TAP 1 and TAP 2 transporter gene polymorphisms in multiple sclerosis: No evidence for disease association with TAP

Journal of Neuroimmunology ELSEVIER

Journal of Neuroimmunology 54 (1994) 35-40

TAP 1 and TAP 2 transporter gene polymorphisms in multiple sclerosis: No evidence for disease association with TAP Caroline Vandevyver

a,*

Piet Stinissen a, Jean-Jacques Cassiman

b,

Jef Raus a,c

a Department of Immunology/Biotechnology, Dr. L. WiUems-lnstituut, Universitaire Campus, B-3590 Diepenbeek, Belgium b "'Centrum voor Menselijke Erfelijkheid", Onderwijs en Navorsing, Gasthuisberg, Herestraat 49, B-3000 Leut'en, Belgium c Limburgs Universitair Centrum, Uniuersitaire Campus, B-3590 Diepenbeek, Belgium

Received 28 February 1994; revision received and accepted 2 June 1994

Abstract

Multiple sclerosis (MS) is known to be associated with HLA-DR2, but it is possible that additional major histocompatibility complex (MHC) genes confer disease susceptibility. The most recent candidate genes for MHC-encoded susceptibility are the TAP genes, which are located between the HLA-DQ and DP loci, and encode for proteins believed to transport antigenic peptides from the cytoplasm into the endoplasmic reticulum. We studied TAP 1 and TAP 2 gene polymorphisms in 65 chronic progressive MS patients and 66 healthy subjects. No significant differences in the frequencies of TAP polymorphisms were observed between both groups. These data suggest that TAP is not a susceptibility gene for MS and that the disease-predisposing haplotype does not extend as far as TAP.

Keywords: Multiple sclerosis; Susceptibility; Transporter Associated with Protein Processing (TAP) genes

1. Introduction

Multiple sclerosis (MS) is a disease of the central nervous system (CNS), characterized by infiltrations of mononuclear cells in the white matter, which in a later stage give rise to plaques of demyelination (McFarlin and McFarland, 1982). Although cellular and humoral immunological abnormalities are associated with MS, the cause and the pathological mechanisms of the disease remain largely unknown. The autoimmune processes in MS apparently result from complex interactions between environmental and genetic factors (Cook and Dowling, 1980; Kurtzke, 1980; Spielman and Nathanson, 1982). This multifactorial nature of MS is reflected in the disease concordance rates among monozygotic twins which are substantially less than 100%. The risk of developing MS for a twin brother or sister of a MS patient is 3 0 - 5 0 % for monozygotic twins, whereas the risk for a dizygotic twin is 4 - 5 % (McFarland et al., 1984; Ebers et al., 1986; Sadovnick et al., 1993). Susceptibility for MS is probably deter-

* Corresponding author. Phone (011) 269 211; Fax (011) 269 209 0165-5728/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 0165-5728(94)00085-3

mined by a large number of currently unidentified genes. The complex interactions between these genes may explain the enormous variety of clinical conditions associated with the disease. Thus far, genetic studies have focused on genes for the human leukocyte antigen (HLA) molecules (Francis et al., 1991; Olerup and Hillert, 1991; Mellins, 1992), because of the known central position of HLA gene products in antigen presentation. These studies demonstrated an over-representation of the HLAA 3 , B 7 , D R 2 / D w 2 , D Q w l haplotype (Oger and Sadovnick, 1991) among Caucasian MS patients of northern European ancestry. However, the genetic region which confers susceptibility has not been narrowed down to a particular gene. Furthermore, all of these associations are relatively weak (relative risk of 2-4) and lead to the assumption that HLA genes themselves may simply be genetic markers in linkage disequilibrium with other putative susceptibility genes and that the true susceptibility genes for MS still need to be identified. Polymorphisms in regulatory regions upstream to the HLA structural genes could also contribute to disease susceptibility. The most recent identified candidate susceptibility factors are the TAP (Transporter

36

c. Vandevyueret al. /Journal of Neuroimrnunology 54 (1994)35-40

Associated with protein Processing) genes, which are located within the class II region of the human HLA complex, between the DQ and DP loci (Ziegler et al., 1991; Bodmer et al., 1992). TAP 1 (previous equivalent RING 4, Y3, PSF 1) and TAP 2 (previous equivalent RING 11, Y1, PSF 2) encode molecules which function as peptide transporters. These molecules show sequence homology with the ABC ('ATP-binding cassette') transporter superfamily, whose members are involved in the transport of a wide variety of substrates across the cell membranes. This localization of the transporter genes TAP 1 and TAP 2 within the HLA complex makes them first-degree suspects of participating in autoimmunity. Furthermore, Powis et al. (1992) showed that a polymorphism of the rat transporter genes, mtp-1 and mtp-2, determines the spectrum of peptides loaded by a class I molecule and thus its presentation of antigen. This implies the potential of these genes - through their differential effect on peptide uptake - to influence the T cell responses. Consequently, the human TAP 1 and TAP 2 transporter genes, which are also polymorphic, are potential susceptibility factors in autoimmune diseases as MS. Jackson and Capra (1993) reported genetic association of insulin-dependent diabetes meUitus (IDD~/I) with TAP 1. This association was stronger than with any HLA-DP allele, but the relative risk was lower than for HLA-DQB*0302. However, the observed ~Lssociations with TAP 2 variants and IDDM (Caill~ttZucman et al., 1992; Colonna et al., 1992) seemed to be secondary to a primary association between t]lis disease and particular DQa/3 heterodimers (R(nningen et al., 1993). Studies of TAP in coeliac dise~se revealed a significant association; however, when I,atients were compared with HLA-DR and -DQ match ed controls, no significant difference was found (Powis et al., 1993). Liblau and co-workers (1993) investigated the T, kP 1 and TAP 2 polymorphisms in a HLA-DR2, rela)sing/remitting (RR) MS population. No association l~etween TAP alleles and RR MS was found. The aim of the present study was to investiglte whether TAP 1 and TAP 2 polymorphisms are assc ciated with chronic progressive (CP) MS. We therefi~re studied these polymorphisms in 65 HLA-class II ty~,ed patients with clinically definite, chronic progressive ]dS and 66 unrelated healthy Belgians.

2. Materials and methods

2.1. Patient population

DNA samples from a group of 65 unrelated IVIS patients, from different parts of Belgium with clinic lily

definite MS (EDSS 6-9.5; 59% women; mean disease duration 22 years (6 years minimum, 52 years maximum)) were studied. Patients selected for this study fulfilled the diagnostic criteria of Poser and co-workers (Poser et al., 1983). Sixty-six randomly selected healthy individuals, of Euro-Caucasian descent, were used as normal controls. All samples were analyzed for the TAP 1 and TAP 2 polymorphisms, and for the HLAclass II genotypes (data not shown). 2.2. PCR amplification

Genomic DNA was prepared from 10 ml EDTAblood with a simple salting out procedure (Miller et al., 1988). The TAP 1 and TAP 2 polymorphic regions were amplified by PCR using the primer sets given in Table 1 (Colonna et al., 1992; Powis et al., 1992). 1 ~g genomic DNA was amplified in a total volume of 100 tzl, containing 50 mM KC1, 10 mM Tris- HCI (pH 8.4), 0.1% gelatin, 1 mM MgCI 2, 200 /zM of each dATP, dCTP, dGTP, dTI'P, 0.2 ~M of each primer and 0.5 unit of Taq DNA polymerase. The amplification was carried out for 40 cycles of incubation for 1 min at 94°C, 2 min at 57°C, 2 min at 72°C, followed by an extension step of 10 rain at 72°C. 2.3. Allele-specific oligonucleotide (ASO) hybridizations

Allele specific oligonucleotides (Table 1) were digoxigenin (DIG)-labeled, using the 3'-end labeling kit of Boehringer Mannheim (Mannheim, Germany). 10 ~1 PCR amplification product was denatured (10 min at 95°C) and subsequently immobilized on Zeta Probe GT membranes (BioRad, Nazareth, Belgium). Filters were pre-hybridized in TMA hybridization solution (3.0 M tetramethyl ammonium chloride, 50 mM Tris (pH 8.0), 2 mM EDTA, 5 x Denhardt's solution (100 x Denhardt: 2% bovine serum albumin, 2% polyvinytpyrolidone, 2% Ficoll, 0.1% SDS, !00 t~g/ml denatured herring sperm DNA) for 1 h at 40°C. Hybridization was carried out for 2 h at 40°C in TMA hybridization solution supplemented with 1 pmol of DIG-A1 or DIG-A2. After hybridization, membranes were subsequently washed in 2 × SSPE (20 × SSPE: 2.6 M NaCI, 0.2 M Na2HPO 4 (pH 6.8), 0.02 EDTA), 0.1% SDS, for 2 × 5 min at room temperature, in 5 X SSPE, 0,1% SDS, for 1 x 10 min at 40°C, in TMA washing solution (3.0 tetramethyl ammonium chloride, 50 mM Tris (pH 8.0), 2 mM EDTA, 0.1% SDS) for 1 x 5 min at room temperature, and for 1 h at 52°C. Filters were dried, and DIG detection with chemiluminescent Lumigen PPD (Boehringer Mannheim, Mannheim, Germany) was performed according to the instructions of the manufacturer.

C. Vandevyver et al. /Journal of Neuroimmunology 54 (1994) 35-40

2.4. Statistical analysis Polymorphic, genotypic and allelic distributions in the MS patients and control group were compared by using the chi-square and Fisher's exact test of independence (Speigel, 1972; Armitage, 1980). Data were considered significant at P < 0.05. The Bonferoni correction for multiple testing was carried out, if necessary (Dunn, 1958, 1961). Polymorphism frequencies were defined as the number of times a polymorphism appeared and was counted once in a heterozygote and twice in a homozygote person. Genotype frequencies were defined as the number of times a particular combination of polymorphisms appeared in either a homozygotic pattern or a heterozygotic pattern. The polymorphic nucleotides are variably associated defining different TAP 1 and TAP 2 alleles. The allele assignment for the normal subject and MS patients was done for all individuals heterozygous at not more than one locus. Without segregation information, the allele phase cannot be deduced for persons who are double heterozygous for one locus.

37

fled. TAP 1 and TAP 2, which are homologous with the bacterial transporter and the mammalian multidrug resistance genes, and are members of the ABC peptide transporter gene family (Spies et al., 1990; Trowsdale et al., 1990; Bahram et al., 1991; Powis et al., 1992), emerged to be candidates for antigen transport. TAP 1 and TAP 2 gene products may be responsible for the transmembrane trafficking of antigenic fragments to complex with HLA molecules (Speis and DeMars, 1991; Powis et al., 1992). Class II molecules bind peptides that are derived from proteins taken up by internalization (Uanue, 1992). These can be soluble proteins or proteins that are derived from microorganisms. It is believed that proteins made in the cytosol can be recognized directly by the MHC class II molecules (Jin et al., 1988; Jacobsen et al., 1989). However, the ER can also serve as a processing compartment for proteins destined for class II presentation. Mellins et al. (1991) showed that a gene that maps to the MHC complex is required for this class II restricted antigen presentation. 3.1. TAP 1 and TAP 2 variants

3. Results and discussion

T cells recognize foreign antigen when it is presented by class I or class II MHC molecules (Bjorkman and Davis, 1988). Recently, a lot of research has been done on the mechanism by which protein antigens are processed for presentation by MHC molecules (Fairchild and Wraith, 1992; Parham, 1992; Uanue, 1992). It is believed that MHC class I molecules bind to peptides - derived from viruses or intracellular pathogenic bacteria that enter the cytosol - in the endoplasmic reticulum (ER). As most of these peptides are derived from the cytoplasm, they must first be transported across the ER, prior to MHC class I binding. A cluster of genes, mapping between DNA and DOB, designated TAP 1 and TAP 2, have been identi-

We evaluated the distribution of two polymorphic loci in the TAP 1 gene at cDNA nucleotide positions 1069 and 1982; and at three polymorphic sites of the TAP 2 gene at cDNA position 1231, 2089 and 2155. The variation at position 2155 results in a shorter protein due to the creation of a stop codon. The amino acid changes that occur with the different nucleic acid substitutions are shown in Table 1. We restricted our study of TAP 1 and TAP 2 allele distribution to patients with chronic progressive MS, to select a homogenous population of MS patients. Table 2 shows the genotypic distribution of TAP 1 and TAP 2 polymorphic nucleotides in MS and control populations. No significant differences are observed when both groups are compared. As HLA-DR2 is known to be associated with MS,

Table 1 P C R primers and allele specific oligonucleotide probes for P C R A S O analysis of T A P 1 and T A P 2 Polymorphic position (bp) TAP 1 1069 1982

TAP 2 1231

2089 2155

P C R primers 5 ' - 3 '

ASO

A m i n o acid change (position)

CACCCTGAGTGATTCTC ACTGAGTCTGCCAAGTCT CCCTATCCAGCTACAACC AACGCCACTGCCTGTCGC

TCACCCTGATCACCCT TCACCCTGGTCACCCT AGAGGTAGACGAGGCT AGABGTAGGCGAGGCT

I ~ V (333)

GCGGAGAGACCTGGAAC6 TCAGCATCAGCATCTGCA ACAGTGCTGGTGATTGCTC CACAGCTCTAGGGAAACTC GGGGATCGCACAGTGCTGGT6 CTGGAATTCAGGAACAGCTAT

ACCTGCTCATAAGGAG ACCTGCTCGTAAGGAG AGGCTGCAGGCAGTTCAG AGGCTGCAGACAGTTCAG CCTCCTGGAGCTGGGCAA CCTCCTAGAGCTGGGCAA

I ~ V (379)

D --* G (637)

A --* T (665) Q ~ Stop (687)

C. Vandevyver et al. / Journal of Neuroimmunology 54 (1994) 35-40

38

Table 2 Frequencies of human TAP 1 and TAP 2 polymorphic nucleotides, as determined by PCR-ASO-hybridization Nucleotide

TAP 1 1069 1982

amino acid

I V D G

TAP 1 Possible alleles

Name

MS patients (n = 65)

Controls (n = 66)

Obs.

Freq.

Obs.

Freq.

I

I!:i:t;:!:]

~

I TAPIA

99 31 115 15

0.76 0.24 0.88 0.12

103 29 115 17

0.78 0.22 0.87 0.13

]

I'~"~,';';~

~

I TAPIB

I

F:i%;;;'l

~1

I TAP1C

Obs.

Freq.

Obs.

Freq.

36 27 2 53 9 3

0.55 0.42 0.03 0.82 0.14 0.05

42 19 5 50 15 1

0.64 0.29 0.08 0.76 0.23 0.02

333

637

Genotype 1069

1982

Nucleotide

I,I I,V V,V D,D D,G G,G Amino acid

MS patients (n = 62)

Controls (n = 62)

Obs.

Freq.

Obs.

Freq.

13 111 57 67 30 94

0.10 0.90 0.46 0.54 0.24 0.76

19 105 59 65 24 100

0.15 0.85 0.48 0.52 0.19 0.81

Obs.

Freq.

Obs.

Freq.

1 10 51 0 57 5 4 22 36

0.02 0.16 0.82 0.00 0.92 0.08 0.06 0.35 0.58

1 17 44 2 55 5 0 24 38

0.02 0.27 0.71 0.03 0.89 0.08 0.00 0.39 0.61

TAP2 1231 2089 2155

I V A T Q Stop Genotype

1231

2089

2155

I,I I,V v,v A,A A,T T,T Q,Q Q,Stop Stop,Stop

TAP 2

379

I

l~1

I I I

3.2. T A P 1 and T A P 2 alleles

~'1

687

TA~A

I!i~il t;~il 14Z/',l li!ili+ii+~il I:~:1 I0¢~ I+iitili~i I:~:t kg~¢q

I I I

T~B w~p2c TAP2D

I

l~'ili~

~

I

TAP2F

I

l i~lJliii;iiil ~ ; ~

[,~

!

not observed

I

~i~!~i

~

I

~to~.~d

i~;.~ f~;~i

~

Fig. 1. Alleles of TAP 1 and TAP 2, as defined by potential combinations of dimorphisms within TAP 1 and TAP 2.

control individuals and 50% of the MS patients (Table 4). W e o b s e r v e d t h r e e d e s c r i b e d a l l e l e s ( T A P 2 A - C ) ( C o l o n n a et al., 1992) a n d t h r e e n o v e l a l l e l e s ( T A P

Table 3 The distribution of the TAP 1 alleles in MS and control group Observed MS 1A: I / D a 1B: V / G " 1C: V / D a 1D: I / G Total number

T h e p o l y m o r p h i s m s in T A P 1 a n d T A P 2 c a n b e c o m b i n e d to d i f f e r e n t a l l e l e s (Fig. 1). B e c a u s e o f t h e l i m i t e d h e t e r o g e n e i t y at t h e T A P 1 locus, a l l e l e s c o u l d b e a s s i g n e d in a l m o s t all i n d i v i d u a l s ( T a b l e 3). T h r e e p r e v i o u s l y d e s c r i b e d alleles, T A P 1 A - C ( C o l o n n a et al., 1992), a n d a f o u r t h n o v e l a l l e l e T A P 1 D ( I - 3 3 3 , G 637) w e r e o b s e r v e d in b o t h M S p a t i e n t s a n d c o n t r o l s . T h e d i s t r i b u t i o n o f t h e s e T A P 1 a l l e l e s is n o t significantly different between the two groups or the DR2positive subgroups. T A P 2 a l l e l e s c o u l d b e d e f i n e d in 4 7 % o f t h e

665

I

Alleles b w e c o m p a r e d t h e T A P v a r i a n t s d i s t r i b u t i o n in M S p a t i e n t s a n d c o n t r o l s t h a t c a r r i e d t h e H L A - D R 2 allele. N o s i g n i f i c a n t d i f f e r e n c e s w e r e f o u n d ( d a t a n o t shown).

Name

Possible alleles

1A: I / D a 1B: V / G " 1C: V / D a 1D: I / G Total number

Frequencies Controls

89 5 20 4

89 3 14 2

118

108

DR2+MS

DR2+ controls

54 1 8 3

15 0 3 0

66

18

MS

Controls

0.75 0.04 0.17 0.03

0.82 0.03 0.13 0.02

DR2+MS

DR2+ controls

0.82 0.02 0.12 0.05

0.83 0.00 0.17 0.00

a Identical to previously described 1A, 1B, 1C alleles of PSF 1 (Colonna et al., 1992), b TAP 1 alleles could be assigned in individuals heterozygous at not more than one locus (91% in MS group, 82% in control group).

c. Vandevyveret al. /Journal of Neuroimmunology 54 (1994) 35-40 2 D - F ) . T h e alleles 2D a n d 2 F were p r e s e n t at very low frequency, while the T A P 2E allele was the second most f r e q u e n t c o m b i n a t i o n . T h e d i s t r i b u t i o n of these T A P 2 alleles was n o t significantly different b e t w e e n MS p a t i e n t s a n d controls, also n o t after stratification for DR2. Moreover, p a r t i c u l a r T A P 1 a n d T A P 2 alleles were n o t different in D R 2 vs. n o n - D R 2 MS p a t i e n t s a n d in D R 2 vs. n o n - D R 2 controls (data n o t shown). O u r data are in good a g r e e m e n t with the observations of Liblau a n d co-workers (1993) for R R MS, suggesting that there is n o i m m u n o g e n e t i c h e t e r o g e n e i t y b e t w e e n these two clinical forms.

3.3. Haplotypes o f TAP 1 and TAP 2 T h e p o l y m o r p h i c m a r k e r s within T A P 1 a n d T A P 2 were used to study the linkage d i s e q u i l i b r i u m b e t w e e n these two loci. H a p l o t y p e s were d e f i n e d in individuals who w h e r e homozygous for at least o n e locus. T a b l e 5 shows the observed a n d expected - as calculated by m u l t i p l i c a t i o n of the allelic f r e q u e n c i e s - haplotype frequencies. T h e f r e q u e n c y d i s t r i b u t i o n is not significantly different in the MS a n d control group. Since n o differences b e t w e e n the observed a n d expected haplotype f r e q u e n c i e s were detected, the T A P 1 a n d T A P 2 polymorphic loci are in linkage equilibrium. I n conclusion, n o positive or negative associations b e t w e e n T A P alleles or haplotypes a n d CP MS were observed. O u r data do n o t s u p p o r t a role for these g e n e s in the susceptibility for MS. However, as we only

Table 4 The distribution of the TAP 2 alleles in MS and control group Alleles b 2A: V/T/Stop a 2B: V / A / Q a 2C: I/T/Stop a 2D: I/A/Stop 2E: V/A/Stop 2F: V / T / Q Total number

2A: V/T/Stop 2B: V / A / Q 2C: I/T/Stop 2D: I/A/Stop 2E: V/A/Stop 2F: V / T / Q Total number

Observed

Frequencies

MS

Controls

MS

Controls

31 6 l 0 23 7

28 2 4 2 22 0

0.46 0.09 0.01 0.00 0.34 0.10

0.48 0.03 0.07 0.03 0.38 0.00

68

58

DR2+MS

DR2+ Controls

DR2+MS

DR2+ Controls

0.45 0.09 0.02 0.00 0.34 0.09

0.50 0.10 0,00 0.10 0.30 0.00

20 4 1 0 15 4

5 1 0 1 3 0

44

10

a Identical to previously described 2A, 2B, 2C alleles for PSF 2 (Colonna et al., 1992). b TAP 2 alleles could be assigned in individuals heterozygous at not more than one locus (50% in MS group, 47% in control group).

39

Table 5 TAP 1 and TAP 2 haplotype percentages observed and expected in MS patients and controls Haplotypes

MS patients

Controls

Observed Expected Observed Expected (n = 22) (n = 17) TAP1A/TAP2A TAP1A/TAP2B TAP1A/TAP2C TAP1A/TAP2D TAP1A/TAP2E TAP1A/TAP2F

45.45 2.27 2.27 0 36.36 2.27

34.5 6.75 <1 0 25.5 7.5

41.18 2.08 2.08 2.08 32.35 0

39.36 2.46 5.74 2.46 31.16 0

TAP1B/TAP2A TAP1B/TAP2B TAP1B/TAP2C TAP1B/TAP2D TAP1B/TAP2E TAP1B/TAP2F

2.27 0 0 0 0 2.27

1.84 <1 <1 0 1.36 <1

2.08 0 0 0 2.08 0

1.44 <1 <1 <1 1.14 0

TAP1C/TAP2A TAP1C/TAP2B TAP1C/TAP2C TAP1C/TAP2D TAP1C/TAP2E TAP1C/TAP2F

6.82 0 0 0 0 0

7.82 1.53 <1 0 5.78 1.7

5.88 0 0 0 5.88 0

6.24 <1 <1 <1 4.94 0

TAP1D/TAP2A TAP1D/TAP2B TAP1D/TAP2C TAP1D/TAP2D TAP1D/TAP2E TAP1D/TAP2F

0 0 0 0 0 0

1.38 <1 <1 0 1.02
0 0 0 0 0 0

<1 <1 <1 <1 <1 <1

Expected haplotype frequencies were determined by multiplication of the observed frequencies for each individual allele shown in Tables 4 and 5. Observed frequencies were derived from persons homozygous for TAP 1 and/or TAP 2, analyzed the k n o w n variations within T A P 1 a n d T A P 2, it is still possible that a rare p o l y m o r p h i s m might exist at a high f r e q u e n c y in MS.

Acknowledgements This work was s u p p o r t e d by the "Sociale Investeringsmaatschappij L i m b u r g " (SIM), the " N a t i o n a l e Loterij", and " I n t e r U n i v e r s i t a i r e Attractie Polen" ( I U A P ) . This text p r e s e n t s research results of the Belgian p r o g r a m o n I n t e r u n i v e r s i t y Poles of A t t r a c t i o n initiated by the Belgian State, P r i m e M i n i s t e r ' s Office, Science Policy P r o g r a m m i n g . T h e a u t h o r s wish to t h a n k Ms. L i n d a P h i l i p p a e r t s a n d Ms. Sigrid V a n Roy for technical assistance. T h e scientific responsibility is ass u m e d by the authors.

References Armitage, P. (1980) Statistical inference. In: Statistical Methods in Medical Research. Blackwell Scientific Publications, London, pp. 99-146.

40

C. Vandet,yl,er et al. /Journal of Neuroirnmunology 54 (1994) 35-40

Bahram, S., Arnold, D., Bresnahan, M., Strominger, J.L. and Spies, T. (1991) Two putative subunits of a peptide pump encoded in the human major histocompatibility complex class II region. Proc. Natl. Acad. Sci. USA 88, 10094-10098. Bjorkman, P.J. and Davis, M. (1988) T cell antigen receptor genes and T cell recognition. Nature 334, 395-401. Bodmer, J.G., Marsh, S.G.E., Albert, E.D., Bodmer, W., Dupont, B., Erlich, H.A. and Mach, B, (1992) Nomenclature for factors of the H L A system, 1991. Human Immunol, 34, 4-18. Caillat-Zucman, S., Bertin, E., Timsit, J., Boitard, C., Asson, R. and Bach, J.F. (1992) TAP 1 and TAP 2 transporter genes and predisposition to insulin dependent diabetes mellitus. Crit. Rev. Acad. Sci. III 315(13), 535-539. Colonna, M., Bresnahan, M., Bahram, S., Strominger, J.L. and Spies, T. (1992) Allelic variants of the human putative peptide transporter involved in antigen processing. Proc. Natl, Acad. Sci. USA 89, 3932-3936. Cook, S.D. and Dowling, P.C. (1980) Multiple Sclerosis and viruses: an overview. Neurology 30, 80-91. Dunn, O.J. (1958) Estimation of the means of dependent variables. Ann. Math. Stat. 29, 1095-1111. Dunn, O.J. (1961) Multiple comparisons among means. Am. J. Stat. Assoc. 56, 52-64. Ebers, G.C., Bulman, D.E., Sadovnick, A.D., Paty, D.W., Warren, S., Hader, W., Murray, J., Seland, P., Duquette, P., Grey, T., Nelson, R. and Nicolle, M. (1986) A population-based study of Multiple Sclerosis in twins. New Engl. J. Med. 315, 1638-1642, Fairchild, P.J. and Wraith, D.C. (1992) Peptide-MHC interaction in autoimmunity. Curr. Opin. Immunol. 4, 748-753. Francis, D,A., Thompson, A.J., Brookes, P., Davey, M., Lechter, R.I., McDonald, W.I. and Batchelor, J.R. (1991) Multiple Sclerosis and HLA: Is the susceptibility gene really HLA-DR or -DQ? Human Immunol. 32, 119-124. Jackson, D.G. and Capra, J.D. (1993) TAP-1 alleles in IDDM: a new centromeric boundary o[ disease susceptibility. Biotec 3, 91 (abstract). Jacobsen, S., Sekaly, R.P., Jacobsen, C.L., McFarland, H.F. and Loy, E.D. (1989) HLA class II-restricted presentation of cytoplasmic measles virus antigen to cytotoxic T cells. J. Virol. 63, 1756-1763. Jin, Y., Shih, J.W.K. and Berkower, I. (1988) Human T cell response to the surface antigen of Hepatitis B Virus (HBsAg). Endosomal and nonendosomal processing pathways are accessible to both endogenous and exogenous antigen. J. Exp. Med. 168, 293-296. Kurtzke, J.F. (1980) Epidemiologic contributions to Multiple Sclerosis: an overview. Neurology 30, 61-79. Liblau, R., Van Endert, P.M., Sandberg-Wollheim, M., Patel, S.D., Lopez, M.T., Land, S., Fugger, L. and McDevitt, H.O. (1993) Antigen processing gene polymorphisms in HLA-DR2 multiple sclerosis. Neurology 43, 1192-1197. McFarlin, D.E. and McFarland, H.F. (1982) Multiple Sclerosis. New Engl. J. Med. 30, 1183-1186. McFarland, H.F., Greenstein, J., McFarlin, D.E., Eldridge, R., Xu, X.-H. and Krebs, H. (1984) Family and twin studies in Multiple Sclerosis. Ann. N.Y. Acad. Sci. 436, 118-124. Mellins, E.D. (1992) The role of the MHC in autoimmunity: an overview. J. Rheumat. 19, 63-69. Mellins, E., Kempin, S., Smith, L., Monji, T. and Pious, D. (1991) A gene required for class II-restricted antigen presentation maps to

the major histocompatibility complex. J. Exp. Med. 174, 16071615. Miller, S.A,, Dykes, D,D. and Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acid Res. 16, 1215. Oger, J.J.F. and Sadovnick, A.D. (1991) Immunogenetics of Multiple Sclerosis. In: R.F. Nadir (Ed.), The lmmunogenetics of Autoimmune Diseases. CRC Press, Boston, MA, pp. 239. Olerup, O. and Hillert, J. (1991) HLA class II-associated genetic susceptibility in Multiple Sclerosis: a critical evaluation. Tissue Ant. 38, 1-15. Parham, P. (1992) Flying the first class flag. Nature 357, 193-194. Poser, C.M., Paty, D.W. and Scheinberg, L. (1983) New diagnostic criteria for Multiple Sclerosis: guidelines for research protocols. Ann. Neurol. 13, 227-231. Powis, S.J., Deverson, E.V., Coadwell, W.J., Ciruela, A., Huskisson, N.S., Smith, H., Butcher, G.W. and Howard, J.C. (1992) Effect of polymophism of an MHC-linked transporter on the peptides assembled in a class I molecule. Nature 357, 211-215. Powis, S.H., Mockridge, I., Kelly, A., Kerr, L.A., Glynne, R., Gileadi, U., Beck, S. and Trowsdale, J. (1992) Polymorphism in a second ABC transporter gene located within the class II region of the human major histocompatibility complex. Proc. Natl. Acad. Sci. USA 89, 1463-1467. Powis, S.H., Rosenber, W.M.C., Hall, M., Mockridge, I., Tonks, S., Ivinson, A., Ciclitira, P.J., Jewell, D.P., Lanchbury, J.S., Bell, J.l. and Trowsdale, J. (1993) TAP 1 and TAP 2 polymorphism in coeliac disease. Immunogenetics 38, 345-350. Ronningen, K.S., Undlien, D.E., Ploski, R., Maouni, N., Konrad, R.J., Jensen, E., Hornes, E., Reijonen, H., Colonna, M., Monos, D.S., Strominger, J.L. and Thorsby, E. (1993) Linkage disequilibrium between TAP 2 variants and HLA class II alleles: no primary association between TAP 2 variants and insulin-dependent diabetes mellitus. J. lmmunol. 23, 1050-1056. Sadovnick, A.D., Armstrong, H., Rice, G.P.A., Bulman, D., Hashimoto, L., Paty, D.W. and Hashimoto, S.A. (1993) A population-based study of multiple sclerosis in twins: Update. Ann. Neurol. 33, 281-285. Spiegel, M.R. (1972) Theory and problems of statistics. McGraw-Hill International Book Company, New York, NY, p. 201. Spielman, R.S. and Nathanson, N. (1982) The genetics of susceptibility to Multiple Sclerosis. Epidemiol. Rev. 4, 45-65. Spies, T., Bresnahan, M., Bahram, S., Arnold, D., Blanck, G., Mellins, E., Pious, D. and DeMars, R. (1990) A gene in the human major histocompatibility complex class II region controlling the class I antigen presentation pathway. Nature 348, 744-747. Spies, T. and DeMars, R. (1991) Restored expression of major histocompatibility class I molecules by gene transfer of a putative peptide transporter. Nature 351,323-324. Trowsdale, J., Hanson, I., Mockridge, I., Beck, S., Townsend, A. and Kelly, A. (1990) Sequences encoded in the class II region of the MHC related to the 'ABC' superfamily of transporters. Nature 348, 741-743. Uanue, E.R. (1992) Cellular studies on antigen presentation by class II MHC molecules. Curr. Opin. Immunol 4, 63-69. Ziegler, A., Field, L.L. and Sakaguchi, A.Y. (1991) Report of the comminttee on the genetic constitution of chromosome 6. Cytogenet. Cell Genet. 58, 295-336.