, Hercules, CA, USA). PCR was monitored for 45 cycles sing an annealing temperature of 60 ◦ C. At the end of the PCR cycles, melt curve analysis and 2% agar electrophoresis was performed to assess the purity of the PCR products. Negative control reactions (no template) were routinely included to monitor potential contamination of reagents. Relative amounts of cyp1a1 and cyp1a2 mRNA were normalized to that of gapdh mRNA.
2.8.
Protein isolation and Western blotting analysis
The concentration of protein extracts from mouse hepatic microsomes was determined using a BCA kit (Pierce, Rockford, IL, USA), and 20 g protein lysates were separated on 10% SDA-PAGE gels followed by transfer to nitrocellulose membranes. Western blotting analysis was performed as previously described (Yan et al., 2006), and the signal was detected using an ECL system (Millipore, Billerica, MA, USA). Antibodies used in this study included anti-mouse cyp1a1 (1:4000, Santa Cruz), anti-mouse cyp1a2 (1:20,000, Millipore), and anti-Cpr (1:8000, Millipore).
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
853
Fig. 3 – Effects of tanshinone I on AAI nephrotoxicity. Blood samples were collected to obtain serum for measurement of BUN (A) and CRE (B). (C) Kidneys were collected to perform H&E staining. Arrowheads, tubular dilation; stars, tubular necrosis and granular casts; pound sign, hyaline cast; arrows, mineralization. Scale bar, 100 m. Data are expressed as the mean ± SD (n = 5). **P < 0.01, ***P < 0.001 versus the AAI group by one-way ANOVA.
2.9.
Plasmid construction
Human CYP1A1 and CYP1A2 have a head-to-head 5 flanking region comprising approximately 27-kb DNA segments (from +1 of the CYP1A1 gene to +835 of the CYP1A2 gene). The constructed plasmids contained xenobiotic response elements (XREs) from the CYP1A enhancer in transcriptional activation (Bresnick et al., 1995; Ueda et al., 2006; Wataru Sato et al., 2010). We chose 2 regions, one named X1 (+1 to −2867 of CYP1A1) containing 6 XRE binding locations near CYP1A1, and the other named X2 (−21,148 to −24,409 of CYP1A1) containing 1 XRE binding location near CYP1A2. Gene-specific PCR primers for X1 and X2 were as follows: X1 forward, 5 ACCTGAGCTCGCTAGCGATCCAGAGGGAAGAGA AAA-3 and
reverse, 5 -CCGGATTGCCAAGCTTTGCACATTGATTCTTGA CTC-3 ; X2 forward, 5 -ACCTGAGCTCGCTAGCGGGTACCCTTGAGAAAGGAA-3 and reverse, 5 -CCGGATTGCCAAGCTTTACCTGTAGAGGCAGGTGCT-3 . Each segment was amplified by PCR with Takara LA Taq or Primestar (Takara Bio, Kyoto, Japan) and was cloned into the pGL4.10 vector (Invitrogen, Carlsbad, CA). All joints in the constructs were confirmed by sequencing (Sangon, Shanghai, China).
2.10.
Luciferase assay
HepG2 cells were seeded at a density of 1.0 × 105 cells/mL in 6-well plates to achieve ∼50% confluence the next day and were then transfected with pGL4.10-X1/2 plasmids using
854
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
Table 2 – Comparison of pharmacokinetic parameters between mice in the AAI and tanshinone I + AAI groups. Groups
Cmax (g/mL)
Tmax (min)
AAI Tan I (60 mg/kg) + AAI Tan I (120 mg/kg) + AAI
14.35 ± 0.32 13.00 ± 1.63 10.43 ± 1.98
10.00 ± 0 10.00 ± 0 8.7 ± 2.5
AUC (min g/mL) 805.73 ± 9.89 707.59 ± 30.07** 633.10 ± 14.92***
t1/2 (min) 51.17 ± 0.15 57.82 ± 4.70 70.03 ± 18.86
Values are expressed as the mean ± SD (n = 4). P < 0.01. ∗∗∗ P < 0.001 versus the AAI group. ∗∗
Lipofectamine 2000 (Invitrogen, Carlsbad, CA). At 12 h after transfection, cells were incubated with the indicated tanshinone I (1, 5, and 10 M), BNF (10 M) or DMSO vehicle (0.1%) for additional 24 h. Thereafter, cells were collected and further assayed for firefly luciferase activity, which was normalized to the activity of renilla luciferase, using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) and a Biotek Synergy 4 Microplate reader (Biotek, Vermont, USA). The results are presented as the ratio of luminescence of treated cell samples to control samples and are given as the mean ± SD of 3 individual transfections.
2.11.
Statistical analysis
The differences between each group were expressed as the mean ± SD. Statistical significance was assessed by Student’s
Fig. 5 – Levels of AAI and its major metabolite AAIa in liver and kidney. Tissue samples from mice were collected at 30 min after AAI injection to determine the levels of AAI (A) and AAIa (B). Data are expressed as the mean ± SD (n = 4). **P < 0.01, ***P < 0.001 versus the AAI group.
t-test and one-way ANOVA followed by a Tukey post hoc test. Differences were considered statistically significant if the Pvalue was less than 0.05.
3.
Results
3.1. Tanshinone I protects mice from AAI-induced acute kidney injury Fig. 4 – Levels of AAI and its major metabolite AAIa in the plasma. Blood samples were collected from mice at the indicated time points after AAI injection (10 mg/kg). Plasma levels of AAI (A) and AAIa (B) were measured by HPLC. Data are expressed as the mean ± SD (n = 4). *P < 0.05, **P < 0.01, ***P < 0.001 versus the AAI group.
Consistent to the previous reports (Xiao et al., 2009; Xue et al., 2008), the levels of serum BUN and CRE in mice were dramatically increased by a single dose of AAI injection after 7 days (Fig. 3A and B). Tanshinone I pretreatment significantly reduced the increase of serum BUN and CRE induced by AAI (Fig. 3A and B). Extensive tubular necrosis, tubular dilation and
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
855
Fig. 6 – Tanshinone I increased the mRNA and protein levels of CYP1A1 and CYP1A2 in the mouse liver. Mice were treated with tanshinone I (60, 120 mg/kg) for 3 days. mRNA levels of CYP1A2 (A) and CYP1A1 (C) were determined by real-time PCR and normalized to the expression of gapdh. Liver microsomes were extracted and separated by SDS-PAGE. Protein levels of CYP1A2 (B) and CYP1A1 (D) were normalized to the expression of cytochrome P450 reductase (CPR). Data are expressed as the mean ± SD (n = 5). *P < 0.05, ***P < 0.001 versus the control group.
massive granular and hyaline cast were observed in the kidneys by histopathological examinations at 7 day after a single dose of AAI injection (Fig. 3C). Kidneys from mice in the tanshinone I-pretreated group displayed fewer lesions (Fig. 3C).
3.2.
Tanshinone I enhances the metabolism of AAI
We next studied the pharmacokinetics of AAI and its metabolites after tanshinone I treatment. AAIa is the major metabolite of AAI oxidative metabolism by CYP1A. Tanshinone I pretreatment markedly decreased the exposure level of AAI in mice as indicated by much lower value of the area under the curve (AUC) of AAI in tanshinone I +AAI group than that in AAI group following a single i.p. of AAI at 10 mg/kg (Fig. 4A, Table 2). Simultaneously, the level of AAIa, the major metabolite of AAI, was higher in plasma of the tanshinone I pretreated group than that in AAI group (Fig. 4B).
3.3.
Tanshinone I reduces the renal distribution of AAI
To examine whether the change in pharmacokinetics of AAI upon tanshinone I pretreatment was due to the change in the tissue distribution of AAI, the levels of AAI and AAIa in liver and kidney were measured by HPLC. Thirty minutes after a single i.p. of AAI at 10 mg/kg, the level of AAI in kidney was higher than that in liver, while the level of AAIa had an opposite result. Tanshinone I pretreatment resulted in reduction in
the level of AAI (Fig. 5A) and AAIa (Fig. 5B) in both liver and kidney.
3.4. Tanshinone I induces the expression of hepatic Cyp1a1 and Cyp1a2 We examined the expression of CYP1A after tanshinone I treatment in vivo. In tanshinone I pretreated mice, mRNA and protein levels of Cyp1a1 (Fig. 6C and D) and Cyp1a2 (Fig. 6A and B) were dose-dependently increased in the liver.
3.5. Role of CYP1A promoter in CYP1A induction by tanshinone I Mammalian CYP1A and CYP1B genes (encoding cytochrome P450 1A1, 1A2, and 1B1, respectively) are regulated mostly by aromatic hydrocarbon receptor (AhR) (Nebert et al., 2004). Upon ligand binding, AhR forms a heterodimer with the AhR nuclear translocator (ARNT), and the AhR-ARNT complex binds to specific xenobiotic response elements (XREs) and activates CYP1A and CYP1B gene expression (Bock et al., 1998; Pollenz et al., 1996). Two pGL4.10 luciferase plasmids containing X1 (+1 to −2867 of CYP1A1) and X2 (−21,148 to −24,409 of CYP1A1; Fig. 7A) segments were transfected into HepG2 cells to investigate the effects of tanshinone I. Treatment with either tanshinone I
856
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
Fig. 7 – Effects of tanshinone I on the AhR-mediated activation of different segments of the CYP1A promoter in HepG2 cells. (A) Location of 2 inset segments, X1 and X2. (B) Effects of tanshinone I and BNF on the luciferase activity of pGL4.10-X1. (C) Effects of tanshinone I and BNF on the luciferase activity of pGL4.10-X2. Luciferase activity was determined by firefly luciferase (FL) activity normalized to renilla luciferase (RL) activity. The results are expressed as the activity relative to that of the vehicle control. Each value is expressed as the mean ± SD *P < 0.05, ***P < 0.001 versus the plasmid only group.
increased Cyp1a1 and Cyp1a2 expression in vivo (Fig. 6) and similarly promoted CYP1A1 and CYP1A2 transcriptional activity in luciferase assay (Fig. 7). Together, our data strongly suggested that CYP1A induction was responsible for the protective effects of tanshinone I against AAI-induced toxicity. CYP1A2 is the major CYP1A enzyme expressed in livers of humans and mice. After tanshinone I treatment, the mRNA level of CYP1A2 is much higher than that of CYP1A1. Besides, Thomas et al. found that CYP1A2 is more efficient than CYP1A1 in the detoxification of AAI (Rosenquist et al., 2010). Taken together, our results suggested that Cyp1a2 play a major role in AA detoxification by tanshinone I. The formation of AAIa, the major metabolite of AAI detoxification, should be increased after the induction of CYP1A in the liver. However, in our study, while AAI was decreased after tanshinone I pretreatment, AAIa was also decreased in the liver. AAIa can be eliminated from the body by undergoing a phase II conjugation, like UDP-glucuronosyltransferase (UGT) (Chan et al., 2007). As studied, UGT is activated through the AhR pathway, which also functions in tanshinone I-induced CYP1A induction (Bock and Bock-Hennig, 2010; Chan et al., 2007; Yanagiba, 2010). Thus, potential induction of UGT by tanshinone I may contribute to the decrease of AAIa in the liver. Tanshinone I largely increased Cyp1a expression in mice liver, meanwhile CYP1A is highly conserved between human and mouse, suggesting that tanshinone I may have a same effect on human body. There are no relevant reports about the toxicity or carcinogenicity of tanshinone I and therefore tanshinone I may be a better choice for the early prevention of AA-induced injury in the clinical practice. Over all, our study demonstrated that tanshinone I protected mice from aristolochic acid I-induced kidney injury through CYP1A induction. This study will be helpful for the clinical use of drugs containing AA and optimization of herb formulae. However, it is critical for healthcare providers to minimize the risk of using herbal drugs containing AA and to ensure that taking such drugs is as safe as possible.
Conflict of interest Nothing declared.
Funding or BNF (positive control) increased the luciferase activity in HepG2 (Fig. 7B and C).
4.
Key projects of national science and technology pillar program [2012ZX09301001-006, 2012zx09302003].
Discussion
Human CYP1A1 and CYP1A2 are the most important enzymes involved in the detoxification of AAI (Arlt et al., 2011; Sistkova et al., 2008). In this study, tanshinone I prevented the kidney injury induced by AAI (Fig. 3) through decreasing AAI content in the kidney (Figs. 4 and 5). Tanshinone I obviously
Acknowledgements The authors wish to thank the students and other staff in Dr. Jin Ren’s laboratory as well as Gui-Hua Huang and Hua Sheng for technical assistance.
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 6 ( 2 0 1 3 ) 850–857
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.etap. 2013.07.017.
references
Arlt, V.M., Levova, K., Barta, F., Shi, Z.Q., Evans, J.D., Frei, E., Schmeiser, H.H., Nebert, D.W., Phillips, D.H., Stiborova, M., 2011. Role of P450 1A1 and P450 1A2 in bioactivation versus detoxication of the renal carcinogen aristolochic acid i: studies in Cyp1a1(−/−), Cyp1a2(−/−), and Cyp1a1/1a2(−/−) mice. Chemical Research in Toxicology 24, 1710–1719. Bock, K.W., Bock-Hennig, B.S., 2010. UDP-glucuronosyltransferases (UGTs): from purification of Ah-receptor-inducible UGT1A6 to coordinate regulation of subsets of CYPs, UGTs, and ABC transporters by nuclear receptors. Drug Metabolism Reviews 42, 6–13. Bock, K.W., et al., 1998. AH receptor-controlled transcriptional regulation and function of rat and human UDP glucuronosyltransferase isoforms. Advances in Enzyme Regulation 38, 207–222. Bresnick, I.C., et al., 1995. Regulation of the constitutive expression of the human CYP1A2 gene: cis elements and their interaction with proteins. Molecular Pharmacology 47, 677–685. Chan, W., Luo, H.B., Zheng, Y.F., Cheng, Y.K., Cai, Z.W., 2007. Investigation of the metabolism and reductive activation of carcinogenic aristolochic acids in rats. Drug Metabolism and Disposition: The Biological Fate of Chemicals 35, 866–874. Nebert, Daniel W., et al., 2004. Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. Journal of Biological Chemistry 279, 23850–23947. Grollman, A.P., Shibutani, S., Moriya, M., Miller, F., Wu, L., Moll, U., Suzuki, N., Fernandes, A., Rosenquist, T., Medverec, Z., Jakovina, K., Brdar, B., Slade, N., Turesky, R.J., Goodenough, A.K., Rieger, R., Vukelic, M., Jelakovic, B., 2007. Aristolochic acid and the etiology of endemic (Balkan) nephropathy. Proceedings of the National Academy of Sciences of the United States of America 104, 12129–12134. Hayashi, H., Taniai, E., Morita, R., Yafune, A., Suzuki, K., Shibutani, M., Mitsumori, K., 2012. Threshold dose of liver tumor promoting effect of beta-naphthoflavone in rats. Journal of Toxicological Sciences 37, 517–526. Hodek, P., Krizkova, J., Frei, E., Singh, R., Arlt, V.M., Stiborova, M., 2011. Impact of beta-naphthoflavone on genotoxicity of food-derived carcinogens. Neuroendocrinology Letters 32 (Suppl. 1), 25–34. Pollenz, R.S., et al., 1996. The aryl-hydrocarbon receptor nuclear translocator protein is rapidly depleted in hepatic and nonhepatic culture cells exposed to 2,3,7,8-tetrachlordibenzo-p-dioxin. Molecular Pharmacology 49, 391.
857
Rosenquist, T.A., Einolf, H.J., Dickman, K.G., Wang, L., Smith, A., Grollman, A.P., 2010. Cytochrome P450 1A2 detoxicates aristolochic acid in the mouse. Drug Metabolism and Disposition: The Biological Fate of Chemicals 38, 761–768. Sistkova, J., Hudecek, J., Hodek, P., Frei, E., Schmeiser, H.H., Stiborova, M., 2008. Human cytochromes P450 1A1 and 1A2 participate in detoxication of carcinogenic aristolochic acid. Neuroendocrinology Letters 29, 733–737. Stiborova, M., Frei, E., Hodek, P., Wiessler, M., Schmeiser, H.H., 2005. Human hepatic and renal microsomes, cytochromes P450 1A1/2, NADPH: cytochrome P450 reductase and prostaglandin H synthase mediate the formation of aristolochic acid-DNA adducts found in patients with urothelial cancer. International Journal of Cancer 113, 189–197. Stiborova, M., Levova, K., Barta, F., Shi, Z., Frei, E., Schmeiser, H.H., Nebert, D.W., Phillips, D.H., Arlt, V.M., 2012. Bioactivation versus detoxication of the urothelial carcinogen aristolochic acid I by human cytochrome P450 1A1 and 1A2. Toxicological Sciences 125, 345–358. Ueda, R., Iketaki, H., Nagata, K., Kimura, S., Gonzalez, F.J., Kusano, K., Yoshimura, T., Yamazoe, Y., 2006. A common regulatory region functions bidirectionally in transcriptional activation of the human CYP1A1 and CYP1A2 genes. Molecular Pharmacology 69, 1924–1930. Wataru Sato, H.S., et al., 2010. Construction of a system that simulaneously evaluates CYP1A1 and CYP1A2 induction in a stable human-derived cell line using a dual reporter plasmid. Drug Metabolism and Pharmacokinetics 25, 180–189. Xiao, Y., Ge, M., Xue, X., Wang, C., Wang, H., Wu, X., Li, L., Liu, L., Qi, X., Zhang, Y., Li, Y., Luo, H., Xie, T., Gu, J., Ren, J., 2008. Hepatic cytochrome P450s metabolize aristolochic acid and reduce its kidney toxicity. Kidney International 73, 1231–1239. Xiao, Y., Xue, X., Wu, Y.F., Xin, G.Z., Qian, Y., Xie, T.P., Gong, L.K., Ren, J., 2009. Beta-naphthoflavone protects mice from aristolochic acid-I-induced acute kidney injury in a CYP1A dependent mechanism. Acta Pharmacologica Sinica 30, 1559–1565. Xue, X., Gong, L.K., Maeda, K., Luan, Y., Qi, X.M., Sugiyama, Y., Ren, J., 2011. Critical role of organic anion transporters 1 and 3 in kidney accumulation and toxicity of aristolochic acid I. Molecular Pharmacology 8, 2183–2192. Xue, X., Xiao, Y., Zhu, H., Wang, H., Liu, Y., Xie, T., Ren, J., 2008. Induction of P450 1A by 3-methylcholanthrene protects mice from aristolochic acid-I-induced acute renal injury. Nephrology, Dialysis, Transplantation 23, 3074–3081. Yan, C., Xin-Ming, Q., Li-Kun, G., Lin-Lin, L., Fang-Ping, C., Ying, X., et al., 2006. Tetrandrine-induced apoptosis in rat primary hepatocytes is initiated from mitochondria: caspases and endonuclease G (Endo G) pathway. Toxicology 218, 1–16. Yanagiba, Y., 2010. Octachlorostyrene induces cytochrome P450, UDP-glucuronosyltransferase, and sulfotransferase via the aryl hydrocarbon receptor and constitutive androstane receptor. Toxicology Letters 196, S107-S107. Zhang, R., Sun, J., Ma, L., Wu, X., Pan, G., Hao, H., Zhou, F.A., Liu, J., Ai, C., Shang, H., Gao, L., Peng, H., Wan, Y., Wu, P., Wang, H.G., 2011. Induction of cytochromes P450 1A1 and 1A2 by tanshinones in human HepG2 hepatoma cell line. Toxicology and Applied Pharmacology 252, 18–27.