Targeting oncogenic fusion genes in leukemias and lymphomas by RNA interference

Seminars in Cancer Biology 13 (2003) 283–292

Targeting oncogenic fusion genes in leukemias and lymphomas by RNA interference Christine Damm-Welk, Uta Fuchs, Wilhelm Wössmann, Arndt Borkhardt∗ Pediatric Hematology & Oncology, Children’s University Hospital Giessen, Feulgenstr. 12, 35392 Giessen, Germany Accepted 28 April 2003

Abstract Leukemias and lymphomas are often characterized by non-random chromosomal translocations that, at the molecular level, induce the activation of specific oncogenes or create novel chimeric genes. They have frequently been regarded as optimal targets for gene-silencing approaches because of the large body of evidence that these single abnormalities directly initiate and maintain the malignant process. Herein, we discuss RNA interference (RNAi)-based approaches for targeting the fusion sites of chromosomal translocations as a future treatment option in leukemias and lymphomas. © 2003 Elsevier Ltd. All rights reserved. Keywords: Antisense oligonucleotides; Fusion genes in leukemia and lymphoma; Gene silencing

1. Introduction Early observations that specific recurring chromosomal translocations were associated with a particular type of leukemia and lymphoma suggested that these chromosomal rearrangements were directly involved in the cellular transformation of the hematopoietic system. During the last two decades the combined effort of many laboratories worldwide has led to the molecular clarification of numerous chromosomal translocations by cloning the genes involved [1–4]. With respect to classification, we nowadays distinguish two different types of chromosomal translocations, named type 1 or type 2, respectively. Type 1 translocation creates a new fusion gene that expresses the N-terminus of one protein fused to the C-terminus of another protein. Consequently, the primary coding sequence of the fusion site is present only in tumor cells, but not in normal cells (Fig. 1). In contrast, type 2 translocations deregulate an otherwise intact oncogene by disruption or removal and replacement of the adjacent controlling elements, e.g. the gene promoter(s). Remarkably, the primary coding sequence of the deregulated oncogene in the tumor cells does not differ from that in the normal hematopoietic cells. Its inappropriate expression/regulation is the molec∗ Corresponding author. Tel.: +49-641-9943462; fax: +49-641-9943429. E-mail address: [email protected] (A. Borkhardt).

1044-579X/$ – see front matter © 2003 Elsevier Ltd. All rights reserved. doi:10.1016/S1044-579X(03)00042-7

ular hallmark of this type of chromosomal translocation. Despite the enormous therapeutic potential, gene-silencing approaches, e.g. by antisense therapy, are far from being fully implemented into the clinical setting, and many clinical trials have revealed a rather disappointing effectiveness. Some of these difficulties stem from the inability to achieve sufficient power and sequence specificity of the gene-silencing strategy. The recent exciting discovery that gene silencing by RNA interference (RNAi) is not restricted to C. elegans or Drosophila, but also possible in human cells, paves the way for the development of novel RNA therapeutics. 2. Antisense oligonucleotides as a therapeutic approach Antisense oligonucleotides have been found to suppress the cognate mRNA function through inhibition of splicing, inhibition of appropriate translation or through recognition and degradation of mRNA antisense oligonucleotide hybrids by RNase H [5,6]. With respect to leukemia the translocation t(9;22) was a main target in antisense oligonucleotide research. This translocation results in the expression of the chimeric BCR/ABL protein. The ABL protein encodes for a tightly regulated tyrosine kinase, but its kinase activity is greatly increased by fusion to the partial BCR protein. BCR/ABL transformed hematopoietic progenitor cells give rise to a leukemic

284

C. Damm-Welk et al. / Seminars in Cancer Biology 13 (2003) 283–292

Fig. 1. Schematic representation of chromosomal translocations of type 1 and type 2. Type 1: the new chimeric gene, e.g. BCR/ABL in the case of translocation t(9;22), has a tumor-specific sequence at its fusion site. This enables the design of either tumor-specific siRNAs or antisense molecules. Whether these fusion sequences are suitable for the development of antisense or siRNA molecules must be tested for each particular fusion site. Type 2: overexpression of an oncogene by its association with immunoglobulin and T cell receptor enhancer elements. The classical example is the c-MYC oncogene juxtaposed to immunoglobulin heavy chain gene in the case of translocation t(8;14) found in Burkitt’s lymphoma. A variety of different siRNAs or antisense molecules (black lines) can be placed along the entire c-MYC cDNA sequence or even in its 3 UTR. However, due to lack of sequence differences between tumor and normal cells, these molecules will affect the c-MYC activity in all cells simultaneously.

phenotype [7–10]. Several reports [11–16] describe the use of antisense olignucleotides that targeted the M-BCR/ABL junction. Application of the BCR/ABL antisense oligonucleotides to primary leukemic blast cells in vitro resulted in the inhibition of cell colony formation [11]. An antisense oligonucleotide with mismatches exhibited no effect on cell formation. These results were confirmed by additional reports by the same authors and others [12–16]. O’Brien et al. demonstrated that BCR/ABL antisense oligonucleotides specifically suppress cell proliferation in three CML cell lines. But this effect seemed to be independent of the different breakpoints of the cell lines, suggesting that the inhibition is not sequence-specific [17]. Besides these problems, the antisense oligonucleotides were injected into SCID mice transplanted with BCR/ABL-positive CML cells. The BCR/ABL transcript levels were decreased, the proliferation of CML cells inhibited and the survival rate of the mice was significantly improved [18,19]. A modified strategy with enhanced specificity to remove BCR/ABL mRNA, or suppress its protein biosynthesis, was recently developed by Stocks and Rabbitts [20]. In their so-called masked antisense oligonucleotides against the BCR/ABL mRNA, the BCR portion of the molecule is masked by a stem loop structure, which results in a discrimination between the BCR/ABL and the single gene mRNAs. Moreover, the chimeric BCR/ABL hybrid gene was also targeted by ribozymes, small RNA molecules which process endoribonuclease catalytic activity. The ribozymes recognize their targets by hybridization and exhibit sequence-specific cleavage of the attacked sequence. In vitro assays demonstrated the successful cleavage of the chimeric BCR/ABL transcript by ribozymes [21–29]. Expression of such ribozymes in CML cells resulted in a

remarkable decrease of both BCR/ABL mRNA and protein [21,25,27,29,30]. This inhibitory effect was also shown for ribozymes targeting either the PML/RARα fusion gene, the molecular equivalent of the translocation t(15;17) found in acute promyelocytic leukemia (APL), or the AML1/ETO chimeric gene resulting from the translocation t(8;21) [31–36]. With few exceptions, however, these encouraging approaches have not yet been translated into larger clinical trials, mainly because of the low efficiency of uptake of either the antisense molecules or ribozymes, respectively. As one of those rare exceptions, de Fabritiis et al. reported on a clinical trial using BCR/ABL antisense molecules for bone marrow purging in CML patients undergoing autologous transplantation. Two out of eight patients showed a complete karyotypic response, e.g. absence of Ph∗ chromosome according to cytogenetic analyses, but relapsed after a while [37].

3. Downregulation of leukemic fusion genes by small interfering RNAs In the last few years much insight was gained into a naturally occurring process called RNAi [38–41]. During RNAi long double-stranded RNA molecules are processed to generate 21-nucleotide small double-stranded interfering RNAs (siRNAs) that ultimately induce a sequence-specific degradation of the sequence-homologous mRNA [42]. It has been demonstrated that the application of synthetic siRNAs to mammalian cells induces sequence-specific silencing of the targeted gene, making this method a valuable key for inhibiting gene expression.

C. Damm-Welk et al. / Seminars in Cancer Biology 13 (2003) 283–292

Recently, three publications described the effective inhibition of fusion genes generated by chromosomal translocation involving small interfering RNAs [43–45]. Two reports focused on the inhibition of the BCR/ABL fusion gene. Wilda et al. were the first to demonstrate the effective inhibition of M-BCR/ABL in the CML cell line K562, which expresses the 210 kD variant of the BCR/ABL oncoprotein. The authors selected a siRNA that targeted the fusion site of the M-BCR/ABL transcript. The analysis of M-BCR/ABL after transfection of this siRNA in K562 cells was done by quantitative real-time RT–PCR and revealed a strong inhibitory effect of the M-BCR/ABL-specific siRNA. The M-BCR/ABL protein is also silenced to a barely visible level. The specificity of the siRNA was tested by comparison with a second siRNA, which was also targeted against the M-BCR/ABL fusion site, but exhibited two point mutations within its central region. This siRNA was clearly less efficient in reduction of M-BCR/ABL. Downregulation of M-BCR/ABL was accompanied by the induction of apoptosis in the Ph+ -K562 cell line after application of M-BCR/ABL-specific siRNAs. When compared to the induction of apoptosis after treatment with the “gold-standard” for BCR/ABL-positive leukemias, the ABL tyrosine kinase inhibitor STI 571, the rate of cell killing was nearly the same for both approaches. However, an additive effect of combining the STI 571 and M-BCR/ABL siRNAs was not seen, possibly because of the high concentration of STI 571 (1 ␮M) used in that study. In the light of the increasing evidence that tumor cells rapidly develop a resistance to the tyrosine

285

kinase inhibitor STI 571, either by a single point mutation within the ABL kinase domain or a variety of other cellular mechanisms bypassing the BCR/ABL pathway, a combined molecular therapy with low molecular weight drugs and RNA therapeutics would be a strategy worth testing. Using the identical cell line, Scherr et al. also showed the effective reduction of M-BCR/ABL mRNA and its oncogenic gene product by siRNA. Their two functional siRNAs, were slightly different from that of Wilda et al., but were also designed to target the M-BCR/ABL fusion site. Further analysis of another cell line (TonB) that expressed M-BCR/ABL under the control of a doxycycline-inducible promoter revealed similar results further substantiating the general applicability of this siRNA-mediated therapeutic strategy. In addition, Scherr et al. transfected primary hematopoietic cells from CML patients with the siRNAs targeted against M-BCR/ABL. In this approach the mRNA level of the oncogene was downregulated to levels between 50 and 70%. A third report [43] deals with AML1/ETO, the fusion gene underlying the translocation t(8;21), which is among the most frequent aberrations in acute myelogenous leukemia (AML). The fusion product AML1/ETO functions as constitutive repressor of transcription of several target genes normally involved in proper myeloid differentiation, e.g. PU.1 or C/EBP␣ transcription factors required for the development of early multipotential myeloid precursors [46–49]. When the C/EBP␣ mRNA is downregulated through AML1/ETO, the myeloid differentiation is blocked, leading to an accumulation of granulocytic precursors. In their work,

Fig. 2. Suppression of NPM/ALK through siRNAs. HeLa cells were transfected with a plasmid that expressed the chimeric NPM/ALK cDNA under the control of a CMV promoter and an NPM/ALK-specific siRNA. NPM/ALK protein was detected in HeLa cells (A) and (C). In the presence of NPM/ALK-specific siRNAs, the expression of the oncoprotein is substantially decreased (B) and (D). Magnification: 40× (upper panel), 80× (lower panel). Transfection was done with Oligofectamine (Invitrogen, Karlsruhe, Germany). Immunohistochemistry was performed with the NPM-ALK/ALK antibody (BD-Pharmingen, San Diego, USA).

286

C. Damm-Welk et al. / Seminars in Cancer Biology 13 (2003) 283–292

Heidenreich et al. reduced the AML1/ETO mRNA through fusion-specific siRNAs to 40–80%. The authors were able to demonstrate that the block of myeloid differentiation can be overcome with the inhibition of AML1/ETO by siRNAs followed by stimulation with the differentiation-inducing agents TGF␤1 and Vitamin D3. With respect to lymphoma, the translocation t(2;5) occurs in up to 75% of all pediatric cases of anaplastic large cell lymphoma (ALCL). The rearrangement combines the nucleophosmin protein NPM1 with the tyrosine kinase gene ALK. The fusion protein exhibits constitutive activation of the tyrosine kinase ALK, leading to cellular transformation through activation of a variety of pathways involved in proliferation and cell survival [50,51]. We achieved a remarkable downregulation of NPM/ALK, as assessed by immunohistochemistry, when HeLa cells were co-transfected with an NPM/ALK expression vector and siRNAs covering the NPM/ALK fusion site (Fig. 2). In summary, the work so far done on siRNA-mediated downregulation of fusion genes in leukemias and lymphomas outlined the power of this strategy. A major drawback of antisense-based strategies, namely that the sequence specificity of the molecules used was often questionable, seems to be overcome with siRNAs. In light of the extreme quickness with which siRNAs entered the field of gene targeting in many labs all over the world, the siRNA-mediated cleavage of mRNA appears to be by far more potent, robust, and reproducible than that of antisense molecules and RNase H cleavage. On the other hand, a recent comparative study from the pharmaceutical company ISIS suggests that both approaches achieve downregulation of target proteins to a similar extent [52]. Additional careful comparisons between antisense/RNase H- and siRNA-mediated mRNA cleavage for a panel of various other genes would be desirable.

4. Proposal for siRNA sequences targeting the fusion sites in leukemias and lymphomas In the present study, we analyzed the fusion sequences of the most frequent type 1 chromosomal translocations in leukemia and lymphomas. On the basis of freely available computer tools, we here suggest a panel of siRNA sequences that may be of help as a starting point for those who are interested in a particular fusion gene. However, we wish to point out that only the M-BCR/ABL, AML1/ETO, and NPM/ALK fusion siRNAs have so far been functionally tested by us or others. With help of the Whitehead Institute’s siRNA selection tool, we suggested suitable siRNAs for all these fusion sites (http://jura.wi.mit.edu/bioc/siRNA/home.php) (Table 1). We also indicated corresponding tumor cell lines bearing such translocations. All sequences were carefully analyzed by Blast search to exclude interaction of the siRNA with additional human genes. Some of the translocations listed in Table 1 give rise to different chimeric transcripts due to the

presence of different splicing variants and heterogeneity of the fusion sites. This is especially true for the PML/RARα gene fusion, the molecular equivalent of the translocation t(15;17), or for all 11q23 translocations which truncate and fuse the MLL gene to one of its partial partners on genes located one more than 40 chromosomal sites. Among those, the most frequent ones are located on chromosomes 4 (AF4), 6 (AF6), 9 (AF9), and 19 (ENL). Many different splicing variants were also known in case of the inversion of chromosome 16 resulting in the CBFβ-MYH11 fusion and of translocation t(1;19), which gives rise to E2A-PBX1 chimeric transcript [53]. Thus, tumor cells may escape from a siRNA therapeutic approach simply by the expression of alternatively spliced transcripts that do not contain the fusion site against which the siRNA was originally designed. Should all siRNA sequences be restricted only to the fusion site of the chimeric gene? When the normal counterparts of the fusion partners are not expressed in hematopoietic cells or other non-malignant cells, one might expect that siRNAs outside the fusion region may also be suitable for specific silencing in cancer cells. One example for this possibility is the ALK gene expression, which is normally limited to neuronal cells, only when fused to NPM does it become detectable in non-neuronal cells [54,55]. In the last year a flurry of papers described vectors for intracellular expression of siRNAs. For achieving high levels of intracellular expression of siRNAs, most of the research groups used polymerase III promoters, which have defined initiation and termination signals [56,57]. Polymerase III promoters naturally express small RNA species, such as tRNAs or snRNAs. Most researchers chose either the U6 snRNA promoter or the RNase H1 RNA promoter. The desired siRNAs were expressed either in sense and antisense directions from two expression cassettes in one plasmid [58,59] or as folded-back stem loop expressed from one promoter element through polymerase III-expressed hairpin RNAs [60–63]. But many siRNAs targeting fusion sites of chimeric mRNAs are not suitable to be expressed from the polymerase III system, because the siRNAs carried stretches of four or more thymidines in their sequences. These polythymidine stretches are the termination signals for RNA-polymerase III. Unfortunately, some of the most common fusion sites found in leukemias, e.g. M-BCR/ABL (K562 cell line), MLL/AF9 (THP-1 cell line), PLM/E2A, NUP98/HOXA9, and MLL/AF4 (MV4-11 cell line), can therefore not be targeted. Besides this profound methodological problem, inherent in each polymerase III-driven transcription, we also speculate that some mechanisms of RNAi resistance may be considered in the near future.

5. Proposed mechanism for RNAi resistance Due to the extreme sequence specificity of RNAi, a single point mutation in the targeted fusion site may abolish siRNA-mediated mRNA degradation of the oncogene, thus

Table 1 Selected siRNAs targeting chromosomal translocations of type 1 in leukemias and lymphomas Genes

GenBank accession number

Cell line

siRNA sense

siRNA antisense

t(1;19) (q23;p13)

PBX1 E2A

M86546 M31222

697

CUCCUACAGUGUUUUGAGUdTdT CAGUGUUUUGAGUAUCCGAdTdT

ACUCAAAACACUGUAGGAGdTdT UCGGAUACUCAAAACACUGdTdT

t(2;5) (p23;q35)

ALK NPM

U04946 M23613

Su-DHl-1 Karpas 299 SR-789

GCACUUAGUAGUGUACCGCCdTdT

GGCGGUACACUACUAAGUGCdTdT

t(4;11) (q21;q23)

AF4 MLL

L13773 L04284

RS4;11

GUGGGCAUGUAGAGCAGACdTdT UGUAGAGCAGACCUACUCCdTdT GAGCAGACCUACUCCAAUGdTdT ACCAAAAGAAAAGGAAAUGdTdT CCAAAAGAAAAGGAAAUGAdTdT AAAGAAAAGGAAAUGACCCdTdT AAGAAAAGGAAAUGACCCAdTdT AGAAAAGGAAAUGACCCAUdTdT GAAAAGGAAAUGACCCAUUdTdT AAAGGAAAUGACCCAUUCAdTdT AAGGAAAUGACCCAUUCAUdTdT

GUCUGCUCUACAUGCCCACdTdT GGAGUAGGUCUGCUCUACAdTdT CAUUGGAGUAGGUCUGCUCdTdT CAUUUCCUUUUCUUUUGGUdTdT UCAUUUCCUUUUCUUUUGGdTdT GGGUCAUUUCCUUUUCUUUdTdT UGGGUCAUUUCCUUUUCUUdTdT AUGGGUCAUUUCCUUUUCUdTdT AAUGGGUCAUUUCCUUUUCdTdT UGAAUGGGUCAUUUCCUUUdTdT AUGAAUGGGUCAUUUCCUUdTdT

CCACCAGAAUCAGGAUUUGdTdT CCAGAAUCAGGAUUUGGAGdTdT GAAUCAGGAUUUGGAGUUCdTdT AUCAGGAUUUGGAGUUCCAdTdT UCAGGAUUUGGAGUUCCAUdTdT

CAAAUCCUGAUUCUGGUGGdTdT CUCCAAAUCCUGAUUCUGGdTdT GAACUCCAAAUCCUGAUUCdTdT UGGAACUCCAAAUCCUGAUdTdT AUGGAACUCCAAAUCCUGAdTdT

MV4;11

t(6;11) (q27;q23)

AF6 MLL

U02478 L04284

ML-2

t(7;11) (p15;p15)

HOXA9 NUP98

U82759 AB040538 (U41814)

No cell line available

GGCCCCAGUAGUUGAUAGAdTdT GUAGUUGAUAGAGAAAAACdTdT

UCUAUCAACUACUGGGGCCdTdT GUUUUUCUCUAUCAACUAdTdT

t(8;21) (q22;22)

ETO AML1

D43638 M83215

Kasumi-1 SKNO-1

CCUCGAAAUCGUACUGAGAAG CCUCGAAAUCGUACUGAGAAG CCUCGAAAUCGUACUGAGAdTdT

UCUCAGUACGAUUUCGAGGUU CUUCUCAGUACGAUUUCGAGGUU UCUCAGUACGAUUUCGAGGdTdT

t(9;l1) (p21;q23)

AF9 MLL

L13744 L04284

THP-1

AAAGAAAAGUCUGAACAACdTdT AAGAAAAGUCUGAACAACCdTdT AGAAAAGUCUGAACAACCCdTdT GAAAAGUCUGAACAACCCAdTdT AAAGUCUGAACAACCCAGUdTdT AAGUCUGAACAACCCAGUCdTdT GUAGUGGGCAUGUAGAGUCdTdT GUGGGCAUGUAGAGUCUGAdTdT GAGUCUGAACAACCCAGUCdTdT

GUUGUUCAGACUUUUCUUUdTdT GGUUGUUCAGACUUUUCUUdTdT GGGUUGUUCAGACUUUUCUdTdT UGGGUUGUUCAGACUUUUCdTdT ACUGGGUUGUUCAGACUUUdTdT GACUGGGUUGUUCAGACUUdTdT GACUCUACAUGCCCACUACdTdT UCAGACUCUACAUGCCCACdTdT GACUGGGUUGUUCAGACUCdTdT

Mono-Mac-6

Hits in Blast search GenBank accession

AI917080 BC035064 BC035064 NM 006421 AW976167

NM 021145 NM 021145

C. Damm-Welk et al. / Seminars in Cancer Biology 13 (2003) 283–292

Translocation

287

288

Table 1 (Continued ) Genes

GenBank accession number

Cell line

siRNA sense

siRNA antisense

t(9;22) (q34;q11)

ABL BCR

X16416 Y00661

K562

GCAGAGUUCAAAAGCCCUUdTdT AGCAGAGUUCAAAAGCCCUdTdT GCAGAGUUCAAAAGCCCdTdT UGGAGACGCAGAAGCCCUUdTdT GACGCAGAAGCCCUUCAGCdTdT CGCAGAAGCCCUUCAGCGGdTdT

AAGGGCUUUUGAACUCUGCdTdT AGGGCUUUUGAACUCUGCUdTdT GGGCUUUUGAACUCUGCdTdT AAGGGCUUCUGCGUCUCCAdTdT GCUGAAGGGCUUCUGCGUCdTdT CCGCUGAAGGGCUUCUGCGdTdT

SD-1

t(11;19) (q23;p13)

MLL ENL

L04284 L04285

HB 11;19

GUGGGCAUGUAGAGUGCACdTdT UGUAGAGUGCACCGUCCAGdTdT GAGUGCACCGUCCAGGUGAdTdT

GUGCACUCUACAUGCCCACdTdT CUGGACGGUGCACUCUACAdTdT UCACCUGGACGGUGCACUCdTdT

t(12;21) (p13;q22)

TEL AML

U11732 M83215

REH

UUGGGAGAAUAGCAGAAUGdTdT GAAUAGCAGAAUGCAUACUdTdT AUAGCAGAAUGCAUACUUGdTdT UAGCAGAAUGCAUACUUGGdTdT GCAGAAUGCAUACUUGGAAdTdT

CAUUCUGCUAUUCUCCCAAdTdT AGUAUGCAUUCUGCUAUUCdTdT CAAGUAUGCAUUCUGCUAUdTdT CCAAGUAUGCAUUCUGCUAdTdT UUCCAAGUAUGCAUUCUGCdTdT

t(15;17) (q22;q21)

PML RAR␣

M73778 X06614

NB4

GGCAGCCAUUGAGACCCAGdTdT

CUGGGUCUCAAUGGCUGCCdTdT

Inv(16) (p13;q22)

CBF␤ MyH11

L20298 X69292

ME-1

GGAAAUGGAGGUCCAUGAGdTdT AAUGGAGGUCCAUGAGCUGdTdT AUGGAGGUCCAUGAGCUGGdTdT

CUCAUGGACCUCCAUUUCCdTdT CAGCUCAUGGACCUCCAUUdTdT CCAGCUCAUGGACCUCCAUdTdT

t(16;21) (p11;q22)

FUS ERG

S62140 M21535

IRTA17

AUAAAUUUGGUGGCAGUGGdTdT UAAAUUUGGUGGCAGUGGCdTdT AAUUUGGUGGCAGUGGCCAdTdT AUUUGGUGGCAGUGGCCAGdTdT UUUGGUGGCAGUGGCCAGAdTdT

CCACUGCCACCAAAUUUAUdTdT GCCACUGCCACCAAAUUUAdTdT UGGCCACUGCCACCAAAUUdTdT CUGGCCACUGCCACCAAAUdTdT UCUGGCCACUGCCACCAAAdTdT

t(X;11) (q13;q23)

AFX MLL

X93996 L04284

Karpas 45

UGUAGAGAGAACUCGAUCCdTdT GUGGGCAUGUAGAGAGAACdTdT GAGAGAACUCGAUCCGCCAdTdT

GGAUCGAGUUCUCUCUACAdTdT GUUCUCUCUACAUGCCCACdTdT UGGCGGAUCGAGUUCUCUCdTdT

Hits in Blast search GenBank accession

BU753447 BU753447

NM 001379 AI248940 NM 001379 CA429511 AK095347

All proposed siRNA sequences were selected with help of the Whitehead Institute’s siRNA selection tool. Sequences are indicated in 5 –3 orientation. The GenBank accession numbers of the single genes involved in the translocations are indicated. Only siRNAs against BCR/ABL, AML/ETO, and NPM/ALK are tested for their functionality. The translocations t(4;11), t(6;11), t(9;11), t(9;22), t(11;19), t(15;17), and Inv(16) are accompanied by a number of alternatively spliced transcripts. Accession numbers of other sequences that may potentially be targeted by the selected siRNAs are indicated as well.

C. Damm-Welk et al. / Seminars in Cancer Biology 13 (2003) 283–292

Translocation

C. Damm-Welk et al. / Seminars in Cancer Biology 13 (2003) 283–292

289

Fig. 3. Proposed mechanisms for tumor cell resistance to RNAi-based therapy. Tumor cells may become resistant to RNAi-based therapy by way of several mechanisms. Resistance could be achieved through point mutations in the targeted gene so that recognition of the cognate mRNA through siRNAs is abolished (a). A second escape mechanism is represented by target gene amplification, which may affect mRNA degradation (b). Thirdly, mutations in proteins essential for an effective RNAi process could significantly impair either recognition or endonucleolytic cleavage of the target mRNA (c). Fourthly, editing of siRNAs by deaminases could lead to reduced incorporation into the RNAi-inducing silencing complex (RISC) or insufficient recognition of the targeted mRNA (d).

keeping the tumor cell resistant to RNAi (Fig. 3a). Secondly, mutations in proteins of the RNAi machinery, e.g. the argonaute proteins, could also render the tumor cells resistant to RNAi (Fig. 3c). Thirdly, an amplification of the fused oncogene, recently also demonstrated in BCR/ABL-positive leukemias after treatment with tyrosine kinase inhibitor STI 571, may result in an inefficient fusion gene suppression (Fig. 3b). Fourthly, RNAi could be antagonized by a mechanism called RNA editing through adenosine deaminases, as has already been shown in C. elegans [64]. The enzyme creates inosines through deamination of adenosines in double-stranded RNA, creating sequence and structural changes in it [65]. RNA editing could antagonize RNAi through inhibition of the recognition of siRNAs by the RNAi machinery as it was seen in Drosophila cell-free extracts [66], or through insufficient base pairing be-

tween siRNA and target, inhibiting cleavage of the mRNA (Fig. 3d).

6. Animal models for chromosomal translocations as a tool for clinical evaluation of RNAi therapeutics Modeling chromosomal translocations in the mouse has become an essential tool to study the pathogengenesis of leukemia and lymphoma in vivo. For many of the chromosomal translocations, mouse models have been established either by classical transgenic methods, through knock-in techniques, or through an inducible or Cre-lox-mediated mechanism [67]. The availability of these mouse models foretells further studies in which the in vivo activity of siRNAs will be tested

290

C. Damm-Welk et al. / Seminars in Cancer Biology 13 (2003) 283–292

in more detail. Such studies will be facilitated by encouraging reports about the successful application of siRNAs in mice [68–72]. The data supplied from these studies targeting, e.g. the genes for the green fluorescent protein and luciferase in transgenics, give great promises that siRNAs could be successfully supplied to transgenic mice strains bearing chromosomal translocations involved in leukemia and lymphoma. It should be noted that high-pressure tail-vein injection of chemically synthesized siRNAs was sufficient for significant downregulation of the target mRNA in highly vascularized organs, e.g. the liver. The oncogenic potential of the BCR/ABL fusion gene was demonstrated in several animal models [73–79]. Transgenic mice modeling the M-BCR/ABL chimeric gene developed acute B cell lymphoblastic leukemia [75,76] or a myeloproliferative phenotype resembling CML in humans [78]. The PML/RARα fusion was also successfully expressed in mouse strains under the control of different tissue-specific promoters, and the transgenic PML/RARα animals exhibited a myeloproliferative syndrome. The leukemic potential of PML/RARα was further increased by crossing PML/RARα transgenic animals with PML-Null-mutant mice [80]. Transgenic mice for AML1/ETO showed that this translocation alone is not sufficient for development of a hematopoietic disease. Additional mutations in combination with AML1/ETO are required for a full malignant phenotype [81]. The most convincing examples for successful modeling of MLL-associated leukemias are the MLL/AF9 or MLL/GAS7 knock-in mice, respectively. In both cases, the animals rapidly developed acute leukemia strongly resembling the phenotype in humans [82,83]. Transgenic animals bearing an NPM/ALK fusion gene involved in anaplastic large cell lymphoma were recently established as well [84]. As expected, the NPM/ALK transgenics acquired malignant lymphoproliferative phenotypes and their tumor cells expressed the CD 30 antigen, a typical finding in ALCL. The successful treatment of such transgenic mice with fusion-site-specific siRNAs will be a conditio sine quo non for later clinical trials in humans. Thus, the ultimate clinical utility of the siRNA-based treatment modalities is obviously still unclear to date. We are, however, confident that many pitfalls and setbacks that we had experienced in initial antisense trails will help us to speed up the progress towards a clinical application of this new class of molecular therapeutics, hopefully for the benefit of our patients. Note added in press In a recent publication Wohlbold et al. (Blood published online May 15, 2003) showed that STI 571 and siRNAs targeting BCR/ABL cooperatively act on the induction of apoptosis in PH+-leucemic cells. Even in clones which had acquired STI-resistance due to point mutation within the ABL kinase domain, siRNAs enabled the efficient induction of apoptosis. These data demonstrate the possibilities to overcome drug resistance by combination therapy.

Acknowledgements We thank Bingbing Yuan, Whitehead Institute, Boston, USA, for helping us with the design of the siRNAs indicated in Table 1. A special note of thanks to Dr. R.M. Bohle, Institute of Pathology, Justus Liebig University, Giessen, Germany, who performed immunohistochemistry on HeLa cells. Our own studies were supported by grants either from the “Deutsche Krebshilfe” or the “Deutsche Forschungsgemeinschaft”.

References [1] Rabbitts TH. Chromosomal translocations in human cancer. Nature 1994;372:143–9. [2] Rabbitts TH. Translocations, master genes, and differences between the origins of acute and chronic leukemias. Cell 1991;67:641–4. [3] Rowley JD. The role of chromosome translocations in leukemogenesis. Semin Hematol 1999;36:59–72. [4] Gilliland DG. Molecular genetics of human leukemia. Leukemia 1998;12:S7–12. [5] Agrawal S, Kandimalla ER. Antisense therapeutics: is it as simple as complementary base recognition? Mol Med Today 2000;6:72–81. [6] Crooke ST. Molecular mechanisms of action of antisense drugs. Biochim Biophys Acta 1999;1489:31–44. [7] Chopra R, Pu QQ, Elefanty AG. Biology of BCR-ABL. Blood Rev 1999;13:211–29. [8] Wang JY. Regulation of cell death by the Abl tyrosine kinase. Oncogene 2000;19:5643–50. [9] Wong S, Witte ON. Modeling Philadelphia chromosome positive leukemias. Oncogene 2001;20:5644–59. [10] Salesse S, Verfaillie CM. BCR/ABL: from molecular mechanisms of leukemia induction to treatment of chronic myelogenous leukemia. Oncogene 2002;21:8547–59. [11] Szczylik C, Skorski T, Nicolaides NC, Manzella L, Malaguarnera L, Venturelli D, et al. Selective inhibition of leukemia cell proliferation by BCR-ABL antisense oligodeoxynucleotides. Science 1991;253:562–5. [12] Chasty R, Whetton A, Lucas G. A comparison of the effect of bcr/abl breakpoint specific phosphothiorate oligodeoxynucleotides on colony formation by bcr/abl positive and negative, CD34 enriched mononuclear cell populations. Leuk Res 1996;20:391–5. [13] de Fabritiis P, Amadori S, Calabretta B, Mandelli F. Elimination of clonogenic Philadelphia-positive cells using BCR-ABL antisense oligodeoxynucleotides. Bone Marrow Transplant 1993;12:261–5. [14] de Fabritiis P, Skorski T, De Propris MS, Paggi MG, NieborowskaSkorska M, Lisci A, et al. Effect of bcr-abl oligodeoxynucleotides on the clonogenic growth of chronic myelogenous leukaemia cells. Leukemia 1997;11:811–9. [15] Skorski T, Szczylik C, Malaguarnera L, Calabretta B. Gene-targeted specific inhibition of chronic myeloid leukemia cell growth by BCR-ABL antisense oligodeoxynucleotides. Folia Histochem Cytobiol 1991;29:85–9. [16] Wu AG, Joshi SS, Chan WC, Iversen PL, Jackson JD, Kessinger A, et al. Effects of BCR-ABL antisense oligonucleotides (AS-ODN) on human chronic myeloid leukemic cells: AS-ODN as effective purging agents. Leuk Lymphoma 1995;20:67–76. [17] O’Brien SG, Kirkland MA, Melo JV, Rao MH, Davidson RJ, McDonald C, et al. Antisense BCR-ABL oligomers cause non-specific inhibition of chronic myeloid leukemia cell lines. Leukemia 1994;8:2156– 62. [18] Skorski T, Nieborowska-Skorska M, Nicolaides NC, Szczylik C, Iversen P, Iozzo RV, et al. Suppression of Philadelphia1 leukemia

C. Damm-Welk et al. / Seminars in Cancer Biology 13 (2003) 283–292

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

cell growth in mice by BCR-ABL antisense oligodeoxynucleotide. Proc Natl Acad Sci USA 1994;91:4504–8. Skorski T, Nieborowska-Skorska M, Wlodarski P, Perrotti D, Hoser G, Kawiak J, et al. Treatment of Philadelphia leukemia in severe combined immunodeficient mice by combination of cyclophosphamide and bcr/abl antisense oligodeoxynucleotides. J Natl Cancer Inst 1997; 89:124–33. Stocks MR, Rabbitts TH. Masked antisense: a molecular configuration for discriminating similar RNA targets. EMBO Rep 2000;1:59– 64. Leopold LH, Shore SK, Newkirk TA, Reddy RM, Reddy EP. Multi-unit ribozyme-mediated cleavage of bcr-abl mRNA in myeloid leukemias. Blood 1995;85:2162–70. Kearney P, Wright LA, Milliken S, Biggs JC. Improved specificity of ribozyme-mediated cleavage of bcr-abl mRNA. Exp Hematol 1995;23:986–9. Pachuk CJ, Yoon K, Moelling K, Coney LR. Selective cleavage of bcr-abl chimeric RNAs by a ribozyme targeted to non-contiguous sequences. Nucleic Acids Res 1994;22:301–7. Snyder DS, Wu Y, Wang JL, Rossi JJ, Swiderski P, Kaplan BE, et al. Ribozyme-mediated inhibition of bcr-abl gene expression in a Philadelphia chromosome-positive cell line. Blood 1993;82:600–5. Snyder DS, Wu Y, McMahon R, Yu L, Rossi JJ, Forman SJ. Ribozyme-mediated inhibition of a Philadelphia chromosome-positive acute lymphoblastic leukemia cell line expressing the p190 bcr-abl oncogene. Biol Blood Marrow Transplant 1997;3:179–86. James H, Mills K, Gibson I. Investigating and improving the specificity of ribozymes directed against the bcr-abl translocation. Leukemia 1996;10:1676. Shore SK, Nabissa PM, Reddy EP. Ribozyme-mediated cleavage of the BCRABL oncogene transcript: in vitro cleavage of RNA and in vivo loss of P210 protein-kinase activity. Oncogene 1993;8:3183–8. Kronenwett R, Haas R, Sczakiel G. Kinetic selectivity of complementary nucleic acids: bcr-abl-directed antisense RNA and ribozymes. J Mol Biol 1996;259:632–44. Lange W, Cantin EM, Finke J, Dolken G. In vitro and in vivo effects of synthetic ribozymes targeted against BCR/ABL mRNA. Leukemia 1993;7:1786–94. Wright LA, Milliken S, Biggs JC, Kearney P. Ex vivo effects associated with the expression of a bcr-abl-specific ribozyme in a CML cell line. Antisense Nucleic Acid Drug Dev 1998;8:15–23. Pace U, Bockman JM, MacKay BJ, Miller Jr WH, Dmitrovsky E, Goldberg AR. A ribozyme which discriminates in vitro between PML/RAR alpha, the t(15;17)-associated fusion RNA of acute promyelocytic leukemia, and PML and RAR alpha, the transcripts from the nonrearranged alleles. Cancer Res 1994;54:6365–9. Nason-Burchenal K, Takle G, Pace U, Flynn S, Allopenna J, Martin P, et al. Targeting the PML/RAR alpha translocation product triggers apoptosis in promyelocytic leukemia cells. Oncogene 1998;17:1759– 68. Nason-Burchenal K, Allopenna J, Begue A, Stehelin D, Dmitrovsky E, Martin P. Targeting of PML/RARalpha is lethal to retinoic acid-resistant promyelocytic leukemia cells. Blood 1998;92:1758–67. Matsushita H, Kobayashi H, Mori S, Kizaki M, Ikeda Y. Ribozymes cleave the AML1/MTG8 fusion transcript and inhibit proliferation of leukemic cells with t(8;21). Biochem Biophys Res Commun 1995;215:431–7. Matsushita H, Kizaki M, Kobayashi H, Muto A, Ikeda Y. Induction of apoptosis in myeloid leukaemic cells by ribozymes targeted against AML1/MTG8. Br J Cancer 1999;79:1325–31. Kozu T, Sueoka E, Okabe S, Sueoka N, Komori A, Fujiki H. Designing of chimeric DNA/RNA hammerhead ribozymes to be targeted against AML1/MTG8 mRNA. J Cancer Res Clin Oncol 1996;122: 254–6. de Fabritiis P, Petti MC, Montefusco E, De Propris MS, Sala R, Bellucci R, et al. BCR-ABL antisense oligodeoxynucleotide in vitro purging and autologous bone marrow transplantation for pa-

[38] [39] [40] [41] [42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50] [51]

[52]

[53]

[54]

[55]

[56] [57] [58]

291

tients with chronic myelogenous leukemia in advanced phase. Blood 1998;91:3156–62. Hutvagner G, Zamore PD. RNAi: nature abhors a double-strand. Curr Opin Genet Dev 2002;12:225–32. Zamore PD. Ancient pathways programmed by small RNAs. Science 2002;296:1265–9. Hannon GJ. RNA interference. Nature 2002;418:244–51. Hammond SM, Caudy AA, Hannon GJ. Post-transcriptional gene silencing by double-stranded RNA. Nat Rev Genet 2001;2:110–9. Elbashir SM, Martinez J, Patkaniowska A, Lendeckel W, Tuschl T. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J 2001;20:6877–88. Heidenreich O, Krauter J, Riehle H, Hadwiger P, John M, Heil G, et al. AML1/MTG8 oncogene suppression by small interfering RNAs supports myeloid differentiation of t(8;21)-positive leukemic cells. Blood 2002;101:3157–63. Scherr M, Battmer K, Winkler T, Heidenreich O, Ganser A, Eder M. Specific inhibition of bcr-abl gene expression by small interfering RNA. Blood 2003;101:1566–9. Wilda M, Fuchs U, Wossmann W, Borkhardt A. Killing of leukemic cells with a BCR/ABL fusion gene by RNA interference (RNAi). Oncogene 2002;21:5716–24. Westendorf JJ, Yamamoto CM, Lenny N, Downing JR, Selsted ME, Hiebert SW. The t(8;21) fusion product, AML-1-ETO, associates with C/EBP-alpha, inhibits C/EBP-alpha-dependent transcription, and blocks granulocytic differentiation. Mol Cell Biol 1998;18:322– 33. Pabst T, Mueller BU, Harakawa N, Schoch C, Haferlach T, Behre G, et al. AML1-ETO downregulates the granulocytic differentiation factor C/EBPalpha in t(8;21) myeloid leukemia. Nat Med 2001;7:444– 51. Jakubowiak A, Pouponnot C, Berguido F, Frank R, Mao S, Massague J, et al. Inhibition of the transforming growth factor beta 1 signaling pathway by the AML1/ETO leukemia-associated fusion protein. J Biol Chem 2000;275:40282–7. Vangala RK, Heiss-Neumann MS, Rangatia JS, Singh SM, Schoch C, Tenen DG, et al. The myeloid master regulator transcription factor PU.1 is inactivated by AML1-ETO in t(8;21) myeloid leukemia. Blood 2003;101:270–7. Duyster J, Bay RY, Morris SW. Translocations involving anaplastic lymphoma kinase (ALK). Oncogene 2001;20:5623–37. Drexler HG, Gignac SM, von Wasielewski R, Werner M, Dirks WG. Pathobiology of NPM-ALK and variant fusion genes in anaplastic large cell lymphoma and other lymphomas. Leukemia 2000;14:1533– 59. Vickers TA, Koo S, Bennett CF, Crooke ST, Dean NM, Baker BF. Efficient reduction of target RNA’s by siRNA and RNase H dependent antisense agents: a comparative analysis. J Biol Chem 2002. Drexler HG, Borkhardt A, Janssen JW. Detection of chromosomal translocations in leukemia-lymphoma cells by polymerase chain reaction. Leuk Lymphoma 1995;19:359–80. Iwahara T, Fujimoto J, Wen D, Cupples R, Bucay N, Arakawa T, et al. Molecular characterization of ALK, a receptor tyrosine kinase expressed specifically in the nervous system. Oncogene 1997;14:439– 49. Morris SW, Naeve C, Mathew P, James PL, Kirstein MN, Cui X, et al. ALK, the chromosome 2 gene locus altered by the t(2;5) in nonHodgkin’s lymphoma, encodes a novel neural receptor tyrosine kinase that is highly related to leukocyte tyrosine kinase (LTK). Oncogene 1997;14:2175–88. Tuschl T. Expanding small RNA interference. Nat Biotechnol 2002;20:446–8. Paddison PJ, Hannon GJ. RNA interference: the new somatic cell genetics? Cancer Cell 2002;2:17–23. Miyagishi M, Taira K. U6 promoter-driven siRNAs with four uridine 3 overhangs efficiently suppress targeted gene expression in mammalian cells. Nat Biotechnol 2002;20:497–500.

292

C. Damm-Welk et al. / Seminars in Cancer Biology 13 (2003) 283–292

[59] Lee NS, Dohjima T, Bauer G, Li H, Li MJ, Ehsani A, et al. Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat Biotechnol 2002;20:500–5. [60] Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296:550–3. [61] Paul CP, Good PD, Winer I, Engelke DR. Effective expression of small interfering RNA in human cells. Nat Biotechnol 2002;20: 505–8. [62] Sui G, Soohoo C, Affar EB, Gay F, Shi Y, Forrester WC, et al. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci USA 2002;99:5515–20. [63] Yu JY, DeRuiter SL, Turner DL. RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci USA 2002;99:6047–52. [64] Knight SW, Bass BL. The role of RNA editing by ADARs in RNAi. Mol Cell 2002;10:809–17. [65] Bass BL. Double-stranded RNA as a template for gene silencing. Cell 2000;101:235–8. [66] Scadden AD, Smith CW. RNAi is antagonized by A → I hyperediting. EMBO Rep 2001;2:1107–11. [67] Bernardi R, Grisendi S, Pandolfi PP. Modelling haematopoietic malignancies in the mouse and therapeutical implications. Oncogene 2002;21:3445–58. [68] McCaffrey AP, Meuse L, Pham TT, Conklin DS, Hannon GJ, Kay MA. RNA interference in adult mice. Nature 2002;418:38–9. [69] Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H. Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nat Genet 2002;32:107–8. [70] Rubinson DA, Dillon CP, Kwiatkowski AV, Sievers C, Yang L, Kopinja J, et al. A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet 2003;33:401–6. [71] Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, et al. RNA interference targeting Fas protects mice from fulminant hepatitis. Nat Med 2003;9:347–51. [72] Hemann MT, Fridman JS, Zilfou JT, Hernando E, Paddison PJ, Cordon-Cardo C, et al. An epi-allelic series of p53 hypomorphs created by stable RNAi produces distinct tumor phenotypes in vivo. Nat Genet 2003;33:396–400. [73] Heisterkamp N, Jenster G, ten Hoeve J, Zovich D, Pattengale PK, Groffen J. Acute leukaemia in bcr/abl transgenic mice. Nature 1990;344:251–3.

[74] Heisterkamp N, Jenster G, Kioussis D, Pattengale PK, Groffen J. Human bcr-abl gene has a lethal effect on embryogenesis. Transgenic Res 1991;1:45–53. [75] Voncken JW, Kaartinen V, Pattengale PK, Germeraad WT, Groffen J, Heisterkamp N. BCR/ABL P210 and P190 cause distinct leukemia in transgenic mice. Blood 1995;86:4603–11. [76] Honda H, Fujii T, Takatoku M, Mano H, Witte ON, Yazaki Y, et al. Expression of p210bcr/abl by metallothionein promoter induced T-cell leukemia in transgenic mice. Blood 1995;85:2853–61. [77] Castellanos A, Pintado B, Weruaga E, Arevalo R, Lopez A, Orfao A, et al. A BCR-ABL(p190) fusion gene made by homologous recombination causes B-cell acute lymphoblastic leukemias in chimeric mice with independence of the endogenous bcr product. Blood 1997;90:2168–74. [78] Honda H, Oda H, Suzuki T, Takahashi T, Witte ON, Ozawa K, et al. Development of acute lymphoblastic leukemia and myeloproliferative disorder in transgenic mice expressing p210bcr/abl: a novel transgenic model for human Ph1-positive leukemias. Blood 1998;91:2067–75. [79] Huettner CS, Zhang P, Van Etten RA, Tenen DG. Reversibility of acute B-cell leukaemia induced by BCR-ABL1. Nat Genet 2000;24:57–60. [80] Rego EM, He LZ, Warrell Jr RP, Wang ZG, Pandolfi PP. Retinoic acid (RA) and As2 O3 treatment in transgenic models of acute promyelocytic leukemia (APL) unravel the distinct nature of the leukemogenic process induced by the PML-RARalpha and PLZF-RARalpha oncoproteins. Proc Natl Acad Sci USA 2000;97: 10173–8. [81] Yuan Y, Zhou L, Miyamoto T, Iwasaki H, Harakawa N, Hetherington CJ, et al. AML1-ETO expression is directly involved in the development of acute myeloid leukemia in the presence of additional mutations. Proc Natl Acad Sci USA 2001;98:10398–403. [82] Corral J, Lavenir I, Impey H, Warren AJ, Forster A, Larson TA, et al. An Mll-AF9 fusion gene made by homologous recombination causes acute leukemia in chimeric mice: a method to create fusion oncogenes. Cell 1996;85:853–61. [83] So CW, Karsunky H, Passegue E, Cozzio A, Weissman IL, Cleary ML. MLL-GAS7 transforms multipotent hematopoietic progenitors and induces mixed lineage leukemias in mice. Cancer Cell 2003;3: 161–71. [84] Chiarle R, Gong JZ, Guasparri I, Pesci A, Cai J, Liu J, et al. NPMALK transgenic mice spontaneously develop T-cell lymphomas and plasma cell tumors. Blood 2003;101:1919–27.