- Email: [email protected]
Targeting of leptin to the regulated secretory pathway in pituitary AtT-20 cells
Brief Communication
349
Targeting of leptin to the regulated secretory pathway in pituitary AtT-20 cells Raymond A. Chavez and Hsiao-Ping H. Moore Leptin, a key regulator of fat homeostasis, is the product of the obese gene [1–3], and is secreted from adipocytes and binds to receptor sites in the choroid plexus [4,5]. Several studies have implicated serum insulin levels in the upregulation of leptin gene expression [6–8]. It is currently not known whether leptin levels are also subject to regulation at the level of secretion. Leptin is normally produced in adipocytes, the secretory pathways of which are not well characterized. Here, we used pituitary AtT-20 cells, which serve as a model system for both regulated and constitutive secretory pathways, to examine the intracellular targeting and secretion of leptin. Confocal immunofluorescence analysis of AtT-20 cells expressing an epitope-tagged human leptin (FLAG–leptin) demonstrated that FLAG–leptin colocalized with endogenous adrenocorticotrophic hormone (ACTH) at the tips of processes extended from these cells, where regulated secretory granules accumulate. FLAG–leptin secretion was increased in the presence of 8-Br-cAMP, which stimulates the secretion of ACTH. For FLAG–leptin, the calculated sorting index, a quantitative measure of the efficiency of protein sorting to the regulated pathway, was similar to those of other regulated secretory proteins. These results demonstrate that FLAG–leptin behaves like a regulated protein in cells with a biosynthetic regulated secretory pathway. Address: 571 Life Sciences Addition, Department of Molecular and Cell Biology, University of California, Berkeley, California 94720-3200, USA.
Correspondence: Hsiao-Ping H. Moore E-mail: [email protected] Received: 29 January 1997 Revised: 17 March 1997 Accepted: 26 March 1997 Electronic identifier: 0960-9822-007-00349 Current Biology 1997, 7:349–352 © Current Biology Ltd ISSN 0960-9822
Results and discussion Studies of the intracellular targeting and secretion pathway of leptin have been hampered by the large amount of fat droplets in intact fat tissues. An important model system for the study of adipocyte biology has been provided by 3T3-L1 adipocyte cells differentiated in vitro [9]; however, under standard differentiation conditions [10], the amount of leptin produced in 3T3-L1 cells is too low to permit pulse–chase studies. The mouse pituitary AtT-20 cell line has been used previously as a reliable surrogate system to investigate protein sorting and secretion, because these cells contain well-characterized secretory pathways and faithfully segregate foreign proteins into the appropriate regulated or constitutive secretory pathways [11–13]. To investigate leptin sorting and secretion, we have therefore stably transfected AtT-20 cells with an epitope-tagged human leptin construct chimera, FLAG–leptin (Fig. 1a). The leptin chimera contains the signal sequence derived from the cell surface antigen CD8 followed by the FLAG epitope tag (DYKDDDDK in
Figure 1 Structure and expression of FLAG–leptin. (a) Diagram of the FLAG–leptin chimera. Human leptin cDNA was PCR-amplified from an adipose cDNA library (Clontech) using the primers 5′-GCGGGGGGATCCGTGCCCAT CCAAAAAGTCCAAGATGACACC-3′ and 5′GCGGGGCTCGAGTCAGCACCCAGGGC TGAGGTCCAGC-3′ to introduce a BamHI site and an XhoI site (underlined) at the 5′ and 3′ end, respectively. This allowed the insertion of the mature human leptin coding sequence into the vector pSSF, which contains a cassette encoding the CD8 signal sequence (including the signal peptidase cleavage site) followed by the eight amino-acid FLAG epitope. Genes introduced in-frame at the BamHI site are expressed with the CD8 signal sequence and FLAG epitope at the amino terminus. (b) FLAG–leptin expression in AtT-
(a)
(b) NH2 -
-COOH
Wild- FLAG– type leptin 45
CD8 signal sequence 29 FLAG epitope tag Human leptin (22–167)
18
Signal cleavage site
14
20 cells stably transfected with the construct as described in [25,26]. Extracts of wild-type and transfected AtT-20 cells were subjected to 16.5% SDS–PAGE followed by immunoblot analysis [16,27] using the antiFLAG monoclonal antibody M2 (IBI) and the
ECL detection system (Amersham). Each sample contains extracts from approximately 2 × 104 cells. The mobilities of standards (in kDa) are indicated.
350
Current Biology, Vol 7 No 5
Figure 2
Double indirect immunofluorescent localization of FLAG–leptin. (a,b) Wild-type and (c–f) FLAG–leptin-transfected AtT-20 cells plated onto laminin were fixed, permeabilized, and blocked with 1% normal goat serum (Organon Teknika) [16]. The cells were stained first with (a,c,e) anti-ACTH polyclonal antibody (1:10) or (b,d,f) anti-FLAG M2
monoclonal antibody (1:200) and then with FITC–goat-anti-rabbit or rhodamine–goat-anti-mouse secondary antibodies (1:25; Organon Teknika). The cells were observed using a Zeiss LSM confocal microscope (300 nm z-section thickness).
single-letter amino-acid code) and the complete coding sequence of mature human leptin (amino acids 22–167; Fig. 1a). The cleavage site of the CD8 signal sequence was retained upstream of the FLAG tag, allowing targeting of FLAG–leptin to the endoplasmic reticulum (ER) translocation machinery and, after removal of the signal sequence, release of FLAG–leptin into the ER lumen.
antibodies (Fig. 2c,e) and the anti-FLAG antibodies (Fig. 2d,f), with some additional staining in a perinuclear region. In wild-type cells, this staining pattern was observed only with the anti-ACTH antibody (compare Fig. 2a with Fig. 2b). These results indicate that FLAG–leptin is targeted to the tips of processes, and we therefore suggest that FLAG–leptin might accumulate in dense-core granules.
A clone of AtT-20 cells was isolated that stably expressed FLAG–leptin following transfection. Using the antiFLAG M2 monoclonal antibody, we detected a single band of 17 kDa on a western blot of extracts from transfected cells that was absent from untransfected wild-type AtT-20 cells (Fig. 1b); no other FLAG-immunoreactive species were detected. The predicted molecular mass of the FLAG–leptin protein without the CD8 signal sequence is 17.3 kDa; the precursor protein containing the signal sequence has a predicted size of 19.5 kDa. As only one FLAG-immunoreactive band was detected, it is clear that FLAG–leptin is being produced and that the CD8 signal sequence is efficiently removed in the ER. We conclude that FLAG–leptin is properly cleaved and expressed in these transfected cells. We therefore sought to determine whether FLAG–leptin was released by the constitutive or the regulated secretory pathway.
If FLAG–leptin is targeted to the dense-core granule, then a secretagogue that stimulates the regulated release of ACTH from these granules should also cause the regulated release of FLAG–leptin. To investigate the secretion of FLAG–leptin, we metabolically labeled cells with 35S-translabel to near steady-state levels, and followed the secretion of FLAG–leptin during three consecutive three-hour chase intervals (Fig. 3). At steady-state, about 9.6% of cellular FLAG–leptin was released into the medium each hour (Fig. 3a,b, lane 1). Upon chase, 26% of total labeled FLAG–leptin was secreted within six hours (Fig. 3a,b, lanes 2,3; see quantitation in Fig. 3c), which probably represents secretion via the constitutive and/or constitutive-like secretory pathway [17]. To induce regulated secretion, cells were incubated with medium containing 8-Br-cAMP during the last chase period (6–9h; Fig. 3b); control cells were not treated with the secretagogue (Fig. 3a). We observed a 10-fold increase in FLAG–leptin secretion from 8-Br-cAMP-treated cells relative to the basal secretion observed from untreated cells (compare lane 4 of Fig. 3b with Fig. 3a). This secretion was paralleled by a 2.8-fold decrease in the FLAG–leptin recovered from the extracts of the stimulated cells, relative to that from untreated cells (compare lane 5 of Fig. 3b with Fig. 3a). The basal secretion of regulated secretory proteins during the stimulation period (Fig. 3a, lane 4) is a common feature of protein secretion from AtT-20 cells [18]. The observed pattern of FLAG–leptin secretion closely resembles that of ACTH
We used immunofluorescence to determine the intracellular location of the exogenously expressed FLAG–leptin construct in AtT-20 cells. Several studies have demonstrated that dense-core regulated secretory granules, the site of accumulation of endogenous adrenocorticotrophic hormone (ACTH), are found at the tip of the extended processes of AtT-20 cells [14–16]. We therefore compared the intracellular localization of ACTH and FLAG–leptin in transfected cells using antibodies specific for each protein (Fig. 2). Staining of the tip region of transfected cells was observed with both the anti-ACTH
Brief Communication
351
Figure 3 (a)
(c) Time (h) –1–0
Medium 0–3 3–6
80
Extract 6–9
9
1
2
3
4
(b)
1
– 0–3
2
– 3–6
3
5 Extract
Medium – 8-Br-cAMP Time (h) –1–0
% Total secreted
60
+ 6–9
4
+ 9
40
20
0 Time (h) 8-Br-cAMP
5
0–3 – –
3–6 6–9 – – – + Medium
9 – + Extract
Secretion profile of FLAG–leptin from transfected AtT-20 cells. (a,b) Pulse–chase secretion assay. Parallel cultures of AtT-20 cells expressing FLAG–leptin were metabolically labeled for 15 h with 0.2 mCi ml–1 translabel (Dupont-New England Nuclear) in 1% FCS/DME, and then incubated with fresh labeling media for an additional hour. The media samples from this short labeling period were collected and immunoprecipitated with anti-FLAG M2 beads (–1–0 h, lane 1). Cells were then chased for the indicated times (0–3, 3–6, and 6–9 h) in 2% FCS/DME and media were immunoprecipitated (lanes 2–4). Immunoprecipitation was carried out as described [25] with anti-FLAG M2 beads (1:1 suspension; IBI) or rabbit anti-ACTH antibody, except that the beads were washed with a urea-containing buffer (2 M urea, 2.5% Tween-20 (w/v), 0.2 M NaCl, 0.1 M Tris-HCl
pH 7.5). 8-Br-cAMP (5 mM; Sigma) was added to one sample during the 6–9 h chase period to stimulate regulated secretion ((b), lane 4) and the parallel sample received medium alone ((a), lane 4). After the last chase, the cells were lysed and immunoprecipitated (lane 5; Extract). The immunoprecipitates were subjected to SDS–PAGE and analyzed by a PhosphorImager. The results are representative of three independent experiments. (c) Quantitation of results from pulse–chase secretion assay. Quantitative data of the FLAG–leptin bands from two independent experiments were obtained using the ImageQuant software package. The counts in each band were normalized to the total counts recovered from the chase medium and cell extracts in either the unstimulated or the stimulated conditions.
secretion (data not shown) [19], and suggests that FLAG–leptin is targeted to the regulated secretory pathway in AtT-20 cells.
that the selection of the FLAG–leptin cell line had not altered the secretory characteristics of endogenous ACTH. Taken together, these results imply that leptin might contain intracellular targeting information similar to those of bona fide peptide hormones, raising the possibility that its release from adipocytes might follow a regulated pathway that is as yet not understood.
Quantitation of these data provided the sorting index (SI) for FLAG–leptin expressed in AtT-20 cells. We have previously used the SI as a measure of the degree to which a given protein is targeted to the regulated secretory pathway. The SI was determined by comparing the amount of 8-Br-cAMP-induced secretion (Fig. 3a,b; lane 4) to the level of steady-state secretion from unstimulated cells (Fig. 3a,b, lane 1; see [11]). SI values have been determined for a variety of secretory proteins in AtT-20 cells (Table 1). The SI for FLAG–leptin is 0.85, which is similar to or greater than the values for other regulated secretory proteins (Table 1). In control studies, we used the same expression vector to examine the intracellular targeting of other secretory proteins and found that neither the CD8 signal sequence nor the FLAG tag causes missorting between the constitutive and the regulated secretory pathways (M. Haugwitz, W.K. Schmidt and H.-P. H. Moore, unpublished observations). In the present experiment, the calculated sorting index for endogenous ACTH in the FLAG–leptin cell line was not significantly different from that determined in wild-type AtT-20 cells [11], indicating
Table 1 Sorting indices of secretory proteins in AtT-20 cells. Protein
SI
Reference
0.005
[15]
Constitutive:
Truncated VSV-G
Regulated:
Mouse ACTH 0.14 (n = 0.02)* [15] Human growth hormone 0.35 (n = 0.06)* [15] Human proinsulin 0.66 [16] FLAG–leptin 0.85 (n = 0.19)* This report
The sorting indices (SI) of the constitutive secretory protein truncated vesicular stomatitis virus (VSV) G protein, the regulated secretory proteins ACTH, growth hormone, proinsulin and FLAG–leptin were determined by comparing the increment in secretion induced by 8-BrcAMP during the last three-hour chase period to the value from the one-hour labeling period as described [11]. For the data from Fig. 3, the calculation of the SI is equivalent to: [(lane 4b – lane 4a)/3]/lane 1. * Range of two independent determinations.
352
Current Biology, Vol 7 No 5
We have shown that 8-Br-cAMP induces secretion of FLAG–leptin from AtT-20 cells, probably because FLAG–leptin is targeted to secretory granules containing the endogenous hormone ACTH. It should be noted that a different signaling pathway is probably involved in adipocytes. Previous studies have shown that increases in cAMP levels have opposing effects on protein production and secretion in adipocytes compared with AtT-20 cells. The simplest explanation of the differences in the secretory response is the existence of different signaling pathways in corticotrophs and adipocytes. The finding that leptin may be a bona fide regulated secretory protein is made less surprising by several studies of adipocyte biology which have suggested that there are multiple types of regulated secretory pathways in these cells. A well-characterized effect of insulin on adipocytes involves the rapid mobilization of the glucose transporter GLUT4 from an intracellular storage pool to the cell surface [20,21]: this process has been likened to synaptic vesicle recycling in neurons. In addition, secretion of other proteins by adipocytes can be enhanced by treatment with insulin. It is at present not known whether this enhancement is due to the effect of insulin on the constitutive pathway, or on a post-Golgi regulated pathway similar to those present in classical endocrine cells. In support of the latter hypothesis, it has been shown that adipocyte differentiation is correlated with the expression of members of the Rab family of small monomeric GTPases, Rab3A and Rab3D [22,23], which have been implicated in a wide variety of regulated secretory processes such as neurotransmitter and peptide hormone secretion [16,24]. These Rab proteins were found in distinct membrane fractions, suggesting that more than one type of regulated secretory organelles exist in these cells [23]. Important challenges in the near future are to determine whether adipocytes possess a bona fide biosynthetic regulated pathway, and whether the secretion of leptin is subject to physiological regulation at the exocytotic level.
5.
6.
7. 8. 9. 10. 11. 12. 13. 14.
15. 16. 17.
18. 19.
20. 21.
Acknowledgements The authors thank S.G. Miller for help with the expression plasmid pSSF and J.M. Andresen for screening plasmid clones of the chimera. We also thank B. Eaton, M. Haugwitz, J. Hacker, and members of the Moore lab for critical reading of the manuscript. This work was supported by grants from the Public Health Service (GM 35239) and American Cancer Society (CB89D). R.A.C. was supported by an National Science Foundation Minority Postdoctoral Fellowship (BIR 9308057).
References 1. Zhang Y, Proenca R, Maffei M, BaroneM, Leopold L, Friedman JM: Positional cloning of the mouse obese gene and its human homologue. Nature 1994, 372:425–432. 2. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, et al.: Weight-reducing effects of the plasma protein encoded by the obese gene. Science 1995, 269:543–546. 3. Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T, et al.: Effects of the obese gene product on body weight regulation in ob/ob mice. Science 1995, 269:540–543. 4. Lynn RB, Cao GY, Considine RV, Hyde TM, Caro JF: Autoradiographic localization of leptin binding in the choroid
22. 23.
24. 25. 26. 27.
plexus of ob/ob and db/db mice. Biochem Biophys Res Commun 1996, 219:884–889. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P: Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 1995, 269:546–549. MacDougald OA, Hwang CS, Fan H, Lane MD: Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3–L1 adipocytes. Proc Natl Acad Sci USA 1995, 92:9034–9037. Saladin R, De VP, Guerre MM, Leturque A, Girard J, Staels B, et al.: Transient increase in obese gene expression after food intake or insulin administration. Nature 1995, 377:527–529. Slieker LJ, Sloop KW, Surface PL, Kriauciunas A, LaQuier F, Manetta J, et al.: Regulation of expression of ob mRNA and protein by glucocorticoids and cAMP. J Biol Chem 1996, 271:5301–5304. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF: A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 1995, 270:26746–26749. Frost SC, Lane MD: Evidence for the involvement of vicinal sulfhydryl groups in insulin-activated hexose transport by 3T3–L1 adipocytes. J Biol Chem 1985, 260:2646–2652. Moore H-PH, Kelly RB: Secretory protein targeting in a pituitary cell line: differential transport of foreign secretory proteins to distinct secretory pathways. J Cell Biol 1985, 101:1773–1781. Powell SK, Orci L, Craik CS, Moore H-PH: Efficient targeting to storage granules of human proinsulins with altered propeptide domain. J Cell Biol 1988, 106:1843–1851. Schmidt WK, Moore HP: Synthesis and targeting of insulin-like growth factor-I to the hormone storage granules in an endocrine cell line. J Biol Chem 1994, 269:27115–27124. Tooze J, Hollinshead M, Fuller SD, Tooze SA, Huttner WB: Morphological and biochemical evidence showing neuronal properties in AtT-20 cells and their growth cones. Eur J Cell Biol. 1989, 49:259–273. Rivas RR, Moore HP: Spatial segregation of the regulated and constitutive secretory pathways. J Cell Biol 1989, 109:51– 60. Chavez RA, Miller SG, Moore H-PH: A biosynthetic regulated secretory pathway in constitutive secretory cells. J Cell Biol 1996, 133:1177–1192. Kuliawat R, Arvan P: Protein targeting via the ‘constitutive-like’ secretory pathway in isolated pancreatic islets: passive sorting in the immature granule compartment. J Cell Biol 1992, 118:521–529. Matsuuchi L, Kelly RB: Constitutive and basal secretion from the endocrine cell line, AtT-20. J Cell Biol 1991, 112:843–852. Moore HPH, Gumbiner B, Kelly RB: A subclass of proteins and sulfated macromolecules secreted by AtT-20 (mouse pituitary tumor) cells is sorted with adrenocorticotropin into dense secretory granules. J Cell Biol 1983, 97:810–817. Slot JW, Geuze HJ, Gigengack S, Lienhard GE, James DE: Immunolocalization of the insulin regulatable glucose transporter in brown adipose tissue of the rat. J. Cell Biol 1991, 113:123–135. Smith RM, Charron MJ, Shah N, Lodish HF, Jarret L: Immunoelectron microscopic demonstration of insulin-stimulated translocation of glucose transporters to the plasma membrane of isolated rat adipocytes and masking of the carboxyl-terminal epitope of intracellular GLUT4. Proc Natl Acad Sci USA 1991, 88:6893–6897. Baldini G, Hohl T, Lin HY, Lodish HF: Cloning of a Rab3 isotype predominantly expressed in adipocytes. Proc Natl Acad Sci USA 1992, 89:5049–5052. Baldini G, Scherer PE, Lodish HF: Nonneuronal expression of Rab3A: induction during adipogenesis and association with different intracellular membranes than Rab3D. Proc Natl Acad Sci USA 1995, 92:4284–4288. Fischer von Mollard G, Stahl B, Li C, SYdhof TC, Jahn R: Rab proteins in regulated exocytosis. Trends Biochem Sci 1994, 19:164–168. Chavez RA, Chen Y, Schmidt WK, Carnell L, Moore H-PH: Expression of exogenous proteins in cells with regulated secretory pathways. Methods Cell Biol 1994, 43:263–288. Graham F, van der Eb A: A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 1973, 52:456–467. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227:680–685.
349
Targeting of leptin to the regulated secretory pathway in pituitary AtT-20 cells Raymond A. Chavez and Hsiao-Ping H. Moore Leptin, a key regulator of fat homeostasis, is the product of the obese gene [1–3], and is secreted from adipocytes and binds to receptor sites in the choroid plexus [4,5]. Several studies have implicated serum insulin levels in the upregulation of leptin gene expression [6–8]. It is currently not known whether leptin levels are also subject to regulation at the level of secretion. Leptin is normally produced in adipocytes, the secretory pathways of which are not well characterized. Here, we used pituitary AtT-20 cells, which serve as a model system for both regulated and constitutive secretory pathways, to examine the intracellular targeting and secretion of leptin. Confocal immunofluorescence analysis of AtT-20 cells expressing an epitope-tagged human leptin (FLAG–leptin) demonstrated that FLAG–leptin colocalized with endogenous adrenocorticotrophic hormone (ACTH) at the tips of processes extended from these cells, where regulated secretory granules accumulate. FLAG–leptin secretion was increased in the presence of 8-Br-cAMP, which stimulates the secretion of ACTH. For FLAG–leptin, the calculated sorting index, a quantitative measure of the efficiency of protein sorting to the regulated pathway, was similar to those of other regulated secretory proteins. These results demonstrate that FLAG–leptin behaves like a regulated protein in cells with a biosynthetic regulated secretory pathway. Address: 571 Life Sciences Addition, Department of Molecular and Cell Biology, University of California, Berkeley, California 94720-3200, USA.
Correspondence: Hsiao-Ping H. Moore E-mail: [email protected] Received: 29 January 1997 Revised: 17 March 1997 Accepted: 26 March 1997 Electronic identifier: 0960-9822-007-00349 Current Biology 1997, 7:349–352 © Current Biology Ltd ISSN 0960-9822
Results and discussion Studies of the intracellular targeting and secretion pathway of leptin have been hampered by the large amount of fat droplets in intact fat tissues. An important model system for the study of adipocyte biology has been provided by 3T3-L1 adipocyte cells differentiated in vitro [9]; however, under standard differentiation conditions [10], the amount of leptin produced in 3T3-L1 cells is too low to permit pulse–chase studies. The mouse pituitary AtT-20 cell line has been used previously as a reliable surrogate system to investigate protein sorting and secretion, because these cells contain well-characterized secretory pathways and faithfully segregate foreign proteins into the appropriate regulated or constitutive secretory pathways [11–13]. To investigate leptin sorting and secretion, we have therefore stably transfected AtT-20 cells with an epitope-tagged human leptin construct chimera, FLAG–leptin (Fig. 1a). The leptin chimera contains the signal sequence derived from the cell surface antigen CD8 followed by the FLAG epitope tag (DYKDDDDK in
Figure 1 Structure and expression of FLAG–leptin. (a) Diagram of the FLAG–leptin chimera. Human leptin cDNA was PCR-amplified from an adipose cDNA library (Clontech) using the primers 5′-GCGGGGGGATCCGTGCCCAT CCAAAAAGTCCAAGATGACACC-3′ and 5′GCGGGGCTCGAGTCAGCACCCAGGGC TGAGGTCCAGC-3′ to introduce a BamHI site and an XhoI site (underlined) at the 5′ and 3′ end, respectively. This allowed the insertion of the mature human leptin coding sequence into the vector pSSF, which contains a cassette encoding the CD8 signal sequence (including the signal peptidase cleavage site) followed by the eight amino-acid FLAG epitope. Genes introduced in-frame at the BamHI site are expressed with the CD8 signal sequence and FLAG epitope at the amino terminus. (b) FLAG–leptin expression in AtT-
(a)
(b) NH2 -
-COOH
Wild- FLAG– type leptin 45
CD8 signal sequence 29 FLAG epitope tag Human leptin (22–167)
18
Signal cleavage site
14
20 cells stably transfected with the construct as described in [25,26]. Extracts of wild-type and transfected AtT-20 cells were subjected to 16.5% SDS–PAGE followed by immunoblot analysis [16,27] using the antiFLAG monoclonal antibody M2 (IBI) and the
ECL detection system (Amersham). Each sample contains extracts from approximately 2 × 104 cells. The mobilities of standards (in kDa) are indicated.
350
Current Biology, Vol 7 No 5
Figure 2
Double indirect immunofluorescent localization of FLAG–leptin. (a,b) Wild-type and (c–f) FLAG–leptin-transfected AtT-20 cells plated onto laminin were fixed, permeabilized, and blocked with 1% normal goat serum (Organon Teknika) [16]. The cells were stained first with (a,c,e) anti-ACTH polyclonal antibody (1:10) or (b,d,f) anti-FLAG M2
monoclonal antibody (1:200) and then with FITC–goat-anti-rabbit or rhodamine–goat-anti-mouse secondary antibodies (1:25; Organon Teknika). The cells were observed using a Zeiss LSM confocal microscope (300 nm z-section thickness).
single-letter amino-acid code) and the complete coding sequence of mature human leptin (amino acids 22–167; Fig. 1a). The cleavage site of the CD8 signal sequence was retained upstream of the FLAG tag, allowing targeting of FLAG–leptin to the endoplasmic reticulum (ER) translocation machinery and, after removal of the signal sequence, release of FLAG–leptin into the ER lumen.
antibodies (Fig. 2c,e) and the anti-FLAG antibodies (Fig. 2d,f), with some additional staining in a perinuclear region. In wild-type cells, this staining pattern was observed only with the anti-ACTH antibody (compare Fig. 2a with Fig. 2b). These results indicate that FLAG–leptin is targeted to the tips of processes, and we therefore suggest that FLAG–leptin might accumulate in dense-core granules.
A clone of AtT-20 cells was isolated that stably expressed FLAG–leptin following transfection. Using the antiFLAG M2 monoclonal antibody, we detected a single band of 17 kDa on a western blot of extracts from transfected cells that was absent from untransfected wild-type AtT-20 cells (Fig. 1b); no other FLAG-immunoreactive species were detected. The predicted molecular mass of the FLAG–leptin protein without the CD8 signal sequence is 17.3 kDa; the precursor protein containing the signal sequence has a predicted size of 19.5 kDa. As only one FLAG-immunoreactive band was detected, it is clear that FLAG–leptin is being produced and that the CD8 signal sequence is efficiently removed in the ER. We conclude that FLAG–leptin is properly cleaved and expressed in these transfected cells. We therefore sought to determine whether FLAG–leptin was released by the constitutive or the regulated secretory pathway.
If FLAG–leptin is targeted to the dense-core granule, then a secretagogue that stimulates the regulated release of ACTH from these granules should also cause the regulated release of FLAG–leptin. To investigate the secretion of FLAG–leptin, we metabolically labeled cells with 35S-translabel to near steady-state levels, and followed the secretion of FLAG–leptin during three consecutive three-hour chase intervals (Fig. 3). At steady-state, about 9.6% of cellular FLAG–leptin was released into the medium each hour (Fig. 3a,b, lane 1). Upon chase, 26% of total labeled FLAG–leptin was secreted within six hours (Fig. 3a,b, lanes 2,3; see quantitation in Fig. 3c), which probably represents secretion via the constitutive and/or constitutive-like secretory pathway [17]. To induce regulated secretion, cells were incubated with medium containing 8-Br-cAMP during the last chase period (6–9h; Fig. 3b); control cells were not treated with the secretagogue (Fig. 3a). We observed a 10-fold increase in FLAG–leptin secretion from 8-Br-cAMP-treated cells relative to the basal secretion observed from untreated cells (compare lane 4 of Fig. 3b with Fig. 3a). This secretion was paralleled by a 2.8-fold decrease in the FLAG–leptin recovered from the extracts of the stimulated cells, relative to that from untreated cells (compare lane 5 of Fig. 3b with Fig. 3a). The basal secretion of regulated secretory proteins during the stimulation period (Fig. 3a, lane 4) is a common feature of protein secretion from AtT-20 cells [18]. The observed pattern of FLAG–leptin secretion closely resembles that of ACTH
We used immunofluorescence to determine the intracellular location of the exogenously expressed FLAG–leptin construct in AtT-20 cells. Several studies have demonstrated that dense-core regulated secretory granules, the site of accumulation of endogenous adrenocorticotrophic hormone (ACTH), are found at the tip of the extended processes of AtT-20 cells [14–16]. We therefore compared the intracellular localization of ACTH and FLAG–leptin in transfected cells using antibodies specific for each protein (Fig. 2). Staining of the tip region of transfected cells was observed with both the anti-ACTH
Brief Communication
351
Figure 3 (a)
(c) Time (h) –1–0
Medium 0–3 3–6
80
Extract 6–9
9
1
2
3
4
(b)
1
– 0–3
2
– 3–6
3
5 Extract
Medium – 8-Br-cAMP Time (h) –1–0
% Total secreted
60
+ 6–9
4
+ 9
40
20
0 Time (h) 8-Br-cAMP
5
0–3 – –
3–6 6–9 – – – + Medium
9 – + Extract
Secretion profile of FLAG–leptin from transfected AtT-20 cells. (a,b) Pulse–chase secretion assay. Parallel cultures of AtT-20 cells expressing FLAG–leptin were metabolically labeled for 15 h with 0.2 mCi ml–1 translabel (Dupont-New England Nuclear) in 1% FCS/DME, and then incubated with fresh labeling media for an additional hour. The media samples from this short labeling period were collected and immunoprecipitated with anti-FLAG M2 beads (–1–0 h, lane 1). Cells were then chased for the indicated times (0–3, 3–6, and 6–9 h) in 2% FCS/DME and media were immunoprecipitated (lanes 2–4). Immunoprecipitation was carried out as described [25] with anti-FLAG M2 beads (1:1 suspension; IBI) or rabbit anti-ACTH antibody, except that the beads were washed with a urea-containing buffer (2 M urea, 2.5% Tween-20 (w/v), 0.2 M NaCl, 0.1 M Tris-HCl
pH 7.5). 8-Br-cAMP (5 mM; Sigma) was added to one sample during the 6–9 h chase period to stimulate regulated secretion ((b), lane 4) and the parallel sample received medium alone ((a), lane 4). After the last chase, the cells were lysed and immunoprecipitated (lane 5; Extract). The immunoprecipitates were subjected to SDS–PAGE and analyzed by a PhosphorImager. The results are representative of three independent experiments. (c) Quantitation of results from pulse–chase secretion assay. Quantitative data of the FLAG–leptin bands from two independent experiments were obtained using the ImageQuant software package. The counts in each band were normalized to the total counts recovered from the chase medium and cell extracts in either the unstimulated or the stimulated conditions.
secretion (data not shown) [19], and suggests that FLAG–leptin is targeted to the regulated secretory pathway in AtT-20 cells.
that the selection of the FLAG–leptin cell line had not altered the secretory characteristics of endogenous ACTH. Taken together, these results imply that leptin might contain intracellular targeting information similar to those of bona fide peptide hormones, raising the possibility that its release from adipocytes might follow a regulated pathway that is as yet not understood.
Quantitation of these data provided the sorting index (SI) for FLAG–leptin expressed in AtT-20 cells. We have previously used the SI as a measure of the degree to which a given protein is targeted to the regulated secretory pathway. The SI was determined by comparing the amount of 8-Br-cAMP-induced secretion (Fig. 3a,b; lane 4) to the level of steady-state secretion from unstimulated cells (Fig. 3a,b, lane 1; see [11]). SI values have been determined for a variety of secretory proteins in AtT-20 cells (Table 1). The SI for FLAG–leptin is 0.85, which is similar to or greater than the values for other regulated secretory proteins (Table 1). In control studies, we used the same expression vector to examine the intracellular targeting of other secretory proteins and found that neither the CD8 signal sequence nor the FLAG tag causes missorting between the constitutive and the regulated secretory pathways (M. Haugwitz, W.K. Schmidt and H.-P. H. Moore, unpublished observations). In the present experiment, the calculated sorting index for endogenous ACTH in the FLAG–leptin cell line was not significantly different from that determined in wild-type AtT-20 cells [11], indicating
Table 1 Sorting indices of secretory proteins in AtT-20 cells. Protein
SI
Reference
0.005
[15]
Constitutive:
Truncated VSV-G
Regulated:
Mouse ACTH 0.14 (n = 0.02)* [15] Human growth hormone 0.35 (n = 0.06)* [15] Human proinsulin 0.66 [16] FLAG–leptin 0.85 (n = 0.19)* This report
The sorting indices (SI) of the constitutive secretory protein truncated vesicular stomatitis virus (VSV) G protein, the regulated secretory proteins ACTH, growth hormone, proinsulin and FLAG–leptin were determined by comparing the increment in secretion induced by 8-BrcAMP during the last three-hour chase period to the value from the one-hour labeling period as described [11]. For the data from Fig. 3, the calculation of the SI is equivalent to: [(lane 4b – lane 4a)/3]/lane 1. * Range of two independent determinations.
352
Current Biology, Vol 7 No 5
We have shown that 8-Br-cAMP induces secretion of FLAG–leptin from AtT-20 cells, probably because FLAG–leptin is targeted to secretory granules containing the endogenous hormone ACTH. It should be noted that a different signaling pathway is probably involved in adipocytes. Previous studies have shown that increases in cAMP levels have opposing effects on protein production and secretion in adipocytes compared with AtT-20 cells. The simplest explanation of the differences in the secretory response is the existence of different signaling pathways in corticotrophs and adipocytes. The finding that leptin may be a bona fide regulated secretory protein is made less surprising by several studies of adipocyte biology which have suggested that there are multiple types of regulated secretory pathways in these cells. A well-characterized effect of insulin on adipocytes involves the rapid mobilization of the glucose transporter GLUT4 from an intracellular storage pool to the cell surface [20,21]: this process has been likened to synaptic vesicle recycling in neurons. In addition, secretion of other proteins by adipocytes can be enhanced by treatment with insulin. It is at present not known whether this enhancement is due to the effect of insulin on the constitutive pathway, or on a post-Golgi regulated pathway similar to those present in classical endocrine cells. In support of the latter hypothesis, it has been shown that adipocyte differentiation is correlated with the expression of members of the Rab family of small monomeric GTPases, Rab3A and Rab3D [22,23], which have been implicated in a wide variety of regulated secretory processes such as neurotransmitter and peptide hormone secretion [16,24]. These Rab proteins were found in distinct membrane fractions, suggesting that more than one type of regulated secretory organelles exist in these cells [23]. Important challenges in the near future are to determine whether adipocytes possess a bona fide biosynthetic regulated pathway, and whether the secretion of leptin is subject to physiological regulation at the exocytotic level.
5.
6.
7. 8. 9. 10. 11. 12. 13. 14.
15. 16. 17.
18. 19.
20. 21.
Acknowledgements The authors thank S.G. Miller for help with the expression plasmid pSSF and J.M. Andresen for screening plasmid clones of the chimera. We also thank B. Eaton, M. Haugwitz, J. Hacker, and members of the Moore lab for critical reading of the manuscript. This work was supported by grants from the Public Health Service (GM 35239) and American Cancer Society (CB89D). R.A.C. was supported by an National Science Foundation Minority Postdoctoral Fellowship (BIR 9308057).
References 1. Zhang Y, Proenca R, Maffei M, BaroneM, Leopold L, Friedman JM: Positional cloning of the mouse obese gene and its human homologue. Nature 1994, 372:425–432. 2. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, et al.: Weight-reducing effects of the plasma protein encoded by the obese gene. Science 1995, 269:543–546. 3. Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T, et al.: Effects of the obese gene product on body weight regulation in ob/ob mice. Science 1995, 269:540–543. 4. Lynn RB, Cao GY, Considine RV, Hyde TM, Caro JF: Autoradiographic localization of leptin binding in the choroid
22. 23.
24. 25. 26. 27.
plexus of ob/ob and db/db mice. Biochem Biophys Res Commun 1996, 219:884–889. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P: Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 1995, 269:546–549. MacDougald OA, Hwang CS, Fan H, Lane MD: Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3–L1 adipocytes. Proc Natl Acad Sci USA 1995, 92:9034–9037. Saladin R, De VP, Guerre MM, Leturque A, Girard J, Staels B, et al.: Transient increase in obese gene expression after food intake or insulin administration. Nature 1995, 377:527–529. Slieker LJ, Sloop KW, Surface PL, Kriauciunas A, LaQuier F, Manetta J, et al.: Regulation of expression of ob mRNA and protein by glucocorticoids and cAMP. J Biol Chem 1996, 271:5301–5304. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF: A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 1995, 270:26746–26749. Frost SC, Lane MD: Evidence for the involvement of vicinal sulfhydryl groups in insulin-activated hexose transport by 3T3–L1 adipocytes. J Biol Chem 1985, 260:2646–2652. Moore H-PH, Kelly RB: Secretory protein targeting in a pituitary cell line: differential transport of foreign secretory proteins to distinct secretory pathways. J Cell Biol 1985, 101:1773–1781. Powell SK, Orci L, Craik CS, Moore H-PH: Efficient targeting to storage granules of human proinsulins with altered propeptide domain. J Cell Biol 1988, 106:1843–1851. Schmidt WK, Moore HP: Synthesis and targeting of insulin-like growth factor-I to the hormone storage granules in an endocrine cell line. J Biol Chem 1994, 269:27115–27124. Tooze J, Hollinshead M, Fuller SD, Tooze SA, Huttner WB: Morphological and biochemical evidence showing neuronal properties in AtT-20 cells and their growth cones. Eur J Cell Biol. 1989, 49:259–273. Rivas RR, Moore HP: Spatial segregation of the regulated and constitutive secretory pathways. J Cell Biol 1989, 109:51– 60. Chavez RA, Miller SG, Moore H-PH: A biosynthetic regulated secretory pathway in constitutive secretory cells. J Cell Biol 1996, 133:1177–1192. Kuliawat R, Arvan P: Protein targeting via the ‘constitutive-like’ secretory pathway in isolated pancreatic islets: passive sorting in the immature granule compartment. J Cell Biol 1992, 118:521–529. Matsuuchi L, Kelly RB: Constitutive and basal secretion from the endocrine cell line, AtT-20. J Cell Biol 1991, 112:843–852. Moore HPH, Gumbiner B, Kelly RB: A subclass of proteins and sulfated macromolecules secreted by AtT-20 (mouse pituitary tumor) cells is sorted with adrenocorticotropin into dense secretory granules. J Cell Biol 1983, 97:810–817. Slot JW, Geuze HJ, Gigengack S, Lienhard GE, James DE: Immunolocalization of the insulin regulatable glucose transporter in brown adipose tissue of the rat. J. Cell Biol 1991, 113:123–135. Smith RM, Charron MJ, Shah N, Lodish HF, Jarret L: Immunoelectron microscopic demonstration of insulin-stimulated translocation of glucose transporters to the plasma membrane of isolated rat adipocytes and masking of the carboxyl-terminal epitope of intracellular GLUT4. Proc Natl Acad Sci USA 1991, 88:6893–6897. Baldini G, Hohl T, Lin HY, Lodish HF: Cloning of a Rab3 isotype predominantly expressed in adipocytes. Proc Natl Acad Sci USA 1992, 89:5049–5052. Baldini G, Scherer PE, Lodish HF: Nonneuronal expression of Rab3A: induction during adipogenesis and association with different intracellular membranes than Rab3D. Proc Natl Acad Sci USA 1995, 92:4284–4288. Fischer von Mollard G, Stahl B, Li C, SYdhof TC, Jahn R: Rab proteins in regulated exocytosis. Trends Biochem Sci 1994, 19:164–168. Chavez RA, Chen Y, Schmidt WK, Carnell L, Moore H-PH: Expression of exogenous proteins in cells with regulated secretory pathways. Methods Cell Biol 1994, 43:263–288. Graham F, van der Eb A: A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 1973, 52:456–467. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227:680–685.