Targeted and Persistent 8-Oxoguanine Base Damage at Telomeres Promotes Telomere Loss and Crisis

Article

Targeted and Persistent 8-Oxoguanine Base Damage at Telomeres Promotes Telomere Loss and Crisis Graphical Abstract

Authors Elise Fouquerel, Ryan P. Barnes, Shikhar Uttam, Simon C. Watkins, Marcel P. Bruchez, Patricia L. Opresko

Correspondence [email protected]

In Brief Chronic oxidative stress accelerates telomere shortening, thought to result from telomeric DNA damage. By developing a tool to selectively target 8-oxoguanine damage to telomeres, Fouquerel et al. demonstrate that this DNA lesion directly drives telomere shortening and impairs replication. Lesion-induced telomere losses promote chromosome fusions and overall genomic instability.

Highlights d

Targeted chronic 8-oxoG damage at telomeres promotes telomere shortening

d

Unrepaired telomeric 8-oxoG in OGG1-deficient cells impairs telomere replication

d

8-oxoG-induced telomere losses cause dicentric chromosomes and anaphase bridges

d

Persistent telomeric 8-oxoG drives telomere crisis and global genomic instability

Fouquerel et al., 2019, Molecular Cell 75, 117–130 July 11, 2019 ª 2019 Elsevier Inc. https://doi.org/10.1016/j.molcel.2019.04.024

Molecular Cell

Article Targeted and Persistent 8-Oxoguanine Base Damage at Telomeres Promotes Telomere Loss and Crisis Elise Fouquerel,1,6 Ryan P. Barnes,1 Shikhar Uttam,2 Simon C. Watkins,3 Marcel P. Bruchez,4,5 and Patricia L. Opresko1,5,7,* 1Department of Environmental and Occupational Health, University of Pittsburgh Graduate School of Public Health, and UPMC Hillman Cancer Center, Pittsburgh, PA, USA 2Department of Computational and Systems Biology, University of Pittsburgh, Pittsburgh, PA, USA 3Center for Biologic Imaging, University of Pittsburgh, Pittsburgh, PA, USA 4Departments of Biological Sciences and Chemistry and the Molecular Biosensors and Imaging Center, Carnegie Mellon University, Pittsburgh, PA, USA 5Center for Nucleic Acids Science and Technology, Carnegie Mellon University, Pittsburgh, PA, USA 6Present address: Department of Biochemistry and Molecular Biology, Sidney Kimmel Medical College, Thomas Jefferson University, Philadelphia, PA, USA 7Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.molcel.2019.04.024

SUMMARY

Telomeres are essential for genome stability. Oxidative stress caused by excess reactive oxygen species (ROS) accelerates telomere shortening. Although telomeres are hypersensitive to ROS-mediated 8-oxoguanine (8-oxoG) formation, the biological effect of this common lesion at telomeres is poorly understood because ROS have pleiotropic effects. Here we developed a chemoptogenetic tool that selectively produces 8-oxoG only at telomeres. Acute telomeric 8-oxoG formation increased telomere fragility in cells lacking OGG1, the enzyme that removes 8-oxoG, but did not compromise cell survival. However, chronic telomeric 8-oxoG induction over time shortens telomeres and impairs cell growth. Accumulation of telomeric 8-oxoG in chronically exposed OGG1-deficient cells triggers replication stress, as evidenced by mitotic DNA synthesis at telomeres, and significantly increases telomere losses. These losses generate chromosome fusions, leading to chromatin bridges and micronucleus formation upon cell division. By confining base damage to the telomeres, we show that telomeric 8-oxoG accumulation directly drives telomere crisis. INTRODUCTION Oxidative stress contributes to the pathogenesis of numerous diseases, including cancer, and occurs when the generation of reactive oxygen species (ROS) exceeds the cellular antioxidant defenses (Hegde et al., 2012; Malinin et al., 2011; Reuter et al., 2010). ROS arise from diverse environmental exposures but also from intrinsic factors, including inflammation and oxidative


ak and Fink, phosphorylation (Lonkar and Dedon, 2011; Poljs 2014). Studies in human tissue, mice, and cell culture show that oxidative stress and chronic inflammation accelerate telomere shortening or dysfunction (Ahmed and Lingner, 2018a; Barnes et al., 2019). Previous models have suggested that this is due to oxidative base damage or repair intermediates in telomeric DNA that interfere with telomere replication (Graham and Meeker, 2017; von Zglinicki, 2002), but this has remained untested because of the inability to confine base damage to the telomeres. Here we overcome this obstacle by developing an innovative tool that selectively induces the common oxidative lesion 8-oxoguanine (8-oxoG) at telomeres and demonstrate the effect on telomere integrity and genome stability. Telomere shortening suppresses cancer by triggering senescence in normal cells but can promote cancer by triggering genomic instability in pre-cancerous or malignant cells (Maciejowski and de Lange, 2017). Telomere crisis arises during tumorigenesis, when critically short telomeres cause chromosome fusions, promoting extensive genomic instability. DNA damage is thought to drive ROS-mediated telomere attrition because telomeric DNA is highly susceptible to oxidative damage (von Zglinicki, 2002). Human telomeres are composed of 10–15 kilobases of TTAGGG repeats coated by shelterin proteins (de Lange, 2018). Guanine is the most easily oxidized of the natural bases (Steenken, 1997), and TTAGGG repeats are preferred sites for conversion of G to 8-oxoG in vitro (Henle et al., 1999; Oikawa et al., 2001). Although 8-oxoG is one of the most abundant lesions, its role at telomeres has remained elusive because ROS induce a myriad of DNA lesions and alter cell signaling and gene expression, which can indirectly affect telomere maintenance (Fleming et al., 2017; Van Houten et al., 2018). ROS also oxidizes free deoxyribonucleoside triphosphates (dNTPs), which inhibit telomerase-mediated telomere elongation (Aeby et al., 2016; Ahmed and Lingner, 2018b; Fouquerel et al., 2016; Smith, 2018). 8-oxoG in duplex DNA is primarily repaired by base excision repair (BER). Repair is initiated by the bi-functional glycosylase Molecular Cell 75, 117–130, July 11, 2019 ª 2019 Elsevier Inc. 117

OGG1, which excises 8-oxoG opposite C in duplex DNA and can cleave the DNA backbone. APE1 removes the resulting 30 sugar and generates a single nucleotide gap or incises the backbone at an abasic site (Wallace, 2013). PARP1 binding to the repair intermediate activates poly(ADP-ribose) (PAR) synthesis, facilitating rapid recruitment of the downstream proteins DNA polymerase b. which fills the gap, and XRCC1-Ligase III, which seals the nick (Schreiber et al., 2006; Srivastava et al., 1998). Inhibiting 8-oxoG BER initiation in Ogg1/ mice leads to telomere lengthening in vivo under normal conditions, potentially because of 8-oxoG disruption of inhibitory G-quadruplex structures (Fouquerel et al., 2016; Lu and Liu, 2010). However, when cells from these mice are cultured under pro-oxidant conditions, the lack of OGG1 accelerates telomere attrition (Wang et al., 2010). Thus, the role of 8-oxoG in telomere length homeostasis is complex and poorly understood. Determining whether telomeric oxidative damage directly affects telomere maintenance and cellular function is challenging because of the pleiotropic effects of cellular oxidants and epigenesis-like effects of 8-oxoG (Fleming et al., 2017). Here we established and validated a chemoptogenetic tool that selectively induces 8-oxoG at telomeres through local production of singlet oxygen (1O2) without causing damage elsewhere in the genome. Using this tool, we found that chronic formation of telomeric 8-oxoG promotes genome instability through a telomere crisis-driven mechanism in human cancer cells. Although acute telomeric 1O2 exposure has minor effects, repeating this exposure over time causes progressive telomere shortening and losses. Accumulation of 8-oxoG in repair-deficient OGG1 knockout (KO) cells triggers telomeric mitotic DNA synthesis (MiDAS), providing evidence that 8-oxoG-induced replication stress promotes the observed increases in telomere losses and consequent chromosomes fusions, chromatid bridges, and micronuclei. By confining 8-oxoG formation to the telomeres, we demonstrate that persistent oxidative base damage at telomeres directly drives overall genomic instability. RESULTS A Tool to Selectively Induce 8-oxoG at Telomeres To target oxidative guanine damage to telomeres, we tagged the shelterin protein TRF1 with a fluorogen-activating peptide (FAP) along with the fluorescent protein mCerulean (mCer) to visualize expression (Figure 1A). FAPs have high affinity for the photosensitizer dye di-iodinated malachite green (MG2I), which produces 1 O2 only upon FAP binding and subsequent excitation with 660-nm light (He et al., 2016). 1O2 primarily generates 8-oxoG upon reaction with DNA (Ravanat et al., 2000) and has a very short half-life (100 ns) in biological systems (Agnez-Lima et al., 2012) allowing highly localized reactions. We selected HeLa cells with long telomeres (HeLa LT; telomerase-positive) and U2OS (telomerase-negative) cells because their average long telomeres (25 kb) (O’Sullivan et al., 2014) provide a large target for FAP-mCer-TRF1 loading and subsequent 8-oxoG formation. Expanded clones, termed HeLaFAP or U2OS-FAP, stably express the fusion protein exclusively at telomeres and at similar levels as endogenous TRF1 (Figures 1B, 1C, S1B, and S1C). To generate 8-oxoG, cells were incubated with 100 nM MG2I

118 Molecular Cell 75, 117–130, July 11, 2019

dye prior to FAP-MG2I activation with 5-min exposure to a high-intensity 660-nm light-emitting diode (LED; 100 mW/cm2) (Figure S1A). Although this combination is sufficient to induce 8-oxoG (see below), this dye concentration has no effect on cell growth (data not shown), and the 5-min exposure minimizes time outside of the incubator. To confirm telomeric 8-oxoG formation, we used repair enzymes and S1 nuclease to cleave telomere restriction fragments that harbor 8-oxoG (Figure 1D). We first converted 8-oxoG to a single nucleotide gap with bi-functional E. coli Fapy DNA glycosylase (FPG), which excises oxidized purines, or the combination of OGG1, which excises only 8-oxoG, and APE1 endonuclease (Krokan and Bjøras, 2013; Wallace, 2013). S1 nuclease then converts the resulting single-stranded breaks (SSBs) or gaps to double-stranded breaks (DSBs), causing the cleaved telomeres to migrate faster by pulsed-field gel electrophoresis (PFGE). S1 alone failed to induce telomere cleavage, indicating a lack of detectable SSBs in untreated and dye + light-treated cells (Figures 1E, lanes 2 and 8, and 1F). For untreated cells, FPG and S1 combined induced minor telomere cleavage, shown as a slight decrease in mean telomere length (MTL) (Figures 1E, lane 3, 1F, and S1D). However, for dye + light-treated cells, FPG and S1 combined induced highly significant telomere cleavage, causing a large reduction in MTL (Figures 1E, lane 9, 1F, and S1D). This indicates that the localized 1O2 exposure increases telomeric oxidized purines 3.3-fold compared with untreated cells. APE1 plus S1 failed to induce significant telomere cleavage, indicating a lack of detectable abasic sites (Figures 1E, lanes 4 and 10, 1F, and S1D). In contrast, combined OGG1, APE1, and S1 induced extensive fragmentation only in telomeres from dye + light-treated cells. The MTL reduction corresponds to a 7.2-fold increase in 8-oxoG lesions (Figures 1E, lanes 6 and 12, 1F, and S1D). Dye + light did not increase FPG-S1 cleavage of the bulk genome compared with untreated cells (Figures S1E and S1F). In contrast, the oxidizer KBrO3 significantly enhanced FPG-S1 cleavage of genomic DNA (Figures S1E and S1F), whereas cleavage at telomeres was comparable with dye + light treatment (Figures S1G and S1H). Based on this comparison, reports that 40 mM KBrO3 generates three to four 8-oxodG/106 deoxyguanosine (dG) in the genome (De Luca et al., 2008; Parlanti et al., 2012) and reports that telomeres are 15-fold more sensitive to damage than the genome overall (Petersen et al., 1998), we estimate that dye + light produces at least one 8-oxoG per 28-kb telomere. Collectively, these results show that the FAPTRF1 system specifically generates 8-oxoG lesions locally at telomeres. 1

O2 Activates BER at Telomeres To test whether 1O2 production at telomeres triggers BER, we first followed OGG1 recruitment, which initiates BER by excising 8-oxoG. Untreated HeLaFAP cells and cells treated with dye or light alone did not display OGG1 foci at telomeres. However, dye + light combined induced significant OGG1 enrichment specifically at telomeres (Figures 2A and 2B). We obtained similar results in U2OS-FAP cells, confirming the applicability of this tool to multiple cell lines (Figures S2A and S2B). We next examined NEIL1 glycosylase, which recognizes oxidized pyrimidines and hydantoin lesions but not 8-oxoG (Wallace, 2013). The dye + light

A

B

C

E

F

D

Figure 1. A Tool to Selectively Induce 8-oxoG at Telomeres (A) Schematic of the chemoptogenetic tool for inducing telomeric 8-oxoG. (B) FAP-mCer-TRF1 colocalization with telomeres in HeLaFAP clone 10 by anti-mCer immunofluorescence (IF) with telo-FISH (top panels) and mCer fluorescence with anti-RAP1 (bottom panels). (C) Immunoblot for TRF1 in whole-cell extracts from HeLaFAP. One star indicates FAP-mCer-TRF1; two stars indicate endogenous TRF1. (D) Schematic of 8-oxoG detection in telomere restriction fragments by converting 8-oxoGs to DSBs with repair enzymes and S1 nuclease. (E) S blot of telomere restriction fragments from untreated and dye + light-treated HeLaFAP cells after digestion with the indicated enzymes and S1 nuclease. (F) Quantification of the percentage of cleaved telomeric DNA (bracketed area in the gel in E) as a function of total DNA. Means ± SD of 3 independent experiments; *p < 0.05, ***p < 0.001, ****p < 0.0001; two-way ANOVA. See also Figure S1.

treatment failed to induce NEIL1 recruitment to telomeres (Figure S2C), confirming specificity for 8-oxoG. PARP1 is a central player in BER and is activated by SSB repair intermediates, leading to the catalytic production of PAR chains (Schreiber et al., 2006). To test whether telomeric 8-oxoG triggers PARP1 activation, we performed PAR immunodetection following dye + light exposure in HeLaFAP cells. PAR detection requires PAR glycohydrolase (PARG) inhibition because PARG rapidly degrades PAR (Rack et al., 2016). Pre-treatment with the PARG inhibitor PDD00017273 (Gravells et al., 2017) enriched for nuclear PAR staining in both untreated and dye + light-treated cells (Figure S2D). However,

dye + light significantly increased PAR colocalization with telomeres compared with untreated cells, suggesting that PARP1 is activated at telomeres after 1O2 production (Figures 2C and 2D). After PARP1 activation, the downstream BER protein XRCC1 is recruited via its high affinity for PAR (Godon et al., 2008). We observed significant XRCC1 enrichment at telomeres after dye + light, which was reduced by pre-treatment with the 1O2 quencher sodium azide (He et al., 2016) or by PARP1 inhibition or depletion (Figures 2E–2G, S2G, and S2I). U2OS-FAP cells displayed similar results (Figures S2E, S2F, and S2H). Our data clearly show a role of PARP1 activity in BER protein recruitment to telomeres following 8-oxoG

Molecular Cell 75, 117–130, July 11, 2019 119

A

C

E

Figure 2. 1O2 Activates BER at Telomeres

B

D

F

G

formation, consistent with reports implicating PARP1 in telomeric BER (Gomez et al., 2006). Acute 8-OxoG Formation at Telomeres Does Not Induce Telomere Dysfunction Having established that targeted 1O2 production at telomeres generates 8-oxoG and canonical BER, we next examined the biological effect of telomeric 8-oxoG in wild-type and repair-deficient cells. We used CRISPR/Cas9 to target exon 2 (gRNA1) or exon 4 (gRNA3) of the OGG1 gene in HeLaFAP cells (Figure S3A). DNA sequencing confirmed gene disruption in clones OGG1ko1.4 (obtained with gRNA1) and OGG1ko3.14 (obtained with gRNA3), western blotting confirmed OGG1 loss, and decreased XRCC1 recruitment to damaged telomeres confirmed BER disruption (Figures S3B and 3A–3C). Oxidative lesions can disrupt binding of the shelterin proteins TRF1 and TRF2 in vitro (Opresko et al., 2005). TRF2 loss causes telomere deprotection which can be monitored by 53BP1 recruitment, a DNA damage response (DDR) protein that signals telomere dysfunction-induced focus (TIFs) or DSB for-

120 Molecular Cell 75, 117–130, July 11, 2019

(A) Endogenous OGG1 and OGG1-EGFP (red) localization to telomeres (green) in HeLaFAP cells by anti-OGG1 IF and telo-FISH after dye + light. (B) Quantification of OGG1 signal intensity at telomeric foci. Medians ± SD from more than 200 foci per condition; ****p < 0.0001, one-way ANOVA. (C) Images of PAR (red) and telomeres (green) by anti-PAR IF and telo-FISH. The last column shows PAR foci colocalizing with telomeres (white). (D) Quantification of PAR foci colocalizing with telomeres. Medians ± SD from more than 350 cells per condition; ***p = 0.0009, ****p = 0.0001, oneway ANOVA. (E) Visualization of yellow fluorescent protein (YFP)XRCC1 (yellow) and FAP-mCer-TRF1 (cyan) fluorescence. Cells in the bottom row were treated with 100 mM NaN3 for 15 min prior to light exposure. (F) Quantification of YFP-XRCC1 signal intensity at telomeric foci. Medians ± SD from more than 400 foci per condition; ****p < 0.0001, one-way ANOVA. (G) Quantification of YFP-XRCC1 signal intensity at telomeric foci upon PARP1 inhibition with ABT888 inhibitor prior to dye + light, or by PARP1-targeting shRNAs as indicated. Medians ± SD from more than 650 foci per condition; ****p < 0.0001, one-way ANOVA. See also Figure S2.

mation (Takai et al., 2003). Overall, dye + light treatment of HeLaFAP and OGG1 KO cells failed to significantly increase telomeric 53BP1 foci compared with untreated cells (Figures 3D–3G). Although the increase to 1.6 TIFs per nucleus after 60-min recovery is significant for HeLaFAP cells, this represents a minor fraction of the telomeres and decreased after 360min recovery (Figures 3D and 3E). We obtained similar results for telomeric gH2AX foci, an additional DDR marker (Figures S3C–S3E). Finally, a lack of TIF increase in U2OS cells indicates that telomerase is not masking potential damage-induced telomere deprotection (Figures S3F and S3G). A lack of telomeric 53BP1 foci also suggests that dye + light treatment does not directly induce DBSs, in agreement with Figure 1E and reports that 1O2 does not generate DSBs upon reaction with DNA (Cadet et al., 2000; Ravanat et al., 2000). Consistent with a lack of induced telomere dysfunction, we failed to detect TRF2 loss by chromatin immunoprecipitation. Neither treatment with KBrO3 nor dye + light reduced TRF2 at the telomeres in wild-type or OGG1 KO cells (Figures 3H and 3I). This suggests that acute 1O2 exposure does not generate enough damage to significantly disrupt TRF2 binding in cells, although disruption locally at the lesion site is possible. Acute 8-OxoG Formation Increases Fragile Telomeres in OGG1 Repair-Deficient Cells Next we examined the effect of 8-oxoG on telomere integrity. Analysis of metaphase chromosomes by telomere fluorescence in situ hybridization (telo-FISH) revealed that neither dye nor light

A

B

C

D

G

E

F

H

I

Figure 3. Acute 8-OxoG Formation at Telomeres Does Not Induce Telomere Dysfunction (A) Immunoblot of OGG1 in parental HeLaFAP cells and two OGG1 KO clones. Actin was used as a loading control. (B) Visualization of YFP-XRCC1 (yellow) and telomeric FAP-mCer-TRF1 (cyan) fluorescence after dye + light. (C) Quantification of YFP-XRCC1 signal intensity at telomeric foci. Medians ± SD from more than 1,200 foci per condition; ****p < 0.0001, one-way ANOVA. (D) Images of 53BP1 (red) and telomeres (green) in HeLaFAP cells by anti-53BP1 IF and telo-FISH. Cells were incubated for the indicated recovery times after dye + light. (E–G) Quantification of the average (av.) number of 53BP1 TIFs per nuclei in (E) HeLaFAP, (F) OGG1ko1.4, and (G) OGG1ko3.14 cells. Means ± SEM of 4 independent experiments, at least 400 cells per experiment; **p < 0.005; ***p = 0.0002; ns, not significant; one-way ANOVA. (H) Dot blot from anti-TRF2 chromatin immunoprecipitation (ChIP) of genomic DNA using an Alu probe (top panel) and of telomeric DNA using the Telo probe (bottom panel). HeLaFAP and OGG1ko1.4 cells were treated with dye + light or for 60 min with 40 mM KBrO3. 25% of the input was loaded. IP, immunoprecipitate. (I) Quantification of the telomeric signal in anti-TRF2 ChIP samples relative to untreated cells for each cell line. Means ± SD of 3 independent experiments. See also Figure S3.

alone altered telomeres (Figures S4A–S4C). Dye + light significantly increased telomere losses (signal-free ends) only in clone OGG1ko1.4 (Figures 4A and 4B). However, this clone showed more basal telomere losses prior to treatment, which may have

further sensitized them to telomere damage. Therefore, we also tested clone OGG1ko1.20, derived from the same population as OGG1ko1.4, and found that it behaved similar to OGG1ko3.14 (Figures 4B and S4D). Dye + light increased fragile

Molecular Cell 75, 117–130, July 11, 2019 121

A

Untreated

B

Dye+Light

Signal free ends

30

Figure 4. Acute 8-OxoG Formation Increases Fragile Telomeres in OGG1 Repair-Deficient Cells

2 signal free ends

HeLa FAP

10μm

10μm

1 fragile telomere

Number / metaphase

25 20 15

ns

5 0

- + - + - + - + OGG1 OGG1

HeLaFAP

2 signal free ends

C 10μm

10μm

Number / metaphase

1 fragile telomere 10μm

***

20

ns

15

5 0

- +

2 signal free ends

10μm

1 fragile telomere

telomeres (multi-telomeric signals) slightly in wild-type cells and significantly in all three OGG1 KO clones (Figure 4C). Fragile telomeres are indicative of replication stalling at telomeres (Sfeir et al., 2009). However, although aphidicolin (APH)-induced replication stress led to Chk1 and RPA phosphorylation, dye + light treatment did not, suggesting that the induced 8-oxoG density was below the threshold to trigger the ATR kinase replication stress checkpoint (Figure S4E). Last, all clones recovered from telomeric damage, as indicated by colony formation (Figures S4F–S4H). OGG1 loss also did not increase sensitivity to KBrO3 which triggers telomere damage as well (Figure S4I). Overall, these data show that a single induction of telomeric 8oxoG causes telomere fragility in OGG1 KO cells but does not consistently cause significant telomere losses or impair cell growth. Chronic Formation of 8-OxoG Impairs Growth and Triggers Telomere Losses Because chronic inflammation and oxidative stress associate with telomere shortening (Barnes et al., 2019), we asked whether repeatedly exposing telomeres to 1O2 would alter telomere maintenance. We exposed HeLaFAP and OGG1 KO cells to dye + light once each day, except on the fourth day, when cells were harvested for analysis, over 24 days for a total of 18 exposures (Figure 5A). Cleavage of telomere restriction fragments with OGG1-APE1 and S1 nuclease from dye + light-treated OGG1ko1.4 and OGG1ko3.14 cells, but not HeLaFAP cells, confirmed an accumulation of 8-oxoG in

122 Molecular Cell 75, 117–130, July 11, 2019

*

10

HeLaFAP

10μm

ko1.20

****

Dye+Light

OGG1 ko1.20

ko3.14

25

1 signal free end

OGG1 ko3.14

OGG1 ko1.4

Fragile telomeres 30

3 fragile telomeres 10μm

ns

ns

10

Dye+Light

OGG1 ko1.4

****

(A) Telo-FISH of metaphase chromosomes 24 h after dye + light. Telomeric signal-free ends (white arrowheads) and fragile telomeres (orange arrowheads) are indicated. (B) Quantification of telomeric signal-free ends. Each dot represents a metaphase. Medians (bar) from three independent experiments (30 to 40 metaphases per condition for each experiment); ****p < 0.0001, one-way ANOVA. (C) Quantification of fragile telomeres. Each dot represents a metaphase. Medians (bar) from three independent experiments (30 to 40 metaphases per condition for each experiment); ****p < 0.0001, ***p < 0.001, *p < 0.05, one-way ANOVA. See also Figure S4.

repair-deficient cells during the experiment (Figures 5B, S5A, and S5B). dye + light exposure signifi- + - + - + Repeated cantly reduced cell population doubling OGG1 OGG1 OGG1 ko3.14 ko1.20 ko1.4 compared with controls, with OGG1ko1.4 cells showing the most significant reduction (Figure 5C). Repeated dye or light treatment alone did not compromise cell growth (Figure S5C), and a single exposure did not reduce growth during 24 days of recovery (Figure S5D). Next we examined telomere lengths and integrity. Repeated dye + light treatment did not significantly increase TIFs, as marked by telomeric 53BP1 or gH2AX foci in all three cell lines (Figures 5D and S5E). S blots of telomere restriction fragments showed that the MTL of dye + light-treated cells decreased progressively with exposures, but reductions were only significant for HeLaFAP cells (Figures S5F–S5J). The S blots also revealed progressive and extensive reductions in telomere staining as a function of repeated exposures (Figures S5F and S5G), indicative of telomere loss and rendering MTL calculations difficult. However, analysis of individual telomeres by quantitative teloFISH revealed a shift toward shortened telomeres for all clones after 18 exposures (Figures 5E–5G and S5K). Shortening is illustrated by the cumulative distribution functions (Casella and Berger, 2002) of the telomere intensities (insets in Figures 5E– 5G), showing a distinct and statistically significant enrichment of shorter telomeres in dye + light-treated cells (steeper slope) compared with untreated cells. Finally, telo-FISH confirmed that, although repeated exposures induced telomere losses in all clones, the increases were higher in OGG1 KO compared with HeLaFAP cells (Figures 5H and S5K). Each clone also displayed small increases in fragile telomeres after damage that reached significance for both OGG1 KO clones (Figures 5I and S5K). Two independent OGG1 KO clones (1.20 and 3.7), expanded from the same population as clones OGG1ko1.4 and OGG1ko3.14, respectively, showed similar results (Figures S5L–S5N). Overall, these data show that OGG1 KO greatly exacerbates

A

E

B

F C

D

H

G

I

the chronic damage-induced telomere losses and that the failure to repair 8-oxoG over time is detrimental to telomere integrity. Persistence of 8-OxoG at Telomeres Increases Aberrant Mitotic DNA Synthesis Previous models have proposed that 8-oxoG may cause telomere loss when SSB and repair intermediates induce replication fork collapse (von Zglinicki, 2002). However, we failed to detect an accumulation of repair intermediates following chronic exposure (Figure 5B). Although chronic dye + light induced Chk2 phosphorylation, consistent with ataxia telangiectasia mutated (ATM) kinase activation upon telomere loss, we did not detect significant

Figure 5. Chronic Formation of 8-OxoG Impairs Growth and Triggers Telomere Losses (A) Schematic of the chronic induction of 1O2. Red bars indicate the days when cells were passaged or harvested and not exposed. (B) 8-OxoG detection at telomeres in untreated cells and after 18 dye + light treatments, as shown by percent telomere cleavage with the indicated enzymes and S1 nuclease, quantified from S blots (Figure S5A). Means ± SD from 3 independent experiments for HeLaFAP cells and from 4 independent experiments for OGG KO cells (2 combined experiments from the OGG1ko1.4 clone and 2 experiments from the OGG1ko3.14 clone) (Figure S5B); ***p < 0.001, ****p < 0.0001, two-way ANOVA. (C) Population doubling (PD) over 24 days of untreated and chronic dye + light-treated cells. Means ± SD from 5 independent experiments; *p < 0.05, **p < 0.005, ***p < 0.001, Welch’s two-sample t test. (D) Quantification of av. 53BP1 TIFs per nucleus after 18 treatments. Means ± SEM of 4 independent experiments from at least 400 cells per experiment;, one-way ANOVA. (E–G) Quantification of telomeric signal intensities from telo-FISH of metaphase chromosomes (Figure S5K) from untreated and dye + light-treated (E) HeLaFAP, (F) OGG1ko1.4, and (G) OGG1ko3.14 cells. 10 metaphases per condition per experiment from three independent experiments. The x axis is shown as binning by 1,000 (a.u.). The inset shows the statistical Kolmogorov-Smirnov test on the cumulative distribution functions derived from the histogram. Significance (p < 0.0005) was determined at 95% confidence interval. (H) Quantification of telomeric signal-free ends. Each dot represents a metaphase. Medians (bar) from three independent experiments (30 to 40 metaphases per condition per experiment); ***p < 0.001, ****p < 0.0001, one-way ANOVA. (I) Quantification of fragile telomeres. Each dot represents a metaphase. Medians (bar) from three independent experiments (30 to 40 metaphases per condition per experiment); ****p < 0.0001, *p < 0.05, one-way ANOVA. See also Figure S5.

Chk1 activation or increased RPA phosphorylation (Figure S6A). This is reminiscent of checkpoint-blind fragile sites in which under-replicated regions fail to reach the required activation threshold (Bergoglio et al., 2013) and suggests that the 8-oxoG frequency is insufficient to trigger replication checkpoint activation. To determine whether unrepaired 8-oxoG in telomeres can disrupt replication, we tested for MiDAS based on data showing that APH-induced replication stress triggers MiDAS at common fragile sites and telomeres (Minocherhomji et al., 2015; O¨zer et al., 2018). We examined 5-ethynyl-20 -deoxyuridine (EdU) incorporation on metaphase chromosomes following release from G2 arrest after APH treatment as a positive control and after 18 cycles of dye + light to induce telomeric 8-oxoG (Figure 6A).

Molecular Cell 75, 117–130, July 11, 2019 123

A

Figure 6. Persistence of 8-OxoG at Telomeres Increases Aberrant Mitotic DNA Synthesis

B

C

F

D

G

E

H

As expected, APH induced MiDAS at non-telomeric and telomeric sites and significantly increased EdU foci colocalizing with telomeric DNA on both sister chromatids in HeLaFAP and OGG1 KO cells (Figures S6C–S6G). In contrast, chronic 8-oxoG formation significantly increased MiDAS events in OGG1 KO cells only, appearing as two distinct patterns at chromatid ends (Figures 6B–6H and S6B). First, we observed conservative DNA synthesis on a single sister chromatid in which the EdU foci colocalized with telomeric DNA or the chromosome tip distal to the telo-FISH foci (Figures 6C–6E). Very few of these EdU foci lacked telomeric staining (10%) and were excluded from analysis. This staining pattern is consistent with break-induced replication (BIR)-mediated repair of collapsed replication forks (Min et al., 2017; O¨zer et al., 2018; Figure 6B). Telomeric BIR is RAD51-independent and utilizes MRE11 and RAD52 proteins (Dilley et al., 2016; Min et al., 2017). In agreement, pretreatment with the MRE11 inhibitor Mirin decreased telomeric EdU foci at single chromatids, whereas the RAD51 inhibitor B02 had no effect (Figures 6D and 6E). The second MiDAS pattern in chronically damaged OGG1 KO cells was semi-conservative DNA synthesis,

124 Molecular Cell 75, 117–130, July 11, 2019

(A) Schematic for EdU labeling of cells undergoing MiDAS. (B) Models illustrating conservative DNA synthesis during break-induced replication (top) and semi-conservative DNA synthesis during homologous recombination (bottom). Red, DNA synthesis (chromosomes show a corresponding MiDAS pattern). (C) Images (top) and quantification of EdU incorporation (red) at telomeres (green) on a single chromatid end of metaphase chromosomes (blue) from HeLaFAP cells after 18 dye + light treatments. Each dot represents a metaphase. Medians ± SD from more than 50 metaphases; one-way ANOVA. (D and E) Quantification of EdU incorporation at telomeres on a single chromatid end of metaphase chromosomes from (D) OGG1ko1.4 or (E) OGG1ko3.14 cells after treatment 18 with MRE11inhibitor Mirin or RAD51-inhibitor B02 treatment prior to EdU addition. Each dot represents a metaphase. Medians ± SD from more than 50–80 metaphases. ****p < 0.0001, ***p = 0.0004, one-way ANOVA. (F) Images (top) and quantification of EdU incorporation (red) at both chromatid ends of metaphase chromosomes (blue) from HeLaFAP cells after 18 dye + light treatments. Telomeres are shown in green. Each dot represents a metaphase. Medians ± SD from more than 50 metaphases; oneway ANOVA. (G and H) Quantification of EdU incorporation at both chromatid ends of metaphase chromosomes from (G) OGG1ko1.4 or (H) OGG1ko3.14 cells after treatment 18, with MRE11-inhibitor Mirin or RAD51inhibitor B02 treatment prior to EdU addition. Each dot represents a metaphase. Medians ± SD from more than 50–80 metaphases. ****p < 0.0001, **p = < 0.005, one-way ANOVA. See also Figure S6.

in which EdU foci appeared at the tips of both sister chromatids (Figures 6F–6H). More than 70% of these events occurred at chromatids lacking telomeric DNA and decreased upon RAD51 inhibition (Figures 6G and 6H), consistent with a homologous recombination (HR) mechanism. This suggests that replication of chromosomes lacking a telomere may provoke HR repair at chromatid ends in G2. Our data provide evidence that accumulation of 8-oxoG at telomeric DNA induces local replication stress, leading to mitotic DNA synthesis in an attempt to complete telomere replication and prevent telomere loss. 8-OxoG-Induced Telomere Losses Promote Chromosome Fusions and Chromatin Bridge Formation Telomere losses can cause chromosome end fusions because of the false recognition of ‘‘uncapped’’ chromosome ends as DSBs by DDR signaling and end joining repair (de Lange, 2018). The chronic formation of telomeric 8-oxoG induced a slight increase in fusions, as indicated by dicentric chromosomes in HeLaFAP cells, but a much more significant increase in OGG1 KO cells (Figures 7A and 7B). An average of 54% and 28% of metaphases

A

B

C

D

E

F G

H

I

Figure 7. 8-OxoG-Induced Telomere Losses Promote Chromosome Fusions and Chromatin Bridge Formation (A) Telomeric (green) and centromeric (pink) staining by FISH on metaphase chromosomes (left panel) 24 h after treatment 18. Dicentric chromosomes are indicated by white arrows. (B) Percentage of metaphases with at least one dicentric chromosome. Means ± SEM from 3 independent experiments (30 to 40 metaphases analyzed per sample per experiment); ***p = 0.0004, ****p < 0.0001, 2-way ANOVA. (C) Chromatin bridge stained with DAPI (blue) and by telo-FISH (green) from OGG1ko1.4 cells after treatment 18. (D) Quantification of chromatin bridges per 100 nuclei after treatments 3 and 18. Means ± SEM from 5 independent experiments (1,500 to 2,000 nuclei per condition for each experiment); *p % 0.05, ***p = 0.0007, ****p < 0.0001, two-way ANOVA. (E) Quantification of chromatin bridge lengths after treatment 18. Means ± SD from 123 and 57 chromatin bridges from OOG1KO1.4 and OGG1ko3.14 cells, respectively, measured from two independent experiments. (F) TREX1 exonuclease (red) localization on a chromatin bridge in OGG1ko1.4 cells after treatment 18. Telomeres are stained by FISH (green) and DNA by DAPI (blue). The mean ± SD of the percentage of TREX1-positive bridges is from 2 independent experiments in which 50 to 60 bridges were counted. (G) RPA (red) localization on a chromatin bridge (blue) from OGG1ko1.4 cells after treatment 18. The percentage of RPA-positive bridges was obtained from the counting of 65 bridges. (H) Micronuclei in HeLaFAP cells after treatment 18. DNA is stained by DAPI. (I) Quantification of micronuclei per 100 nuclei after treatments 3 and 18. Means ± SEM from 5 independent experiments (1,500 to 2,000 nuclei per condition for each experiment). **p < 0.005, ****p < 0.0001, 2-way ANOVA. See also Figure S7.

Molecular Cell 75, 117–130, July 11, 2019 125

contained at least one dicentric chromosome in OGG1ko1.4 and OGG1ko3.14 cells, respectively, after 18 treatments (Figure 7B). Here again, two additional OGG1 KO clones displayed similar results (Figures S7A and S7B). We next asked whether the dicentric chromosomes led to chromatin bridges during mitosis, as reported for telomeres rendered dysfunctional by TRF2 inhibition (Maciejowski et al., 2015). DAPI staining revealed that 3 dye + light exposures slightly increased chromatin bridges in OGG1 KO cell lines. However, 18 exposures led to a small increase in HeLaFAP cells and highly significant increases in both OGG1 KO clones (Figures 7C and 7D). The chromatin bridges from OGG1 KO cells averaged 22 mm in length but reached up to 81 mm (Figure 7E). Chromatin bridges formed through TRF2 inhibition are converted into single-stranded DNA (ssDNA) by TREX1 exonuclease to resolve the bridges (Maciejowski et al., 2015). Similarly, 54% of the bridges colocalized with TREX1 (Figure 7F), which occurred more frequently on very long bridges averaging 25 mm as opposed to 15 mm for TREX1-negative bridges (Figures S7C and S7E). Moreover, 20% of the bridges stained positive for the ssDNA binding protein RPA, averaging 34.6 mm in length (Figures 7G, S7D, and S7F), suggesting successful conversion to ssDNA for resolution. Chromatin bridges can also cause chromosome breaks and consequent micronuclei (Bizard and Hickson, 2018; Utani et al., 2010). Consistent with this, we observed significant increases in micronuclei for all cell lines after 18 exposures but not after dye or light alone or a single exposure followed by 24 recovery days (Figures 7H, 7I, S7G, and S7H). The increase in micronuclei was greater for OGG1 ko cells compared with HeLaFAP cells (Figure 7I). More than 70% of micronuclei contained at least one detectable telomeric focus (Figure S7I). Importantly, chronic exposure did not increase detectable FPG-sensitive sites or DSBs in the bulk genome compared with untreated cells (Figures S7J and S1K). Finally, to visualize the timing of chromatin bridge and micronucleus formation, we performed live-cell imaging after 21 dye + light treatments of OGG1ko1.4 cells (Videos S1 and S2). These time-lapse experiments clearly reveal the formation of chromatin bridges and micronuclei upon cell division, leading to apoptotic blebbing in some cases. Taken together, these data provide evidence that chronic and persistent telomeric 8-oxoG formation leads to chromatin bridges and micronucleus formation, increasing overall genomic instability. DISCUSSION Oxidative stress has been proposed to accelerate telomere shortening and dysfunction through ROS-induced base damage in telomeric DNA (von Zglinicki, 2002). Here, using an innovative chemoptogenetic tool to generate 8-oxoG at telomeres with high temporal and spatial control, we demonstrate that human cancer cells can fully recover from a single round of telomeric damage. However, chronic formation and persistence of 8-oxoG selectively at telomeres not only promotes telomere shortening but also extensive telomere losses, leading to chromosome end fusions, chromatin bridges, and micronuclei. We attribute these telomere crisis phenotypes to telomeric 8-oxoG because they are greatly exacerbated in the absence of OGG1 glycosylase,

126 Molecular Cell 75, 117–130, July 11, 2019

the enzyme that specifically recognizes and removes 8-oxoG. Our data reveal a role for accumulated 8-oxoG in promoting telomere loss and crisis by triggering replication stress at telomeres and provide a mechanism by which this common oxidative lesion drives overall genomic instability. In this study, we show that the duration of telomeric 8-oxoG formation and its accumulation over time determines telomere and cellular fates. Together with published work, our data support a hormesis-like model whereby low basal levels of telomeric 8-oxoG may be beneficial for telomere lengthening, whereas higher accumulated levels are detrimental. Ogg1/ mice exhibit telomere lengthening in vivo under non-stress conditions, but when Ogg1/ mouse embryonic fibroblasts (MEFs) are cultured under pro-oxidant conditions, the inability to repair 8-oxoG leads to telomere shortening and aberrations (Wang et al., 2010). We showed previously that a single 8-oxoG in the telomeric 30 single-stranded overhang stimulates telomerase by disrupting inhibitory G-quadruplex structures, which may partly explain telomere lengthening in vivo when basal 8-oxoGs remain (Fouquerel et al., 2016). Although we did not observe telomere lengthening in the expanded OGG1 KO HeLa clones, these cells likely experienced some oxidative stress during passaging. Furthermore, a single induction of telomeric 8-oxoG in human cancer cells was well tolerated, even in OGG1-deficient cells. In contrast, repeating the same non-lethal dose of telomeric 1 O2 production over time to mimic oxidative stress conditions unmasked a critical role for OGG1 in preventing 8-oxoG-induced telomere loss and crisis. Although chronic damage significantly increased fusions and bridges in OGG1-deficient cells, all cell lines showed significant micronucleus increases, raising the possibility that some micronuclei arose by mechanisms other than bridges, such as nuclear blebbing or buds (Kisurina-Evgenieva et al., 2016; Utani et al., 2010). Alternatively, micronuclei may persist longer than unstable, transient bridges, fusions, and MiDAS events, facilitating their detection when arising at lower levels in BER-proficient cells compared with repair-deficient cells. Our data are consistent with a mechanism by which persistent 8-oxoG in the telomere duplex provokes losses by interfering with telomere replication. We favor this model over previous models where repair intermediates (von Zglinicki, 2002), rather than 8-oxoG itself, cause oxidative stress-induced telomere loss for several reasons. First, we detected an accumulation of 8-oxoG in OGG1 KO cells after chronic damage but not SSB or abasic intermediates. Second, although 8-oxoG is generally not considered a strong block, replicative DNA polymerase d stalls at 8-oxoG, particularly after incorporation of the correct C (Fazlieva et al., 2009; Markkanen et al., 2012). In agreement, telomeric 8-oxoG increased fragile telomeres in OGG1 KO cells, a marker of replication stalling. Telomeres are well recognized as difficult-to-replicate regions that are sensitive to replication stress (Sfeir et al., 2009), suggesting that they may be highly sensitive to stalling at DNA lesions and possible fork collapse (reviewed in Zeman and Cimprich, 2014). 8-OxoG accumulation promotes a BIR-like MiDAS event in which RAD52 mediates ssDNA annealing from one end of a collapsed fork into telomeric DNA of the sister chromatid for templated DNA synthesis. This mechanism is used in alternative lengthening of telomeres

(ALT), and replication stress induced by various agents triggers MiDAS in both telomerase-positive and ALT cells (Dilley et al., 2016; Min et al., 2017; O¨zer et al., 2018; O¨zer and Hickson, 2018). The failure to repair broken forks can cause telomere loss and may have triggered the MiDAS events we observed at both chromatid ends. These events lack telomeric DNA and are consist with HR repair of collapsed forks. Alternatively, replication of chromosomes lacking a telomere may trigger HR in G2 because of false recognition as a DSB. Finally, we and others reported that 8-OxoG can also drive telomere losses when arising in dNTPs by inhibiting telomerase (Aeby et al., 2016; Fouquerel et al., 2016). Although we found that acute increases in 8-oxodGTP caused telomere losses and fragility in HeLa cells with short telomeres, it did not in HeLa LT cells (Fouquerel et al., 2016). This difference suggests that 8-oxodGTP incorporation during DNA synthesis may affect replication differently than when DNA polymerase encounters an 8-oxoG in the template. Nevertheless, previous and current data provide evidence that 8-oxoG can drive telomere loss by two independent mechanisms: (1) when arising in free dNTPs by interfering with telomerase activity but also (2) when accumulating in duplex telomeric DNA by interfering with replication. Other indirect roles for unrepaired 8-oxoGs in provoking telomere defects are possible, but our data suggest that they likely play a minor role, if any. First, although 8-oxoGs can be converted to replication-blocking hydantoin lesions (Henderson et al., 2003; Kolbanovskiy et al., 2017), we did not detect recruitment of the hydantoin repair enzyme NEIL1 glycosylase (Wallace, 2013). Second, 8-oxoG could interfere with TRF1 or TRF2 binding directly (Opresko et al., 2005) or by causing G to T mutations because 8-oxoG miscodes for A (Hsu et al., 2004; Markkanen, 2017). However, in our study, the chromosome fusions arose from telomere loss rather than complete TRF2 disruption and telomere deprotection because the dicentric chromosomes lack telomeric DNA at the fusion site. Although even partial TRF2 depletion significantly increases TIFs (Van Ly et al., 2018), neither acute nor chronic telomeric 8-oxoG caused a robust increase in 53BP1 or gH2AX TIFs. Furthermore, although telomeric 8-oxoG increased telomere fragility in OGG1 KO cells, this was not likely to result from TRF1 loss, based on data showing that TRF1 suppresses telomere fragility by recruiting bloom syndrome helicase (BLM) to unwind G-quadruplexes (Zimmermann et al., 2014). Because both 8-oxoG and G-to-T mutations disrupt G-quadruplex formation, this structure is probably not responsible for 8-oxoG-induced telomere fragility (Fouquerel et al., 2016; Lee et al., 2005). Although our data suggest that TRF1 and TRF2 disruption are not the primary cause of the telomere defects, we cannot rule out the possibility that 8-oxoG may disrupt them locally at the lesion to facilitate repair enzyme access. Previous studies showing shortened telomeres in inflamed tissues and pre-malignant lesions arising from chronic inflammatory diseases implicated ROS-induced telomere damage as driving telomere shortening (Barnes et al., 2019; O’Sullivan et al., 2002). Using a tool to confine 8-oxoG formation to telomeres, we provide direct evidence that an accumulation of telomeric 8-oxoG is sufficient to trigger telomere shortening

and crisis. Although 8-oxoG is not the only oxidative DNA lesion, it is one of the most abundant. Because 8-oxoG is mutagenic rather than cytotoxic, it can promote genomic alterations in dividing cells and drives carcinogenesis in Ogg1/ mice challenged with genotoxic agents (Kakehashi et al., 2017; Xie et al., 2004). In addition to 8-oxoG’s well established role in mutagenesis, our results indicate that it can also cause genomic instability through a telomere crisis-driven mechanism. This is highly relevant in the context of cancer cells, which typically exhibit higher ROS because of dysfunctional redox regulation (Liou and Storz, 2010) and rely on telomere maintenance for sustained proliferation. Finally, our work has implications for aging. Numerous studies report an increase in levels of oxidative DNA damage, including 8-oxoG, in various tissues and a reduction of BER activity with age (Hamilton et al., 2001; Xu et al., 2008). Moreover, OGG1 polymorphisms have been associated with Alzheimer disease and several cancers (Jacob et al., 2013; Kabzinski et al., 2018; Singh et al., 2017). Given the critical role of telomere crisis in driving carcinogenesis, our findings have important implications for how oxidative stress may drive genome instability and tumorigenesis. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING METHOD DETAILS B Cell lines, lentivirus production and CRISPR gene editing B Western blots B Acute singlet oxygen induction at telomeres B Repeated singlet oxygen production to induce chronic telomeric 8-oxoG B Telomeres restriction fragment analysis for oxidative lesion detection and mean telomere length B Immunofluorescence and telomere fluorescence in situ hybridization (FISH) B Quantitation of 53BP1, gH2AX or PAR foci colocalization with telomeric foci B Measurement of OGG1 and XRCC1 recruitment to telomeres B Quantitative telomere fluorescence in situ hybridization B Mitotic DNA synthesis assay and EdU labeling B Population doubling measurement B Colony formation assay B Telomeric chromatin immunoprecipitation (ChIP) analysis B Pulsed-Field Gel Electrophoresis of Cells in Agarose Plugs QUANTIFICATION AND STATISTICAL ANALYSIS

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. molcel.2019.04.024.

Molecular Cell 75, 117–130, July 11, 2019 127

ACKNOWLEDGMENTS We are grateful to Roderick O’Sullivan for providing HeLa LT cells, Anna Campalans for the pOGG1-EGFP plasmid, Marit Otterlei for the pEYFP-XRCC1 plasmid, and David Wilson for the pmCherry-NEIL1 plasmid. We also thank Ben Van Houten, Roderick O’Sullivan, Bret Freudenthal, Amy Whitaker, and the Opresko lab for critical reading of the manuscript and helpful discussions. We thank Sandy Schamus-Haynes and Ariana Detwiler for technical assistance. This work was supported by NIH grants K99ES027028 (to E.F.); R01ES022944, R01CA207342, and R01ES028242 (to P.L.O); R21/ R33ES025606 (to P.L.O., S.C.W., and M.P.B.); and R01EB017268 (to M.P.B.). This project used the UPMC Hillman Cancer Center CTIF and CF, which are supported in part by award P30CA047904. AUTHOR CONTRIBUTIONS E.F., M.P.B., and P.L.O. conceived the study. E.F., R.P.B., and P.L.O designed the experiments. E.F. performed most of the experiments. R.P.B. conducted telomere FISH after acute exposures and the 8-oxoG and DSB detection assays, and assisted with the chronic exposures. S.W.C. performed the time-lapse live-cell imaging experiments. M.P.B. provided the MG2I dye and 660-nm LED irradiator. S.U. conducted statistical analyses. E.F. and P.L.O. wrote the manuscript with assistance from the other authors.

Campalans, A., Amouroux, R., Bravard, A., Epe, B., and Radicella, J.P. (2007). UVA irradiation induces relocalisation of the DNA repair protein hOGG1 to nuclear speckles. J. Cell Sci. 120, 23–32. Casella, G., and Berger, R.L. (2002). Statistical Inference, Second Edition (Duxbury). de Lange, T. (2018). Shelterin-Mediated Telomere Protection. Annu. Rev. Genet. 52, 223–247. De Luca, G., Russo, M.T., Degan, P., Tiveron, C., Zijno, A., Meccia, E., Ventura, I., Mattei, E., Nakabeppu, Y., Crescenzi, M., et al. (2008). A role for oxidized DNA precursors in Huntington’s disease-like striatal neurodegeneration. PLoS Genet. 4, e1000266. Dilley, R.L., Verma, P., Cho, N.W., Winters, H.D., Wondisford, A.R., and Greenberg, R.A. (2016). Break-induced telomere synthesis underlies alternative telomere maintenance. Nature 539, 54–58. Fan, J., Otterlei, M., Wong, H.K., Tomkinson, A.E., and Wilson, D.M., 3rd (2004). XRCC1 co-localizes and physically interacts with PCNA. Nucleic Acids Res. 32, 2193–2201. Fazlieva, R., Spittle, C.S., Morrissey, D., Hayashi, H., Yan, H., and Matsumoto, Y. (2009). Proofreading exonuclease activity of human DNA polymerase delta and its effects on lesion-bypass DNA synthesis. Nucleic Acids Res. 37, 2854–2866.

DECLARATION OF INTERESTS

Fleming, A.M., Ding, Y., and Burrows, C.J. (2017). Oxidative DNA damage is epigenetic by regulating gene transcription via base excision repair. Proc. Natl. Acad. Sci. USA 114, 2604–2609.

M.P.B. is a founder, chief scientific officer, and member of the board of directors for Sharp Edge Labs, a company applying the FAP-fluorogen technology commercially. M.P.B has summitted a patent application entitled 20180280510 Activatable Two-Component Photosensitizers.

Fouquerel, E., Lormand, J., Bose, A., Lee, H.T., Kim, G.S., Li, J., Sobol, R.W., Freudenthal, B.D., Myong, S., and Opresko, P.L. (2016). Oxidative guanine base damage regulates human telomerase activity. Nat. Struct. Mol. Biol. 23, 1092–1100.

Received: November 2, 2018 Revised: March 4, 2019 Accepted: April 15, 2019 Published: May 14, 2019 REFERENCES Aeby, E., Ahmed, W., Redon, S., Simanis, V., and Lingner, J. (2016). Peroxiredoxin 1 Protects Telomeres from Oxidative Damage and Preserves Telomeric DNA for Extension by Telomerase. Cell Rep. 17, 3107–3114. Agnez-Lima, L.F., Melo, J.T., Silva, A.E., Oliveira, A.H., Timoteo, A.R., LimaBessa, K.M., Martinez, G.R., Medeiros, M.H., Di Mascio, P., Galhardo, R.S., and Menck, C.F. (2012). DNA damage by singlet oxygen and cellular protective mechanisms. Mutat. Res. Rev. Mutat. Res. 751, 15–28. Ahmed, W., and Lingner, J. (2018a). Impact of oxidative stress on telomere biology. Differentiation 99, 21–27. Ahmed, W., and Lingner, J. (2018b). PRDX1 and MTH1 cooperate to prevent ROS-mediated inhibition of telomerase. Genes Dev. 32, 658–669. Barnes, R.P., Fouquerel, E., and Opresko, P.L. (2019). The impact of oxidative DNA damage and stress on telomere homeostasis. Mech. Ageing Dev. 177, 37–45. Bergoglio, V., Boyer, A.S., Walsh, E., Naim, V., Legube, G., Lee, M.Y., Rey, L., Rosselli, F., Cazaux, C., Eckert, K.A., and Hoffmann, J.S. (2013). DNA synthesis by Pol h promotes fragile site stability by preventing under-replicated DNA in mitosis. J. Cell Biol. 201, 395–408. Bizard, A.H., and Hickson, I.D. (2018). Anaphase: a fortune-teller of genomic instability. Curr. Opin. Cell Biol. 52, 112–119. Buisson, R., Niraj, J., Pauty, J., Maity, R., Zhao, W., Coulombe, Y., Sung, P., and Masson, J.Y. (2014). Breast cancer proteins PALB2 and BRCA2 stimulate polymerase h in recombination-associated DNA synthesis at blocked replication forks. Cell Rep. 6, 553–564. Cadet, J., Douki, T., Pouget, J.P., and Ravanat, J.L. (2000). Singlet oxygen DNA damage products: formation and measurement. Methods Enzymol. 319, 143–153.

128 Molecular Cell 75, 117–130, July 11, 2019

Godon, C., Cordelie`res, F.P., Biard, D., Giocanti, N., Me´gnin-Chanet, F., Hall, J., and Favaudon, V. (2008). PARP inhibition versus PARP-1 silencing: different outcomes in terms of single-strand break repair and radiation susceptibility. Nucleic Acids Res. 36, 4454–4464. Gomez, M., Wu, J., Schreiber, V., Dunlap, J., Dantzer, F., Wang, Y., and Liu, Y. (2006). PARP1 Is a TRF2-associated poly(ADP-ribose)polymerase and protects eroded telomeres. Mol. Biol. Cell 17, 1686–1696. Graham, M.K., and Meeker, A. (2017). Telomeres and telomerase in prostate cancer development and therapy. Nat. Rev. Urol. 14, 607–619. Gravells, P., Grant, E., Smith, K.M., James, D.I., and Bryant, H.E. (2017). Specific killing of DNA damage-response deficient cells with inhibitors of poly(ADP-ribose) glycohydrolase. DNA Repair (Amst.) 52, 81–91. Hamilton, M.L., Van Remmen, H., Drake, J.A., Yang, H., Guo, Z.M., Kewitt, K., Walter, C.A., and Richardson, A. (2001). Does oxidative damage to DNA increase with age? Proc. Natl. Acad. Sci. USA 98, 10469–10474. He, J., Wang, Y., Missinato, M.A., Onuoha, E., Perkins, L.A., Watkins, S.C., St Croix, C.M., Tsang, M., and Bruchez, M.P. (2016). A genetically targetable near-infrared photosensitizer. Nat. Methods 13, 263–268. Hegde, M.L., Mantha, A.K., Hazra, T.K., Bhakat, K.K., Mitra, S., and Szczesny, B. (2012). Oxidative genome damage and its repair: implications in aging and neurodegenerative diseases. Mech. Ageing Dev. 133, 157–168. Henderson, P.T., Delaney, J.C., Muller, J.G., Neeley, W.L., Tannenbaum, S.R., Burrows, C.J., and Essigmann, J.M. (2003). The hydantoin lesions formed from oxidation of 7,8-dihydro-8-oxoguanine are potent sources of replication errors in vivo. Biochemistry 42, 9257–9262. Henle, E.S., Han, Z., Tang, N., Rai, P., Luo, Y., and Linn, S. (1999). Sequencespecific DNA cleavage by Fe2+-mediated fenton reactions has possible biological implications. J. Biol. Chem. 274, 962–971. Herbert, B.S., Shay, J.W., and Wright, W.E. (2003). Analysis of telomeres and telomerase. Curr. Protoc. Cell Biol., Chapter 18, Unit 18.6. Hsu, G.W., Ober, M., Carell, T., and Beese, L.S. (2004). Error-prone replication of oxidatively damaged DNA by a high-fidelity DNA polymerase. Nature 431, 217–221.

Jacob, K.D., Noren Hooten, N., Tadokoro, T., Lohani, A., Barnes, J., and Evans, M.K. (2013). Alzheimer’s disease-associated polymorphisms in human OGG1 alter catalytic activity and sensitize cells to DNA damage. Free Radic. Biol. Med. 63, 115–125. Kabzinski, J., Walczak, A., Dziki, A., Mik, M., and Majsterek, I. (2018). Impact of the Ser326Cys polymorphism of the OGG1 gene on the level of oxidative DNA damage in patients with colorectal cancer. Pol. Przegl. Chir. 90, 13–15. Kakehashi, A., Ishii, N., Okuno, T., Fujioka, M., Gi, M., and Wanibuchi, H. (2017). Enhanced Susceptibility of Ogg1 Mutant Mice to Multiorgan Carcinogenesis. Int. J. Mol. Sci. 18, E1801. Kisurina-Evgenieva, O.P., Sutiagina, O.I., and Onishchenko, G.E. (2016). Biogenesis of Micronuclei. Biochemistry (Mosc.) 81, 453–464. Kolbanovskiy, M., Chowdhury, M.A., Nadkarni, A., Broyde, S., Geacintov, N.E., Scicchitano, D.A., and Shafirovich, V. (2017). The Nonbulky DNA Lesions Spiroiminodihydantoin and 5-Guanidinohydantoin Significantly Block Human RNA Polymerase II Elongation in Vitro. Biochemistry 56, 3008–3018.

Oikawa, S., Tada-Oikawa, S., and Kawanishi, S. (2001). Site-specific DNA damage at the GGG sequence by UVA involves acceleration of telomere shortening. Biochemistry 40, 4763–4768. Opresko, P.L., Fan, J., Danzy, S., Wilson, D.M., 3rd, and Bohr, V.A. (2005). Oxidative damage in telomeric DNA disrupts recognition by TRF1 and TRF2. Nucleic Acids Res. 33, 1230–1239. O¨zer, O¨., and Hickson, I.D. (2018). Pathways for maintenance of telomeres and common fragile sites during DNA replication stress. Open Biol. 8, 180018. O¨zer, O¨., Bhowmick, R., Liu, Y., and Hickson, I.D. (2018). Human cancer cells utilize mitotic DNA synthesis to resist replication stress at telomeres regardless of their telomere maintenance mechanism. Oncotarget 9, 15836–15846. Parlanti, E., D’Errico, M., Degan, P., Calcagnile, A., Zijno, A., van der Pluijm, I., van der Horst, G.T., Biard, D.S., and Dogliotti, E. (2012). The cross talk between pathways in the repair of 8-oxo-7,8-dihydroguanine in mouse and human cells. Free Radic. Biol. Med. 53, 2171–2177.

Krokan, H.E., and Bjøra˚s, M. (2013). Base excision repair. Cold Spring Harb. Perspect. Biol. 5, a012583.

Petersen, S., Saretzki, G., and von Zglinicki, T. (1998). Preferential accumulation of single-stranded regions in telomeres of human fibroblasts. Exp. Cell Res. 239, 152–160.

Lee, J.Y., Okumus, B., Kim, D.S., and Ha, T. (2005). Extreme conformational diversity in human telomeric DNA. Proc. Natl. Acad. Sci. USA 102, 18938– 18943.

Polj
sak, B., and Fink, R. (2014). The protective role of antioxidants in the defence against ROS/RNS-mediated environmental pollution. Oxid. Med. Cell. Longev. 2014, 671539.

Liou, G.Y., and Storz, P. (2010). Reactive oxygen species in cancer. Free Radic. Res. 44, 479–496. Loayza, D., and De Lange, T. (2003). POT1 as a terminal transducer of TRF1 telomere length control. Nature 423, 1013–1018. Lonkar, P., and Dedon, P.C. (2011). Reactive species and DNA damage in chronic inflammation: reconciling chemical mechanisms and biological fates. Int. J. Cancer 128, 1999–2009. Lu, J., and Liu, Y. (2010). Deletion of Ogg1 DNA glycosylase results in telomere base damage and length alteration in yeast. EMBO J. 29, 398–409.

Rack, J.G., Perina, D., and Ahel, I. (2016). Macrodomains: Structure, Function, Evolution, and Catalytic Activities. Annu. Rev. Biochem. 85, 431–454. Ravanat, J.L., Di Mascio, P., Martinez, G.R., Medeiros, M.H., and Cadet, J. (2000). Singlet oxygen induces oxidation of cellular DNA. J. Biol. Chem. 275, 40601–40604. Reuter, S., Gupta, S.C., Chaturvedi, M.M., and Aggarwal, B.B. (2010). Oxidative stress, inflammation, and cancer: how are they linked? Free Radic. Biol. Med. 49, 1603–1616.

Maciejowski, J., and de Lange, T. (2017). Telomeres in cancer: tumour suppression and genome instability. Nat. Rev. Mol. Cell Biol. 18, 175–186.

Sanjana, N.E., Shalem, O., and Zhang, F. (2014). Improved vectors and genome-wide libraries for CRISPR screening. Nat. Methods 11, 783–784.

Maciejowski, J., Li, Y., Bosco, N., Campbell, P.J., and de Lange, T. (2015). Chromothripsis and Kataegis Induced by Telomere Crisis. Cell 163, 1641–1654.

Schreiber, V., Dantzer, F., Ame, J.C., and de Murcia, G. (2006). Poly(ADPribose): novel functions for an old molecule. Nat. Rev. Mol. Cell Biol. 7, 517–528.

Malinin, N.L., West, X.Z., and Byzova, T.V. (2011). Oxidation as ‘‘the stress of life’’. Aging (Albany N.Y.) 3, 906–910. Markkanen, E. (2017). Not breathing is not an option: How to deal with oxidative DNA damage. DNA Repair (Amst.) 59, 82–105. €bscher, U. (2012). A switch beMarkkanen, E., Castrec, B., Villani, G., and Hu tween DNA polymerases d and l promotes error-free bypass of 8-oxo-G lesions. Proc. Natl. Acad. Sci. USA 109, 20401–20406. McNeill, D.R., Paramasivam, M., Baldwin, J., Huang, J., Vyjayanti, V.N., Seidman, M.M., and Wilson, D.M., 3rd (2013). NEIL1 responds and binds to psoralen-induced DNA interstrand crosslinks. J. Biol. Chem. 288, 12426– 12436. Min, J., Wright, W.E., and Shay, J.W. (2017). Alternative Lengthening of Telomeres Mediated by Mitotic DNA Synthesis Engages Break-Induced Replication Processes. Mol. Cell. Biol. 37, e00226-17. Minocherhomji, S., Ying, S., Bjerregaard, V.A., Bursomanno, S., Aleliunaite, A., Wu, W., Mankouri, H.W., Shen, H., Liu, Y., and Hickson, I.D. (2015). Replication stress activates DNA repair synthesis in mitosis. Nature 528, 286–290. O’Sullivan, J.N., Bronner, M.P., Brentnall, T.A., Finley, J.C., Shen, W.T., Emerson, S., Emond, M.J., Gollahon, K.A., Moskovitz, A.H., Crispin, D.A., et al. (2002). Chromosomal instability in ulcerative colitis is related to telomere shortening. Nat. Genet. 32, 280–284. O’Sullivan, R.J., Arnoult, N., Lackner, D.H., Oganesian, L., Haggblom, C., Corpet, A., Almouzni, G., and Karlseder, J. (2014). Rapid induction of alternative lengthening of telomeres by depletion of the histone chaperone ASF1. Nat. Struct. Mol. Biol. 21, 167–174.

Sfeir, A., Kosiyatrakul, S.T., Hockemeyer, D., MacRae, S.L., Karlseder, J., Schildkraut, C.L., and de Lange, T. (2009). Mammalian telomeres resemble fragile sites and require TRF1 for efficient replication. Cell 138, 90–103. Singh, A., Singh, N., Behera, D., and Sharma, S. (2017). Genetic Investigation of Polymorphic OGG1 and MUTYH Genes Towards Increased Susceptibility in Lung Adenocarcinoma and its Impact on Overall Survival of Lung Cancer Patients Treated with Platinum Based Chemotherapy. Pathol. Oncol. Res. Published online December 5, 2017. https://doi.org/10.1007/s12253-0170372-6. Smith, S. (2018). Telomerase can’t handle the stress. Genes Dev. 32, 597–599. Srivastava, D.K., Berg, B.J., Prasad, R., Molina, J.T., Beard, W.A., Tomkinson, A.E., and Wilson, S.H. (1998). Mammalian abasic site base excision repair. Identification of the reaction sequence and rate-determining steps. J. Biol. Chem. 273, 21203–21209. Steenken, S. (1997). Electron transfer in DNA? Competition by ultra-fast proton transfer? Biol. Chem. 378, 1293–1297. Takai, H., Smogorzewska, A., and de Lange, T. (2003). DNA damage foci at dysfunctional telomeres. Curr. Biol. 13, 1549–1556. Telmer, C.A., Verma, R., Teng, H., Andreko, S., Law, L., and Bruchez, M.P. (2015). Rapid, specific, no-wash, far-red fluorogen activation in subcellular compartments by targeted fluorogen activating proteins. ACS Chem. Biol. 10, 1239–1246. Utani, K., Kohno, Y., Okamoto, A., and Shimizu, N. (2010). Emergence of micronuclei and their effects on the fate of cells under replication stress. PLoS ONE 5, e10089.

Molecular Cell 75, 117–130, July 11, 2019 129

Van Houten, B., Santa-Gonzalez, G.A., and Camargo, M. (2018). DNA repair after oxidative stress: current challenges. Curr. Opin. Toxicol. 7, 9–16. Van Ly, D., Low, R.R.J., Frolich, S., Bartolec, T.K., Kafer, G.R., Pickett, H.A., Gaus, K., and Cesare, A.J. (2018). Telomere Loop Dynamics in Chromosome End Protection. Mol. Cell 71, 510–525.e6. von Zglinicki, T. (2002). Oxidative stress shortens telomeres. Trends Biochem. Sci. 27, 339–344. Wallace, S.S. (2013). DNA glycosylases search for and remove oxidized DNA bases. Environ. Mol. Mutagen. 54, 691–704. Wang, Z., Rhee, D.B., Lu, J., Bohr, C.T., Zhou, F., Vallabhaneni, H., de SouzaPinto, N.C., and Liu, Y. (2010). Characterization of oxidative guanine damage and repair in mammalian telomeres. PLoS Genet. 6, e1000951.

130 Molecular Cell 75, 117–130, July 11, 2019

Xie, Y., Yang, H., Cunanan, C., Okamoto, K., Shibata, D., Pan, J., Barnes, D.E., Lindahl, T., McIlhatton, M., Fishel, R., and Miller, J.H. (2004). Deficiencies in mouse Myh and Ogg1 result in tumor predisposition and G to T mutations in codon 12 of the K-ras oncogene in lung tumors. Cancer Res. 64, 3096–3102. Xu, G., Herzig, M., Rotrekl, V., and Walter, C.A. (2008). Base excision repair, aging and health span. Mech. Ageing Dev. 129, 366–382. Zeman, M.K., and Cimprich, K.A. (2014). Causes and consequences of replication stress. Nat. Cell Biol. 16, 2–9. Zimmermann, M., Kibe, T., Kabir, S., and de Lange, T. (2014). TRF1 negotiates TTAGGG repeat-associated replication problems by recruiting the BLM helicase and the TPP1/POT1 repressor of ATR signaling. Genes Dev. 28, 2477–2491.

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Anti-53BP1 rabbit polyclonal

Santa Cruz

Cat#sc-22760 SC-22760; RRID: AB_2256326

Anti-GFP rabbit polyclonal

GeneTex

Cat#GTX20290 GTX20290; RRID: AB_371415

Anti-OGG1 rabbit monoclonal

Abcam

Cat#ab124741 ab124741; RRID: AB_10973360

Anti-OGG1 rabbit polyclonal

Novus Biologicals

Cat#NB100-106 nb100-106; RRID: AB_10104097

Anti-Poly(ADP-ribose) (10H) mouse monoclonal

Enzo Life Sciences

Cat#ALX-803-220 ALX-804-220_10h; RRID:AB_2272987

Antibodies

Anti-TREX1 [EPR14985] rabbit monoclonal

Abcam

Cat#ab185228 ab185228;

Anti-Rap1 rabbit polyclonal

Bethyl Laboratories

Cat#A300-306a A300-306A/RAP1; RRID:AB_162721

Anti-RPA32/RPA2 [9H8] mouse monoclonal

Abcam

Cat#ab2175 9h8-ab2175; RRID:AB_302873

Anti-TRF1 (TRF-78) mouse monoclonal

Santa Cruz

Cat#sc-56807 trf1-antibody-trf-78; RRID:AB_793407

Anti-TRF2 rabbit polyclonal

Novus Biologicals

Cat#NB110-57130 trf-2-antibody_nb11057130; RRID:AB_844199

Anti-PARP1 C-2-10 mouse monoclonal

Enzo Life Sciences

Cat#BML-SA249 BML-SA249/parp-1; RRID:AB_11001350

Anti-Phospho-Chk1 (ser317) (D12H3) XP rabbit monoclonal

Cell signaling

Cat#12302 phospho-chk1-ser317-d12h3; RRID:AB_2783865

Anti-Phospho-Chk1 (ser345) (133D3) rabbit monoclonal

Cell signaling

Cat#2348 phospho-chk1-ser345-133d3; RRID:AB_331312

Anti-Chk1 (2G1D5) mouse monoclonal

Cell signaling

Cat#2360 chk1-2g1d5-mouse-mab; RRID:AB_2080320

Anti-Phospho-Chk2 (Thr68) (C13C1) rabbit monoclonal

Cell signaling

Cat#2197 anti-phospho-chk2; RRID: AB_2080501

Anti-Chk2 (1C12) mouse monoclonal

Cell signaling

Cat#3440 chk2-1c12-mouse-mab; RRID:AB_2229490

Anti-Phospho-RPA32 (S4/S8) rabbit polyclonal

Bethyl Laboratories

Cat#A300-245A A300-245A/ Phospho+RPA32; RRID:AB_210547

Anti-gammaH2Ax (Ser139) mouse monoclonal

SantaCruz

Cat#sc-517348 p-histone-h2a-x-antibodyser-139; RRID:AB_2783871

bis[4-(dimethylamino)phenyl](4 -(3carboethoxypropyl)-3,5-diiodo-phenyl)chloride (MG-2I)

He et al., 2016

N/A

Chemicals, Peptides, and Recombinant Proteins

Potassium Bromate KBrO3

Sigma

cat#309087; CAS: 7758-01-2

Sodium Azide NaN3

Fisher Chemical

Cat#S227I; CAS: 26628-22-8

Deferoxamine mesylate salt

Sigma

Cat#D9522; CAS: 138-14-7

Butylated hydroxytoluene

Sigma

Cat#W218405; CAS: 128-37-0

ABT-888 (veliparib)

Selleck chemicals

Cat#S1004; CAS: 912444-00-9

PDD00017273

Sigma

Cat#SML1781; CAS: 1945950-21-9

Cdk1 Inhibitor IV, RO-3306

Millipore

Cat#217699 (Continued on next page)

Molecular Cell 75, 117–130.e1–e6, July 11, 2019 e1

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Mirin

Sigma

Cat#M9948-5MG

RAD51 Inhibitor B02

Sigma

Cat#SML0364-5MG

FPG

NEB

Cat#M0240L

APE1

NEB

Cat#M0282L

Human OGG1

NovusBiologicals

Cal#NBP1-45318

Si nuclease

ThermoFisher

Cat#EN0321

pGEM-T Easy Vector System I

Promega

Cat#A1360

CellLightTM Histone2B-GFP, BacMam 2.0

TheroFisher Sceintific

Cat#C10594

Click-iTTM Edu Alexa FluorTM 594 Imaging Kit

TheroFisher Sceintific

Cat#C10340

This paper

https://doi.org/10.17632/25sbxyt8tx.1

HeLa LT

Gift from Dr. Roderick O’Sullivan (University of Pittsburgh)

N/A

U2OS

ATCC

N/A

Forward Primer 1 for HeLaFAP OGG1ko clones CGCCATGCCCGGTTAAATTTTTG

IDT

N/A

Reverse Primer 1 for HeLaFAP OGG1ko clones AGTGACTTATGTCCAAGAACCCT

IDT

N/A

Forward Primer 3 for HeLaFAP OGG1ko clones GAACTTAGGAAAAGCACTCTTGT

IDT

N/A

Reverse Primer 3 for HeLaFAP OGG1ko clones TGGTCTTTCTGAAATTCATTCA AAGGG

IDT

N/A

(TTAGGG)4

IDT

N/A

(CCCTAA)4

IDT

N/A

Critical Commercial Assays

Deposited Data Mendeley Dataset Experimental Models: Cell Lines

Oligonucleotides

Recombinant DNA pLVX-IRES-puro

Clontech

pcDNA3.1-KozakATG-dL5-2XG4S-mCer3

Addgene

#73207, Telmer et al., 2015

pLentiCRISPR v2 gRNA1, OGG1 targeting sequence (exon 2: GTGTACTAGCGG ATCAAGTA)

GeneScript.

N/A

pLentiCRISPR v2 gRNA3, OGG1 targeting sequence (exon 4: GCTACGAGAGTC CTCATATG)

GeneScript.

N/A

pLKO1-puro PARP1 shRNA4 (sequence: CCGGCCGAGAAATCTCTTACCTCAAC TCGAGTTGAGGTAAGAGATTTCTCG GTTTTT)

Sigma MISSION shRNA

SHCLNG-NM_001618 TRCN0000007930 Clone ID: NM_001618.2-1176s1c1

pLKO1-puro PARP1 shRNA5 (sequence: CCGGGCAGCTTCATAACCGAAGATTCT CGAGAATCTTCGGTTATGAAGCTG CTTTTT)

Sigma MISSION shRNA

SHCLNG-NM_001618 TRCN0000007929 Clone ID: NM_001618.2-2715s1c1

pCMV-VSV-G

Addgene, gift from Dr. Bob Weinberg

Cat#8454

psPAX2

Addgene, gift from Dr. Didier Trono

Cat#11260

pOGG1-EGFP plasmid

Gift from Dr. Anna Campalans (CEA, France)

Campalans et al., 2007 (Continued on next page)

e2 Molecular Cell 75, 117–130.e1–e6, July 11, 2019

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

pEYFP-XRCC1 plasmid

Gift from Dr. Marit Otterlei (NTNU, Normway)

Fan et al., 2004

pmCherry-NEIL1 plasmid

Gift from Dr. David Wilson (NIA, USA)

McNeill et al., 2013

Nikon

N/A

Software and Algorithms NIS Elements AR Prism 7

Graph Pad software

N/A

R

RStudio

N/A

AlphaView

Proteinsimple

N/A

TelC-Alexa488 (CCCTAACCCTAACCCTAA)

PNA Bio

Cat#F1004

CENPB-Cy5 (Pan centromere probe. ATTCGTTGGAAACGGGA)

PNA Bio

Cat#F3005

Other: Peptide Nucleic Acid Probes

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for reagents should be directed to and will be fulfilled by the Lead Contact, Patricia L. Opresko ([email protected]). METHOD DETAILS Cell lines, lentivirus production and CRISPR gene editing HeLaFAP and U2OS-FAP cells were obtained by transfecting pLVX-FAP-mCer-TRF1 plasmid in HeLa1211 (also called HeLa LT) cells (O’Sullivan et al., 2014) or U2OS cells followed by selection in 500 mg/ml G418 (GIBCO) and single cell cloning. Cells displaying exclusive localization of the FAP-mCer-TRF1 construct at telomeres were selected. HeLa LT cells were a generous gift from R. O’Sullivan (University of Pittsburgh) and U2OS were from ATCC. The pLVX-FAP-mCer-TRF1 plasmid was generated by subcloning the dL52XG4S-mCer3 cassette from pcDNA3.1-KozATG-dL5-2XG4S-mCer (Addgene plasmid #73207) (Telmer et al., 2015) into pLVXIRES-Neo (Clontech) in frame with, and 50 to, the human TRF1 cDNA. Cells were cultured at 5% oxygen in Dulbecco’s Modified Eagle Medium (DMEM) containing 4g/l glucose (GIBCO) and supplemented with 10% Fetal Bovine Serum (GIBCO), 1x penicillin/streptomycin (Life Technologies) and 500 mg/ml G418. OGG1 knock out cells were obtained by infection of HeLaFAP cells with lentivirus expressing S. pyogenes Cas9 and guide RNAs targeting OGG1 exon 2 (gRNA1, sequence GTGTACTAGCGGATCAAGTA) or exon 4 (gRNA3, sequence GCTACGAGAGTCCTCA TATG). Guide RNAs were designed and validated for uniquely targeting the human OGG1 gene by Feng Zheng’s laboratory (Broad institute) (Sanjana et al., 2014), and were incorporated into pLentiCRISPR v2 vectors (GenScript). For lentiviral production, pLentiCRISPR v2 vectors were encapsulated in viral particles using the Gecko system. Approximately 2.5x105 HEK293T cells (ATCC) were seeded in a 6-well plate. The next day 500 ng of pLentiCRISPR v2 vector was co-transfected with 50 ng the packaging plasmid pVSVg (Addgene 8454) and 500ng of envelope plasmid psPAX2 (Addgene 12260) in a total volume of 37.5 mL OPTI-MEM (GIBCO). In parallel, 3 mL of Fugene6 (Promega) was added to a separate tube containing 12 mL of OPTI-MEM media. The Fugene6 mix was then added to the 3 plasmid mix and incubated for 30 min at room temperature. The transfection mix was added dropwise to the cells and incubated 18 hr at 37 C and 5% oxygen. Next the media was replaced with 2.5 mL of fresh high-BSA growth media (DMEM supplemented with FBS (HyClone #SH30071.03), 6.4 g BSA (VWR #14230-738), 5 mL 100x penicillin/streptomycin) and incubated for 24 hr. The media containing the lentivirus particles was harvested and filtered through a 0.2 mm filter and replaced with 2.5 mL fresh high-BSA growth media for a second harvest. The first harvest was added with 2.5 mL 10 mg/ml polybrene (Millipore #TR-1003-G) to the HeLaFAP cells in a 6-well plate and incubated overnight at 37 C. This procedure was repeated with the second lentiviral harvest. The infected cells were then washed and recovered for 8 to 10 hr in DMEM before selection with 1.5 mg/ml puromycin for 2 days. Cells were cultured in a 75 cm2 flask under selective pressure for an additional 2 days before harvesting for protein extraction and single cell cloning without puromycin. Each expanded clone was tested for OGG1 expression by western blot using OGG1 antibody (NovusBio #NB100-106). Western blots Cells were resuspended in 400 mM NaCl buffer and whole cell extracts were prepared by freeze and thaw cycles followed by 15 min centrifugation at 14000 rpm. Protein amounts were measured using Bradford reagent (Sigma). TRF1 (1:1000, TRF-78 Santa Cruz #sc56807), b-actin (1:20,000, Sigma #A5441), OGG1 (1:1000, NovusBio #NB100-106), C2-10 anti PARP1 (1:1000, Enzo Life Sciences

Molecular Cell 75, 117–130.e1–e6, July 11, 2019 e3

#BML-SA249), and Phospho RPA32 (S4/S8) (1:1000, Bethyl #A300-245A) antibodies were used. The following antibodies from Cell Signaling were used at 1:1000 dilution: Phospho-Chk1 (Ser317) (#D12H3) XP rabbit mAb), Phospho-Chk1 (Ser345) (#133D3 rabbit mAb), Chk1 (#2G1D5 mouse mAb), Phospho-Chk2 (Thr68) (#C13C1 rabbit mAb), and Chk2 (#1C12 mouse mAb). Acute singlet oxygen induction at telomeres HeLaFAP or U2OS-FAP cells were incubated for 15 min at 37 C and 5% O2 in OptiMEM (GIBCO) with 100 nM MG2I dye final concentration (unless indicated otherwise). Cells were then exposed to a high intensity 660 nm LED light at 100 mW/cm2 for 5 min (unless indicated otherwise) to trigger excitation of the FAP-bound MG2I dye and the production of singlet oxygen. Repeated singlet oxygen production to induce chronic telomeric 8-oxoG 2x105 cells were seeded in 10 cm dishes and treated with 100 nM MG2I dye and 5 min 660 nm light exposures as described above, every 24 hours for 3 consecutive days. Every 4th day, cells were harvested to perform analyses and 2x105 cells were re-seeded to undergo a new cycle of exposures once a day for 3 days. Cells were submitted to a total of 18 exposures during 24 days. Telomeres restriction fragment analysis for oxidative lesion detection and mean telomere length Telomere length analysis was performed as previously described (Fouquerel et al., 2016) with slight modification. For determining mean telomere lengths, 3 mg of genomic DNA were digested with a cocktail of 4 restriction enzymes (RsaI, AluI, HindIII, MnlI) for 16 h at 37 C. For 8-oxoG lesions detection, genomic DNA was isolated from cells using the QIAGEN Tip-100 according to the manufacturer’s instructions, except 100 mM of butylated hydroxytoluene (Sigma; DMSO solvent) and deferoxamine mesylate (Sigma; Water solvent) were added to both lysis buffers to reduce background oxidation. After resuspension in TE, DNA was treated with FPG (NEB, 2.7U/ mg DNA), OGG1 (Novus, 125 nM), and APE1 (NEB, 3.3U/ mg DNA) enzymes alone or in combination for 2 hours at 37 C in 1X Cutsmart buffer (NEB). Then telomere restriction fragments were released from bulk genomic DNA by digestion with AluI, HphI, MnlI, and HinfI (0.5 U each, NEB) overnight at 37 C. Single-stranded breaks or single nucleotide gaps were then converted to double strand breaks by adding 2U of S1 nuclease (ThermoFisher) in 1x S1 Nuclease buffer at 37 C for 1 hour. After adding 6X loading dye, an aliquot of each reaction was removed to run on an agarose gel as a loading control. Telomere restriction fragments for length analysis or oxidative lesion detection were resolved by pulse field gel electrophoresis on a 1% Certified Megabase Agarose gel (Biorad) in 0.5 X TBE. Samples were electrophoresed at 14 C and 6V with a 1 s initial switch, and 6 s final switch for 12-15 hours using a CHEF-DR II apparatus (BioRad). The gel was dried under vacuum at 50 C for 2 hours and stained with SYBR green, before denaturation (0.5M NaOH, 1.5M NaCl) and neutralization (0.5M Tris pH 8, 1.5M NaCl). The gel was prehybridized with Church buffer (0.25M sodium phosphate buffer pH 7.2, 1mM EDTA, 1% BSA, 7% SDS) before hybridizing with 32P labeled telomere probes (mix of (TTAGGG)4 and (CCCTAA)4) in Church buffer overnight at 42 C. The gel was washed with 2X SSC, 0.1% SDS, 0.1X SSC, and 2X SCC 10 min each, before exposing on a phosphorimaging screen. Mean telomere restriction fragment lengths (MTL) were calculated using ImageQuant and Telorun analysis as described previously (Herbert et al., 2003). In samples for oxidative lesion detection, the fold increase in oxidative lesions was calculated from MTLs as described previously (Lu and Liu, 2010). To calculate the percent of telomeric DNA cleaved by digestion with repair enzymes and/or S1 nuclease, the telomere signal intensity of DNA migrating below (cleaved) the intact telomeres (bulk) was divided by the total telomere intensity in the lane. Immunofluorescence and telomere fluorescence in situ hybridization (FISH) Cells grown on coverslips were placed in 6-well plates and fixed in 4% formaldehyde in PBS for 10 min at room temperature, except for TREX1 staining fixation was on ice in 20 C acetone for 10 min, and for PAR staining fixation was on ice in 20 C methanol/ acetone (v/v) for 10 min. After three PBS washes, cells were incubated in PBS containing 0.2% Triton X-100 for 10 min, and blocked for 1 hour in blocking solution (10% goat serum, 1% BSA in PBS). Rabbit 53BP1 (1:500 dilution, Santa Cruz #H-300), mouse monoclonal phospho-histone H2AX (Ser 139) (1:1000 dilution, Santa Cruz #sc-517348), rabbit monoclonal TREX1 (1:250 dilution, Abcam #185228), mouse monoclonal a-Tubulin (1:200 dilution, clone DM1A Sigma #T9026), rabbit RAP1 polyclonal (1:500 dilution, Bethyl laboratories #A300-306A), or monoclonal 10H (Enzo Life Sciences #ALX-803-220) antibodies were diluted in 1% BSA in PBS and incubated overnight at 4 C. Cells were washed in PBS three times for 10 min each at room temperature with mild shaking and incubated with secondary antibody (1:1000 dilution of goat anti-mouse Alexa 594, goat anti-rabbit Alexa 594, or anti-rabbit Cy5 (Invitrogen)) for 1 hour. After three PBS washes, cells were fixed for 10 min in 2% formaldehyde at room temperature and dehydrated in 70%, 90% and 100% ethanol for 5 min. Telomeric PNA probe (PNA Bio, F1001 3xCCCTAA) was diluted 1:200 in hybridization buffer (70% formamide, 10mM Tris HCl pH 7.5, 1x Maleic Acid buffer, 1x MgCl2 buffer) and boiled for 5 min at 85 C. Samples were incubated for 10 min on a hot plate at 75 C and then at room temperature for 2 h in the dark. After two washes in hybridization wash buffer (70% formamide, 10 mM tris HCl pH 7.5), slides were rinsed in PBS, incubated 10 min at room temperature in PBS containing 10 mg/ml DAPI and mounted with antifade gold. Image acquisition was performed with a Nikon Ti inverted fluorescence microscope. Z stacks of 0.2 mm thickness were captured and images were deconvolved using NIS Elements Advance Research software algorithm. For OGG1 immunofluorescence, the pOGG1-EGFP plasmid (a kind gift from Anna Campalans, UMR217, CEA/CNRS Fontenay aux Roses, France) (Campalans et al., 2007) was transfected using Lipofectamine 2000 (Invitrogen) 2 days before treatments to induce telomeric singlet oxygen. Cytosolic pre-extraction was conducted before fixation in formaldehyde using CSK buffer (100 mM NaCl, 3 mM MgCl2, 300 mM glucose, 10 mM Pipes pH 6.8, 0.5% Triton X-100, and protease inhibitors tablet (Roche)). Rabbit monoclonal

e4 Molecular Cell 75, 117–130.e1–e6, July 11, 2019

OGG1 antibody (Abcam, ab124741) (diluted at 1:100 in 1% BSA) and goat anti-rabbit Alexa 594 secondary antibody were used to detect OGG1, followed by telo-FISH staining as described above. XRCC1 and NEIL1 recruitment were assessed after transfection of pEYFP-XRCC1 plasmid (a kind gift from Marit Otterlei, NTNU, Norway) (Fan et al., 2004) and mCherry-NEIL1 (a kind gift from David Wilson, NIA, USA) (McNeill et al., 2013) respectively, using Lipofectamine 2000. Repair proteins were visualized in the YFP and mCherry channels to detect repair proteins, and telomeres were visualized by examining FAP-mCer-TRF1 in the CFP channel with a Nikon Ti inverted fluorescence microscope. Quantitation of 53BP1, gH2AX or PAR foci colocalization with telomeric foci The number of 53BP1, gH2AX and PAR foci colocalizing with telomeres were measured using NIS Element Advanced Research software (Nikon) after deconvolution. Briefly, the measurement feature of the software was used to create binary layers based on intensity and defining binary objects corresponding to 53BP1, gH2AX or PAR foci and telomere foci. An intensity threshold was set up for an image from the control experiment (untreated) for each channel (threshold FITC for telomeres and threshold Cy3 for 53BP1, gH2AX or PAR) and held constant for analyzing images. The binary objects corresponding to areas smaller than 0.05 mm were discarded. The intersection tool was then used to create a third binary layer corresponding to the 53BP1, gH2AX or PAR binary objects overlapping with telomere binary objects. Each nucleus was isolated using the region of interest (ROI) identification tools, based on DAPI staining, and the number of 53BP1, gH2AX or PAR foci and intersections per ROI were exported to Excel for data batch analysis using RStudio (open source). Measurement of OGG1 and XRCC1 recruitment to telomeres Using NIS Element Advanced Research software (Nikon) each nucleus was first isolated using the region of interest (ROI) identification tools, based on DAPI staining. Then, a binary layer corresponding to telomere foci was created based on intensity threshold. A new ‘‘background’’ binary layer was obtained by subtracting the telomere binary layer and the ROI binary layer. Finally, the intensity of OGG1 and XRCC1 signals within the background layer and the telomere layer were exported to Excel for analysis. The intensities of OGG1 and XRCC1 foci at telomeres were then obtained by subtracting the back ground intensity from the OGG1 and XRCC1 intensities measured on the telomere binary layer. Quantitative telomere fluorescence in situ hybridization Chromosome metaphase preparations and quantitative telomere FISH were performed as described previously (Fouquerel et al., 2016). Briefly, cells were treated with 0.05 mg/ml colcemid for 2 hr and harvested with trypsin, followed by incubation in 75 mM KCl hypotonic buffer for 8 min at 37 C and fixation in methanol and glacial acid acetic (3:1). Cells were dropped on microscope slides and dried overnight before fixation in 4% formaldehyde. Slides were treated with RNaseA and Pepsin at 37 C, and then dehydrated in successive ethanol solution of 70%, 90% and 100%. Telomere and centromere FISH was conducted using an Alexa 488 conjugated telomeric PNA probe (PNA Bio, F1004 TelC-Alexa488 (CCCTAA)3) and a Cy5 conjugated CENPB probe (PNA Bio, F3005 Pan-centromere ATTCGTTGGAAACGGGA) overnight at 4 C, and then slides were washed in hybridization buffer and mounted overnight at room temperature in Diamond AntiFade (Invitrogen). In order to measure single telomere signal intensities, we used Nikon NIS Elements AR software. Each chromosome was isolated as single ROI and telomeres were selected as objects creating a binary layer based on their intensities. The binary object intensities were then collected and separately binned into intervals of 1000 to obtain histograms using RStudio. Mitotic DNA synthesis assay and EdU labeling After 18 dye + light treatments or 16 h treatment with 0.4 mM APH, cells were allowed to recover for 8h prior to an 8h incubation with 7 mM Cdk1 inhibitor RO3306 (Millipore). Where indicated, cells were incubated with MRE11 inhibitor Mirin (100 mM; Sigma) or RAD51 inhibitor B02 (100 mM; Sigma) during the last hour of Cdk1 inhibitor incubation. Cells were washed twice with PBS and incubated in fresh media containing 1x EdU and 50ng/ml concentrations colcemid with or without MRE11 or RAD51 inhibitor for 1h prior to harvest. Metaphase spreads were prepared as described above and EdU staining performed using Click-iTTM EdU Alexa FluorTM 594 imaging kit (ThermoFisher) after telomere FISH staining. Population doubling measurement The population doubling (PD) values were calculated using the mathematical formula PD = [(ln(N2)) - (ln(N1))] / ln(2). N1 is the initial number of cells plated and N2 the final number of cells counted. The PD curves were obtained using the sum of the individual PDs calculated every 4 days. Colony formation assay Cells were seeded in 6 cm dish 24 h prior to treatment with dye + light as described above. After exposures, cells were harvested, counted and 1000 cells were seeded in 6 cm dishes in triplicate for each condition and incubated for 10 days at 37 C and 5% O2. Cells were then fixed with 4% formaldehyde in PBS for 15 min at room temperature and colonies stained using a 0.1% crystal violet, 20% methanol solution for 30 min at room temperature. The plates were washed under running water and dried overnight before imaging with FluorChemTM system (Proteinsimple). The colonies were counted using Alphaview software.

Molecular Cell 75, 117–130.e1–e6, July 11, 2019 e5

Telomeric chromatin immunoprecipitation (ChIP) analysis Telomeric DNA ChIP was done as previously described (Loayza and De Lange, 2003) with slight modifications. Cells were grown on 150 mm dishes until 90% confluence and treated 1h with 40 mM KBrO3 or pre-incubated with 100 nM MG2I dye followed by a 15 min exposure to the 660 nm light. Cells were washed twice in PBS and crosslinked with 1% formaldehyde in PBS for 30 min. Crosslinking was stopped by adding 1.5 M glycine to a final 0.2 M concentration. Cells were harvested by scrapping in ice cold PBS. Cell pellets were resuspended in 2 mL lysis buffer. Sonication was performed using a COVARIS Focused Ultrasonicator M220 in 1 mL adapted tubes with following parameters: PIP 75, Duty Factor 10% and 200 cycles per burst. Processing times were 2, 2, 4, 4, 3 and 5 min with 30 s break in between. After centrifugation, 400 mL of sheared chromatin was diluted with 1600 mL of dilution buffer and then incubated over night at 4 C with 4 mg TRF2 antibody (NB110-57130). Immunoprecipitation was performed the following day using Protein A/G Plus agarose (Thermo Scientific #20423) for 2-3 hours at 4 C. The agarose beads were washed on ice and elution was performed at room temperature. Eluted DNA was then dot blotted and telomeric DNA quantified using 32P labeled C rich telomere probe ((CCCTAA)3). The presence of genomic DNA in elution and input fractions was assessed using 32P labeled Alu probe. Pulsed-Field Gel Electrophoresis of Cells in Agarose Plugs The protocol for detecting double strand breaks by PFGE using a CHEF-DR II apparatus was followed according to the manufacturer’s instructions (BioRad) as described previously (Buisson et al., 2014). Briefly, cells were harvested by trypsinization, washed with PBS, and counted. 500,000 cells were embedded in 0.75% Clean Cut Agarose and allowed to solidify, before digesting overnight with Proteinase K at 50 C. The plugs were washed four times for 1 hour, before loading into a 1% agarose gel. The gel was run with 0.5X TBE at 14 C with a two-block program; block 1: 12 hr, 0.1 s initial, 30 s final, at 6V/cm; block 2: 12 hr 0.1 s initial, 5 s final, 3.8V/cm. The gel was then dried 2 hours at 50 C before staining with SYBR Green and imaging on a Typhoon. QUANTIFICATION AND STATISTICAL ANALYSIS Statistical analyses were performed with Prism 8 (GraphPad Software). For Figures 2B, 2D, 2F, 2G, 3C, 3E–3G, 4B, 4C, 5D, 5H, 5I, and 6C–6H, a one-factor ANOVA was used at a 95% confidence level (Turkey’s honest significance test). For Figures 1F, 5B, 7B, 7D, and 7I, a multiple comparisons two-factor ANOVA was used at a 95% confidence level (Turkey’s honest significance test). RStudio integrated development environment for R language was also used for Figures S4F–S4H, S5C, and 5E–5G as described below. Figures S4G–S4I: For each treatment we conducted three independent experiments and computed the survival rate (slope of the recovery). We next compared the survival between each treated cell lines (Figures S4H and S4I) for each dye concentration with the survival of untreated HeLaFAP cells (Figure S4G) by performing Welch’s two-sided t test using the set of three independent experiments. We found that the difference between mean recoveries of treated and untreated HeLaFAP cells were not significant at the significance level of 0.05. We, therefore, accepted the null hypothesis that treated HeLaFAP cells fully recover after exposures to dye and 5 or 10 min light. Figure 5C: The PD of dye + light treated cells was compared to that of untreated cells for each cell line. Five independent experiments were performed and separate Welch’s two-sided t test on the PD rate was conducted. We obtained p values of 0.0025, 0.0006 and 0.023 for HeLaFAP, OGG1ko1.4 and OGG1ko3.14 cells, respectively. Therefore, at the 0.05 significance level, we rejected the null hypothesis and accepted the alternative hypothesis that the PD of dye and light treated cells was significantly reduced for all cell lines. Figure S5C: To test whether repeated telomere exposures to singlet oxygen alter the population doubling (PD) time, we compared each treatment (dye only, light only, and dye + light) with untreated HeLaFAP cells. Four independent experiments were performed for each condition, and separate Welch’s two-sided t test on the PD rate was performed between untreated, dye-treated, light-treated, and dye + light treated cells. At the significance level of 0.05, the PD of dye-treated and lighttreated cells was not different from the PD of untreated cells. For dye + light treated cells, we obtained a p value of 0.00957. Therefore, at the 0.05 significance level, we rejected the null hypothesis and accepted the alternative hypothesis that the PD of dye + light treated HeLaFAP cells was significantly reduced. Figures 5E–5G: To test the significance of the enrichment of shortened telomeres in dye+light treated cells as visualized by the leftward shift of their histogram when compared with untreated cells, the non-parametric Kolmogorov-Smirnov test was performed. The Kolmogorov-Smirnov test statistic quantifies the separation between the cumulative distribution functions (CDFs) of the dye+light and untreated cells. These CDFs were computed from their respective histograms using standard probability theory [1]. Based on the test statistic, the null hypothesis that telomere intensities for both dye+light and untreated cells were drawn from the same CDF was rejected at the 0.05 significance level with the p value being less than 0.0005. The test was separately performed for HeLaFAP and OGG ko cells.

e6 Molecular Cell 75, 117–130.e1–e6, July 11, 2019