- Email: [email protected]
Targeting expression of antimicrobial peptide CAMA-Syn by adenovirus vector in macrophages inhibits the growth of intracellular bacteria
Gene 630 (2017) 59–67
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Targeting expression of antimicrobial peptide CAMA-Syn by adenovirus vector in macrophages inhibits the growth of intracellular bacteria
MARK
Junlin Zhang1, Lilan Xie1, Dingfeng Xu, Shuohao Yue, Yi Li, Xiaohong Guo⁎, Xiaojing Lai⁎ Hubei Engineering Research Center of Viral Vector, Applied Biotechnology Research Center, Wuhan Institute of Bioengineering, Wuhan 30415, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Antimicrobial peptide CAMA-syn Macrophages Intracellular bacteria
Although purified and synthesized Cecropin A-magainin 2 (CAMA-syn) shows potent antibacterial activity in vitro, its ability to inhibit bacteria within mammal cells mediated by virus vector has not yet been investigated. To enhance its antimicrobial potential and reduce systemic side effects, it would be desirable to deliver CAMAsyn in macrophages by adenovirus vector. In this study,recombinant adenovirus Ad-MSP-CAMA/GFP were used to infect macrophages RAW264.7 cells in vitro and macrophages cells of lungs in vivo and the expression of CAMA-syn was detected by RT-PCR and observation of co-expression of GFP. Antimicrobial activity in cells was evaluated by colony enumeration. The results showed that expression of CAMA-syn in macrophages conferred antimicrobial activity against a series of bacteria, including E. coli and BCG(Bacillus Calmette-Guérin). To establish BCG infection animal model, 40 Kunming mice were randomly divided into the following four groups: adenoviral delivery of Ad-MSP-CAMA/GFP, Ad-CMV-CAMA/GFP, empty-virus Ad-GFP, and control PBS, respectively. The expression of CAMA-syn in mouse was confirmed by real-time PCR and GFP co-expression. In brief, 3 days after injection of adenoviral vector, mice were scarified, different tissues were sectioned and homogenized and colony-forming efficiency by these treated tissues was determined. The colony-forming efficiency of Ad-MSP-CAMA/GFP (78.31%) and Ad-CMV-CAMA/GFP (61.68%) showed significant reduction compared to control groups. No inhibition of bacterial colony was observed from tissues treated by the PBS or empty-virus control. In conclusion, our results demonstrated that macrophages-specific expression of antimicrobial peptide CAMA-syn in macrophages inhibited the growth of intracellular bacteria, providing a promise approach for the control of refractory intracellular infection.
1. Introduction Intracellular bacteria, especially Mycobacterium tuberculosis, are important pathogenic microbes that pose a serious threat to human health. It is estimated that one third of the world's population are infected with M. tuberculosis. In nine out of ten cases, M. tuberculosis persists in a latent state throughout an individual's lifetime. The ability of M. tuberculosis to survive and multiply within macrophages makes these host cells an ideal niche for persisting microbes (Lapointe and Labrie, 2001). The intracellular persistence of bacteria not only protects them from the human immune response, but also produces bacteria from inactivation by most antibiotics, resulting in drug resistance and making the treatment of intracellular infection disease refractory (Babu and Meenakshi, 1997; Ji et al., 1994; Ohta et al., 1990). Killing of the intracellular Tubercle bacilli is a key requirement for
efficient tuberculosis treatment, yet identifying potent inhibitors has been hampered by labor-intensive techniques and lack of validated targets. As one of the most evolutionally conserved components of the innate immune system in various species, antimicrobial peptides have shown highly efficient antibacterial activity against a broad spectrum of pathogens including intracellular bacteria and have emerged as promising therapeutic agents for infectious diseases (Jacobsen et al., 2011; Talactac et al., 2017). CA (Cecropin A) and MA (magainin 2) display powerful lytic activity against both gram positive and negative bacteria, but have a less cytotoxic effect against human erythrocytes and other eukaryotic cells. Cecropin A-magainin 2 (CAMA) hybrid peptides comprising the N-terminal amphipathic basic region of CA and the Nterminal hydrophobic region of MA also exhibited higher antibacterial and antitumor activities, yet showed no hemolytic activity at 100 μg/ mL (Oh et al., 1999; Oh et al., 2000). It was reported that the hybrid
Abbreviations: Ad, adenovirus; MSP, macrophage-specific promoter; CMV, cytomegalovirus; PBS, phosphate buffer saline; GFP, green fluorescent protein; BCG, Bacillus CalmetteGuerin; GAPDH, glyceraldehyde-3-phosphatedehydrogenase ⁎ Corresponding authors. E-mail addresses: [email protected] (X. Guo), [email protected] (X. Lai). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.gene.2017.07.079 Received 15 February 2017; Received in revised form 19 June 2017; Accepted 31 July 2017 Available online 05 August 2017 0378-1119/ © 2017 Published by Elsevier B.V.
Gene 630 (2017) 59–67
J. Zhang et al.
peptide analogue CAMA-syn with substitutions of Ile10 and Ser16 with Lys in CAMA led to the increasing of total positive charge, a better antibacterial activity and lower cytotoxicity (Jeong et al., 2009). CAMA-syn exhibited antimicrobial activity against a broad range of microorganisms, such as E. coli, P. aeruginosa, S. aureus, B. subtilis and E. faecalis. (Jeong et al., 2009; Zhang et al., 2012). Thus, this hybrid peptide possesses potent therapeutic potential against bacterial infections in transgenic animals. Transient cutaneous transgene expression may be a potential alternative to the application of synthetically derived proteins in the treatment of tuberculosis. Therefore, it is necessary to focus on a highly effective transient gene delivery system to promote local tissue healing factors. Compared to other established gene transfer methods, including retroviruses and cationic lipids, adenovirus is independent of cell division state. Furthermore, it has been previously demonstrated that adenovirus transduced effectively cutaneous cell, such as adipocytes, fibroblasts and keratinocytes (Jones et al., 2008; Pohin et al., 2016; Woo et al., 2015). Normal macrophages can be efficiently transfected with viral and noviral expression systems, but little is known about the feasibility of adenoviral gene delivery in lungs. The goal of this study is to investigate the feasibility of transient cutaneous adenoviral gene delivery of hybrid antimicrobial peptide CAMA-syn with macrophages-specific promoter into weak bovine tubercle bacilli infected lung. Our results demonstrated that macrophages-specific expression of antimicrobial peptide CAMA-syn in macrophages inhibited the growth of intracellular bacteria, indicating that this gene delivery system is a promise approach for the control of refractory intracellular infection.
2.4. Reverse transcription polymerase chain reaction (RT-PCR) and realtime PCR Total RNA was extracted from cells using RNAiso Reagent (Takara Biotechnology Co. Ltd., China) and cDNA was synthesized from total RNA with reverse transcriptase M-MLV (Takara Biotechnology Co. Ltd.). Both steps were carried out according to the manufacturer's instructions. Real-time PCR was carried out using an ABI 7500 fast machine and 7500 Software v2.0.5 (7500 Fast Real-Time PCR System, ABI, Grand Island, NY). The mouse GAPDH (Glyceraldehyde-3-phosphatedehydrogenase) gene as the reference gene was amplified in parallel with the target gene to allow for gene expression normalization, and the 2− ΔΔCt was used for quantification. Real-time PCR amplification was carried out as step one at 94 °C for 1 min, followed by 40 cycles of a 2step loop: 15 s at 95 °C and 30 s at 60 °C (Xu et al., 2017). Relative quantification of the PCR products was calculated following normalization to GAPDH (glyceraldehyde-3-phosphatedehydrogenase). The experiments were performed in triplicate for each data point, and the mean of all the values was used for the final analysis. Primers used in this test were shown in following: GAPDH, forward: ACCACAGTCCATGCCATCAC, reverse: TCCACCACCCTGTTGCTGTA; CAMA-syn, forward: TCTTAGCTTTACTGCTCTGTGG, reverse: GCCCTTGCCGATCTT CTT; TNF-α, forward: AAGCCTGTAGCCCACGTCGTA, reverse: GGCACCACTAGTTG GTTGRCTTTG; IL-6, forward: CCACTTCACAAGTCGGCTTA, reverse: GCAAGTGCATCATCGTTGTTCATAC. 2.5. Recombinant adenovirus infection by tracheal injection Randomly choose mouse were retroperitoneally injected 0.1 ml 2% pentobarbital sodium, operative procedure was executed on holonarcosis after 5 min when mouse cannot turn over. Firstly, mouse neck was cut a small opening along the trachea using scissors after 75% alcohol sterilization. Then tweezers were used to carefully cut through the skin and subcutaneous tissue to expose a small trachea. 100 μL recombinant adenovirus (1 × 109 pfu) were then slowly injected into trachea. Finally, both ears of the mouse were picked up to make its body upright in order to make adenovirus solution easily into the lungs, and wounds were finally stitched. 3 days post-infection with different vectors, the mice were sacrificed and the tissues including heart, liver, spleen, lungs and kidneys were isolated and frozen until use, and total RNA was extracted from those tissues when needed. The expression of GFP was observed under Fluorescence microscope (Leica, Heidelberg, Germany). The relative expression of CAMA-syn and inflammatory cytokines were identified by real-time PCR.
2. Materials and methods 2.1. Bacterial strains and culture Salmonella abortusovis strain grown in LB (Luria–Bertani) broth or on LB agar plates was used for the antibacterial assays. BCG (Bacillus Calmette-Guerin) from the Fourth Military Medical University in Xi'an were grown in LUO media. Gram-negative bacterial strains (Salmonella abortusovis, Pasteurella anatis) and Gram-positive bacterial strains (Staphylococcus hyicus and Streptococcus suis) were routinely cultured in LB plates. 2.2. Cell lines and experiment animals Mouse macrophage cells RAW264.7 and human embryo kidney cells Phoenix were grown in DMEM medium (12100-046, Invitrogen, USA) supplemented with 10% fetal bovine serum (Gibco BRL, USA) at 37 °C in 5% CO2. Kunming mice from experimental animal center of the Fourth Military Medical University, 20 days old, male, were used to construct BCG infection animal model. All animal studies were approved by the Animal Ethics Committee of Wuhan Institute of Bioengineering (authorisation no. 2015010016), and were performed in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council, 2011).
2.6. Construction of BCG infection animal model Kunming mice 50, female, weight about 25 g, was implemented with BCG at MOI of 1 × 106 CFU through tracheal injection using Wakeham and Chen's methods (L. Chen et al., 2004; Wakeham et al., 2000). Observation of clinical pathology in mice for 2 weeks, mice were infected recombinant adenovirus Ad-MSP-CAMA/GFP, Ad-CMV-CAMA/GFP or Ad-GFP 100 μL (1 × 109 pfu) respectively. 3 days after recombinant adenovirus injection, lungs were get from euthanasia mice to make tissue homogenate for antimicrobial assays by calculating the colony-forming efficiency.
2.3. Generation of recombinant adenovirus and cell infection The CAMA-syn gene along with its macrophage-specific promoter (MSP) and GFP driven by IRES (MSP-CAMA/GFP) was digested from plasmid pMSP-CAMA with SalI and ApaI, and then was inserted into pAdTrack to generate the recombinant shuttle vector pAd-MSP-CAMA/ GFP. Recombinant adenovirus encoding CAMA-syn driven by MSP was named as Ad-MSP-CAMA/GFP, in addition, adenovirus expressing CAMA-syn driven by CMV named as Ad-CMV-CAMA/GFP. And the adenovirus control, which lacks the CAMA-syn gene, was named as AdGFP.
2.7. Tissue slice preparation and observation The mouse lungs and other tissues were collected and fixed immediately with 4% paraformaldehyde for 24 h. The paraffin-embedded lungs and other tissues were prepared according to the standard procedure and were cut into 6-mm sections. The sections were dehydrated at 37 °C overnight and then HE (hematoxylin-eosin) staining was performed with standard protocol for inflammatory cytokines detection. 60
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 1. Expression of CAMA-syn under different MOI in Ad infected cells. A. Expression of GFP in RAW264.7 cells infected with Ad-MSP-CAMA/GFP at MOI (40, 80, 120, 160, 200, 240). B. Expression of GFP in Phoenix cells infected with Ad-CMV-CAMA/GFP at MOI (20, 40, 80, 160, 320, 640). C. RT-PCR and real-time PCR detection of CAMA-syn expressed in RAW264.7 cells infected with Ad-MSP-CAMA/GFP at MOI 20 and 200. p < 0.05. n = 3. D. RT-PCR and real-time PCR detection of CAMA-syn expressed in Phoenix cells infected with Ad-CMV-CAMA/GFP at MOI 4 and 40.
61
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 2. Antimicrobial activity assay of RAW264.7 and Phoenix cell lysates. A. RAW264.7 cells were infected with Ad-MSPCAMA/GFP and Phoenix cells with Ad-CMVCAMA/GFP. The cell lysates containing CAMA-syn peptide were prepared and added onto LB plates, on which four bacterial strains were inoculated, respectively. After 24-hour incubation, the colonyforming efficiency was counted. *p < 0.05. n = 3. B. Growth curves of four bacterial strains inoculated in LB medium with cell lysates containing CAMA-syn. CAMA in RAW264.7, cell lysate of RAW264.7 infected with Ad-MSP-CAMA/ GFP; Control in RAW264.7, cell lysate of RAW264.7 infected with Ad-GFP; CAMA in Phoenix, cell lysate of Phoenix infected with AdCMV-CAMA/GFP; Control in Phoenix, cell lysate of Phoenix infected with Ad-GFP.
CO2. Then, 100 μL of inoculum containing 1 × 106 BCG or S. abortusovis was added to each well. After 2 h of incubation in 5% CO2 at 37 °C, the infected cells were washed three times with warm RPMI 1640 and treated for another 2 h with complete medium containing 100 μg/mL kanamycin to kill extracellular BCG or 100 μg/mL gentamicin to kill extracellular S. abortusovis. After replacement with DMEM medium, cells were infected with recombinant adenovirus Ad-MSP-CAMA/GFP, Ad-CMV-CAMA/GFP or Ad-GFP with optimal MOI as previously described. After 48 h, inflected cells were lysed with 1 mL of 1% Triton X-100 and the lysates were diluted 1:1000 with LB broth. Then, 100uL of the diluted lysates was plated onto LB agar plates. CFU (n) were counted following incubation at 37°C to detect S. abortusovis overnight or to distinguish BCG for 2 weeks. CFU/cell were calculated according to the formula: (CFU/cell) = n × 104/105. To detect the intracellular antibacterial activity in animal model after CAMA-syn expression in lungs, lung homogenate was plated into five 60 mm plates. Of the above 20 wells, after 2 weeks incubation, BCG CFU/cell were determined by calculating the colony-forming efficiency.
Immunocytochemical staining of nuclei was carried out according to the protocol of the PI or H33342 (Sigma-Aldrich, USA) and viewed under the fluorescence microscope (Leica, Heidelberg, Germany). 2.8. Antimicrobial activity assays Cell lysates or cell-free culture supernatants from 35 mm dish were spread on LB agar plates and dried in the fume hood for 1 h. Four bacterial strains, S. abortusovis, P. anatis, S. hyicus and S. suis, were inoculated on the LB agar plates, and colony-forming efficiency was counted after the overnight incubation. The tests were repeated three times and the means were used to identify the colony-forming efficiency that was calculated by the number of colony-forming units (CFU) of the bacteria grown on LB agar plates. To determine the antibacterial activity of CAMA-syn peptide, bacterial strains were inoculated in 3 ml LB broth supplemented with 300 μL cell lysates or 3 ml cell-free culture supernatants from the infected RAW264.7 and Phoenix cells. The bacteria were incubated in the culture shaker (160 rpm) at 37 °C, and the growth curve of bacteria was plotted in line with OD600 value recorded per hour. The assays were repeated for three times and the means were used to draw bacterial growth curves.
2.10. Statistical analysis All values were expressed as mean ± standard error of means. To compare the difference between two groups, a two-tailed Student's ttest subsequent analysis of variance (ANOVA) was used. A p-value < 0.05 was considered significant difference.
2.9. Intracellular inhibition assay BCG cultured in LUO broth routinely or S. abortusovis was diluted to a density of 1 × 107 CFU/mL in RPMI 1640 medium. Aliquots of inoculate were subjected to colony enumeration assay to confirm the bacteria number. RAW264.7 and phoenix cells infected by recombinant adenovirus Ad-MSP-CAMA/GFP and Ad-CMV-CAMA/GFP respectively were plated into 10 wells of 24-well plates at a density 1 × 105 cells/ well. Cells were allowed to adhere to the plates for 2 h at 37 °C in 5% 62
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 3. Antimicrobial activity assay of RAW264.7 and Phoenix cell-free culture supernatants. A. RAW264.7 cells were infected with Ad-MSPCAMA/GFP and Phoenix cells with Ad-CMVCAMA/GFP. The cell-free culture supernatants containing CAMA-syn peptide were prepared and added onto LB plates, on which four bacterial strains were inoculated, respectively. After 24hour incubation, the colony-forming efficiency was counted. *p < 0.05. n = 3. B. Growth curves of four bacterial strains inoculated in LB medium with cell-free culture supernatants containing CAMA-syn. CAMA in RAW264.7, cell-free culture supernatants of RAW264.7 infected by Ad-MSP-CAMA/GFP; Control in RAW264.7, cellfree culture supernatants of RAW264.7 infected by Ad-GFP; CAMA in Phoenix, cell-free culture supernatants of Phoenix infected by Ad-CMVCAMA/GFP; Control in Phoenix, cell-free culture supernatants of Phoenix infected by Ad-GFP.
Fig. 4. Expression of CAMA-syn in RAW264.7 and Phoenix cells confers antimicrobial activity against Salmonella and BCG. A. Survival rate of Salmonella in RAW264.7 and Phoenix cells infected with Ad-MSP-CAMA/GFP and Ad-CMV-CAMA/GFP respectively was significantly lower than that in RAW264.7 and Phoenix cells infected with Ad-GFP (p < 0.05; n = 10). B. Survival rate of BCG in RAW264.7 and Phoenix cells infected with recombinant adenovirus Ad-MSP-CAMA/GFP after challenged by BCG was significantly lower than that in RAW264.7 and Phoenix cells infected with AdGFP (p < 0.05; n = 10). Data shown are representative of three independent experiments.
3. Results
cases, significant differences were seen with different MOI. Generally, infection after 24 h, the expression of CAMA-syn was detected and reached highest expression 48 h post-infection.
3.1. CAMA-syn was expressed in RAW264.7 and phoenix infected by recombinant adenovirus
3.2. CAMA-syn expressed in cells showed antibacterial activity Adenoviral transfection efficiency for CAMA-syn was dose and cell dependent. Compared to expression of the reference gene GFP, the infection efficiency of adenovirus in RAW264.7 increased with the augmentation of MOI from 40 to 200, while no significant increasing was deteced in MOI of 240 (Fig. 1A). Similar results were observed in Phoenix cells, adenoviral infection efficiency raised with the increasing of MOI from 20 to 80, while no significant difference was detected at MOI of 80, 160, 320, 640, except for some cytopathic effect (Fig. 1B). In order to obtain the optimal MOI of adenoviral infection efficiency in different cells, real-time PCR was performed. The highest expression of CAMA-syn was seen in cell line Phoenix at the MOI of 40 (Fig. 1D) and in RAW264.7 cell at the MOI of 200 (Fig. 1C), respectively. In all
To investigate whether CAMA-syn expressing cells were capable of producing biologically active CAMA-syn, the antibacterial activity of cell lysates and cell-free culture supernatants were assessed. The results of colony-forming efficiency showed that both cell lysates and cell-free culture supernatants with CAMA-syn exhibited higher antibacterial activity than control groups (Fig. 2A). The differences of bacterial colony-forming efficiency in RAW264.7 (such as P. anatis, 70.9%) versus phoenix (P. anatis, 70.0%) were not statistically significant. However, the antibacterial activity was slightly higher in phoenix than in RAW264.7, this difference might be due to the activity of various potent promoters of CMV and MSP. To further evaluate the 63
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 5. Expression of CAMA-syn in vivo after recombinant adenovirus infection. A. expression of GFP was observed after adenovirus Ad-CMV-CAMA/GFP infection by tracheal injection, by tissue sections with PI dye nuclei, scale bar is 400 um. B. relative expression of CAMA-syn compared with GAPHD by real-time PCR was detected in the liver, heart, spleen, lungs and kidneys in day3, 7, 14 after tracheal injection with Ad-CMV-CAMA/GFP.
growth curve experiments showed that CAMA-syn expressed in both RAW264.7 and phoenix cells was readily secreted into the media and exhibited the potent suppression to bacterial proliferation (Fig. 3A and C). Overall, the cell-free culture supernatants showed similar antimicrobial activity to both of Gram-positive and Gram-negative bacterial as cell lysates did. For instance, the colony-forming efficiency of P. anatis treated with phoenix cell lysates and cell-free culture supernatants was reduced to 70.7% and 72.6%, respectively, compared to the control.
antibacterial activity, the time-dependent analysis was conducted to detect the inhibition activity of CAMA-syn. The results of bacteria growth curve showed that CAMA-syn treatments could significantly inhibit the bacterial growth (Fig. 2B). In 4–6 h incubation, the control bacteria were in the log phase, while the CAMA-syn treated bacteria reached the plateau phase, suggesting that CAMA-syn could prevent the bacterial proliferation with the antibacterial activity in vitro. Since the constructs of recombinant adenovirus containing the signal peptide of bovine IFN gamma, the expressed CAMA-syn can be secreted into culture media. To test whether CAMA-syn peptide secreted from cells has biological function, the cell-free culture supernatants from macrophage and phoenix cells were used to examine the antibacterial activity. The results of colony-forming efficiency and 64
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 6. Activation of inflammatory cytokines after recombinant adenovirus infection. A. Activation of TNF-α after adenovirus infection in various tissues with tracheal injection. B. Activation of IL-6 after adenovirus infection in various tissues with tracheal injection. C. HE staining of tissues infected with recombinant adenovirus through tracheal injection after 3 days, the heart, liver, spleen, lung and kidney were taken for HE staining to detect the infiltration of inflammatory cells. Scale bar = 200 μm.
3.3. CAMA-syn expressed in RAW264.7 showed intracellular antibacterial activity to Salmonella and BCG
3.5. Recombinant adenovirus infection led to fluctuation of immunological cytokines
To further evaluate the intracellular antibacterial activity of cells endowed expression of CAMA-syn in cells infected with the recombinant adenovirus, macrophage RAW264.7 and phoenix cells were infected with S. abortusovis or BCG followed by infection of either AdMSP-CAMA/GFP or Ad-CMV-CAMA/GFP. 48 h after adenovirus infection, intracellular live microbes were counted by colony enumeration assay. The results showed that the colony number of both S. abortusovis and BCG from RAW264.7 cells infected with Ad-MSP-CAMA/GFP was significantly less than that from RAW264.7 cells infected with Ad-GFP (p < 0.05; n = 10) (Fig. 4A, B). The similar results were observed in phoenix CAMA-syn expressing cells infected with Ad-CMV-CAMA/GFP.
Adenovirus infection usually caused the body's violent immune response, especially accompanying with some immunological stress cytokines expression volatility such as TNF-α and IL-6. After performance of recombinant adenovirus infection by tracheal infusion, only TNF-α was detected in liver in the 3rd day, and highly expressed in heart and kidney after 7 days. Meanwhile, TNF-αreached the highest expression in lungs and spleen 14 days after infection (Fig. 6A). On the other hand, IL-6 expression level enhanced significantly in heart, liver and lungs 3 days after infection and detected only in heart 7 days after infection and achieved the highest expression level also in spleen and lungs 14 days post-infection (Fig. 6B). Histological staining of these tissues after infection indicated that obvious lymphocytes infiltration and slight inflammation were observed in lungs and spleen but not in kidney (Fig. 6C).
3.4. CAMA-syn was expressed in mouse tissue To detect the expression level of CAMA-syn in mouse lungs, AdMSP-CAMA/GFP was used to infect mice by tracheal infusion and CAMA-syn expression level was evaluated by observation of the GFP expression. The data showed that CAMA-syn was highly expressed in lung 3 days post-infection and declined gradually by 7 days and almost disappeared 14 days post-infection as showed in Fig. 5A. To confirm these results, CAMA-syn expression was also evaluated by real-time PCR, the same results were obtained (Fig. 5B). As expected, 3 days after infection of Ad-MSP-CAMA/GFP, the expression of CAMA-syn in lungs reached the highest among other tissues including heart, liver, spleen and kidney. 7 days after infection, the expression of CAMA-syn in lungs became less than that of 3 days post-infection (about 1/10 of that level), and 14 days after infection, the expressing of CAMA-syn was hardly detected.
3.6. CAMA-syn displayed intracellular antibacterial activity in mouse lungs Recombinant adenovirus (Ad-MSP-CAMA/GFP, Ad-CMV-CAMA/ GFP and Ad-GFP) were used to infect BCG bearing mouse model by tracheal infusion. 3 days after infection, lungs were collected and RNA was extracted to detect the expression of CAMA-syn by real-time PCR. As shown in Fig. 7A, the expression level of CAMA-syn in mouse lungs infected by Ad-CMV-CAMA/GFP reached the highest, but was less in those infected with Ad-MSP-GFP/CAMA. To evaluate the recombinant adenoviral infection of these BCG bearing mice as a model, colonyformation efficiency of BCG from mouse lung homogenate infected with recombinant adenovirus Ad-MSP-GFP/CAMA, Ad-CMV-GFP/CAMA and Ad-GFP, respectively, was determined. 3 days after infection, lung 65
Gene 630 (2017) 59–67
J. Zhang et al.
be possible to use the tissue specific promoter to drive therapeutic proteins to be secreted at the site of infected or tumor. The results indicated that the macrophage specific expression system would enable secretion of therapeutic proteins as therapeutic agents at special tissue. Thus, we sought to determine whether acquisition of an antimicrobial peptide gene in macrophage cells can increase their antibacterial activity. Our results demonstrated that targeting expression of antimicrobial peptide CAMA-Syn inhibited BCG growth within macrophage RAW264.7 cells, endowing them with enhanced bactericidal activity against ingested bacteria. Thus, overexpression of CAMA-Syn in macrophage cells has high potential to improve their intracellular bactericidal ability to be applied as a promising therapeutic strategy for refractory intracellular infections in the future. Cell-specific expression of therapeutic genes in targeted cells is an excellent strategy due to no side effects on normal cells and even the whole body. The macrophage specific promoter can drive objective gene expression in macrophage cells exclusively, making it a convenient method for targeted expression. Indeed, it has already been applied to therapeutic research on diseases such as atherosclerosis (Whitman et al., 2002). Wen et al. reported that antimicrobial peptide PR-39 could be overexpressed in RAW.264.7 cell to inhibit intracellular growth of Salmonella enterica serovar Typhimurium (Wen et al., 2009). Thus, expression of CAMA-syn in macrophage cells is a desirable approach to improve antibacterial ability of lymphocytes to be applied as an alternative therapeutic strategy for refractory blood infections. Recombinant expressed AMPs have displayed a broad spectrum of antibacterial activity (Ladram and Nicolas, 2016; Sadr et al., 2017). It was reported that human keratinocyte cell line was transduced with adenovirus encoding human β-defensin 3 (HBD-3) or LL-37, and various bacteria were allowed to adsorb onto the surface (Jones et al., 2008; Suzuki et al., 2011). They found that when LL-37 or HBD-3 was overexpressed in the cells, Escherichia coli viability was reduced by 28%–68% and 34%–72%, respectively. For Staphylococcus aureus, the cell expressing LL-37 and HBD-3 showed 20%–45% and 20%–85% inhibitory activity, respectively. Pseudomonas aeruginosa viability was inhibited by 43%–53% and 28%–35% when LL-37 or HBD-3 was overexpressed, respectively (Jones et al., 2008). Antimicrobial assays demonstrated that recombinant cecropin B has antimicrobial activity against both Gram positive and negative bacteria (P. Y. Chen et al., 2011). Fusion expression of CAMA hybrid peptide in E. coli and in eucaryotic cells showed a certain inhibitory effect on Staphylococcus (Feng Wei-ping et al., 2008). In our study, CAMA-syn produced by adenovirus vector increased antibacterial activity against both gram-positive and gram-negative bacterial strains, suggesting that the CAMA-syn mediated by adenovirus vector has high potential for a range of therapeutic applications for intracellular infectious diseases such as tuberculosis.
Fig. 7. Expression of CAMA-syn in lungs and BCG inhibition assay. A. Tracheal injection of mouse with recombinant Adenovirus (Ad-GFP, Ad-MSP-CAMA/ GFP, and Ad-CMV-CAMA/GFP), relative expression of CAMA-syn compared with GADPH by real-time PCR was detected in the lungs. B. colony-formation efficiency of BCG in mouse lungs after adenoviral infection with Ad-GFP, Ad-MSP-CAMA/GFP and Ad-CMVCAMA/GFP Recombinant adenovirus was used to inhibit BCG infection in mouse model, respectively. 3 days after injection, lung tissue was grinded and tested for BCG colony formation efficiency.
tissue was grinded and tested for BCG colony formation efficiency. The results demonstrated that the Ad-MSP-GFP/CAMA and Ad-CMV-CAMA/GFP showed better antibacterial activity and the colony-forming efficiency was reduced to 78.31% and 61.68%, respectively, compared to 100% of the control Ad-GFP (Fig. 7B). 4. Discussion Short chain AMPs (antimicrobial peptides) can be prepared in bulk by solid phase chemical synthesis, but the cost is prohibitive, and improper folding of polypeptides may compromise their activity. There are several biological expression systems which have been used to produce antimicrobial peptides, including yeasts and bacteria (Verma et al., 1998). Attempts have been made to produce AMPs in transgenic eukaryotic expression system to accelerate the implementation of the peptide for use as antimicrobial agent and medicinal settings (Yarus et al., 1996). For example, human β-defensin 2 was used as a model for in vivo antimicrobial gene therapy (Huang et al., 2002). Also, human host defense peptide LL-37 was effective for the treatment of burn wound infections (Jacobsen et al., 2005). Recombinant adenovirus expression systems have various advantages because they do not require a DNA integration procedure or a selection step, and they can be prepared more rapidly and unaffected by chromosomal positional effects (Yi and Li, 2010). Production of recombinant proteins by adenovirus expression vectors in mammalian cells, such as the cell lines of COS (Corsi et al., 1998), HEK293 (Liu et al., 2010), and BHK (Wurm and Bernard, 1999), has been described. In this study, we constructed recombinant adenovirus to express AMPs in RAW264.7and mouse macrophage cells. The construct comprised of two basic components: the macrophage special promoter (MSP) (GenBank accession: No. DQ107382) and the synthetic peptide of CAMA-syn. Therefore, it might
5. Conclusion In this article, we expressed antimicrobial peptide CAMA-syn mediated by recombinant adenovirus in RAW264.7 and macrophage cells in lungs with MSP promoters that showed intracellular antibacterial activity, implying that this system has a potential to be used in infectious diseases. This system provides a novel insight and approach for the control of refractory infections caused by intracellular bacteria such as M. tuberculosis, especially multidrug-resistant strains that are sensitive to CAMA-Syn.
Acknowledgments We thank Pro. Zengqi Yang of College of Veterinary Medicine, Northwest A & F University, for kindly donating the strains of bacterial for antibacterial assay. This work was supported by a grant from the National Science Foundation of China (No. 31302148). 66
Gene 630 (2017) 59–67
J. Zhang et al.
structures. Biochemistry 39 (39), 11855–11864. Ohta, Y., Horiuchi, T., Dohi, T., Sugaya, K., Matsumoto, H., Ide, H., 1990. Development of computer-aided motion analyzing (CAMA) system for radiopaque implanted tilting disk heart valves. Artif. Organs 14 (6), 449–453. Pohin, M., Guesdon, W., Mekouo, A.A., Rabeony, H., Paris, I., Atanassov, H., ... Jegou, J.F., 2016. Oncostatin M overexpression induces skin inflammation but is not required in the mouse model of imiquimod-induced psoriasis-like inflammation. Eur. J. Immunol. 46 (7), 1737–1751. http://dx.doi.org/10.1002/eji.201546216. Sadr, V., Saffar, B., Emamzadeh, R., 2017. Functional expression and purification of recombinant Hepcidin25 production in Escherichia coli using SUMO fusion technology. Gene. http://dx.doi.org/10.1016/j.gene.2017.02.010. Suzuki, Y., Inokuchi, S., Takazawa, K., Umezawa, K., Saito, T., Kidokoro, M., ... Ando, K., 2011. Introduction of human beta-defensin-3 into cultured human keratinocytes and fibroblasts by infection of a recombinant adenovirus vector. Burns 37 (1), 109–116. Talactac, M.R., Yada, Y., Yoshii, K., Hernandez, E.P., Kusakisako, K., Maeda, H., ... Tanaka, T., 2017. Characterization and antiviral activity of a newly identified defensin-like peptide, HEdefensin, in the hard tick Haemaphysalis longicornis. Dev. Comp. Immunol. 68, 98–107. Verma, R., Boleti, E., George, A.J., 1998. Antibody engineering: comparison of bacterial, yeast, insect and mammalian expression systems. J. Immunol. Methods 216 (1–2), 165–181. Wakeham, J., Wang, J., Xing, Z., 2000. Genetically determined disparate innate and adaptive cell-mediated immune responses to pulmonary Mycobacterium bovis BCG infection in C57BL/6 and BALB/c mice. Infect. Immun. 68 (12), 6946–6953. Wen, Y.A., Yu, X.L., Xia, Q.F., Cen, D., Liu, J.B., Tu, Z.G., 2009. Macrophage-specific overexpression of antimicrobial peptide PR-39 inhibits intracellular growth of Salmonella enterica serovar Typhimurium in macrophage cells. Int. J. Antimicrob. Agents 34 (4), 315–321 (doi:S0924-8579(09)00216-7 [pii]10.1016/j.ijantimicag.2009.04.014). Whitman, S.C., Rateri, D.L., Szilvassy, S.J., Cornicelli, J.A., Daugherty, A., 2002. Macrophage-specific expression of class A scavenger receptors in LDL receptor(−/−) mice decreases atherosclerosis and changes spleen morphology. J. Lipid Res. 43 (8), 1201–1208. Woo, J.I., Kil, S.H., Brough, D.E., Lee, Y.J., Lim, D.J., Moon, S.K., 2015. Therapeutic potential of adenovirus-mediated delivery of beta-defensin 2 for experimental otitis media. Innate Immun. 21 (2), 215–224. Wurm, F., Bernard, A., 1999. Large-scale transient expression in mammalian cells for recombinant protein production[J]. Curr. Opin. Biotechnol. 10 (2), 156–159. Xu, W., Huo, L., Li, J., Xu, C., Wang, S., Yang, Y., ... Yan, X., 2017. Effects of alcohol on mitochondrial functions of cumulus cells in mice. Cell Rep. 19 (2), 123–131 (d). Yarus, S., Rosen, J.M., Cole, A.M., Diamond, G., 1996. Production of active bovine tracheal antimicrobial peptide in milk of transgenic mice. Proc. Natl. Acad. Sci. U. S. A. 93 (24), 14118–14121. Yi, N., Li, N., 2010. Transient expression of chicken antimicrobial peptides by mouse mammary carcinoma cells C127. Protein Pept. Lett. 17 (12), 1517–1523 (doi:BSP/ PPL/E pub/0209 [pii]). Zhang, J., Peng, S., Cheng, X., Wang, H., 2012. Functional analysis of hybrid peptide CAMA-Syn: expression in mammalian cells and antimicrobial potential. Protein Pept. Lett. 19 (10), 1076–1081.
References Babu, P.B., Meenakshi, A., 1997. Detection of breast tumor associated mucin epitope on CAMA cell line using monoclonal antibody G3F1 generated against HMFG membrane. Cancer Biochem. Biophys. 15 (4), 263–274. Chen, L., Wang, J., Zganiacz, A., Xing, Z., 2004. Single intranasal mucosal Mycobacterium Bovis BCG vaccination confers improved protection compared to subcutaneous vaccination against pulmonary tuberculosis. Infect. Immun. 72 (1), 238–246. Chen, P.Y., Wang, X.Q., Zhu, M.X., Yang, G.M., Su, C.X., Zhang, A.J., Cao, R.B., 2011. Expression of cecropin B in Pichia pastoris and its bioactivity in vitro. Exp. Ther. Med. 2 (4), 655–660. Corsi, B., Perrone, F., Bourgeois, M., Beaumont, C., Panzeri, M.C., Cozzi, A., Levi, S., 1998. Transient overexpression of human H- and L-ferritin chains in COS cells. Biochem. J. 330 (Pt 1), 315–320. Feng Wei-ping, Han Yue-wu, Hui-zi, R., 2008. Construction and expression of cecropin A (1-8) - magainin (1-12) hybrid peptide mutant and antibacterial activity of expressed product. Chin. J. Biol. 21 (9), 4. Huang, G.T., Zhang, H.B., Kim, D., Liu, L., Ganz, T., 2002. A model for antimicrobial gene therapy: demonstration of human beta-defensin 2 antimicrobial activities in vivo. Hum. Gene Ther. 13 (17), 2017–2025. Jacobsen, F., Mittler, D., Hirsch, T., Gerhards, A., Lehnhardt, M., Voss, B., ... Steinstraesser, L., 2005. Transient cutaneous adenoviral gene therapy with human host defense peptide hCAP-18/LL-37 is effective for the treatment of burn wound infections. Gene Ther. 12 (20), 1494–1502. Jacobsen, F., Rittig, A., Steinstraesser, L., 2011. Introduction of human beta-defensin-3 into cultured human keratinocytes and fibroblasts by recombinant adenovirus vectors—are primary cells able to secrete sufficient amounts of transgene to exhibit biological activity in vitro? Burns 37 (7), 1268–1269. Jeong, K.W., Shin, S., Kim, J.K., Kim, Y., 2009. Antibacterial activity and synergism of the hybrid antimicrobial peptide, CAMA-syn. Bull. Kor. Chem. Soc. 30 (8), 1839–1844. Ji, H., Stout, L.E., Zhang, Q., Zhang, R., Leung, H.T., Leung, B.S., 1994. Absence of transforming growth factor-beta responsiveness in the tamoxifen growth-inhibited human breast cancer cell line CAMA-1. J. Cell. Biochem. 54 (3), 332–342. Jones, C.J., Skidmore, J.A., Aplin, J.D., 2008. Placental glycosylation in a cama (camelllama cross) and its relevance to successful hybridisation. Mol. Phylogenet. Evol. 49 (3), 1030–1035. Ladram, A., Nicolas, P., 2016. Antimicrobial peptides from frog skin: biodiversity and therapeutic promises. Front. Biosci. 21, 1341–1371. Lapointe, J., Labrie, C., 2001. Role of the cyclin-dependent kinase inhibitor p27(Kip1) in androgen-induced inhibition of CAMA-1 breast cancer cell proliferation. Endocrinology 142 (10), 4331–4338. Liu, L., Xu, H.M., Jiang, H., Wang, J., Song, N., Xie, J.X., 2010. Recombinant adenovirusmediated expression of GHS-R1a in HEK 293 cells. Neurosci. Bull. 26 (3), 225–231. Oh, D., Shin, S.Y., Kang, J.H., Hahm, K.S., Kim, K.L., Kim, Y., 1999. NMR structural characterization of cecropin A(1-8) - magainin 2(1-12) and cecropin A (1-8) - melittin (1-12) hybrid peptides. J. Pept. Res. 53 (5), 578–589. Oh, D., Shin, S.Y., Lee, S., Kang, J.H., Kim, S.D., Ryu, P.D., ... Kim, Y., 2000. Role of the hinge region and the tryptophan residue in the synthetic antimicrobial peptides, cecropin A(1-8)-magainin 2(1-12) and its analogues, on their antibiotic activities and
67
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Targeting expression of antimicrobial peptide CAMA-Syn by adenovirus vector in macrophages inhibits the growth of intracellular bacteria
MARK
Junlin Zhang1, Lilan Xie1, Dingfeng Xu, Shuohao Yue, Yi Li, Xiaohong Guo⁎, Xiaojing Lai⁎ Hubei Engineering Research Center of Viral Vector, Applied Biotechnology Research Center, Wuhan Institute of Bioengineering, Wuhan 30415, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Antimicrobial peptide CAMA-syn Macrophages Intracellular bacteria
Although purified and synthesized Cecropin A-magainin 2 (CAMA-syn) shows potent antibacterial activity in vitro, its ability to inhibit bacteria within mammal cells mediated by virus vector has not yet been investigated. To enhance its antimicrobial potential and reduce systemic side effects, it would be desirable to deliver CAMAsyn in macrophages by adenovirus vector. In this study,recombinant adenovirus Ad-MSP-CAMA/GFP were used to infect macrophages RAW264.7 cells in vitro and macrophages cells of lungs in vivo and the expression of CAMA-syn was detected by RT-PCR and observation of co-expression of GFP. Antimicrobial activity in cells was evaluated by colony enumeration. The results showed that expression of CAMA-syn in macrophages conferred antimicrobial activity against a series of bacteria, including E. coli and BCG(Bacillus Calmette-Guérin). To establish BCG infection animal model, 40 Kunming mice were randomly divided into the following four groups: adenoviral delivery of Ad-MSP-CAMA/GFP, Ad-CMV-CAMA/GFP, empty-virus Ad-GFP, and control PBS, respectively. The expression of CAMA-syn in mouse was confirmed by real-time PCR and GFP co-expression. In brief, 3 days after injection of adenoviral vector, mice were scarified, different tissues were sectioned and homogenized and colony-forming efficiency by these treated tissues was determined. The colony-forming efficiency of Ad-MSP-CAMA/GFP (78.31%) and Ad-CMV-CAMA/GFP (61.68%) showed significant reduction compared to control groups. No inhibition of bacterial colony was observed from tissues treated by the PBS or empty-virus control. In conclusion, our results demonstrated that macrophages-specific expression of antimicrobial peptide CAMA-syn in macrophages inhibited the growth of intracellular bacteria, providing a promise approach for the control of refractory intracellular infection.
1. Introduction Intracellular bacteria, especially Mycobacterium tuberculosis, are important pathogenic microbes that pose a serious threat to human health. It is estimated that one third of the world's population are infected with M. tuberculosis. In nine out of ten cases, M. tuberculosis persists in a latent state throughout an individual's lifetime. The ability of M. tuberculosis to survive and multiply within macrophages makes these host cells an ideal niche for persisting microbes (Lapointe and Labrie, 2001). The intracellular persistence of bacteria not only protects them from the human immune response, but also produces bacteria from inactivation by most antibiotics, resulting in drug resistance and making the treatment of intracellular infection disease refractory (Babu and Meenakshi, 1997; Ji et al., 1994; Ohta et al., 1990). Killing of the intracellular Tubercle bacilli is a key requirement for
efficient tuberculosis treatment, yet identifying potent inhibitors has been hampered by labor-intensive techniques and lack of validated targets. As one of the most evolutionally conserved components of the innate immune system in various species, antimicrobial peptides have shown highly efficient antibacterial activity against a broad spectrum of pathogens including intracellular bacteria and have emerged as promising therapeutic agents for infectious diseases (Jacobsen et al., 2011; Talactac et al., 2017). CA (Cecropin A) and MA (magainin 2) display powerful lytic activity against both gram positive and negative bacteria, but have a less cytotoxic effect against human erythrocytes and other eukaryotic cells. Cecropin A-magainin 2 (CAMA) hybrid peptides comprising the N-terminal amphipathic basic region of CA and the Nterminal hydrophobic region of MA also exhibited higher antibacterial and antitumor activities, yet showed no hemolytic activity at 100 μg/ mL (Oh et al., 1999; Oh et al., 2000). It was reported that the hybrid
Abbreviations: Ad, adenovirus; MSP, macrophage-specific promoter; CMV, cytomegalovirus; PBS, phosphate buffer saline; GFP, green fluorescent protein; BCG, Bacillus CalmetteGuerin; GAPDH, glyceraldehyde-3-phosphatedehydrogenase ⁎ Corresponding authors. E-mail addresses: [email protected] (X. Guo), [email protected] (X. Lai). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.gene.2017.07.079 Received 15 February 2017; Received in revised form 19 June 2017; Accepted 31 July 2017 Available online 05 August 2017 0378-1119/ © 2017 Published by Elsevier B.V.
Gene 630 (2017) 59–67
J. Zhang et al.
peptide analogue CAMA-syn with substitutions of Ile10 and Ser16 with Lys in CAMA led to the increasing of total positive charge, a better antibacterial activity and lower cytotoxicity (Jeong et al., 2009). CAMA-syn exhibited antimicrobial activity against a broad range of microorganisms, such as E. coli, P. aeruginosa, S. aureus, B. subtilis and E. faecalis. (Jeong et al., 2009; Zhang et al., 2012). Thus, this hybrid peptide possesses potent therapeutic potential against bacterial infections in transgenic animals. Transient cutaneous transgene expression may be a potential alternative to the application of synthetically derived proteins in the treatment of tuberculosis. Therefore, it is necessary to focus on a highly effective transient gene delivery system to promote local tissue healing factors. Compared to other established gene transfer methods, including retroviruses and cationic lipids, adenovirus is independent of cell division state. Furthermore, it has been previously demonstrated that adenovirus transduced effectively cutaneous cell, such as adipocytes, fibroblasts and keratinocytes (Jones et al., 2008; Pohin et al., 2016; Woo et al., 2015). Normal macrophages can be efficiently transfected with viral and noviral expression systems, but little is known about the feasibility of adenoviral gene delivery in lungs. The goal of this study is to investigate the feasibility of transient cutaneous adenoviral gene delivery of hybrid antimicrobial peptide CAMA-syn with macrophages-specific promoter into weak bovine tubercle bacilli infected lung. Our results demonstrated that macrophages-specific expression of antimicrobial peptide CAMA-syn in macrophages inhibited the growth of intracellular bacteria, indicating that this gene delivery system is a promise approach for the control of refractory intracellular infection.
2.4. Reverse transcription polymerase chain reaction (RT-PCR) and realtime PCR Total RNA was extracted from cells using RNAiso Reagent (Takara Biotechnology Co. Ltd., China) and cDNA was synthesized from total RNA with reverse transcriptase M-MLV (Takara Biotechnology Co. Ltd.). Both steps were carried out according to the manufacturer's instructions. Real-time PCR was carried out using an ABI 7500 fast machine and 7500 Software v2.0.5 (7500 Fast Real-Time PCR System, ABI, Grand Island, NY). The mouse GAPDH (Glyceraldehyde-3-phosphatedehydrogenase) gene as the reference gene was amplified in parallel with the target gene to allow for gene expression normalization, and the 2− ΔΔCt was used for quantification. Real-time PCR amplification was carried out as step one at 94 °C for 1 min, followed by 40 cycles of a 2step loop: 15 s at 95 °C and 30 s at 60 °C (Xu et al., 2017). Relative quantification of the PCR products was calculated following normalization to GAPDH (glyceraldehyde-3-phosphatedehydrogenase). The experiments were performed in triplicate for each data point, and the mean of all the values was used for the final analysis. Primers used in this test were shown in following: GAPDH, forward: ACCACAGTCCATGCCATCAC, reverse: TCCACCACCCTGTTGCTGTA; CAMA-syn, forward: TCTTAGCTTTACTGCTCTGTGG, reverse: GCCCTTGCCGATCTT CTT; TNF-α, forward: AAGCCTGTAGCCCACGTCGTA, reverse: GGCACCACTAGTTG GTTGRCTTTG; IL-6, forward: CCACTTCACAAGTCGGCTTA, reverse: GCAAGTGCATCATCGTTGTTCATAC. 2.5. Recombinant adenovirus infection by tracheal injection Randomly choose mouse were retroperitoneally injected 0.1 ml 2% pentobarbital sodium, operative procedure was executed on holonarcosis after 5 min when mouse cannot turn over. Firstly, mouse neck was cut a small opening along the trachea using scissors after 75% alcohol sterilization. Then tweezers were used to carefully cut through the skin and subcutaneous tissue to expose a small trachea. 100 μL recombinant adenovirus (1 × 109 pfu) were then slowly injected into trachea. Finally, both ears of the mouse were picked up to make its body upright in order to make adenovirus solution easily into the lungs, and wounds were finally stitched. 3 days post-infection with different vectors, the mice were sacrificed and the tissues including heart, liver, spleen, lungs and kidneys were isolated and frozen until use, and total RNA was extracted from those tissues when needed. The expression of GFP was observed under Fluorescence microscope (Leica, Heidelberg, Germany). The relative expression of CAMA-syn and inflammatory cytokines were identified by real-time PCR.
2. Materials and methods 2.1. Bacterial strains and culture Salmonella abortusovis strain grown in LB (Luria–Bertani) broth or on LB agar plates was used for the antibacterial assays. BCG (Bacillus Calmette-Guerin) from the Fourth Military Medical University in Xi'an were grown in LUO media. Gram-negative bacterial strains (Salmonella abortusovis, Pasteurella anatis) and Gram-positive bacterial strains (Staphylococcus hyicus and Streptococcus suis) were routinely cultured in LB plates. 2.2. Cell lines and experiment animals Mouse macrophage cells RAW264.7 and human embryo kidney cells Phoenix were grown in DMEM medium (12100-046, Invitrogen, USA) supplemented with 10% fetal bovine serum (Gibco BRL, USA) at 37 °C in 5% CO2. Kunming mice from experimental animal center of the Fourth Military Medical University, 20 days old, male, were used to construct BCG infection animal model. All animal studies were approved by the Animal Ethics Committee of Wuhan Institute of Bioengineering (authorisation no. 2015010016), and were performed in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council, 2011).
2.6. Construction of BCG infection animal model Kunming mice 50, female, weight about 25 g, was implemented with BCG at MOI of 1 × 106 CFU through tracheal injection using Wakeham and Chen's methods (L. Chen et al., 2004; Wakeham et al., 2000). Observation of clinical pathology in mice for 2 weeks, mice were infected recombinant adenovirus Ad-MSP-CAMA/GFP, Ad-CMV-CAMA/GFP or Ad-GFP 100 μL (1 × 109 pfu) respectively. 3 days after recombinant adenovirus injection, lungs were get from euthanasia mice to make tissue homogenate for antimicrobial assays by calculating the colony-forming efficiency.
2.3. Generation of recombinant adenovirus and cell infection The CAMA-syn gene along with its macrophage-specific promoter (MSP) and GFP driven by IRES (MSP-CAMA/GFP) was digested from plasmid pMSP-CAMA with SalI and ApaI, and then was inserted into pAdTrack to generate the recombinant shuttle vector pAd-MSP-CAMA/ GFP. Recombinant adenovirus encoding CAMA-syn driven by MSP was named as Ad-MSP-CAMA/GFP, in addition, adenovirus expressing CAMA-syn driven by CMV named as Ad-CMV-CAMA/GFP. And the adenovirus control, which lacks the CAMA-syn gene, was named as AdGFP.
2.7. Tissue slice preparation and observation The mouse lungs and other tissues were collected and fixed immediately with 4% paraformaldehyde for 24 h. The paraffin-embedded lungs and other tissues were prepared according to the standard procedure and were cut into 6-mm sections. The sections were dehydrated at 37 °C overnight and then HE (hematoxylin-eosin) staining was performed with standard protocol for inflammatory cytokines detection. 60
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 1. Expression of CAMA-syn under different MOI in Ad infected cells. A. Expression of GFP in RAW264.7 cells infected with Ad-MSP-CAMA/GFP at MOI (40, 80, 120, 160, 200, 240). B. Expression of GFP in Phoenix cells infected with Ad-CMV-CAMA/GFP at MOI (20, 40, 80, 160, 320, 640). C. RT-PCR and real-time PCR detection of CAMA-syn expressed in RAW264.7 cells infected with Ad-MSP-CAMA/GFP at MOI 20 and 200. p < 0.05. n = 3. D. RT-PCR and real-time PCR detection of CAMA-syn expressed in Phoenix cells infected with Ad-CMV-CAMA/GFP at MOI 4 and 40.
61
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 2. Antimicrobial activity assay of RAW264.7 and Phoenix cell lysates. A. RAW264.7 cells were infected with Ad-MSPCAMA/GFP and Phoenix cells with Ad-CMVCAMA/GFP. The cell lysates containing CAMA-syn peptide were prepared and added onto LB plates, on which four bacterial strains were inoculated, respectively. After 24-hour incubation, the colonyforming efficiency was counted. *p < 0.05. n = 3. B. Growth curves of four bacterial strains inoculated in LB medium with cell lysates containing CAMA-syn. CAMA in RAW264.7, cell lysate of RAW264.7 infected with Ad-MSP-CAMA/ GFP; Control in RAW264.7, cell lysate of RAW264.7 infected with Ad-GFP; CAMA in Phoenix, cell lysate of Phoenix infected with AdCMV-CAMA/GFP; Control in Phoenix, cell lysate of Phoenix infected with Ad-GFP.
CO2. Then, 100 μL of inoculum containing 1 × 106 BCG or S. abortusovis was added to each well. After 2 h of incubation in 5% CO2 at 37 °C, the infected cells were washed three times with warm RPMI 1640 and treated for another 2 h with complete medium containing 100 μg/mL kanamycin to kill extracellular BCG or 100 μg/mL gentamicin to kill extracellular S. abortusovis. After replacement with DMEM medium, cells were infected with recombinant adenovirus Ad-MSP-CAMA/GFP, Ad-CMV-CAMA/GFP or Ad-GFP with optimal MOI as previously described. After 48 h, inflected cells were lysed with 1 mL of 1% Triton X-100 and the lysates were diluted 1:1000 with LB broth. Then, 100uL of the diluted lysates was plated onto LB agar plates. CFU (n) were counted following incubation at 37°C to detect S. abortusovis overnight or to distinguish BCG for 2 weeks. CFU/cell were calculated according to the formula: (CFU/cell) = n × 104/105. To detect the intracellular antibacterial activity in animal model after CAMA-syn expression in lungs, lung homogenate was plated into five 60 mm plates. Of the above 20 wells, after 2 weeks incubation, BCG CFU/cell were determined by calculating the colony-forming efficiency.
Immunocytochemical staining of nuclei was carried out according to the protocol of the PI or H33342 (Sigma-Aldrich, USA) and viewed under the fluorescence microscope (Leica, Heidelberg, Germany). 2.8. Antimicrobial activity assays Cell lysates or cell-free culture supernatants from 35 mm dish were spread on LB agar plates and dried in the fume hood for 1 h. Four bacterial strains, S. abortusovis, P. anatis, S. hyicus and S. suis, were inoculated on the LB agar plates, and colony-forming efficiency was counted after the overnight incubation. The tests were repeated three times and the means were used to identify the colony-forming efficiency that was calculated by the number of colony-forming units (CFU) of the bacteria grown on LB agar plates. To determine the antibacterial activity of CAMA-syn peptide, bacterial strains were inoculated in 3 ml LB broth supplemented with 300 μL cell lysates or 3 ml cell-free culture supernatants from the infected RAW264.7 and Phoenix cells. The bacteria were incubated in the culture shaker (160 rpm) at 37 °C, and the growth curve of bacteria was plotted in line with OD600 value recorded per hour. The assays were repeated for three times and the means were used to draw bacterial growth curves.
2.10. Statistical analysis All values were expressed as mean ± standard error of means. To compare the difference between two groups, a two-tailed Student's ttest subsequent analysis of variance (ANOVA) was used. A p-value < 0.05 was considered significant difference.
2.9. Intracellular inhibition assay BCG cultured in LUO broth routinely or S. abortusovis was diluted to a density of 1 × 107 CFU/mL in RPMI 1640 medium. Aliquots of inoculate were subjected to colony enumeration assay to confirm the bacteria number. RAW264.7 and phoenix cells infected by recombinant adenovirus Ad-MSP-CAMA/GFP and Ad-CMV-CAMA/GFP respectively were plated into 10 wells of 24-well plates at a density 1 × 105 cells/ well. Cells were allowed to adhere to the plates for 2 h at 37 °C in 5% 62
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 3. Antimicrobial activity assay of RAW264.7 and Phoenix cell-free culture supernatants. A. RAW264.7 cells were infected with Ad-MSPCAMA/GFP and Phoenix cells with Ad-CMVCAMA/GFP. The cell-free culture supernatants containing CAMA-syn peptide were prepared and added onto LB plates, on which four bacterial strains were inoculated, respectively. After 24hour incubation, the colony-forming efficiency was counted. *p < 0.05. n = 3. B. Growth curves of four bacterial strains inoculated in LB medium with cell-free culture supernatants containing CAMA-syn. CAMA in RAW264.7, cell-free culture supernatants of RAW264.7 infected by Ad-MSP-CAMA/GFP; Control in RAW264.7, cellfree culture supernatants of RAW264.7 infected by Ad-GFP; CAMA in Phoenix, cell-free culture supernatants of Phoenix infected by Ad-CMVCAMA/GFP; Control in Phoenix, cell-free culture supernatants of Phoenix infected by Ad-GFP.
Fig. 4. Expression of CAMA-syn in RAW264.7 and Phoenix cells confers antimicrobial activity against Salmonella and BCG. A. Survival rate of Salmonella in RAW264.7 and Phoenix cells infected with Ad-MSP-CAMA/GFP and Ad-CMV-CAMA/GFP respectively was significantly lower than that in RAW264.7 and Phoenix cells infected with Ad-GFP (p < 0.05; n = 10). B. Survival rate of BCG in RAW264.7 and Phoenix cells infected with recombinant adenovirus Ad-MSP-CAMA/GFP after challenged by BCG was significantly lower than that in RAW264.7 and Phoenix cells infected with AdGFP (p < 0.05; n = 10). Data shown are representative of three independent experiments.
3. Results
cases, significant differences were seen with different MOI. Generally, infection after 24 h, the expression of CAMA-syn was detected and reached highest expression 48 h post-infection.
3.1. CAMA-syn was expressed in RAW264.7 and phoenix infected by recombinant adenovirus
3.2. CAMA-syn expressed in cells showed antibacterial activity Adenoviral transfection efficiency for CAMA-syn was dose and cell dependent. Compared to expression of the reference gene GFP, the infection efficiency of adenovirus in RAW264.7 increased with the augmentation of MOI from 40 to 200, while no significant increasing was deteced in MOI of 240 (Fig. 1A). Similar results were observed in Phoenix cells, adenoviral infection efficiency raised with the increasing of MOI from 20 to 80, while no significant difference was detected at MOI of 80, 160, 320, 640, except for some cytopathic effect (Fig. 1B). In order to obtain the optimal MOI of adenoviral infection efficiency in different cells, real-time PCR was performed. The highest expression of CAMA-syn was seen in cell line Phoenix at the MOI of 40 (Fig. 1D) and in RAW264.7 cell at the MOI of 200 (Fig. 1C), respectively. In all
To investigate whether CAMA-syn expressing cells were capable of producing biologically active CAMA-syn, the antibacterial activity of cell lysates and cell-free culture supernatants were assessed. The results of colony-forming efficiency showed that both cell lysates and cell-free culture supernatants with CAMA-syn exhibited higher antibacterial activity than control groups (Fig. 2A). The differences of bacterial colony-forming efficiency in RAW264.7 (such as P. anatis, 70.9%) versus phoenix (P. anatis, 70.0%) were not statistically significant. However, the antibacterial activity was slightly higher in phoenix than in RAW264.7, this difference might be due to the activity of various potent promoters of CMV and MSP. To further evaluate the 63
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 5. Expression of CAMA-syn in vivo after recombinant adenovirus infection. A. expression of GFP was observed after adenovirus Ad-CMV-CAMA/GFP infection by tracheal injection, by tissue sections with PI dye nuclei, scale bar is 400 um. B. relative expression of CAMA-syn compared with GAPHD by real-time PCR was detected in the liver, heart, spleen, lungs and kidneys in day3, 7, 14 after tracheal injection with Ad-CMV-CAMA/GFP.
growth curve experiments showed that CAMA-syn expressed in both RAW264.7 and phoenix cells was readily secreted into the media and exhibited the potent suppression to bacterial proliferation (Fig. 3A and C). Overall, the cell-free culture supernatants showed similar antimicrobial activity to both of Gram-positive and Gram-negative bacterial as cell lysates did. For instance, the colony-forming efficiency of P. anatis treated with phoenix cell lysates and cell-free culture supernatants was reduced to 70.7% and 72.6%, respectively, compared to the control.
antibacterial activity, the time-dependent analysis was conducted to detect the inhibition activity of CAMA-syn. The results of bacteria growth curve showed that CAMA-syn treatments could significantly inhibit the bacterial growth (Fig. 2B). In 4–6 h incubation, the control bacteria were in the log phase, while the CAMA-syn treated bacteria reached the plateau phase, suggesting that CAMA-syn could prevent the bacterial proliferation with the antibacterial activity in vitro. Since the constructs of recombinant adenovirus containing the signal peptide of bovine IFN gamma, the expressed CAMA-syn can be secreted into culture media. To test whether CAMA-syn peptide secreted from cells has biological function, the cell-free culture supernatants from macrophage and phoenix cells were used to examine the antibacterial activity. The results of colony-forming efficiency and 64
Gene 630 (2017) 59–67
J. Zhang et al.
Fig. 6. Activation of inflammatory cytokines after recombinant adenovirus infection. A. Activation of TNF-α after adenovirus infection in various tissues with tracheal injection. B. Activation of IL-6 after adenovirus infection in various tissues with tracheal injection. C. HE staining of tissues infected with recombinant adenovirus through tracheal injection after 3 days, the heart, liver, spleen, lung and kidney were taken for HE staining to detect the infiltration of inflammatory cells. Scale bar = 200 μm.
3.3. CAMA-syn expressed in RAW264.7 showed intracellular antibacterial activity to Salmonella and BCG
3.5. Recombinant adenovirus infection led to fluctuation of immunological cytokines
To further evaluate the intracellular antibacterial activity of cells endowed expression of CAMA-syn in cells infected with the recombinant adenovirus, macrophage RAW264.7 and phoenix cells were infected with S. abortusovis or BCG followed by infection of either AdMSP-CAMA/GFP or Ad-CMV-CAMA/GFP. 48 h after adenovirus infection, intracellular live microbes were counted by colony enumeration assay. The results showed that the colony number of both S. abortusovis and BCG from RAW264.7 cells infected with Ad-MSP-CAMA/GFP was significantly less than that from RAW264.7 cells infected with Ad-GFP (p < 0.05; n = 10) (Fig. 4A, B). The similar results were observed in phoenix CAMA-syn expressing cells infected with Ad-CMV-CAMA/GFP.
Adenovirus infection usually caused the body's violent immune response, especially accompanying with some immunological stress cytokines expression volatility such as TNF-α and IL-6. After performance of recombinant adenovirus infection by tracheal infusion, only TNF-α was detected in liver in the 3rd day, and highly expressed in heart and kidney after 7 days. Meanwhile, TNF-αreached the highest expression in lungs and spleen 14 days after infection (Fig. 6A). On the other hand, IL-6 expression level enhanced significantly in heart, liver and lungs 3 days after infection and detected only in heart 7 days after infection and achieved the highest expression level also in spleen and lungs 14 days post-infection (Fig. 6B). Histological staining of these tissues after infection indicated that obvious lymphocytes infiltration and slight inflammation were observed in lungs and spleen but not in kidney (Fig. 6C).
3.4. CAMA-syn was expressed in mouse tissue To detect the expression level of CAMA-syn in mouse lungs, AdMSP-CAMA/GFP was used to infect mice by tracheal infusion and CAMA-syn expression level was evaluated by observation of the GFP expression. The data showed that CAMA-syn was highly expressed in lung 3 days post-infection and declined gradually by 7 days and almost disappeared 14 days post-infection as showed in Fig. 5A. To confirm these results, CAMA-syn expression was also evaluated by real-time PCR, the same results were obtained (Fig. 5B). As expected, 3 days after infection of Ad-MSP-CAMA/GFP, the expression of CAMA-syn in lungs reached the highest among other tissues including heart, liver, spleen and kidney. 7 days after infection, the expression of CAMA-syn in lungs became less than that of 3 days post-infection (about 1/10 of that level), and 14 days after infection, the expressing of CAMA-syn was hardly detected.
3.6. CAMA-syn displayed intracellular antibacterial activity in mouse lungs Recombinant adenovirus (Ad-MSP-CAMA/GFP, Ad-CMV-CAMA/ GFP and Ad-GFP) were used to infect BCG bearing mouse model by tracheal infusion. 3 days after infection, lungs were collected and RNA was extracted to detect the expression of CAMA-syn by real-time PCR. As shown in Fig. 7A, the expression level of CAMA-syn in mouse lungs infected by Ad-CMV-CAMA/GFP reached the highest, but was less in those infected with Ad-MSP-GFP/CAMA. To evaluate the recombinant adenoviral infection of these BCG bearing mice as a model, colonyformation efficiency of BCG from mouse lung homogenate infected with recombinant adenovirus Ad-MSP-GFP/CAMA, Ad-CMV-GFP/CAMA and Ad-GFP, respectively, was determined. 3 days after infection, lung 65
Gene 630 (2017) 59–67
J. Zhang et al.
be possible to use the tissue specific promoter to drive therapeutic proteins to be secreted at the site of infected or tumor. The results indicated that the macrophage specific expression system would enable secretion of therapeutic proteins as therapeutic agents at special tissue. Thus, we sought to determine whether acquisition of an antimicrobial peptide gene in macrophage cells can increase their antibacterial activity. Our results demonstrated that targeting expression of antimicrobial peptide CAMA-Syn inhibited BCG growth within macrophage RAW264.7 cells, endowing them with enhanced bactericidal activity against ingested bacteria. Thus, overexpression of CAMA-Syn in macrophage cells has high potential to improve their intracellular bactericidal ability to be applied as a promising therapeutic strategy for refractory intracellular infections in the future. Cell-specific expression of therapeutic genes in targeted cells is an excellent strategy due to no side effects on normal cells and even the whole body. The macrophage specific promoter can drive objective gene expression in macrophage cells exclusively, making it a convenient method for targeted expression. Indeed, it has already been applied to therapeutic research on diseases such as atherosclerosis (Whitman et al., 2002). Wen et al. reported that antimicrobial peptide PR-39 could be overexpressed in RAW.264.7 cell to inhibit intracellular growth of Salmonella enterica serovar Typhimurium (Wen et al., 2009). Thus, expression of CAMA-syn in macrophage cells is a desirable approach to improve antibacterial ability of lymphocytes to be applied as an alternative therapeutic strategy for refractory blood infections. Recombinant expressed AMPs have displayed a broad spectrum of antibacterial activity (Ladram and Nicolas, 2016; Sadr et al., 2017). It was reported that human keratinocyte cell line was transduced with adenovirus encoding human β-defensin 3 (HBD-3) or LL-37, and various bacteria were allowed to adsorb onto the surface (Jones et al., 2008; Suzuki et al., 2011). They found that when LL-37 or HBD-3 was overexpressed in the cells, Escherichia coli viability was reduced by 28%–68% and 34%–72%, respectively. For Staphylococcus aureus, the cell expressing LL-37 and HBD-3 showed 20%–45% and 20%–85% inhibitory activity, respectively. Pseudomonas aeruginosa viability was inhibited by 43%–53% and 28%–35% when LL-37 or HBD-3 was overexpressed, respectively (Jones et al., 2008). Antimicrobial assays demonstrated that recombinant cecropin B has antimicrobial activity against both Gram positive and negative bacteria (P. Y. Chen et al., 2011). Fusion expression of CAMA hybrid peptide in E. coli and in eucaryotic cells showed a certain inhibitory effect on Staphylococcus (Feng Wei-ping et al., 2008). In our study, CAMA-syn produced by adenovirus vector increased antibacterial activity against both gram-positive and gram-negative bacterial strains, suggesting that the CAMA-syn mediated by adenovirus vector has high potential for a range of therapeutic applications for intracellular infectious diseases such as tuberculosis.
Fig. 7. Expression of CAMA-syn in lungs and BCG inhibition assay. A. Tracheal injection of mouse with recombinant Adenovirus (Ad-GFP, Ad-MSP-CAMA/ GFP, and Ad-CMV-CAMA/GFP), relative expression of CAMA-syn compared with GADPH by real-time PCR was detected in the lungs. B. colony-formation efficiency of BCG in mouse lungs after adenoviral infection with Ad-GFP, Ad-MSP-CAMA/GFP and Ad-CMVCAMA/GFP Recombinant adenovirus was used to inhibit BCG infection in mouse model, respectively. 3 days after injection, lung tissue was grinded and tested for BCG colony formation efficiency.
tissue was grinded and tested for BCG colony formation efficiency. The results demonstrated that the Ad-MSP-GFP/CAMA and Ad-CMV-CAMA/GFP showed better antibacterial activity and the colony-forming efficiency was reduced to 78.31% and 61.68%, respectively, compared to 100% of the control Ad-GFP (Fig. 7B). 4. Discussion Short chain AMPs (antimicrobial peptides) can be prepared in bulk by solid phase chemical synthesis, but the cost is prohibitive, and improper folding of polypeptides may compromise their activity. There are several biological expression systems which have been used to produce antimicrobial peptides, including yeasts and bacteria (Verma et al., 1998). Attempts have been made to produce AMPs in transgenic eukaryotic expression system to accelerate the implementation of the peptide for use as antimicrobial agent and medicinal settings (Yarus et al., 1996). For example, human β-defensin 2 was used as a model for in vivo antimicrobial gene therapy (Huang et al., 2002). Also, human host defense peptide LL-37 was effective for the treatment of burn wound infections (Jacobsen et al., 2005). Recombinant adenovirus expression systems have various advantages because they do not require a DNA integration procedure or a selection step, and they can be prepared more rapidly and unaffected by chromosomal positional effects (Yi and Li, 2010). Production of recombinant proteins by adenovirus expression vectors in mammalian cells, such as the cell lines of COS (Corsi et al., 1998), HEK293 (Liu et al., 2010), and BHK (Wurm and Bernard, 1999), has been described. In this study, we constructed recombinant adenovirus to express AMPs in RAW264.7and mouse macrophage cells. The construct comprised of two basic components: the macrophage special promoter (MSP) (GenBank accession: No. DQ107382) and the synthetic peptide of CAMA-syn. Therefore, it might
5. Conclusion In this article, we expressed antimicrobial peptide CAMA-syn mediated by recombinant adenovirus in RAW264.7 and macrophage cells in lungs with MSP promoters that showed intracellular antibacterial activity, implying that this system has a potential to be used in infectious diseases. This system provides a novel insight and approach for the control of refractory infections caused by intracellular bacteria such as M. tuberculosis, especially multidrug-resistant strains that are sensitive to CAMA-Syn.
Acknowledgments We thank Pro. Zengqi Yang of College of Veterinary Medicine, Northwest A & F University, for kindly donating the strains of bacterial for antibacterial assay. This work was supported by a grant from the National Science Foundation of China (No. 31302148). 66
Gene 630 (2017) 59–67
J. Zhang et al.
structures. Biochemistry 39 (39), 11855–11864. Ohta, Y., Horiuchi, T., Dohi, T., Sugaya, K., Matsumoto, H., Ide, H., 1990. Development of computer-aided motion analyzing (CAMA) system for radiopaque implanted tilting disk heart valves. Artif. Organs 14 (6), 449–453. Pohin, M., Guesdon, W., Mekouo, A.A., Rabeony, H., Paris, I., Atanassov, H., ... Jegou, J.F., 2016. Oncostatin M overexpression induces skin inflammation but is not required in the mouse model of imiquimod-induced psoriasis-like inflammation. Eur. J. Immunol. 46 (7), 1737–1751. http://dx.doi.org/10.1002/eji.201546216. Sadr, V., Saffar, B., Emamzadeh, R., 2017. Functional expression and purification of recombinant Hepcidin25 production in Escherichia coli using SUMO fusion technology. Gene. http://dx.doi.org/10.1016/j.gene.2017.02.010. Suzuki, Y., Inokuchi, S., Takazawa, K., Umezawa, K., Saito, T., Kidokoro, M., ... Ando, K., 2011. Introduction of human beta-defensin-3 into cultured human keratinocytes and fibroblasts by infection of a recombinant adenovirus vector. Burns 37 (1), 109–116. Talactac, M.R., Yada, Y., Yoshii, K., Hernandez, E.P., Kusakisako, K., Maeda, H., ... Tanaka, T., 2017. Characterization and antiviral activity of a newly identified defensin-like peptide, HEdefensin, in the hard tick Haemaphysalis longicornis. Dev. Comp. Immunol. 68, 98–107. Verma, R., Boleti, E., George, A.J., 1998. Antibody engineering: comparison of bacterial, yeast, insect and mammalian expression systems. J. Immunol. Methods 216 (1–2), 165–181. Wakeham, J., Wang, J., Xing, Z., 2000. Genetically determined disparate innate and adaptive cell-mediated immune responses to pulmonary Mycobacterium bovis BCG infection in C57BL/6 and BALB/c mice. Infect. Immun. 68 (12), 6946–6953. Wen, Y.A., Yu, X.L., Xia, Q.F., Cen, D., Liu, J.B., Tu, Z.G., 2009. Macrophage-specific overexpression of antimicrobial peptide PR-39 inhibits intracellular growth of Salmonella enterica serovar Typhimurium in macrophage cells. Int. J. Antimicrob. Agents 34 (4), 315–321 (doi:S0924-8579(09)00216-7 [pii]10.1016/j.ijantimicag.2009.04.014). Whitman, S.C., Rateri, D.L., Szilvassy, S.J., Cornicelli, J.A., Daugherty, A., 2002. Macrophage-specific expression of class A scavenger receptors in LDL receptor(−/−) mice decreases atherosclerosis and changes spleen morphology. J. Lipid Res. 43 (8), 1201–1208. Woo, J.I., Kil, S.H., Brough, D.E., Lee, Y.J., Lim, D.J., Moon, S.K., 2015. Therapeutic potential of adenovirus-mediated delivery of beta-defensin 2 for experimental otitis media. Innate Immun. 21 (2), 215–224. Wurm, F., Bernard, A., 1999. Large-scale transient expression in mammalian cells for recombinant protein production[J]. Curr. Opin. Biotechnol. 10 (2), 156–159. Xu, W., Huo, L., Li, J., Xu, C., Wang, S., Yang, Y., ... Yan, X., 2017. Effects of alcohol on mitochondrial functions of cumulus cells in mice. Cell Rep. 19 (2), 123–131 (d). Yarus, S., Rosen, J.M., Cole, A.M., Diamond, G., 1996. Production of active bovine tracheal antimicrobial peptide in milk of transgenic mice. Proc. Natl. Acad. Sci. U. S. A. 93 (24), 14118–14121. Yi, N., Li, N., 2010. Transient expression of chicken antimicrobial peptides by mouse mammary carcinoma cells C127. Protein Pept. Lett. 17 (12), 1517–1523 (doi:BSP/ PPL/E pub/0209 [pii]). Zhang, J., Peng, S., Cheng, X., Wang, H., 2012. Functional analysis of hybrid peptide CAMA-Syn: expression in mammalian cells and antimicrobial potential. Protein Pept. Lett. 19 (10), 1076–1081.
References Babu, P.B., Meenakshi, A., 1997. Detection of breast tumor associated mucin epitope on CAMA cell line using monoclonal antibody G3F1 generated against HMFG membrane. Cancer Biochem. Biophys. 15 (4), 263–274. Chen, L., Wang, J., Zganiacz, A., Xing, Z., 2004. Single intranasal mucosal Mycobacterium Bovis BCG vaccination confers improved protection compared to subcutaneous vaccination against pulmonary tuberculosis. Infect. Immun. 72 (1), 238–246. Chen, P.Y., Wang, X.Q., Zhu, M.X., Yang, G.M., Su, C.X., Zhang, A.J., Cao, R.B., 2011. Expression of cecropin B in Pichia pastoris and its bioactivity in vitro. Exp. Ther. Med. 2 (4), 655–660. Corsi, B., Perrone, F., Bourgeois, M., Beaumont, C., Panzeri, M.C., Cozzi, A., Levi, S., 1998. Transient overexpression of human H- and L-ferritin chains in COS cells. Biochem. J. 330 (Pt 1), 315–320. Feng Wei-ping, Han Yue-wu, Hui-zi, R., 2008. Construction and expression of cecropin A (1-8) - magainin (1-12) hybrid peptide mutant and antibacterial activity of expressed product. Chin. J. Biol. 21 (9), 4. Huang, G.T., Zhang, H.B., Kim, D., Liu, L., Ganz, T., 2002. A model for antimicrobial gene therapy: demonstration of human beta-defensin 2 antimicrobial activities in vivo. Hum. Gene Ther. 13 (17), 2017–2025. Jacobsen, F., Mittler, D., Hirsch, T., Gerhards, A., Lehnhardt, M., Voss, B., ... Steinstraesser, L., 2005. Transient cutaneous adenoviral gene therapy with human host defense peptide hCAP-18/LL-37 is effective for the treatment of burn wound infections. Gene Ther. 12 (20), 1494–1502. Jacobsen, F., Rittig, A., Steinstraesser, L., 2011. Introduction of human beta-defensin-3 into cultured human keratinocytes and fibroblasts by recombinant adenovirus vectors—are primary cells able to secrete sufficient amounts of transgene to exhibit biological activity in vitro? Burns 37 (7), 1268–1269. Jeong, K.W., Shin, S., Kim, J.K., Kim, Y., 2009. Antibacterial activity and synergism of the hybrid antimicrobial peptide, CAMA-syn. Bull. Kor. Chem. Soc. 30 (8), 1839–1844. Ji, H., Stout, L.E., Zhang, Q., Zhang, R., Leung, H.T., Leung, B.S., 1994. Absence of transforming growth factor-beta responsiveness in the tamoxifen growth-inhibited human breast cancer cell line CAMA-1. J. Cell. Biochem. 54 (3), 332–342. Jones, C.J., Skidmore, J.A., Aplin, J.D., 2008. Placental glycosylation in a cama (camelllama cross) and its relevance to successful hybridisation. Mol. Phylogenet. Evol. 49 (3), 1030–1035. Ladram, A., Nicolas, P., 2016. Antimicrobial peptides from frog skin: biodiversity and therapeutic promises. Front. Biosci. 21, 1341–1371. Lapointe, J., Labrie, C., 2001. Role of the cyclin-dependent kinase inhibitor p27(Kip1) in androgen-induced inhibition of CAMA-1 breast cancer cell proliferation. Endocrinology 142 (10), 4331–4338. Liu, L., Xu, H.M., Jiang, H., Wang, J., Song, N., Xie, J.X., 2010. Recombinant adenovirusmediated expression of GHS-R1a in HEK 293 cells. Neurosci. Bull. 26 (3), 225–231. Oh, D., Shin, S.Y., Kang, J.H., Hahm, K.S., Kim, K.L., Kim, Y., 1999. NMR structural characterization of cecropin A(1-8) - magainin 2(1-12) and cecropin A (1-8) - melittin (1-12) hybrid peptides. J. Pept. Res. 53 (5), 578–589. Oh, D., Shin, S.Y., Lee, S., Kang, J.H., Kim, S.D., Ryu, P.D., ... Kim, Y., 2000. Role of the hinge region and the tryptophan residue in the synthetic antimicrobial peptides, cecropin A(1-8)-magainin 2(1-12) and its analogues, on their antibiotic activities and
67