Targeting of neuromodulin (GAP-43) fusion proteins to growth cones in cultured rat embryonic neurons

Neuron,

Vol. 6, 411-420, March, 1991, Copyright

0 1991 by Cell Press

Targeting of Neuromodulin Fusion Proteins to G rowth in Cultured Rat Embryonic

(GAP-43) Cones Neurons

Yuechueng Liu, Edwin R. Chapman, and Daniel R. Storm

and Fl), has been isolated and characterized (Skene and Willard, 1981; Andreasen et al., 1983; Masure et al., 1986). Neuromodulin is a neurospecific phosphoprotein that has been implicated in the regulation of free calmodulin levels in neurons (Andreasen et al., 1983; Alexander et al., 1987; Liu and Storm, 1990), neuronal growth and regeneration (Skene and Willard, 1981; Benowitz and Lewis, 1983), long-term potentiation (Akers and Routtenberg, 1987), and neurotransmitter release (Dekker et al., 1989). lmmunofluorescence staining of neuromodulin in cultured sympathetic neurons (Meiri et al., 1988) and hippocampal neurons (Goslin et al., 1988) has shown that the protein is concentrated in axons and axonal growth cones. Neuromodulin is a major component of growth cone membranes in developing rat brains (Skene et al., 1986) and of membranes prepared from adult bovine brain (Cimleret al., 1985). Electron microscopic immunolocalization of differentiated PC12 cells has shown that neuromodulin is associated with membranes in the neurites and growth cones (Van Hooff et al., 1989). The amino acid sequence obtained from bovine brain neuromodulin and cDNA-derived sequences from mouse (Cimler et al., 1987), rat (Basi et al., 1987; Rosenthal et al., 1987), fish (LaBate and Skene, 1989), chicken (Baizer et al., 1990), and human (Kosik et al., 1988; Ng et al., 1988) revealed no apparent transmembrane sequences that could anchor the protein to membranes. However, it has been shown in cultured rat cortical neurons that palmitic acid is incorporated into neuromodulin, probably at cysteines 3 and 4 (Skene and Virag, 1989); substitution of these cysteines with serines by site-directed mutagenesis abolished membrane association (Zuber et al., 1989). These data suggest that palmitylation at cysteines 3 and 4 is required for membrane association of neuromodulin, although membrane attachment may also involve additional structural components of the protein. The availability of full-length clones for neuromodulin makes it possible to define amino acid sequences of the protein that target it to growth cone membranes. For example, Zuber et al. (1989) have reported that a fusion protein composed of the N-terminal IO amino acid sequence of neuromodulin and chloramphenicol acetyltransferase (CAT) accumulated in the growth cones of PC12 cells. On the basis of their studies with PC12 cells, these investigators proposed that the sequence containing the first 10 amino acid residuesof neuromodulin may besufficienttotarget macromolecules to axonal growth cone membranes. In this study, we have investigated the growth cone targeting properties of neuromodulin by transfecting cultured embryonic rat neurons with constructs encoding neuromodulin-B-galactosidase fusion proteins. Our data demonstrate that the full-length neuromodulin-B-galactosidase fusion protein (NM&gal) accu-

Department of Pharmacology University of Washington School Seattle, Washington 98195

of Medicine

Summary Neuromodulin (GAP-43) is a membrane protein that is transported to neuronal growth cones. Zuber and coworkers have proposed that the N-terminal 10 amino acid sequence of neuromodulin is sufficient to target proteins to growth cones. We demonstrate that a neuromodulinP-galactosidase fusion protein is transported to growth cones of cultured rat neurons, whereas a fusion protein containing the N-terminal 10 amino acids of neuromodulin and B-galactosidase is not. A mutant neuromodulin lacking cysteines 3 and 4, the palmitylation sites required for membrane attachment, does not target p-galactosidase to growth cones. We conclude that membrane attach ment is required for growth cone accumulation and that structural elements, in addition to the first 10 amino acids of neuromodulin, may be required for growth cone targeting. Introduction The transport of specific proteins into the processes of neurons is essential for a number of neuronal functions including chemical transmission, electrical excitability, and synaptic plasticity. For example, synapsin I, a phosphoprotein involved in the secretion of synaptic vesicles, is concentrated in nerve terminals (DeCamilli et al., 1983), while microtubule-associated protein-2 (MAP2) is found exclusively in the dendrites of mature neurons (Caceres et al., 1986). In addition, newly synthesized proteins are delivered to the terminals of neuronal processes at different rates during the outgrowth of neurites. Five groups of proteins differing in their transport rates have been identified by studying protein transport in regenerating neurons (reviewed by Grafstein and Forman, 1980; Skene, 1989). Rapidl;r transported proteins (groups I and II) are generally transported into axons within hours of their synthesis (Willard et al., 1974; Grafstein and Forman, 1980), whereas slowly transported proteins (groups IV and V) require days to reach their destination (Black and Lasek, 1980). Very little is known about the molecular recognition mechanism(s) for differential sorting and targeting of proteins in neurons. However, it has been suggested that newly synthesized proteins undergo selective sorting and packaging in the Golgi apparatus before transport (Hammerschlag et al., 1982). Oneofthe proteinstransported by fast axonal transport, neuromodulin (also known as GAP-43, P-57, B-50,

Neuron 412

Anti-tubulin

Anti-MAP-2

Figure 1. Double MAP2 Antibodies

lmmunofluorescence

Staining

of Primary

Rat Embryo

Mesencephalic

Neuron

Cultures

with Anti-Tubulin

and AntI-

(Top) Dissociated neurons after 2 hr in culture that were stained with anti-MAP2 and anti-tubulin antibodies, (Bottom) Neurons in culture for 4 days that were stained with anti-MAP2 and anti-tubulin antibodies. Cells were fixed with 3% paraformaldehyde in PBS at room temperature for 15 min and permeabilized with -2OOC ethanol. Note that the MAP2 immunoreactivity was restricted to the cell bodies and dendrites, whereas anti-tubulin staining revealed intense staining of all processes including the axon (arrowheads). Bars, 20 urn.

mulates in growth cones. However, the N-terminal IO amino acid sequence of neuromodulin is not sufficient to target P-galactosidase to growth cones in cultured neurons.

Results Expression of the Neuromodulin-P-Galactosidase Fusion Protein in Cultured Rat Mesencephalic Neurons The transport and accumulation of examined using cultured neurons because primary neurons in culture erties with their counterparts in Cowan, 1977; Caceres and Kosik, neurons were allowed to attach plates for l-2 hr, after which time

neuromodulin was as a model system share many propvivo (Banker and 1990). Dissociated to tissue culture the medium was

removed and transfections were carried out. Plasmids were introduced into primary cultures of rat embryo mesencephalic neurons using the lipofection method of Felgner et al. (1987). As shown in Figure 1, most of the cells were round with short processes at the time of transfection. By day4 in culture, the neurons elaborated an extensive network of processes that could be distinguished as dendrites or axons by their MAP2 content. As reported for cultured hippocampal neurons (Caceres et al., 1986), MAP2 immunoreactivity was concentrated in the cell bodies and shorter processes (presumably dendrites), whereas anti-tubulin staining revealed both dendritic and axonal processes (Figure 1). Transfections of cultured neurons were optimal when a mixture of 25 PLg of plasmid DNA and 70 ug of Lipofectin was incubated with the cells for 5 hr. The

Axonal Targeting

of Neuromodulin

413

Table 1. Localization Proteins in Neurons

Plasmida P-Gal NM&-gal NM&gal NM&-gal

I.

0

20

I.

40

I.

60

I.

80

I.

loo

I.

I.,

120

140

.

160

I.

180

zoo

Hours After Transfection Figure 2. Expression of the NM&gal Fusion Protein in Cultured Rat Embryonic Neurons Using the Lipofection Method Lipfection was carried out using 70 pg of Lipofectin and 25 Kg of plasmid DNA encoding NM&-gal as described in Experimental Procedures. At each time point, the cells were harvested and lysed by homogenization in 10 m M Tris-HCI (pH 7.51, 2 m M EDTA. P-Galactosidase activity was assayed using O-nitrophenyl&galactopyranoside as a substrate as described in Experimental Procedures.

expression of fi-galactosidasefusion proteins in transfected neurons was monitored by measuring P-galactosidaseactivityand byimmunofluorescencestaining of the cells using antibodies directed against B-galactosidase. By plating the cells at a relatively high density, a transfection efficiency of approximately O.Ol%-0.05% was achieved, which provided a sufficient number of transfected cells for these studies. The transfected cells were identified as neurons by immunofluorescence staining with anti-MAP2 and anti-tubulin antibodies. The time course for expression of NM&gal was also examined (Figure 2). Expression of the fusion protein was detected 38 hr after transfection, reaching the highest level of expression 96 hr posttransfection. Expression levels returned to background after 7days.

Neurite Targeting of Neuromodulin-fl-Calactosidase Fusion Proteins The localization of P-galactosidaseand the neuromodulin-p-galactosidase fusion protein expressed in neurons in culture was monitored by immunofluorescence staining using antibodies against p-galactosidase. As a negative control, neurons were transfected with a construct encoding b-galactosidase. P-Galactosidase expressed in neurons was localized primarily in the cell bodies, with some weak diffusion into the processes (Figure 3A). As expected, there was no accumulation of the enzyme in the neurites or the growth cones. These data are consistent with the observation that p-galactosidase is a cytosolic protein when expressed in COS cells (Picard and Yamamoto, 1987). Transfections with a construct encoding NM&-gal led to the expression of the fusion protein in neurons with a distribution quite distinct from that seen with

of Expressed

Axonal Stainingb 2

90

Fusion

Growth Cone Staining<

Number of Neurons Examined

0

50

0 10

38 49

65

a5

a P-gal, P-galactosidase; NM&gal, the fusion protein containing the full-length neuromodulin and P-galactosidase; Nh&-P-gal, the fusion protein containing the N-terminal 10 amino acid se quence of neuromodulin and P-galactosidase; NM&gal, same as NM,-P-gal but with cysteines 3 and 4 mutagenized to glycines. h The percentage of transfected neurons showing immunofluorescence staining in axons. Neurons with processes having neuromodulin concentrated in the distal regions and with punctate staining patterns along processes were scored as positive. c The percentage of transfected neurons showing immunofluorescence staining in growth cones. Growth cones staining with an intensity equal to or greater than that seen in the cell body were scored as positive.

P-galactosidase alone (Figure 3B). Neurons expressing NM&gal showed intense fluorescence staining in the distal regions of the neurites including the growth cones. In 90% of the transfected neurons expressing NM&-gal, the fusion protein was targeted to axons, and in 65% of these cells, NM&-gal accumulated in growth cones (Table 1). The punctate staining pattern for NM+gal along the neurites is similar to that reported for the distribution of endogenous neuromodulin in neurons (Meiri et al., 1988; Goslin et al., 1988). These data indicate that the full-length neuromodulin polypeptide is able to target P-galactosidase to axonal membranes and growth cones. Presumably, specific stuctural elements of neuromodulin are required for theaccumulationof neuromoduIin,ortheneuromodulin fusion protein, in growth cones. It has been reported that neuromodulin is specifically accumulated in the axons, but not in the dendrites, of cultured rat hippocampal neurons (Goslin et al., 1988). However, no axon-specific transport of NM&-gal was observed in our experiments. This could be due to the different subpopulations of cultured neurons, orto the overexpression of NM&gal leading to the nonspecific delivery of the fusion protein into the dendritic processes. Zuber et al. (1989) have reported that the N-terminal 10 amino acid sequence of neuromodulin is sufficient to target CAT to the growth cone membranes of PC12 cells. This sequence contains 2 cysteines at positions 3 and 4, which are essential for membrane association of neuromodulin (Skene and Virig, 1989; Zuber et al., 1989). The outgrowth rate of neurites in PC12 cells is slower than that of primary neurons in cultures (Greene and Tischler, 1982), and the processes are shorter compared with those of neurons. Consequently, PC12 cells may not be an appropriate model system for studying the axonal transport of neuromodulin. Therefore, we examined the transport and accumulation of a fusion

Neuron 414

Figure 3. lmmunofluorescence

Staining

of Cultured

Neurons

Expressing

l%Galactosidase,

NM&-gal,

and NM&gal

Lipofection was carried out using 70 Bg of Lipofectin and 25 pg of plasmid DNA encoding P-galactosidase or the fusior 1 proteins as described in Experimental Procedures. Four days after transfection, the cells were immunostained with antibody against p-g ,alactosidz tse as described in Experimental Procedures. (A) Neurons expressing !3-galactosidase; (6) neurons expressing NM,-P-gal; (C) Neurc Ins expressing NM,&gal. Multiple varicosities (mv); growth cones (gc). Bars, 25 pm.

protein composed of the first 10 amino acids of neuromodulin and j3-galactosidase (NM&-gal) in cultured neurons. The distribution of NM&-gal expressed in neurons was similar to that seen with P-galactosidase

alone (Figure 3C). Fluorescence was very ’ intense ! in the cell bodies and shorter processes, but no NM1 o-B gal accumulation was observed in the grc ,wth COIies or the distal regions of the neurites (Table 1). We c’on-

Axonal Targeting 415

of Neuromodulin

Figure 4. lmmunofluorescence

Staining

of Neurons

Expressing

NM$.%gal

39 hr after Transfection

Transfections of primary neurons in culture w&e carried out using 70 ug of Lipofectin and 25 wg of plasmid DNA encoding NM&-gal as described in Experimental Procedures. Thirty-nine hours after transfection, the cells were fixed and immunostained as described in Experimental Procedures. lmmunofluorescence staining of the growth cones is indicated by the arrows. The insert shows a magnified growth cone from the same neuron. Bars, 25 pm.

elude that the N-terminal 10 amino acid sequence of neuromodulin is insufficient to direct the accumulation of b-galactosidase in neuronal growth cones and that there may be additional structural elements of the protein required for this function. The accumulation of NM&gal in the growth cones of the elongating neurites was prominent even at early stages of the expression. Thirty-nine hours after transfection, and approximately 3-5 hr after the expression of the fusion protein could be detected, high NM& gal immunoreactivity was found in neuronal growth cones (Figure 4). These data indicate that NM&-gal

accumulated in growth cones during the early stages of neurite outgrowth when processes were being rapidly extended. The selective concentration of neuromodulin in the growth cones of rapidly elongating axons has also been reported for cultured rat hippocampal neurons (Goslin et al., 1990). Membrane-Binding Properties of NM&-gal and NMl&gal Because membrane association may be required for growth cone accumulation of neuromodulin, the failure of NM,&-gal to be targeted into neurites may

Neuron 416

&gal

w

c

MC

MC

-a-gal Nh4c-S-gal Nh4f-B-gal

M

B)

c

M

C MCM

--.

1 l 13-gal

Figure 5. Transient Expression and NM,&gal in COS-7 Cells

of B-Galactosidase,

NM&gal,

COS-7 cells were transfected by the calcium phosphate method as described in the Experimental Procedures. After 48 hr, the cells were collected and homogenized. Membrane (M) and cytosolic (C) fractions were prepared as described in Experimental Procedures. Protein samples were assayed for B-galactosidase activity, and 6 ug of protein from each sample was loaded onto SDS-PAGE gels and subjected to Western blot analysis as described in Experimental Procedures. (A) B-Calactosidase activity assay; (B) Western blot using anti-B-galactosidase antibodies. Lane 1, NM,,-B-gal; lane 2, NM&gal; lane 3, B-galactosidase (P-gal).

have been due to diminished membrane binding, compared with that of NM&gal. Therefore, the membrane association of the two fusion proteins was studied by transient expression of the proteins in COS-7 cells. The distribution of the fusion proteins in the cytosolic and total membrane fractions from transfectedCOS-7cellswasdetermined bymeasuringp-galactosidase activity, or by Western blot analysis using anti-e-galactosidase antibodies (Figure 5). b-Galactosidase alone was found in the cytosol, whereas NM& gal was located predominantly in the membrane fraction (Figure 5A). In contrast, greater than 50% of NM&-gal was in the cytosolic fraction (Figure 5A). Western blot analysis of the same samples confirmed these observations, with NM&gal appearing as a 175 kd polypeptide on the Western blot and f3-galactosidase and NM&-gal as 120 kd polypeptides (Figure

O-gal

NMC-B-gal

Figure6. Western Blot Analysis Fractions Prepared from COS-7 dase, NM&gal, and NM&gal

NMf-B-gal

of Membrane and Cytosolic Cells Expressing B-Galactosi-

COS-7cells were transfected with plasmids encoding B-galactosidase, NM&gal, or NM&gal as described in Experimental Procedures. Membrane (M) and cytosolic (C) fractions were prepared and subjected to Western blot analysis as described in Experimental Procedures, using rabbit anti-neuromodulin antibodies. (A) Coomassie blue staining of the SDS gel;(B) Western blot of the same samples. Each sample contained 25 ug of protein for Coomassie blue staining and 19 ug of protein for Western blot analysis.

56). These data indicate that the full-length neuromodulin polypeptide targeted the fusion protein to membranes more effectively than the N-terminal 10 amino acid sequence of the molecule, even though both contained the palmitylation sites. Either there are additional structural elements in neuromodulin that contribute to membrane binding, or b-galactosidase sterically hinders interactions between the membrane and the IO amino acid peptide. Membrane localization To address

Association Is Essential for Growth Cone of Neuromodulin Fusion Proteins the role of membrane binding in the accu-

Axonal Targeting

of Neuromodulin

417

Figure 7. lmmunofluorescence

Staining

of Neurons

Expressing

NM&gal

Transfections of primary neurons in culture were carried out using 70 ug of Lipofectin and 25 ug of plasmid DNA encoding NM&gal, the neuromodulin-B-galactosidase fusion protein in which cysteines 3 and 4 of neuromodulin were replaced with glycines. Note the intense immunoreactivity of the multiple varicosities (mv). The arrowheads illustrate the processes that were faintly stained. Bars, 25 urn.

mulation of neuromodulin in growth cones, we prepared a construct that encoded a neuromodulin-b-galactosidase fusion protein in which cysteines 3 and 4 of neuromodulin were replaced by glycines (NM& gal) using site-directed mutagenesis. Replacement of the cysteines with glycines in NM&gal abolished the membrane association of neuromodulin+galactosidase transiently expressed in COS-7 cells (Figure 6). When expressed in cultured neurons, NM&gal failed to localize consistently along neurite membranes or in neuronal growth cones, presumably because of its inability to bind to neurite or growth cone membranes (Figure 7). Interestingly, NM&gal was detected in the varicosities of the distal regions of the neurites of transfected neurons, suggesting that the protein may be packaged into the transporting varicosities but not deposited at membrane sites. Discussion One of the objectives of this study was to determine whether transport of neuromodulin into neuronal growth cones can be studied by the expression of neuromodulin+galactosidase fusion proteins in cultured neurons. We have demonstrated that the Iipofection techniquecan beusedfortheexpressionof neuromodulin-b-galactosidase fusion proteins in primary neuron cultures and that the intracellular distribution of the fusion proteins can be examined by immunofluorescence staining. Because neurite membrane and growth cone accumulation of the fusion proteins was assayed by visual examination of immunostained transfected neurons, it was crucial to examine a statistically significant number of cells transfected with each construct. Although the transfection efficiency was relatively low, cultured neurons expressing fu-

sion proteins were readily detected, and a sufficient numberof transfected neuronswereobtained ineach case (Table 1). The data indicate that NM&-gal was rapidly transported into neuronal growth cones. We hypothesize that specific structural domains of neuromodulin are required for transport and association of neuromodulin with growth cone membranes. The system described in this paper may be appropriate for identifying these crucial structural elements. The mechanism(s) for the sorting and transport of proteins into neuronal processes is not fully understood. However, it has been proposed that rapidly transported proteins contain a “recognition sequence” that targets them to specific regions of the Golgi, where they are packaged into membrane vesicles for transport (Stone and Hammerschlag, 1987). Recently, Fishman and colleagues reported that the 10 amino acid N-terminal sequence of neuromodulin was able to direct the accumulation of CAT into the growth cones of PC12 cells. It was suggested that this sequence may be sufficient to target neuromodulin or other macromolecules to neuronal growth cones (Zuber et al., 1989). This observation is very important, since it was the first report in the literature describing an axonal targeting amino acid sequence. Furthermore, one might be able to use this simple amino acid sequence as a tool to deliver a variety of proteins to neuronal growth cones. In our study, the 10 amino acid sequence from the N-terminus of neuromodulin was not able to target &galactosidase to the growth cones of cultured neurons, even though the full-length neuromodulin polypeptide did. The N-terminal amino acid sequence is important for axonal targeting, because it contains the sites for membrane attachment. However, it may not be sufficient for axonal targeting. We conclude that there may be additional regions

Neuron 418

outside the N-terminal domain of neuromodulin that are important for growth cone accumulation. Because neuromodulin is a membrane-associated protein and is transported by fast axonal transport (Skeneand Willard, 1981; Perryet al., 1990), membrane association may be obligatory for axonal transport. Indeed, a fusion protein lacking the membrane attachment sites, NM&gal, did not accumulate in axonal membranes or growth cones. The failure of NMIoo-gal to accumulate in growth cones may be due, at least in part, to its less efficient membrane attachment, compared with that of NM&-gal. However, membrane attachment in itself.is not sufficient for axonal transport, since approximately50% of NM&gal was associated with membranes when the fusion protein was expressed in COS-7 cells. Even though most of the neurons that expressed NM&gal showed noaccumulation of this fusion protein in neurite or growth cone membranes, NM&-gal was associated with varicosities that may be involved in the delivery of newly synthesized neuromodulin. This observation suggests that NM&-gal may have been packaged for transport, even though it lacks the palmitylation sites for membrane attachment. The truncated fusion protein, NM&gal, did not accumulate in analogous structures, presumably because the recognition sequence for packaging was lacking or incomplete. Consequently, we propose that growth cone accumulation of neuromodulin requires at least two structural components: a membrane attachment domain and a recognition sequence for packaging. In summary, transfection of primary neurons in culture with constructs encoding neuromodulin+galactosidase fusion proteins provides a useful system for identifying structural elements important for axonal transport. Membrane attachment is a necessary but not sufficient condition for growth cone membraneaccumulation, and the N-terminal IOamino acid sequence of neuromodulin may not contain enough information to target neuromodulin or fusion protein to growth cones. Experimental

Procedures

Plasmid Construction A full-length P-galactosidase gene from pCHll0 (Pharmacia) was subcloned into the expression vector pCDM8 (a gift from Dr. Brian Seed, Massachusetts General Hospital). A fusion gene encoding NM+gal was constructed by in-frame ligation of the BamHI-Pstl fragment of theb-galactosidasegene from pMC1780 (Casadaban et al., 1983) to the 3’end of the full-length neuromodulin cDNA coding sequence (Cimler et al., 1987). Site-directed mutagenesis of cysteines 3 and 4 to glycines 3 and 4 was done by the general method of Kunkel et al. (1987). The fusion gene encoding NM&-gal was prepared by adding a synthetic oligonucleotide (5’~AAGC~ATGCTCTCCTCTATCAGAAGAACCAA ACAG-3’) encoding the first IO amino acid residues of neuromodulinattheHindlll andl3amHl sitesofthe5’endofthe!J-galactosidase gene of pCDM8-NM&gal. All constructs were confirmed by DNA sequencing. Cell Cultures and Transfections Mesencephalic neurons from 17-day-old rat embryos weredissociated in 20 m M HEPES, (pH 7.5), 150 m M NaCl (HBS) by tritura-

tion through a fire-polished glass pipette. Cells were plated onto 10 cm dishes coated with 50 pg/ml poly-L-lysine (Sigma) and cultured in chemicallydefined Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5 pglml insulin, 100 @ml transferrin, 20 nM progesterone, 100 PM putrescine, 1 m M sodium pyruvate, 30 nM sodium selenite, and 0.1% ovalbumin (Bottenstein and Sato, 1979). The cells were maintained in a humidified 37OC incubator with 5% CO*, COS-7 cells were grown in DMEM supplemented with 10% fetal calf serum. Transfections of COS-7 cells with various plasmids were accomplished using the calcium phosphate method (Chen and Okayama, 1987). Cells were plated at 35%-400/o confluency the day before transfection. Twenty micrograms of DNA was used for each transfection, and the cells were incubated in a 35OC incubator with 3.5% CO, overnight. For the transfection of neuronal cultures, dissociated neurons were plated at 1.3 x 106 to 2 x 106 cells per 10 cm dish. After 2 hr in culture, lipofection was performed using 70 pg of Lipofectin (Bethesda Research Laboratories, Inc.) and 25 pg of DNA in 4 ml of HBS. After incubation for 5 hr at 37”C, culture medium was added, and the incubation was continued for another 12 hr before replacement with fresh medium. The transfected COS-7 cells and neurons were assayed for P-galactosidase activity or stained with anti-b-galactosidase antibodies. lmmunofluorescence Staining and Western Blot Analysis Cells were fixed with 3% paraformaldehyde in 25 m M NaZHPOJ, 25 m M KH2P04 (pH 7.4), 100 m M NaCI, 1 m M MgCI,, 0.01% NaNi (PBS) at room temperature for 15 min and permeabillzed with -2O”Cethanol for5 min. Nonspecific binding siteswere blocked with 4% bovine serum albumin and 10% fetal calf serum in PBS for 30 min at room temperature. The cells were incubated overnight at 4OC with primary antibodies at the following dilutions: rabbit anti-tubulin (Sigma), 1:lOO; monoclonal anti-MAP2 (Sigma), 1:500; rabbit anti-@galactosidase (Cappel), 1:lOOO. After washing the cells with PBS, rhodamine-conjugated goat anti-rabbit IgC (Boehringer Mannheim, 1:1500) was added and incubated for 1 hr at room temperature. The fluorescence signal was further amplified by incubation with a rhodamine-conjugated rabbit anti-goat IgG (Pierce, 1:1500) for 30 min at room temperature. In the case of double immunofluorescence staining, FITC-conjugated horse anti-mouse IgC (Sigma, 1:1500) and FITC-conjugated rabbit anti-horse IgC (Sigma, 1:1500) were used. The cells were washed extensively with PBS before being examined. Photography was done using a Leitz Dialux 20 fluorescence microscope equipped with a Leitz Vario Orthomat camera system. To determine the subcellular localization of P-galactosidase or fi-galactosidase fusion proteins, COS-7 cells were scraped off of the plates and collected by sedimentation at 3000 x g for 5 min. The cell pellet was resuspended in ice-cold Tris-HCI (pH 7.5), 2 m M EDTA and homogenized in the same buffer on ice. Nuclei and unbroken cells were separated by centrifugation at 4000 x g for 2 min. Cytosol and membranes were prepared by centrifugation at 150,000 x g for40 min in an Airfuge. p-Galactosidase activity was assayed using O-nitrophenyl-&c-galactopyranoside as a substrate according to Pardee et al. (1959). One unit of B-galactosidase activity = 1000 x [&ZOnm- (1.75 x ArTO,&Tmln. The assay was performed at 35OC for 30 min with preparations from COS-7 cells and for 60 min with neuronal preparatins. Western blot analysis was carried out using anti-neuromodulin or anti-bgalactosidase antibodies as primary antibody, with an alkaline phosphatase-conjugated goat anti-rabbit secondary antibody. Acknowledgment We thank Dr. Brian Seed for providing pCDM8 plasmid and Fan Wang for assistance in DNA sequencing. This work was supported by National Institutes of Health grant GM 33708. Y. L is a recipient of a postdoctoral fellowship from the American Heart Association, Washington Affiliate. E. R. C. was supported by National Institutes of Health Predoctoral Training Grant GM-07270. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be

Axonal Targeting 119

of Neuromodulin

hereby marked “advertisemenf”in accordance tion 1734 solely to indicate this fact. Received

November

15, 1990; revised

December

with 18 USC Sec-

Goslin, K., Schreyer, D. J.,Skene, J. H. P., and Banker,G.A.(1988). Development of neuronal polarity: GAP-43 distinguishes axonal from dendritic growth cones. Nature 336, 672-674.

27,199O

References Akers, R. F., and Routtenberg, location of protein kinase C the phosphorylation of an involved in synaptic activity.

(1987). Lipofection: a highly efficient, Jipid-mediated DNAtransfection procedure. Proc. Natl. Acad. Sci. USA84,7413-7417.

A. (1987). Calcium-promoted transto synaptic membranes: relation to endogenous substrate (protein Fl) J. Neurosci. 7, 3976-3983.

Goslin, K., Schreyer, D.J., Skene,J. H. P., and Banker, G. A. (1990). Changes in the distribution of GAP-43 during the development of neuronal polarity. J. Neurosci. 70, 588-602. Grafstein, neurons.

B., and Forman, D. S. (1980). Intra-cellular Physiol. Rev. 60, 1167-1283.

transport

in

A. S. (1982). PC12 pheochromocytoma research. Adv. Cell. Neurobiol.

3,

Alexander, K. A., Cimler, B. M., Meier, K. E., and Storm, D. R. (1987). Regulation of calmodulin binding to P-57. J. Biol. Chem. 262, 6108-6113.

Greene, L.A.,andTischler, cultures in neurobiological 373-415.

Alexander, K. A., Wakim, B. T., Doyle, C. S., Walsh, K. A., and Storm, D. R. (1988). Identification and characterization of the calmodulin binding domain of neuromodulin, a neurospecific calmodulin binding protein. J. Biol. Chem. 263, 7544-7549.

Hammerschlag, R., Stone, G. C., Bolen, F. A., Lindsey, J. D., and Ellisman, M. H. (1982). Evidence that all newly synthesized proteins destined for fast axonal transport pass through the Golgi apparatus. J. Cell Biol. 93, 568-575.

Andreasen, T. J., Luetje, C. W., Heiderman, W., and Storm, D. R. (1983). Purification of a novel calmodulin binding protein from bovine cerebral cortex membranes. Biochemistry22,4615-4618.

Koenig, E., Kinsman, S., Repasky, E., and Sultz, L. (1985). Rapid mobility of motile varicosities and inclusions containing a-spectrin, actin, and calmodulin in regenerating axons in vitro. J. Neurosci. 5, 715-729.

Baizer, L., Alkan, growth-associated lated expression Res. 7, 61-68.

S., Stocker, K., and Ciment, C. (1990). Chicken protein (GAP)43: primary structure and reguof mRNA during embryogenesis. Mol. Brain

Banker, G. A., and Cowan, W. M. (1977). Rat hippocampal rons in dispersed cell culture. Brain Res. 726, 397-425.

neu-

Basi, G. S., Jacobson, R. D., Virag, I., Schilling, J., and Skene, J. H. P. (1987). Primary structureand transcriptional regulation of CAP-43, a protein associated with nerve growth. Cell 49,785-791. Benowitz, L. I., and Lewis, E. R. (1983). Increased transport of 44,000 to 49,000-dalton acidic proteins during regeneration of the goldfish optic nerve: a two-dimensional gel analysis. J. Neurosci. 3, 2153-2163. Black, M. M., and Lasek, R. 1. (1980). Slow components of axonal transport: two cytoskeletal networks. J. Cell Biol. 86, 616-623. Bottenstein, J. E., and Sato, G. H. (1979). Growth blastoma cell line in serum-free supplemented Natl. Acad. Sci. USA 70, 514-519.

of a rat neuromedium. Proc.

Caceres, A., and Kosik, K. S. (1990). Inhibition of neurite polarity by tau antisense oligonucleotides in primary cerebellar neurones. Nature 343, 461-463. Caceres, A., Banker, C. A., and Binder, L. (1986). Immunocytochemical localization of tubulin and microtubule-associated protein 2 during the development of hippocampal neurons in culture. J. Neurosci. 6, 714-722. Casadaban, M. J., Martinez-Arias, A., Shapira, S. K., and Chou, J. (1983). B-Calactosidase gene fusion for analyzing gene expression in Escherichia co/i and yeast. Meth. Enzymol. 700,293-308. Chen, C., and Okayama, H. (1987). High-efficiency transfection of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7, 27452752. Cimler, B. M., Andreasen, T. J., Andreasen, K. I., and Storm, D. R. (1985). P-57 is a neural specific calmodulin-binding protein. 1. Biol. Chem. 260, 10784-10788. Cimler, B. M., Giebelhaus, D. H., Wakim, B. T., Storm, D. R., and Moon, R. T. (1987). Characterization of murine cDNAs encoding P-57, a neurospecific calmodulin-binding protein. J. Biol. Chem. 262, 12158-12163. DeCamilli, P., Cameron, R., and Creengard, P. (1983). Synapsin I (protein I), a nerve terminal-specific phosphoprotein. 1. Its general drstribution in synapses of the central and peripheral nervous system in frozen and plastic sections. J. Cell Biol. 96,13371354. Dekker, L. V., DeGraan, P. N. E., Oestreicher, A. B., Versteeg, D. H. G., and Gispen, W. H. (1989). Inhibition of noradrenaline release by antibodies to B-50 (GAP-43). Nature 342, 74-76. Felgner, P. L., Gadek, Wenz. M., Northrop,

T. R., Holm, M., Roman, R., Chan, H. W., J. P., Ringold, G. M., and Danielsen, M.

Kosik, K. S., Orecchio, L. D., Bruns, C. A. P., MacDonald, G. P., Cox, D. R., and Neve, R. L. (1988). Human GAP-43: its deduced amino acid sequence and chromosomal Jocalizatron in mouse and human. Neuron 7, 127-132. Kunkel, P. A., Roberts, J. D., and Zakoca, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Meth. Enzymol. 754, 367-382. LaBate, M. E., and Skene, J. H. P. (1989). Selective conservation of GAP-43 structure in vertebrate evolution. Neuron 3,299-310. Liu, Y., and Storm, D. R. (1990). Regulation levels by neuromodulin: neuron growth Trends Pharmacol. Sci. 77, 107-111.

of free calmodulin and regeneration.

Masure, H. R., Alexander, K. A., Wakim, B. T., and Storm, D. R. (1986). Physicochemical and hydrodynamic characterization of P-57, a neurospecific calmodulin binding protein. Biochemistry 25, 7553-7560. Meiri, K. F., Johnson, M. I., and Willard, M. (1988). Distribution and phosphorylation of the growth associated protein GAP-43 in regenerating sympathetic neurons in culture. J. Neurosci. 8, 2571-2581. Ng, S.-C., de la Monte, S. M., Conboy, C. L., Karns, L. R., and Fishman, M. C. (1988). Cloning of human CAP-43: growth association and ischemic resurgence. Neuron ?, 133-139. Pardee, A. B., Jacob, F., and Monod, J. (1959). The genetic control and cytoplasmic expression of “inducibility” in the synthesis of B-galactosidase by E. co/i. J. Mol. Biol. 7 165-178. Perry, G. W., Burmeister, D. W., and Crafstein, B. (1990). Effect of target removal on goldfish optic nerve regeneration: analysis of fast axonally transported proteins. J. Neurosci. 70, 3439-3448. Picard, D., and Yamamoto, K. (1987). Two signals mediate hormone-dependent nuclear localization of the glucocorticoid receptor. EMBO J. 6, 3333-3340. Rosenthal, A., Chan, S. Chen, J. N., Wilcox, A., berg, A. (1987). Primary tein Fl, a growth-related with synaptic plasticity.

Y., Henzel, W., Haskell, C., Kuang, W.-J., Ullrich, D. V., Coeddel, E., and Routtenstructure and mRNA localization of proprotein kinase C substrate associated EMBO J. 6, :3641-3646.

Seed, B. (1987). An LFA-3 cDNA membrane protein homologous 840. Skene, J. H. P. (1989). Axonal Rev. Neurosci. 72, 127-156.

encodes a phospholipid-linked to its receptor CD2. Nature329,

growth-associated

proteins.

Skene, J. H. P., and Virag, I. (1989). Post-translational attachment and dynamic fattyacylation of neuronal protein, GAP-43. J. Cell Biol. 708, 613-625. Skene, J. H. P., and Willard,

Annu.

membrane growth cone

M. (1981). Axonallytransported

pro-

teins associated with axon growth in rabbit central eral nervous systems. J. Cell Biol. 89, 96-103. Skene, J. H. P., Jacobson, Norden, J. J., and Freeman, nerve growth (GAP-43) is membranes. Science 233,

and periph-

R. D., Snipes, C. J., McCuire, C. B., J. A. (1986). A protein induced during a major component of growth-cone 783-786.

Stone, G. C., and Hammerschlag, R. (1987). Molecular mechanisms involved in sorting of fast-transported proteins. In Axonal Transport, R. S. Smith, and M. A. Bisby, eds. (New York, NY: Alan R. Liss), pp. 15-36. Van Hooff, C. 0. M., Holthuis, J., Oestreicher, A. B., Boonstra, J., De Craan, P. N. E., and Gispen, W. H. (1989). Nerve growth factor-induced changes in the intracellular localization of the protein kinase C substrate B-50 in pheochromocytoma PC12 cells. J. Cell Biol. 708, 1115-1125. Wakim, B. T., Alexander, K. A., Masure, H. B., Cimler, B. M., Storm, D. R., and Walsh, K. A. (1987). Amino acid sequence of P-57, a neurospecific calmodulin binding protein. Biochemistry 26, 7466-7470. Willard, M., Cowan, W. M., and Vagelos, P. R. (1974). The polypeptide composition of intra-axonally transported proteins: evidence for four transport velocities. Proc. Natl. Acad. Sci. USA 71, 2103-2187. Zuber, M. X., Strittmatter, S. M., and Fishman, M. C. (1989). A membrane-targeting signal in the amino terminus of the neuronal protein GAP-43. Nature 347, 345-348.