Target-site mechanism of ACCase-inhibitors resistance in American sloughgrass (Beckmannia syzigachne Steud.) from China

Pesticide Biochemistry and Physiology 110 (2014) 57–62

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest

Target-site mechanism of ACCase-inhibitors resistance in American sloughgrass (Beckmannia syzigachne Steud.) from China Lingxu Li a,b, Long Du a, Weitang Liu a, Guohui Yuan a, Jinxin Wang a,⇑ a b

Key Laboratory of Pesticide Toxicology and Application Technique, College of Plant Protection, Shandong Agricultural University, Tai’an 271018, Shandong, PR China College of Chemistry and Pharmaceutical Science, Qingdao Agricultural University, Qingdao 266109, Shandong, PR China

a r t i c l e

i n f o

Article history: Received 16 November 2013 Accepted 5 March 2014 Available online 14 March 2014 Keywords: Beckmannia syzigachne Fenoxaprop-p-ethyl Resistance Mutation dCAPS

a b s t r a c t American sloughgrass (Beckmannia syzigachne) is a troublesome weed in winter wheat field rotated with rice in China. Fenoxaprop-p-ethyl and pinoxaden were observed failing to control American sloughgrass in the same filed in Lujiang county in 2011 and 2012, respectively. Whole-plant bioassay was conducted to determine the resistance to fenoxaprop-p-ethyl, pinoxaden and other herbicides in American sloughgrass. Dose–response experiment indicated that Lujiang population was highly resistant to fenoxaprop-p-ethyl (199.8-fold), pinoxaden (76.2-fold), clodinafop-propargyl (334.1-fold) and sethoxydim (15.9-fold); moderately resistant to clethodim (6.3-fold), susceptible to mesosulfuron-methyl, flucarbazone-sodium, pyroxsulam and isoproturon. Partial gene of CT domain was cloned and sequenced to confirm the molecular mechanism of resistance to ACCase-inhibiting herbicides. A Trp2027Cys mutation was found in Lujiang population according to the sequencing result. This mutation is the molecular mechanism of resistance to fenoxaprop-p-ethyl in Lujiang population. Furthermore the Trp2027Cys mutation very likely results in cross resistance to clodinafop-propargyl and pinoxaden in Lujiang population. 103 mutant homozygotes were detected from the 108 plants tested using a rapid dCAPS method developed in this paper. This is the first report of pinoxaden resistance and a mutation at position of 2027 for American sloughgrass. Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction Acetyl-coenzyme A carboxylase (ACCase, EC 6.4.1.2), a key enzyme in the regulation of fatty acid biosynthesis [1], is a biotin-dependent carboxylase catalyzing the first step of fatty acid biosynthesis in eukaryotes and prokaryotes [2]. In plants two forms of ACCase have been identified, with one located in the plastid and the other the cytosol [3,4]. Plastid ACCase catalyzes de novo fatty acid synthesis while cytosolic ACCase is responsible for the synthesis of long chain fatty acid and secondary metabolites such as flavonoids and suberins [5]. The cytosolic ACCase in all plants studied so far are homomeric, as it is in eukaryotes, containing the biotin carboxylase (BC) domain, the biotin carboxyl carrier protein (BCCP) domain, and the carboxyltransferase (CT) domain in a single polypeptide. Plastid ACCase, found in most plants, is a heterodimeric enzyme that carries the three domains in four subunits encoded by nuclear gene and chloroplastic gene. Plants of the Poaceae family and Geraniaceae are distinctive, as the plastid isoform of their ACCase is homomeric [4]. ACCase-inhibiting herbicides block fatty acid biosynthesis and cause death by inhibiting ⇑ Corresponding author. Fax: +86 538 8241114. E-mail address: [email protected] (J. Wang). http://dx.doi.org/10.1016/j.pestbp.2014.03.001 0048-3575/Ó 2014 Elsevier Inc. All rights reserved.

the catalyzing activity of the plastid ACCase in grass weeds. While the heterodimeric ACCase in broadleaved weed is insensitive to these herbicides [6]. ACCase-inhibiting herbicides consist of three dissimilar classes of herbicides, aryloxyphenoxypropionates (APPs), cyclohexanediones (CHDs) and phenylpyraxoline (DENs). CT domain of plastid ACCase in grass weed is the target of these herbicides [7–10]. ACCase inhibitors are used widely to control gramineous weeds in wheat fields. But continuous application of ACCase-inhibiting herbicides has resulted in resistance in grass weeds. Enhanced metabolism and insensitive enzyme are thought to be the main two mechanisms resulting in herbicide resistance [11]. Metabolic resistance, which is controlled by polygenes, is mainly due to detoxifying enzymes, such as gluthathione-S-transferases and cytochrome P450s. The increased detoxication sometimes leads to broad resistance to herbicides which are completely different in mode of action [12]. While insensitive enzyme, also called target site resistance (TSR) usually occurs by a single point mutation conferring amino acid change in a target enzyme that prevents herbicide binding [13]. TSR often causes different cross-resistance to herbicides possessing the same mode of action [14]. To date, seven ACCase codon positions in the CT domain of ACCase are documented to endow ACCase-inhibiting herbicide resistance in grass

58

L. Li et al. / Pesticide Biochemistry and Physiology 110 (2014) 57–62

weed: Ile1781 to Leu or Val or Thr [15–21], Trp1999 to Cys or Ser [5,22], Trp2027 to Cys [23–27], Ile2041 to Asn or Val [22,28–30], Asn2078 to Gly [13,22,23,25,31], Cys2088 to Arg [24,32,33], and Gly2096 to Ala or Ser [23,26,34]. American sloughgrass (Beckmannia syzigachne) is a diploid and annual grass weed. American sloughgrass occurs all over China and is also a native weed in north United States and south Canada. In China, American sloughgrass used to be a sporadic species before 1990s, even in the middle and lower reaches of the Yangtze River. The germination of American sloughgrass is strongly related to the buried depth of the seeds. More than seventy percent can germinate when buried at the depth of no more than 3 cm, whereas only less than twenty percent can germinate when buried at the depth of more than 3 cm [35]. Reduced- and no-tillage practices have massively expanded in the rice–wheat rotation area in the late of 1980s, which resulted in a rapid increase of the seed bank contained in the upper soil layer. After more than 20 years succession, American sloughgrass has become one of the most predominant and troublesome weeds in the wheat fields rotated with rice (Oryza sativa L.), especially in the middle and lower reaches of the Yangtze River, one of the main grain-producing areas in China [20,35]. For a long time the ACCase-inhibitors have been the main postemergence herbicides available in China to selectively control grass weeds. Fenoxaprop-p-ethyl, one of the typical APPs, has been continuously used for about 10 years in the middle and lower reaches of the Yangtze River. While pinoxaden, the latest member of ACCase-inhibiting herbicides and the sole member of DENs, was marketed in China in 2010. Thanks to its high effect in controlling a wide range of grass species and some ability to control APPs-resistant populations, pinoxaden is becoming a popular herbicide in China. Fenoxaprop-p-ethyl failed in controlling American sloughgrass in 2011 in some wheat fields in Lujiang county, Anhui province. Then pinoxaden was also observed failing to control these weeds in 2012. So, this research aimed to (a) investigate the fenoxaprop-p-ethyl and pinoxaden susceptibility of American sloughgrass population collected in Lujiang county where inadequate control was observed; (b) characterize herbicide sensitivity of the resistant population to various herbicides with different modes of action; (c) reveal the molecular mechanisms responsible for the resistance to fenoxaprop-p-ethyl and pinoxaden in American sloughgrass; and (d) develop a dCAPS marker to quickly detect a mutation at position 2027, which preliminary sequencing showed to be involved in a large number of plants. 2. Materials and methods

sethoxydim (12.5% EC, Soda, Tianjin, China), mesosulfuron-methyl (30 g/L OF, Bayer), flucarbazone-sodium (70% WDG, Arysta LifeScience, Shanghai, China), pyroxsulam (7.5% WDG, Dow AgroSciences); isoproturon (50% WP, Bianjing, Suzhou, China). 2.3. Herbicide sensitivity bioassays The experiments were conducted from October 2012 to May 2013. Herbicide sensitivity assessment procedure was the same for all samples. Seeds were germinated and sowed as described before [20]. Seedlings transferred to greenhouse (temperature maintained at approximately 15–25 °C, 75% humidity, and natural sunlight) were thinned to five evenly sized plants per pot, and watered as needed. Herbicide treatments were applied to American sloughgrass plants at three to four-leaf stage using a compressed air, moving nozzle cabinet sprayer equipped with one Teejet 9503EVS flat fan nozzle and calibrated to deliver 450 L ha1 at 0.28 MPa. The doses of different herbicides sprayed to American sloughgrass were as in Table 1. All plants were returned to green house after herbicide treatments. The plants were cut at the soil surface and the fresh weight was recorded at 21 days after treatment (DAT). All treatments were replicated three times and the experiment was conducted twice. Analysis of all dose–response data were performed using the probit model (Eq. (1)) of SPSS software (Version 20.0, SPSSInc.), then GR50 values were computed:

y ¼ b þ kx

ð1Þ

where y is probit, b is intercept, k is the regression coefficient and x is log 10 (dose). GR50 is the herbicide rate required for 50% growth reduction relative to the nontreated control. Resistance index (RI) was calculated as the GR50 of the resistant population divided by the GR50 of the susceptible population to indicate the level of resistance for the resistant population. Differences between the data of the two runs of the experiment for each herbicide were not detected, so the data were pooled. ANOVA was performed on all data using SPSS software. 2.4. DNA extraction, PCR and sequencing Seeds were germinated as described above and then sowed into plastic pots to keep only one seedling in every pot. Pots were Table 1 Herbicide treatments applied for dose–response tests. Herbicides

Dosage

2.1. Plant material

Lujiang population

In June 2012 seeds of putative resistant population were collected from winter wheat fields rotated with rice in Lujiang county, Anhui province of China, where fenoxaprop-p-ethyl and pinoxaden failed to control American sloughgrass in succession since 2011. Fenoxaprop-p-ethyl had been applied to control grass weeds for more than 8 years before pinoxaden was used. Seeds of the susceptible population were collected from the riverside of Yellow River in Dongming county, Shandong province. Seeds were collected randomly and bulked, then air dried and stored in paper bags at 4 °C until used.

g a.i. ha1

2.2. Herbicides and chemicals The herbicides used for dose–response tests were: fenoxapropp-ethyl (69 g/L EW, Bayer, Hangzhou, China), pinoxaden (5% EC, Syngenta), clodinafop-propargyl (15% WP, Syngenta, Shanghai, China), clethodim (240 g/L EC, Arysta LifeScience, Shanghai, China),

a

Fenoxaprop-pethyl

165.6, 496.8, 1490.4, 4471.2, 13413.6, 40240.8

Pinoxaden

6.67, 20, 60, 180, 540, 1620

Clodinafoppropargyl

180, 540, 1620, 4860, 14580, 43740

Clethodim

10, 30, 90, 270, 810, 2430

Sethoxydim

20.83, 62.5, 187.5, 562.5, 1687.5

Mesosulfuronmethyl Flucarbazonesodium Pyroxsulam

1.75, 5.25, 15.75, 47.25, 141, 75 1.17, 3.5, 10.5, 31.5, 94.5

Isoproturon

65.63, 131.25, 262.5, 525, 1050

1, 5, 3, 6, 12, 24, 48

Dongming population

3.88, 7.76, 15.53, 31.05, 62.1a, 124.2 1.88, 3.75, 7.5, 15, 30, 60 2.11, 4.22, 8.44, 16.88, 33.75, 67.5 5.63, 11.25, 22.5, 45, 90, 180 11.72, 23.44, 46.88, 93.75, 187.5, 375 1.97, 3.94, 7.88, 15.75, 31.5 0.99, 1.97, 3.94, 7.88, 15.75 1.5, 3, 6, 12, 24 32.81, 65.62, 131.25, 262.5, 525

The recommend field rate for each herbicide was underlined.

59

L. Li et al. / Pesticide Biochemistry and Physiology 110 (2014) 57–62

placed in the same greenhouse and watered as needed. Fifty milligrams of shoot tissue from individual plants were frozen in liquid nitrogen and then ground with a cooled mortar and pestle. Total DNA was extracted using the CTAB (cetyltrimethylammonium bromide) method [36]. The PCR procedure for generating and sequencing the ACCase gene fragment encompassing the carboxyl transferase domain was the same as described in Li et al. [20]. Ten individual plants from every population were used for ACCase gene amplification and four clones for each biological replicate were sent for sequencing. The sequence data of resistant and susceptible American sloughgrass populations were compared to determine whether there was a nucleotide substitution associated with resistance. Sequence data for each American sloughgrass population and Alopecurus myosuroides (Gene Bank accession AJ310767) were aligned and compared using DNAMAN version 5.2.2 software (Lynnon Biosoft, Quebec, Canada). 2.5. dCAPS (derived amplified polymorphic sequence for genotyping) A dCAPS marker was developed in this research for the large scale genotyping of the 108 individuals. According to the sequencing results, the wild and mutant amino acid residues at ACCase position 2027 were coded by the triplets TGG (Trp) and TGC (Cys), respectively. A 35 bp forward primer F-2027 was designed (Table 2) using the free dCAPS Finder 2.0 software [37]. An adenine was enforced at the second base of codon 2027 by the F-2027 primer to create a restriction site CTAG for the restriction endonuclease Mae I. The assay consisted of a single PCR fragment and the Mae I restriction enzyme detecting the wild type 2027Trp allele. The third base of codon 2026 and the first base of codon 2027 were also included in the Mae I restriction site. Any change in the third base of codon 2027 would disrupt the Mae I restriction site and result in an undigested band on the agarose gel. For each plant used in dCAPS assay, 4 cm leaf was ground in liquid nitrogen and total DNA was extracted as described in 2.4 when the plants were at three-leaved stage. PCRs were carried out in a total volume of 25 lL containing 1 lL of genomic DNA (about 30 ng), 1 lL of each primer (10 lM), 2.5 lL of 10 Trans Taq Hifi Buffer (Mg2+ Plus, TransGen Biotech, China), 2 lL of dNTP Mixture (2.5 mM, TransGen Biotech, China), 0.5 lL of Trans Taq DNA Hifi polymerase High Fidelity (2.5 units) and 17 lL of ddH2O. PCR were performed on a BioRad™ T100 Thermal Cycler programmed for an initial denaturation step of 94 °C for 3 min followed by 38 cycles of 30 s at 94 °C, 30 s at 56 °C and 20 s at 72 °C. A final extension for 5 min at 72 °C was also included. Two microliter of quantified PCR production was then digested with 1 lL (5 units) of Mae I at 37 °C for 1 h in a 20 lL reaction system. Ten microliter of the PCR product treated with Mae I was then analysed on a 3% agarose gel in 1 TAE buffer. To test the accuracy of the dCAPS method developed in this paper, ten individual plants were selected randomly and sequenced.

plants survived fenoxaprop-p-ethyl when treated at the dose of 4471.2 g a.i. ha1, the same result was also observed when sprayed with pinoxaden at 540 g a.i. ha1. While Dongming population was severely injured by either fenoxaprop-p-ethyl or pinoxaden at the recommend rate. The RI of resistant population was as high as 199.8 and 76.2 to fenoxaprop-p-ethyla and pinoxaden respectivly compared to the susceptible population (Table 3), which means Lujiang population have evolved high level of resistance to fenoxaprop-p-ethyl and pinoxaden, even if pinoxaden was only used one time in these fields. Lujiang population responded differently to other ACCaseinhibitors (Table 3). Lujiang population showed very high resistance to clodinafop-propargyl, with the RI as high as 334.1. High resistance to sethoxydim (RI = 15.9) was also observed in Lujiang population. While Lujiang population only showed a moderate resistance to clethodim, with a RI of 6.3. Fortunately, Lujiang population showed no multiple-resistance to ALS inhibitors and photosystem II inhibitors. Flucarbazone-sodium and isoproturon showed high efficiency in the whole-plant experiment and no plants survived at the recommend dose (data was not shown). 3.2. Sequence and mutation Lujiang population was so resistant to fenoxaprop-p-ethyl and pinoxaden that it seemed that target site mutation was highly likely related to the ACCase-inhibitor resistance. A 1437 bp fragment encompassing the CT region within the ACCase gene was amplified to compare the sequence. The CT domain sequencing of Lujiang population revealed four different amino-acid substitutions between the resistant and the susceptible population in the ACCase gene: Phe1735Tyr, Ala1892Gly, Phe2089Tyr and Trp2027Cys. The Phe1735Tyr, Ala1892Gly, Phe2089Tyr were also found in the herbicide susceptible populations of weeds such as A. myosuroides (AJ310767), A. japonicus (AQ068820), Lolium rigidum (AY995232), Phalaris paradoxa (AM745339) and Avena fatua (AF231335), so these mutations are unlikely to confer the resistance. While Trp2027Cys mutation caused by a nucleotide change of TGG to TGC (Fig. 1) has been reported in the ACCase inhibitor resistant A. myosuroides [23,25], A. sterilis [22], A. fatua [26] and A. japonicus [27]. This result suggested that the mutation Trp2027Cys in the target enzyme was the molecular mechanism endowing fenoxapropp-ethyl-resistance and very likely the molecular mechanism endowing pinoxaden-resistance in Lujiang population. To our knowledge, this is the first report of a mutation at position of 2027 for American sloughgrass.

Table 3 Sensitivity of resistant and susceptible populations to herbicides. Herbicide

Lujiang population

3. Results

Dongming population

g a.i. ha1

3.1. Herbicide sensitivity bioassays In the dose–response experiment, Lujiang population showed high resistance to both fenoxaprop-p-ethyl and pinoxaden. All

Table 2 Primers used in 2027 dCAPS. Primers

Sequence (50 –30 )

Amplicon size

F-2027

CGTGAAGGATTACCTCTGTTCATCCTTGCTAACTA GGTAGGCTTGATCCAGAATT

328 bp

R-2027

RIb

GR50a

Fenoxaprop-p-ethyl Pinoxaden Clodinafop-propargyl Clethodim Sethoxydim Mesosulfuron-methyl Flucarbazone-sodium Pyroxsulam Isoproturon

4214.00 ± 232.06 210.30 ± 18.89 798.61 ± 74.70 155.00 ± 26.55 303.21 ± 25.57 6.92 ± 0.26 6.87 ± 0.56 12.45 ± 2.19 156.37 ± 13.11

21.09 ± 2.26 2.76 ± 0.27 2.39 ± 0.41 24.49 ± 3.78 19.05 ± 2.17 5.21 ± 0.27 8.38 ± 1.06 7.05 ± 0.95 222.60 ± 15.39

199.8 76.2 334.1 6.3 15.9 1.3 0.8 1.8 0.7

a GR50 refers to the herbicide ratio required to decrease plant fresh weight by 50% compared to the untreated control. Each value represents the mean ± standard error. b RI refers to resistance index and was calculated by dividing GR50 value of the resistant population by that of the susceptible population.

60

L. Li et al. / Pesticide Biochemistry and Physiology 110 (2014) 57–62

Fig. 1. Alignment of partial amino acid sequences of plastidic ACCases from various weed species. The box indicates the substitution.

3.3. dCAPS The dCAPS has led to a quick identification of the allelic variant at position 2027. Upon ristriction with Mae I, the wild type had a 295 bp digested band and mutant homozygote type had a 328 bp undigested band, while heterozygous plants had a copy of each band. The gene type analysis indicated that in the all plants tested, 103 plants were identified as homozygous Cys2027Cys mutation, one plant was heterozygous Trp2027Cys mutation, and four plants were wild type (Fig. 2).

the Trp2027Cys mutation and be sprayed with APPs for years as same as Lujiang population. Compared with the insensitive target site enzyme, NTSR was more prevalent in grass weed species [12,14,21,25]. Fenoxaprop could be detoxified by GSTs [14,39,40] or by P450s [12]. NTSR to pinoxaden also exist in grass weeds such as A. myosuroides [21,25] and A. fatua [26]. Here, we couldn’t exclude enhanced metabolism or other resistant mechanisms contributing to pinoxaden-resistance in Lujiang population. 4.3. Cross resistance to CHDs

4. Discussion 4.1. Trp2027Cys mutation and APPs-resistance In the whole plant experiment, Lujiang population showed high lelvel rensistance to ACCase inhibiting herbicides such as fenoxaprop-p-ethyl, clodinafop-propargyl and pinoxaden. The wellknown Trp2027Cys mutation was detected by comparing the gene sequnce of ACCase from the resistant and susceptible populations. The Trp2027Cys mutation, firstly reported in A. myosuroides, has been proved to endow APPs-resistantce in plants, the purified ACCase and the yeast gene-replacement strains [22,23,38], even more than 100 fold resistance to fenoxaprop-p-ethyl and clodinafoppropargyl [38]. So it is not surprising that Lujiang population is highly resistant to fenoxaprop-p-ethyl and clodinafop-propargyl. 4.2. Cross resistance to pinoxaden Pinoxaden, a newly marketed ACCase-inhibiting herbicide in China, failed to control Lujiang population in this research even if pinoxaden was only sprayed one time in fields. The Trp2027Cys mutation has been proved to confer medium resistance to pinoxaden (RI = 11 ± 2) in the yeast gene-replacement strains [38]. So the Trp2027Cys mutation is very likely one of the mechnisms endowing the pinoxaden-resistance in Lujiang population. An application history as short as 1 year is not enough to evolve resistance. The resistance to pinoxaden in Lujang population is very likely selected by fenxaprop-p-ethyl which has been repeated applied in the past several years in Anhui province. Similar results were also observed in A. fatua [26] and A. japonicus [27], even in A. myosuroides never exposed to pinoxaden [25]. These weed populations all contained

In the crystal structure of the CT domain of yeast ACCase in complex with haloxyfop, Trp2027Cys is located near the first aryl ring of haloxyfop, a unique feature of APPs [8,10]. So the Trp2027Cys mutation is thought to confer resistance to the APPs while having only small effects on the CHDs. This conclusion is also supported by the bioassay conducted in greenhouse or fields [23,26,27]. In another research, the Trp2027Cys mutation was detected in L. rigidum plants that survived clethodim treatment at 60 g a.i. ha1, though only a few plants contained this mutation [24]. In addition, yeast gene-replacement strains containing Trp2027Cys mutation also showed partial sethoxydim resistance [22,38]. American sloughgrass containing the Trp2027Cys mutation was observed to be highly resistant to sethoxydim and moderately resistant to clethodim in this paper (Table 3). Even so, it is still difficult to determine that Trp2027Cys mutation can endow CHDs resistance in American sloughgrass for the NTSR couldn’t be excluded in this research even metabolism-based CHDs-resistance was rarely reported. Grass weed is less selected by CHDs because these herbicides are mainly used in broad-leaf crop fields. For this reason, fewer mutations can confer CHDs-resistance, for an example, only two mutations (2078 and 2088) confer resistance to clethodim [14]. In addition, CHDs are slowly metabolized herbicides in plants [41,42]. Though tralkoxydim can be detoxified more rapidly in herbicide-resistant A. myosuroides [43], L. rigidum [44], and L. multiflorum [45]. Metabolism-based resistance to sethoxydim and clethodim was never demonstrated. So CHDs, especially clethodim, were very important selection to control APPs-resistant grass weeds in the wheat fields rotated with broad-leaf crop. Obviously, clethodim-resistant grass weeds will be a great trouble. To data, we have known little about the NTSR mechanisms of CHDs. More work is needed to explore the mechanism of resistance to CHDs in American sloughgrass. 4.4. Accuracy of the dCAPS method

Fig. 2. dCAPS of Trp2027Cys. M means DNA marker, lane1 means CW2027, lane 2–5 mean WW2027, lane 6–8 mean CC 2027.

A dCAPS method could be applied to detect the Trp2027Cys mutation rapidly. The method was based on the change of the third base in codon 2027. TGG codes for the wild type Trp. Either TGC or TGT codes for Cys, a mutant type. While TGA is a termination codon. So any change of third base in codon 2027 will result in the Trp to Cys substitution in plants. Mae I was selected to positively detect the wild type 2027Trp allele, which was more reliable than to positively detect the mutant type. Trp2027Cys mutation could

L. Li et al. / Pesticide Biochemistry and Physiology 110 (2014) 57–62

also result from the change of codon TGG to TGT [23]. But the change of TGG to TGT was never found in the 21 population we have sequenced (show in Supplement data), which were collected from 11 counties of three provinces. Except the three bases of codon 2027, the third base of codon 2026 were also included in the Mae I restriction site. This base is very conservative not only in American sloughgrass but also in other gramineous weeds such as A. myosuroides (AJ310767), A. japonicus (AQ068820), L. rigidum (AY995232), L. multiflorum (AY710293), A. fatua (AF231335), Setaria viridis (AJ966464), P. paradoxa (AM745339) and P. minor (AY196481). To test the accuracy of the dCAPS method, ten individuals from the 108 plants analyzed by dCAPS were selected randomly and sequenced. The sequencing results were completely consistent with the dCAPS method. Therefore, the dCAPS method developed in this paper is a rapid and accurate method to detect the Trp2027Cys mutation in American sloughgrass. American sloughgrass collected from Lujiang county of Anhui province has evolved high resistance to fenoxaprop-p-ethyl and cross resistance to pinoxaden and clodinafop-propargyl. Molecular analysis showed that the Trp2027Cys mutation was the molecular basis for the fenoxaprop-p-ethyl resistance and this mutation very likely resulted in the cross resistance to pinoxaden and clodinafoppropaygyl. Lujiang population also showed some resistance to CHDs, but more data was needed to determine it. A rapid and accurate dCAPS method was developed to detect the Trp2027Cys mutation and gene type. As far as we know, this is the first report of resistance to pinoxaden in American sloughgrass and a target site mutation at position of 2027 that correlated to resistance to fenoxaprop-p-ethyl and pinoxaden. Acknowledgements This work was financial supported by the Special Fund for Agroscientific Research in the Public Interest of China (No. 201303031) and National Natural Science Foundation of China (No. 31301680). The authors thank all the workers for assistance in conducting this research. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.pestbp.2014.03. 001. References [1] M.D. Devine, Mechanisms of resistance to acetyl-coenzyme carboxylase inhibitors: a review, Pestic. Sci. 51 (1997) 259–264. [2] J.L. Harwood, Fatty acid metabolism, Annu. Rev. Plant Physiol. 39 (1988) 101– 138. [3] Y. Sasaki, T. Konishi, Y. Nagano, The compartimentation of acetyl-coenzyme A carboxylase in plant, Plant Physiol. 108 (1995) 445–449. [4] T. Konishi, K. Shinohara, K. Ymada, Y. Sasaki, Acetyl-coA carboxylase in higher plants most plants other than Gramineae have both the prokaryotic and the eukaryotic forms of this enzyme, Plant Cell Physiol. 37 (1996) 117–122. [5] S.S. Kaundun, G.C. Bailly, R.P. Dale, S.J. Hutchings, E. Mclndoe, A novel W1999S mutation and non-target site resistance impact on acetyl-coA carboxylase inhibiting herbicides to varying degrees in a UK Lolim multiflorum population, PLoS ONE 8 (2013) e58012. [6] T. Konishi, Y. Sasaki, Compartmentalization of two forms of acetyl-CoA carboxylase in plants and the origin of their tolerance toward herbicides, Proc. Natl. Acad. Sci. U.S.A. 91 (1994) 3598–3601. [7] H. Zhang, Z. Yang, Y. Shen, L. Tong, Crystal structure of the carboxyltransferase domain of acetyl-coenzyme A carboxylase, Science 299 (2003) 2063–2067. [8] H. Zhang, B. Tweel, L. Tong, Molecular basis for the inhibition of the carboxyltransferase domain of acetyl-coenzyme-A carboxylase by haloxyfop and diclofop, Proc. Natl. Acad. Sci. U.S.A. 101 (2004) 5910–5915. [9] S. Xiang, M.M. Callaghan, K.G. Watson, L. Tong, A different mechanism for the inhibition of the carboxyltransferase domain of acetyl-coenzyme A carboxylase by tepraloxydim, Proc. Natl. Acad. Sci. U.S.A. 106 (2009) 20723– 20727.

61

[10] L.P. Yu, Y. Kim, L. Tong, Mechanism for the inhibition of the carboxyltransferase domain of acetyl-coenzyme A carboxylase by pinoxaden, Proc. Natl. Acad. Sci. U.S.A. 107 (2010) 22072–22077. [11] C. Délye, Weed resistance to acetyl coenzyme A carboxylase inhibitors: an update, Weed Sci. 53 (2005) 728–746. [12] S.B. Powles, Q. Yu, Evolution in action: plants resistance to herbicides, Annu. Rev. Plant Biol. 61 (2010) 317–347. [13] S.S. Kaundun, An aspartate to glycine change in the carboxyl transferase domain of acetyl CoA carboxylase and non-target-site mechanism(s) confer resistance to ACCase inhibitor herbicides, Pest Manag. Sci. 66 (2010) 1249– 1256. [14] H.J. Beckie, F.J. Tardif, Herbicide cross resistance in weeds, Crop Prot. 35 (2012) 15–18. [15] O. Zagnitko, J. Jelenska, G. Tevzadze, R. Haselkorn, P. Gornicki, An isoleucine/ leucine residue in the carboxyltransferase domain of acetyl-CoA carboxylase is critical for interaction with a aryloxyphenoxypropionate and cyclohexanedione inhibitors, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 6617–6622. [16] C. Délye, T. Wang, H. Darmency, An isoleucine-leucine substitution in chloroplastic acetyl-CoA carboxylase from green foxtail (Setaria viridis L. Beauv.) is responsible for resistance to the cyclohexanedione herbicide sethoxydim, Planta 214 (2002) 421–427. [17] C. Délye, É. Calmès, A. Matéjicek, SNP markers for black-grass (Alopecurus myosuroides Huds.) genotypes resistant to acetyl CoA-carboxylase inhibiting herbicides, Theor. Appl. Genet. 104 (2002) 1114–1120. [18] A. Collavo, S. Panozzo, G. Lucchesi, L. Scarabel, M. Sattin, Characterisation and management of Phalaris paradoxa resistant to ACCase-inhibitors, Crop Prot. 30 (2011) 203–299. [19] I.A. Mohamed, R. Li, Z. You, Z. Li, Japanese foxtail (Alopecurus japonicus) resistance to fenoxaprop and pinoxaden in China, Weed Sci. 60 (2012) 167–171. [20] L. Li, Y. Bi, L. Liu, G. Yuan, J. Wang, Molecular basis for resistance to fenoxaprop-p-ethyl in American sloughgrass (Beckmannia syzigachne Stedu.), Pestic. Biochem. Physiol. 105 (2013) 118–121. [21] S.S. Kaundun, S.J. Hutchings, R.P. Dale, E. McIndoe, Role of a novel I1781T mutation and other mechanisms in conferring resistance to acetyl-coA carboxylase inhibiting herbicides in a black-grass population, PLoS ONE 8 (2013), http://dx.doi.org/10.1371/journal.pone.0069568. [22] W. Liu, D.K. Harrison, D. Chalupska, P. Gornicki, C.C. O’Donnell, S.W. Adkins, R. Haselkorn, R.R. Williams, Single-site mutations in the carboxyltransferase domain of plastid acetyl-CoA carboxylase confer resistance to grass-specific herbicides, Proc. Natl. Acad. Sci. U.S.A. 104 (2007) 3627–3632. [23] C. Délye, X. Zhang, S. Michel, A. Matejicek, S.B. Powles, Molecular bases for sensitivity to acetyl-coenzyme A carboxylase in inhibitors in blackgrass, Plant Physiol. 137 (2005) 794–806. [24] Q. Yu, A. Collavo, M. Zheng, M. Owen, M. Sattin, S.B. Powles, Diversity of acetylcoenzyme A carboxylase mutations in resistant Lolium populations: evaluation using clethodim, Plant Physiol. 145 (2007) 547–558. [25] C. Petit, G. Bay, F. Pernin, C. Délye, Prevalence of cross or multiple resistance to the acetyl coenzyme A carboxylase inhibitors fenoxaprop, clodinafop and pinoxaden in black-grass (Alopecurus myosuroides Huds.) in France, Pest Manag. Sci. 66 (2010) 168–177. [26] H.J. Beckie, S.I. Warwick, C.A. Sauder, Basis for herbicide resistance in Canadian populations of wild oat (Avena fatua), Weed Sci. 60 (2012) 10–18. [27] H. Xu, X. Zhu, H. Wang, J. Li, L. Dong, Mechanism of resistance to fenoxaprop in Japanese foxtail (Alopecurus japonicus) from China, Pestic. Biochem. Physiol. 107 (2013) 25–31. [28] C. Délye, X. Zhang, C. Chalopin, S. Michel, S.B. Powles, An isoleucine residue within the carboxyl-transferase domain of multidomain acetyl-coenzyme A carboxylase is major determinant of sensitivity to aryloxyphenoxypropionate but not to cyclohexanedione inhibitors, Plant Physiol. 132 (2003) 1716–1723. [29] H. Cruz-Hipolito, M.D. Osuna, J.A. Domínguez-Valenzuela, N. Espinoza, R. De Prado, Mechanism of resistance to ACCase-inhibiting herbicides in Wild oat (Avena fatua) from Latin America, J. Agric. Food Chem. 59 (2011) 7261–7267. [30] H. Tang, J. Li, L. Dong, A. Dong, B. Lv, X. Zhu, Molecular bases for resistance to acetyl-coenzyme A carboxylase inhibitor in Japanese foxtail (Alopecurus japonicus), Pest Manag. Sci. 68 (2012) 1241–1247. [31] O. Hochberg, M. Sibony, B. Rubin, The response of ACCase-resistant Phalaris paradoxa populations involves two different target site mutations, Weed Res. 49 (2009) 37–46. [32] L. Scarabel, S. Panozzo, S. Varotto, M. Sattin, Allelic variation of the ACCase gene and response to ACCase-inhibiting herbicides in pinoxaden-resistant Lolium spp, Pest Manag. Sci. 67 (2011) 932–941. [33] S.S. Kaundun, S.J. Hutchings, R.P. Dale, E. McIndoe, Broad resistance to ACCase inhibiting-herbicides in a ryegrass population is due only to a cysteine to arginine mutation in the target enzyme, PLoS ONE 7 (2012) e39759. [34] H. Cruz-Hipolito, J.A. Domínguez-Valenzuela, M.D. Osuna, R.D. De Prado, Resistance mechanism to acetyl coenzyme A carboxylase inhibiting herbicides in Phalaris paradoxa collected in Mexican wheat fields, Plant Soil 355 (2012) 121–130. [35] N. Rao, L. Dong, J. Li, H. Zhang, Influence of environmental factors on seed germination and seedling emergence of American sloughgrass (Beckmannia syzigachne), Weed Sci. 56 (2008) 529–533. [36] J.J. Doyle, J.L. Doyle, A rapid DNA isolation procedure for small quantities of fresh leaf tissue, Phytochem. Bull. 19 (1987) 11–15. [37] M.M. Neff, J.D. Neff, J. Chory, A.E. Pepper, DCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms experimental applications in Arabidopsis thaliana genetics, Plant J. 14 (1998) 387–392.

62

L. Li et al. / Pesticide Biochemistry and Physiology 110 (2014) 57–62

[38] S. Jang, J. Marjanovic, P. Gornicki, Resistance to herbicides caused by single amino acid mutations in acetyl-CoA carboxylase in resistant populations of grassy weeds, New Phytol. (2013), http://dx.doi.org/10.1111/nph. 12117. [39] I. Cummins, S. Moss, D.J. Cole, R. Edwards, Glutathione transferases in Herbicide-Resistant and herbicide-susceptible black-grass (Alepecurus myosuroides), Pestic. Sci. 51 (1997) 244–250. [40] I. Cummins, D.J. Cole, R. Edwards, A role for glutathione transferases functioning as glutathione peroxidases in resistance to multiple herbicides in black-grass, Plant J. 18 (1999) 285–292. [41] M.D. Devine, Mechanisms of resistance to acetyl-coenzyme A carboxylase inhibitors: a review, Pestic. Sci. 51 (1999) 259–264. [42] C. Délye, Weed resistance to acetyl coenzyme A carboxylase inhibitors: an update, Weed Sci. 53 (2005) 728–746.

[43] L.M. Hall, S.R. Moss, S.B. Powles, Mechanisms of resistance to aryloxyphenoxypropionate herbicides in two resistant biotypes of Alopecurus myosuroides (blackgrass): herbicide metabolism as a cross-resistance mechanism, Pestic. Biochem. Physiol. 57 (1997) 87–98. [44] C. Preston, F.J. Tardif, J.T. Chistopher, S.B. Powles, Multiple resistance to dissimilar herbicide chemistries in a biotype of Lolium rigidum due to enhanced activity of several herbicide degrading enzyme, Pestic. Biochem. Physiol. 45 (1996) 123–134. [45] K.M. Cocker, D.S. Northcroft, J.D. Coleman, S.R. Moss, Resistance to ACCaseihibing herbicides and isproturon in UK populationsof Lolium multiflorum: mechanisms of resistance and implications for contol, Pest Manag. Sci. 57 (2001) 587–597.