P21 signaling pathway and activation of p53 pathway in breast cancer

Biochemical and Biophysical Research Communications xxx (xxxx) xxx

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer Miaomiao Chen a, b, 1, Hongqin Zhang a, b, 1, Guihong Zhang a, b, Ailing Zhong a, b, Qian Ma a, b, Jinyan Kai a, b, Yin Tong a, Suhong Xie a, Yanchun Wang a, Hui Zheng a, Lin Guo a, b, Renquan Lu a, b, * a b

Department of Clinical Laboratory, Fudan University Shanghai Cancer Center, Shanghai, China Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 7 October 2018 Accepted 26 October 2018 Available online xxx

Targeting protein for Xenopus kinesin-like protein 2 (TPX2) is a microtubule-associated protein required for mitosis and spindle assembly. Previous studies showed that TPX2 is overexpressed in various human cancers and promotes cancer progression. In this study, the differentially expressed genes including TPX2 were screened in GEO database for gene expression microarray of breast cancer. The TPX2 expression level was significantly increased in breast cancer cells and the breast malignant tissues compared with those controls. In vitro experiment further confirmed that knockdown of TPX2 by small hairpin RNA inhibited breast cancer cell proliferatio, migration, and induced cell apoptosis. TPX2 silencing decreased the expression of PI3K and extent of AKT phosphorylation, as well as increased expression of p53 and p21. Taken together, our findings indicate that TPX2 silencing negatively regulates the PI3K/AKT and activates p53 signaling pathway by which breast cancer cells proliferation were inhibited whereas cellulars apoptosis were accelerated, suggesting that TPX2 may be a potential target for anticancer therapy in breast cancer. © 2018 Published by Elsevier Inc.

Keywords: TPX2 Breast cancer Cell apoptosis AKT signaling pathway p53

1. Introduction Breast cancer accounting for 30% of all new cancer diagnoses among women in 2018 is the most common malignant tumor of women worldwide. According to the latest statistics from the American Cancer Society, breast cancer is also the second leading cause of death in female malignancies, with a mortality accounting for 14% of all malignant tumor deaths [1]. Despite advances in surgical and chemotherapeutic treatment, the long-term survival rate for advanced breast cancer patients still remains low [2]. The poor prognosis for advanced breast cancer patients is, at least in part, due to the complexity and poorly understood underlying cellular and molecular mechanisms associated with the occurrence

* Corresponding author. Department of Clinical Laboratory, Fudan University Shanghai Cancer Center, No.270, Dong’An, Road, Xuhui District, Shanghai, 200032, China. E-mail address: [email protected] (R. Lu). 1 These authors contributed equally to this work.

of the disease. Therefore, a better understanding of molecular breast carcinogenesis will provide opportunities for the design of targeted therapy. TPX2, initially found by Heidebrecht et al. in 1997 [3], is a microtubule-associated protein that regulates the formation of the spindle by promoting microtubule nucleation from the chromatin and stabilizes the spindle microtubules in a Ran-dependent manner [4]. Since this initial research, several studies have demonstrated that TPX2 is overexpressed in various types of human cancers, including esophageal squamous cell carcinoma [5], bladder carcinoma [6] and medullary thyroid cancer [7]. Furthermore, the overexpression of TPX2 promotes tumor growth and metastasis in HCC [8]. However, there are a lack of in-depth studies focused on the relationship between TPX2 and breast cancer progression. The role of TPX2 in breast cancer progression and its underlying mechanisms remain unclear. In this study, we aimed to explore the relationship between TPX2 and breast cancer and the possible molecular mechanism in aims to elucidate the effect of TPX2 on the proliferation and

https://doi.org/10.1016/j.bbrc.2018.10.164 0006-291X/© 2018 Published by Elsevier Inc.

Please cite this article as: M. Chen et al., Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/ 10.1016/j.bbrc.2018.10.164

2

M. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

2. Materials and methods

containing 10% fetal bovine serum (FBS) and 1%penicillin-streptomycin (Gibco). ZR75-1, MDA-MB-231 and MDA-MB-468 cells were cultured in RPMI-1640 medium (Gibco). These cells were cultured at 5% CO2 in a 37  C incubator.

2.1. Differentiated expression genes screening

2.5. Establishment of TPX2 down-regulation transduced cells

To investigate the role of TPX2 in different types of tumors, we analyzed the microarray from Oncomine. By searching “Breast Carcinoma” on the Gene Expression Omnibus (GEO) database available at https://www.ncbi.nlm.nih.gov/geo/, we obtained the expression chip of breast cancer genes, and selected GSE54002, GSE22820 and GSE42568 for further use. Chip expression data were used for standardized pretreatment and differentiated gene screening of the limma package in R Programming Language [9]. Gene screening conditions were as follows: adj.P.Val <0.001 and LogFoldChange >2. Comparisons among the differentiated genes of three chips were conducted using the Venn online drawing tool: Calculate and draw custom Venn diagrams, which was available at http://bioinformatics.psb.ugent.be/webtools/Venn/. String database (https://string-db.org/) provided us with information of proteineprotein interaction, including direct (physical) and indirect (functional) relations [10]. Differentiated genes were incorporated in the String database for analysis of gene interaction. Gene interaction network were visualized in the Cytoscape 3.6.0 software.2.

Short hairpin RNA (shRNA) sequences, as shown in Table 1, were designed with the manufacturer's RNAi Designer program. The detailed procedures of the transfection were referred to the previous publication of our research group [12].

apoptosis of breast cancer for the identification of potential therapeutic targets for breast cancer.

2.2. Tissue samples Forty breast cancer tissues and adjacent normal tissues were obtained from patients undergoing resection of the breast cancer at the Department of Breast Surgery, Fudan University Shanghai Cancer Center (Shanghai, China) during 2016. The study was endorsed by the Ethics Committee of Shanghai Cancer Center, Fudan University (Certification No. 050432-4-1212B). Written informed consent was available from all patients. The final diagnosis of breast carcinoma was confirmed by histological analysis. 2.3. Immunohistochemistry and evaluation TPX2 was detected with a mouse polyclonal antibody at a dilution of 1:200(ab32795, Abcam, Cambridge, UK). IHC stain for TPX2 was according to a previous publication [11]. The staining was assessed independently by two pathologists through a blinded fashion, and all discrepancies were resolved by consensus. The staining intensity was granted as 0e3 (0 ¼ negative staining, 1 ¼ weak staining intensity, 2 ¼ moderate staining intensity, and 3 ¼ high staining intensity), whereas the percentage of stainingpositive cells was scored as: 0, 0e5%; 1, 6e25%; 2, 26e50%; 3, 51e75%; 4, 76e100%. The final staining scores were constituted by the sum of staining intensity and the proportion of positive cells, ranging from 0 to 7 (0e1, negative expression; 2e3, weak expression; 4e5, moderate expression; and 6e7, strong expression). For statistical analysis, patients with the score of 0e3 were regarded as a low expression while with the score of 4e7 were regarded as a high expression of TPX2 protein.

2.6. Quantitative real-time PCR (qRT-PCR) The procedures and materials was referred to a previous publication [12]. The specific primers used in the qPCR are listed in Table 2. 2.7. Western blotting and immunoprecipitation For western-blotting and immunoprecipitation, the method was according to a previous publication [12]. The antibodies and the dilution used in the detection were: TPX2 1:500 (ab32795, Abcam), p21 1:1000(10355-1-AP, Proteintech Group, Chicago, USA), AKT 1:1000(#4685, Cell Signaling Technology, USA), p-AKT 1:1000(#4056, CST), b-actin1:5000 (60008-1-lg, Proteintech Group), p53 1:1000(sc-126, Santa Cruz Biotechnology, CA, USA), MDM2 1:1000(ab38618, Abcam). The densities of the protein bands were quantified by Image J software (NIH, USA). 2.8. Colony-formation assay Cells were seeded into 6 well-plates at a density of 1000 cells/ well in a 6-well plate and incubated for 10e14 days until visible clones appeared. The process of crystal violet staining was referred to the previous publication [12]. 2.9. Cell proliferation assay Cells were seeded into 96-well plates. After 0, 24, 48, or 72 h of culture, each well was added with CCK8 solution (cell counting kit8, Dojindo, Japan) solution and incubated at 37  C for 2 h. Optical density (OD) was detected at 450 nm with a microplate reader. 2.10. Cell migration assays Cell migration assay were conducted using a modified 24-well Boyden chamber with a membrane that was uncoated with Matrigel (BD Biosciences, San Jose, CA, USA). Cells prepared in 500 mL of DMEM were loaded in the upper wells, and a medium containing 12% FBS was placed in the lower wells as a chemoattractant stimulus. Cells that had migrated to the bottom surface of the filter were fixed, stained with 0.5% crystal violet, and counted under a microscope in three randomly selected fields at a magnification of 200 .

2.4. Cell culture The MCF10A cells were cultured in a DMEM/F12 medium supplemented with 5% donor horse serum, 10 mg/ml insulin, 1%penicillin-streptomycin (Gibco, Carlsbad, USA), 20 ng/ml epidermal growth factor, 0.5 mg/ml hydrocortisone and 100 ng/ml cholera toxin(Sigma-Aldrich; St. Louis, MO, USA). The culture medium for MCF-7, T47D and HEK 293T cells is low-glucose DMEM medium

Table 1 Sequence of shRNA against TPX2 for transfection. Name

Sequence

shCtrl(scrambled sequence) shTPX2-1 ShTPX2-2

50 -CCTAAGGTTAAGTCGCCCTCG-30 50 -CTAATCTTCAGCAAGCTATTGCTC-30 50 -TCCAGACCTTGCCCTACTAAGCTC-30

Please cite this article as: M. Chen et al., Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/ 10.1016/j.bbrc.2018.10.164

M. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx Table 2 Primer sequences for RT-qPCR. Gene

Sequence(5‘-3‘)

TPX2

F: ACCTTGCCCTACTAAGATT R: AATGTGGCACAGGTTGAGC F: TGGCCTTAGCTCTTAGCCAAACAC R: ATTGGAACACGGCCTTTGACA F: CTGTGCCTATGCTGCCCAT R: CAGTGCGATGTCGTGGAGG F: GACCTGTCACTGTCTTGTAC R: CTCTCATTCAACCGCCTAG F: GGATAACGGAGGCTGGGATGC R: GACTTCACTTGTGGCCCAGAT F: TTCATCCAGGATCGAGCAGG R: GGAAAAAGACCTCTCGGGGG F: AGCGAATCAATGGACTCTGGA R: TTCCCTGAGGTTTGCTGCAT F: AAGGTGACAGCAGTCGGTT R: TGTGTGGACTTGGGAGAGG

PI3K AKT P21 BCL2 BAX Caspase-3

b-actin

2.11. Cell apoptosis Targeted cells were harvested and re-suspended in 0.5 ml binding buffer, then incubated with Annexin V-fluorescein isothiocyanate/PI dual stain (BD Biosciences) for 15 min and finally determined by flow cytometry. 2.12. Immunofluorescence Cells were 4% formalin and formaldehyde-acetone fixed inorder. Auto-fluorescence was quenched with BSA and then the cells were stained with primary monoclonal antibodies overnight, followed by incubated with secondary antibodies (Alexa Fluor 488 and 594, Life Technologies) at a dilution of 1:5000 and then mounted by ProLong® Gold Antifade Reagent with DAPI (Life Technologies). Cells were visualized under a multiphoton confocal microscope system (LAS-AF-Lite, Germany). 2.13. Statistical analysis Statistical analyses were performed using SPSS 19.0 software. Differences of TPX2 expression levels in tissues between groups were analyzed using Pearson chi-square or Fisher's exact tests. Other experiments between two groups were evaluated by student t-tests. Differences were considered statistically significant at P < 0.05. 3. Result 3.1. TPX2 is highly expressed in human breast carcinoma through Oncomine and GEO dataset We analyzed microarrays from Ocomine to investigate the role of TPX2 in different types of cancers. Ramaswamy Muti-cancer2 demonstrated that the expression of TPX2 in the breast cancer (n ¼ 11) was higher than other types of cancers (p < 0.001). TCGA dataset indicated that the expression of TPX2 in breast cancer was higher than normal breast tissues samples (P < 0.001) (Fig. 1A). We retrieved three chips of breast cancer gene expression in the GEO database: GSE54002, GSE22820, and GSE42568 (Table 3). Taking adj.P.Val <0.001 and LogFoldChange >2 as the selection criteria, we screened out 92, 295 and 235 differentiated gene, respectively from GSE54002, GSE22820, and GSE42568. The differentiated genes of these three chips were compared, and the Venn diagram was shown in Fig. 1B, from which we found 38 genes that were differentially up-expressed in three chips at the

3

same times. We retrieved the genes associated with breast cancer in DisGeNET and select ten most relevant genes (BRCA2, BRCA1, ERBB2, CHEK2, TP53, AR, CYP17A1, PTEN, KLK3, and PALB2) for follow-up analysis as the breast cancer genes. To further study the interactions between breast cancer differentiated genes and breast cancer genes, we analyzed the gene interaction network by String database (Fig. 1C). The data showed that 22 of the 38 breast cancer differentiated genes including TPX2 were linked to breast cancer genes. The heat map of top 20 differentiated genes in GSE54002 was mapped (Fig. 1D), and we found that the expression of TPX2 was significantly increased in breast cancer tissues, as well as in GSE22820 and GSE42568, compared with normal breast tissues(Fig. 1E). 3.2. Aberrant overexpression of TPX2 in breast cancer tissues and cells We collected 40 pairs of breast carcinoma and adjacent nontumor tissue samples from patients who underwent surgical resection at the Fudan University Shanghai Cancer Center in 2016. Fig. 1F illustrated the representative expression pattern in both tumor and adjacent non-tumor tissue samples. Immunohistochemistry and quantitative PCR analysis demonstrated the protein (P ¼ 0.000), and mRNA (P ¼ 0.0052) expression levels of TPX2 were higher in cancer tissues relative to adjacent tissues as shown in Table 4 and Fig. 1G. The expression of TPX2 were investigated among various breast cancer cell lines, including MCF7, T47D, ZR751, MDA-MB-231 and MDA-MB-468. Via western-blotting and quantitative PCR manifestations, we identified that TPX2 expression was notably higher in all the cancerous cell lines than in normal breast epithelial cells MCF10A (Fig. 1H). The two cell lines with the highest expressions of TPX2, MCF-7 and T47D cell lines, were selected for subsequent functional studies. 3.3. Association between TPX2 expression and the clinical features of breast cancer We identified a dramatic upregulation of TPX2 expression in primary breast cancer tissues compared to adjacent normal tissue by immunohistochemistry. The correlation between TPX2 expression and clinicopathologic characteristics was shown in Table 5. We found a close correlation of TPX2 expression with the tumor size (P ¼ 0.008), tumor differentiation (P ¼ 0.044) and clinical stage (P ¼ 0.026) among the included breast cancer patients. Collectively, these data indicated that TPX2 might be involved in breast cancer carcinogenesis and participated in the progression of breast cancer. 3.4. Down-regulation of TPX2 suppresses breast cancer cell proliferation, colony formation, migration and induces apoptosis in vitro After transfection of shTPX2-1/shTPX2-2 plasmid in MCF7 and T47D cells, we observed a significant decrease in both the mRNA and protein expression of TPX2 (Fig. 2A). Surprisingly, knockdown of TPX2 impaired cell proliferation, colony formation and migration in vitro (Fig. 2B, C, D). We further investigated the apoptosis rate in the TPX2 knockdown cells. The results showed an increased apoptosis in TPX2 knockdown cells compared to control cells with the shCtrl plasmid. Subsequently, we determined whether TPX2 has impact on the levels of apoptosis-related proteins, and observed a significant increased mRNA expression of Caspase3 and Bax, and a decreased of anti-apoptotic gene Bcl2 mRNA expression in TPX2 knockdown cells comparing to control cells. Our results indicated that silencing TPX2 may contribute to cellular apoptosis

Please cite this article as: M. Chen et al., Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/ 10.1016/j.bbrc.2018.10.164

4

M. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

Fig. 1. TPX2 expression was significantly increased in breast cancer A. Oncomine data analysis for TPX2 in breast cancer. (a) TPX2 mRNA was over-expressed in breast cancer tissues compared to other kinds of cancer tissues; (b) mRNA expression of TPX2 was over-expressed in invasive ductal breast cancer tissues relative to normal breast tissues; B. The differentiated genes screened in the three sets of chips GSE54002, GSE22820 and GSE42568 were compared with each other, among which there were 38 intersecting genes; C.

Please cite this article as: M. Chen et al., Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/ 10.1016/j.bbrc.2018.10.164

M. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

5

Table 3 Chips of breast cancer gene. Accession

Platform

Organism

Sample

GSE54002 GSE22820 GSE42568

GPL570 GPL6480 GPL570

Homo sapiens Homo sapiens Homo sapiens

417 patients with breast cancer and 16 non-tumor tissues 176 primary breast cancer patients and 10 normal breast samples 104 breast cancer and 17 normal breast biopsies

Table 4 The comparison of TPX2 expression between breast cancer tissues and control tissues. TPX2 expression

para-carcinoma tissues

carcinoma tissues

P

Negative Weak Moderate Strong

11 27 2 0

1 8 26 5

<0.05

and may be tightly associated with the levels of cell-apoptosisrelated proteins (Fig. 3A). 3.5. Gene silencing of TPX2 inhibits the PI3K/AKT/P21 signaling pathway Given the previous studies demonstrated that TPX2 may affect the protein kinase B (AKT) pathway that plays an important role in cancer progression in liver cancer, bladder cancer and ovarian cancer, we hypothesized TPX2 might affect the progression of breast cancer through the AKT pathway. Therefore, we analyzed the expression of PI3K, p-AKT and p21 in both TPX2 knockdown cells and control cells. As predicted, knockdown of TPX2 significantly decreased the expression level of PI3K and P-AKT and notably increased the expression of p21 (Fig. 3A). We also found that P21 could not enter the nucleus in cells expressing TPX2(Fig. 3B). It was also observed that treatment of cells with AKT inhibitor MK2206 in large part phenocopied the effect of TPX2 knockdown. TPX2 suppression enhanced sensitivity to MK2206 in MCF-7 and T47D cells. While treated with MK2206, the percentage of apoptosis was higher in TPX2 down-regulated cells than in controlled cells (Fig. 3C). Out results suggested that TPX2 may affect the biological function of breast cancer cells through the PI3K/AKT/P21 signaling pathway. 3.6. p53 pathways were activated by TPX2 down-regulation After down-regulation of TPX2, the expression of p53 and MDM2 were increased (Fig. 4A). Immunofluorescence assay indicated that TPX2 was mainly involved in spindle formation during mitosis, and mainly expressed in the nucleus during other cell cycle phases. p53 was localized in the nuclei, and the fluorescence intensity of p53 in the TPX2 down-regulated group was significantly higher than that in the control group (Fig. 4B). The CO-IP analyze showed that TPX2, MDM2 and p53 have direct interaction with each other. These results indicated that the two proteins are colocalized intracellularly and interact with each other (Fig. 4C). In addition, it suggested that inhibition of TPX2 expression would trigger and activate the p53 pathway (Fig. 4D).

Table 5 Correlations between TPX2 expression and clinicopathological features in breast cancer. Characteristics

Age(years) <¼50 >50 Tumor size(cm) <¼2 >2 Differentiation Well Moderate Poor Stage Ⅰ Ⅱ Ⅲ ER Negative Positive PR Negative Positive

of patients

TPX2 expression Low

High

P value

16 24

4 5

12 19

0.757

20 20

8 1 19

12

0.008

1 26 13

0 9 0

1 17 13

0.044

9 23 8

5 3 1

4 20 7

0.026

10 30

3 6

7 24

0.512

15 25

3 6

12 19

0.769

4. Discussion Targeting protein for Xenopus kinesin-like protein 2 (TPX2), a microtubule-associated protein, is encoded by the gene located in the human genome 20q11.1 and primarily involved in spindle formation and microtubule nucleation [13]. At present, more and more studies have explored the relationship between TPX2 and tumor progression. Overexpression of TPX2 promotes tumor growth in colon cancer [14], cervical cancer [15] and pancreatic cancer [16]. To date, there is a relative lack of investigations exploring functions of TPX2 in human breast cancers and, to our knowledge, no previous studies have included a study of molecular mechanisms of TPX2 in breast cancer. Thus, in the present study, we investigated the functional roles and underlying mechanisms of TPX2 in breast cancer. We initially analyzed the high expression of TPX2 in breast cancer by Oncomine and GEO databases. Our data manifested that the expression of TPX2 is significantly higher in breast cancer tissues and breast cancer cell lines. Increased expression of TPX2 was also observed in breast cancer patients with tumor size, advanced clinical tumor stage and differentiation. These results indicate that TPX2 is highly expressed in breast cancer and significantly associated with clinicopathological features of breast cancer.

Gene interaction network of breast cancer differentiated genes and breast cancer genes, in which red circles meant breast cancer genes and blue circles meant breast cancer differentiated genes, and differentiated genes showed no interaction with other genes were not shown in the figure; D. The expression thermal map of first 20 up-differentiated genes in GSE54002, from which the expression of TPX2 was markedly increased; E. The high expression of TPX2 in GSE22820 and GSE42568 respectively; F. Immunostaining of TPX2 protein in breast cancer tissues. (a) Normal tumor-adjacent tissues showed negative staining of TPX2; (bed) Representative images of weak, moderate and strong TPX2 expression in breast cancer tissues respectively. TPX2 was localized within the nuclei (original magnification: 400X for the inserts, 100X for all); G. TPX2 mRNA expression in breast carcinoma and corresponding para-carcinoma tissues using quantitative reverse transcription polymerase chain reaction (qRTePCR) (n ¼ 40, P ¼ 0.0052); H. TPX2 protein(a) and mRNA(b) expression in the normal human mammary cell line MCF-10a and five breast cancer cell lines (MCF-7, T47D, ZR75-1, MDA-MB-231 and MDA-MB-468) using western blot and qRTePCR. *P < 0.05. Data are presented as the mean ± SEM of three independent experiments. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Please cite this article as: M. Chen et al., Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/ 10.1016/j.bbrc.2018.10.164

6

M. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

Fig. 2. TPX2 inhibition suppressed proliferation and induced apoptosis of breast cancer cells. A. TPX2 knockdown efficiency was determined by Western blot and qRT-PCR analysis in MCF-7 and T47D cells; B. Suppression of TPX2 significantly reduced the proliferation of MCF-7 and T47D cells; C. MCF-7 and T47D cells were transfected with shCtrl and shTPX21/2 for the clonogenic assay. Representative data and quantitative results are shown; D. Representative images showed the migration ability of MCF-7 and T47D cells transfected with shTPX2-2 or shCtrl (original magnification 200) and quantitative results were shown; E. The percentage of apoptosis were measured by flow cytometry in the transduced MCF-7 and T47D cells. All experiments were carried out in triplicate. Data are shown as mean ± SEM, *P < 0.05, **P < 0.01.

Please cite this article as: M. Chen et al., Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/ 10.1016/j.bbrc.2018.10.164

M. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

7

Fig. 3. TPX2 silencing inhibited the PI3K/AKT signaling pathway. A. (a) MCF-7 and T47D cells that had been transfected with shCtrl and shTPX2-1/2, respectively, were subjected to western blotting for PI3K, AKT, phosphorylated p-AKT, P21, Procaspase-3 and Caspase-3. b-actin served as the loading control; (b) qRT-PCR analysis of TPX2, PI3K, AKT, p21, Caspase3, Bcl-2 and Bax mRNA expression in cells transfected with shTPX2-1/2 and shCtrl. b-actin served as the control; B. Immunofluorescence analysis revealed that P21 was considerably higher in TPX2 knockdown cells compared with controls. C. Suppression of TPX2 combined with MK2206 promoted cell apoptosis in T47D cells. Representative data and quantitative results of apoptosis ratio were shown. *P < 0.05, **P < 0.01 compared with the shCtrl; #P < 0.05, compared with the shCtrl with MK2206 group; data are means ± SEM from three independent experiments.

Please cite this article as: M. Chen et al., Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/ 10.1016/j.bbrc.2018.10.164

8

M. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

Fig. 4. Suppression of TPX2 activated p53 pathway. A. The protein expression of MDM2 and P53 in MCF-7 and T47D cells, treated with shTPX2-1/2 and shCtrl, were analyzed by western blot. B. Immunofluorescence analysis revealed that p53 was considerably higher in TPX2 knockdown MCF-7 and T47D cells compared with controls. TPX2 mainly located in spindle during mitosis and expressed in the nucleus during other phase. In shTPX2-1/2 transfected breast cancer cells, p53 mainly located at nucleolus. The DAPI nuclear staining was shown in blue, TPX2 expression in red and p53 in green. C. Western blot analysis of co-immunoprecipitated ability of TPX2, p53 and MDM2 with each other in MCF-7 cells. D. Schematic model of TPX2 regulates AKT signaling pathway and p53 pathway in breast cancer. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Please cite this article as: M. Chen et al., Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/ 10.1016/j.bbrc.2018.10.164

M. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

Furthermore, many studies have reported the essential role of the PI3K/AKT/P21 pathway in malignant tumor progression and activation of AKT is associated with cancer cell proliferation, survival, migration and invasion [17,18]. Liu et al. reported that silencing TPX2 prohibited hepatocellular carcinoma cell invasion by inactivating the AKT signaling pathway and suppressed the expressions of Matrix Metalloproteinase [19]. Consistent with previous studies, we found that down-regulation of TPX2 expression significantly reduced proliferation, colony formation and migration in breast cancer cells. Besides, the expression of PI3K, P-AKT and Bcl2 decreased, while the expression of p21, Caspase-3 and Bax increased. Moreover, inhibition of TPX2 synergizes with AKT inhibitor MK2206 to promote tumor cell apoptosis. These data suggested that down-regulation of TPX2 can promote apoptosis and inhibit cell proliferation by inactivating the PI3K/AKT signaling pathway. p53 is a well-known tumor suppressor able to drive cell cycle arrest, apoptosis, or senescence when DNA damaging occurred or the loss of cell integrity [20]. Indeed, during cell cycle, p53 associates with MDM2 in the nucleus and subsequently undergoes nuclear exclusion, allowing its ubiquitination and subsequent degradation [21]. In our experiments, we investigated the interaction among TPX2, P53 and MDM2, yet, it remains unclear that whether TPX2 interacts with MDM2 to indirectly affect P53 activity, or directly interacts with P53. Pascreau et al. reported that p53 was synthesized and phosphorylated during oocyte maturation in a manner dependent on the activity of Aurora A, which was activated by TPX2 in vivo [22]. p53 is an important transcription factor. Through the PROMO database, we predicted that p53 may be a transcription factor of TPX2. It is possible that there is a negative feedback regulation mechanism between TPX2-p53. The knockdown of TPX2 could increase the expression level of P53, which may subsequently promote TPX2 transcription. While research on TPX2 and MDM2 has never been reported before, we predicted that TPX2 gene silencing may directly promote the expression of MDM2, thereby promoting the ubiquitination degradation of p53. Suppression of TPX2 may activate the p53 pathway and promote the expression of MDM2 to maintain balance and stability. In short, TPX2, p53 and MDM2 are combined with each other, but the specific binding sites and mechanism of action still remain unclear, and further research in our subsequent experiments is needed. In conclusion, we demonstrated that TPX2 was highly expressed and played a vital role in breast cancer. Knockdown of TPX2 expression significantly inhibited cancer cell proliferation, colony formation, migration and promoted cell apoptosis through the PI3K/AKT signaling pathway. Moreover, we found that TPX2 can also bind to MDM2 and P53, participating in the regulation of breast cancer progression by p53 pathway. We discovered TPX2 represented a potentially promising biomarker and provided a new therapeutic tool in treating breast cancer, but more efforts are needed to be done for further exploration of the mechanism and its action in cancer pathogenesis were also required in future research. Funding The project is supported by National Natural Science Foundation of China (NSF-81572552).

9

Conflicts of interest The authors declare that they have no competing interests. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.10.164. References [1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, Ca - Cancer J. Clin. 68 (2018) (2018) 7e30. [2] M. Luo, J.L. Guan, Focal adhesion kinase: a prominent determinant in breast cancer initiation, progression and metastasis, Cancer Lett. 289 (2010) 127e139. [3] H.J. Heidebrecht, F. Buck, J. Steinmann, R. Sprenger, H.H. Wacker, R. Parwaresch, p100: a novel proliferation-associated nuclear protein specifically restricted to cell cycle phases S, G2, and M, Blood 90 (1997) 226e233. [4] O.J. Gruss, I. Vernos, The mechanism of spindle assembly: functions of Ran and its target TPX2, J. Cell Biol. 166 (2004) 949e955. [5] P.K. Hsu, H.Y. Chen, Y.C. Yeh, C.C. Yen, Y.C. Wu, C.P. Hsu, W.H. Hsu, T.Y. Chou, TPX2 expression is associated with cell proliferation and patient outcome in esophageal squamous cell carcinoma, J. Gastroenterol. 49 (2014) 1231e1240. [6] L. Yan, S. Li, C. Xu, X. Zhao, B. Hao, H. Li, B. Qiao, Target protein for Xklp2 (TPX2), a microtubule-related protein, contributes to malignant phenotype in bladder carcinoma, Tumour Biol 34 (2013) 4089e4100. [7] X. Yang, G. Liu, H. Xiao, F. Yu, X. Xiang, Y. Lu, W. Li, X. Liu, S. Li, Y. Shi, TPX2 overexpression in medullary thyroid carcinoma mediates TT cell proliferation, Pathol. Oncol. Res. 20 (2014) 641e648. [8] Y. Huang, W. Guo, H. Kan, TPX2 is a prognostic marker and contributes to growth and metastasis of human hepatocellular carcinoma, Int. J. Mol. Sci. 15 (2014) 18148e18161. [9] G.K. Smyth, Linear models and empirical bayes methods for assessing differential expression in microarray experiments, Stat. Appl. Genet. Mol. Biol. 3 (2004) Article3. [10] D. Szklarczyk, A. Franceschini, S. Wyder, K. Forslund, D. Heller, J. HuertaCepas, M. Simonovic, A. Roth, A. Santos, K.P. Tsafou, M. Kuhn, P. Bork, L.J. Jensen, C. von Mering, STRING v10: protein-protein interaction networks, integrated over the tree of life, Nucleic Acids Res. 43 (2015) D447eD452. [11] R. Lu, M. Sun, J. Feng, X. Gao, L. Guo, Myofibrillogenesis regulator 1 (MR-1) is a novel biomarker and potential therapeutic target for human ovarian cancer, BMC Canc. 11 (2011) 270. [12] H. Zhang, A. Zhong, J. Sun, M. Chen, S. Xie, H. Zheng, Y. Wang, Y. Yu, L. Guo, R. Lu, COPS5 inhibition arrests the proliferation and growth of serous ovarian cancer cells via the elevation of p27 level, Biochem. Biophys. Res. Commun. 493 (2017) 85e93. [13] T. Wittmann, M. Wilm, E. Karsenti, I. Vernos, TPX2, A novel xenopus MAP involved in spindle pole organization, J. Cell Biol. 149 (2000) 1405e1418. [14] P. Wei, N. Zhang, Y. Xu, X. Li, D. Shi, Y. Wang, D. Li, S. Cai, TPX2 is a novel prognostic marker for the growth and metastasis of colon cancer, J. Transl. Med. 11 (2013) 313. [15] P. Jiang, K. Shen, X. Wang, H. Song, Y. Yue, T. Liu, TPX2 regulates tumor growth in human cervical carcinoma cells, Mol. Med. Rep. 9 (2014) 2347e2351. [16] S.L. Warner, B.J. Stephens, S. Nwokenkwo, G. Hostetter, A. Sugeng, M. Hidalgo, J.M. Trent, H. Han, D.D. Von Hoff, Validation of TPX2 as a potential therapeutic target in pancreatic cancer cells, Clin. Canc. Res. 15 (2009) 6519e6528. [17] S.X. Yang, E. Polley, S. Lipkowitz, New insights on PI3K/AKT pathway alterations and clinical outcomes in breast cancer, Cancer Treat Rev. 45 (2016) 87e96. [18] T. Rabi, A. Huwiler, U. Zangemeister-Wittke, AMR-Me inhibits PI3K/Akt signaling in hormone-dependent MCF-7 breast cancer cells and inactivates NF-kappaB in hormone-independent MDA-MB-231 cells, Mol. Carcinog. 53 (2014) 578e588. [19] Q. Liu, P. Yang, K. Tu, H. Zhang, X. Zheng, Y. Yao, Q. Liu, TPX2 knockdown suppressed hepatocellular carcinoma cell invasion via inactivating AKT signaling and inhibiting MMP2 and MMP9 expression, Chin. J. Canc. Res. 26 (2014) 410e417. [20] D.P. Lane, Cancer. p53, guardian of the genome, Nature 358 (1992) 15e16. [21] Y. Yang, C.C. Li, A.M. Weissman, Regulating the p53 system through ubiquitination, Oncogene 23 (2004) 2096e2106. [22] G. Pascreau, F. Eckerdt, A.L. Lewellyn, C. Prigent, J.L. Maller, Phosphorylation of p53 is regulated by TPX2-Aurora A in xenopus oocytes, J. Biol. Chem. 284 (2009) 5497e5505.

Please cite this article as: M. Chen et al., Targeting TPX2 suppresses proliferation and promotes apoptosis via repression of the PI3k/AKT/P21 signaling pathway and activation of p53 pathway in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/ 10.1016/j.bbrc.2018.10.164