- Email: [email protected]
Targeting vectors for intracellular immunisation
Gene 187 (1997) 1–8
Targeting vectors for intracellular immunisation Lidija Persic a, Massimo Righi b, Andy Roberts c, Hennie R. Hoogenboom d, Antonino Cattaneo b, Andrew Bradbury a,b,* a Societa Italiana per la Ricerca Scientifica, Via G. Paisiello 47C, Roma 00198, Italy b Scuola Internazionale Superiore di Studi Avanzati (SISSA), Via Beirut 2/4, Trieste 34013, Italy c Cambridge Antibody Technology (CAT), The Science Park, Melbourn, SG6 8EH, UK d CAT and CESAME, present address CESAME at the Department of Pathology, University Hospital Maastricht, P.O. Box 5800, 6202 AZ Maastricht, The Netherlands Received 15 February 1996; revised 23 July 1996; accepted 25 July 1996; Received by J. Knowles
Abstract We define intracellular immunization as the inhibition or inactivation of the function of a molecule by the ectopic intracellular expression of antibody binding domains which recognise the molecule. Such recombinant antibodies can be directed to different compartments of eukaryotic cells by means of previously defined targeting signals, thus permiting the study of any molecule in any cellular compartment for which an antibody is available. For this purpose, we have created a set of vectors based on the VHExpress vector described [Persic, L., Roberts, A., Wilton, J., Cattaneo, A., Bradbury, A. and Hoogenboom, H.R. (1997) An integrated vector system for the eukaryotic expression of antibodies or their fragments after selection from phage display libraries. Gene 187, 000–000], which has been modified to express scFvs (single chain fragments) linked to specific targeting signals. These permit the localisation of scFvs to different intracellular compartments: the endoplasmic reticulum (scFvE-er), the nucleus (scFvEnuclear), the mitochondria (scFvE-mit), the cytoplasm (scFvE-cyto), and as secreted proteins (scFvE-sec). The function of these vectors has been assessed by the immunofluorescence of COS cells transiently transfected with constructs containing the aD11 scFv. Keywords: Intracellular immunization; Targeting signals; Antibodies
1. Introduction The concept of intracellular immunisation using the ectopic expression of antibody domains within different intracellular compartments has progressed from a model system (Biocca et al., 1990) to an experimental tool (reviewed in Biocca and Cattaneo (1995) and Richardson and Marasco (1995) which has been used to inhibit the function of proteins expressed in the cytoplasm (Biocca et al., 1993; Duan et al., 1994a,b; Werge et al., 1994; Maciejewski et al., 1995; Mhashilkar et al., 1995), the nucleus (Mhashilkar et al., 1995) and in the secretory pathway (Marasco et al., 1993; Beerli * Corresponding author. Tel +39 40 398995; Fax +39 40 398991; e-mail: [email protected] Abbreviations: ELISA, enzyme-linked immunosorbent assay; NGF, nerve growth factor; PBS, phosphate buffered saline; scFv, single-chain Fv; VH, immunoglobulin heavy chain variable region; VL, immunoglobulin light chain variable region; NLS, nuclear localization signal; ER, endoplasmic reticulum.
et al., 1994a; Deshane et al., 1994) of mammalian cells. Inhibition in the secretory pathway can be improved (Beerli et al., 1994b; Richardson et al., 1995) by the incorporation of the SEKDEL endoplasmic reticulum retention signal (Munro and Pelham, 1987). The use of intracellular immunisation has not been limited to mammalian cells: the activity of alcohol dehydrogenase has been inhibited in yeast (Carlson, 1988), that of p21ras has been inhibited in Xenopus oocytes (Biocca et al., 1993, 1994), and inhibition of viral infection has been shown for single chain Fvs (scFvs) expressed in plant cytoplasm ( Tavladoraki et al., 1993). Targeting in a model system has also been demonstrated for mitochondria (Biocca and Cattaneo, 1995; Biocca et al., 1995), and is potentially possible for a large number of other organelles (e.g. peroxisomes, lysosomes, nucleoli, trans golgi network) for which single or combination targeting signals have been identified. In general, the single chain Fv has been the form preferred for these experiments due to its smaller size. The problems with the use of this technique concern
0378-1119/97/$17.00 Copyright © 1997 Elsevier Science B.V. All rights reserved PII S 03 7 8 -1 1 1 9 ( 9 6 ) 0 0 6 27 - 0
2
L. Persic et al. / Gene 187 (1997) 1–8
Fig. 1. Map of scFvExpress-cyto. A map of the scFvExpress-cyto plasmid is given. This is the backbone plasmid from which the other scFv targeting plasmids are derived.
the relative difficulty in isolating antibody V region genes from hybridomas (Ruberti et al., 1994) and their subsequent cloning under control of an appropriate promoter with the signal necessary to direct the antibody to the desired cellular compartment. The first of these problems is likely to be overcome in the future by the isolation of antibody binding regions as scFvs or FAbs from large phage antibody libraries (McCafferty et al., 1990; Marks et al., 1991; Griffiths et al., 1994; Nissim et al., 1994), where the cloning of the antibody gene is simultaneous with the selection of the antibody with the desired binding activity. The second problem has been addressed here, by the modification of the already existing VHExpress vector from the integrated vector system (see Persic et al. (1997) in this issue) for the expression and targeting of scFvs to different compartments of the mammalian cells.
2. Experimental and discussion 2.1. Vector construction In the accompanying paper (Persic et al., this issue) we describe the construction of VHExpress, a vector
used to produce secretory immunoglobulin heavy chains from cloned IgH regions. We used this as the starting point for the creation of the scFvExpress vectors. The prototype of all these, scFvExpress-cyto (Fig. 1), has no targeting signal and expresses scFv with an N-terminal methionine. As a result it should be expresssed in the cytoplasm. This plasmid was constructed by the cloning of the pHEN1 expression cassette ( Hoogenboom et al., 1991) into the Nco1 and Xba1 sites of the heavy chain expression vector, VHExpress. In scFvExpress-cytoII, the EF BOS promoter is replaced by the weaker CMV (cytomegalovirus) promotor, using the EcoRI and PmlI sites of scFvExpress-cyto. All other targeting vectors are derivatives of the scFvExpress-cyto and were obtained by the insertion of a series of previously well characterised targeting signals ( Table 1) (Biocca et al., 1990, 1993, 1994, 1995; Biocca and Cattaneo, 1995) either N or C-terminal to the scFv by PCR or by cloning annealed oligonucleotides. These are all characterized by the same backbone plasmid and a series of expression cassettes (shown in Fig. 2) which should direct the synthesis of the scFv to different cellular compartments. In addition, all the expression cassettes encode a myc tag in frame with the scFv at the C terminus (in addition to any targeting signals),
Table 1 Origins of targeting signals Target
Origin
Reference
Secretory leader Nuclear localization sequence Mitochondrial signal Endoplasmatic reticulum retention signal
IgG1 pRLT3 coxVIII cDNA Chemically synthesized
Cattaneo and Neuberger, 1987 Fisher-Fantuzzi and Vesco, 1988 Rizzuto et al., 1992 Munro and Pelham, 1987
The origins and references of the targeting signals used in this work are given.
L. Persic et al. / Gene 187 (1997) 1–8
3
Fig. 2. scFvExpress polylinker sequences. The sequences of all the scFvExpress polylinkers are given. These have been inserted into the VHbackbone between the NcoI and XbaI sites. The scFvExpress-cyto and scFvExpress-nuclear polylinkers share the first 66 bp, indicated as scFvExpress intracellular framework. The scFvExpress-sec and scFvExpress-er polylinkers share the first 195 bp, indicated as scFvExpress secretory framework. Restrictions sites, targeting signals (including secretory leaders), and introns are indicated. Numbers refer to base pairs from the beginning of the scFvExpress expression cassette, which includes the EF-a-BOSS promoter. Methods: All cloning steps were performed by standard genetic engineering methods (Sambrook et al., 1989). DH5aF ∞ (Life Technologies) was the bacterial strain used for transformations. Restriction and modification enzymes were from Promega or New England Biolabs. PCR was carried out using AmpliTaq (Perkin-Elmer) or Vent (New England Biolabs).
4
L. Persic et al. / Gene 187 (1997) 1–8
Fig. 3. Confocal images of targeting of scFv to different cellular compartments. Immunofluorescence of COS cells transiently transfected with different scFvExpress vectors. The patterns of expression shown are typical for the compartment targeted. (a) scFvExpress-nuclear (nuclear); (b) scFvExpress-mit (mitochondrial ); (c) scFvExpress-sec (secretory); (d ) scFvExpress-er (endoplasmatic reticulum); Methods: Transient transfections were performed in simian COS cells by the DEAE-dextran method (Pelham, 1984). Cells were grown on glass coverslips coated with poly--lysine. Immunofluorescence analysis was usually performed 48 h after transfection. The cells were fixed with 3.7% paraformaldehyde in PBS and permeabilized with 0.1 M Tris-HCl (pH 7.4) and 0.2% TritonX-100. After blocking in 3% BSA or 2.5% skimmed milk, the cells were incubated for 2 h at room temperature with the appropriate dilution of fluorescein-conjugated antibody. For scFv detection, the monoclonal antibody 9E10 ( Evan et al., 1985) was used.
allowing their detection in immunofluorescence and in Western blots using the mAb 9E10 ( Evan et al., 1985). Confirmation of the expected pattern of expression for all plasmids was tested by cloning the scFv form of the murine aD11 hybridoma which recognises nerve growth factor (NGF ) into each of the vectors. 2.2. scFv targeting to different cellular compartments It has been previously shown that scFv’s can be efficiently folded and secreted in COS cells (Jost et al., 1994), although other studies (Marasco et al., 1993; Richardson et al., 1995) have failed to demonstrate secretion. The level of scFv secretion is variable, this variability appearing to depend upon the amino acid sequence of the V regions and the level of glycosylation of the scFv (Jost et al., 1994). The aD11 scFv expressed and secreted in COS cell transient transfections as well as in C6 stable transfections using these vectors is detectable as protein of
the expected length and is active in recognizing NGF in ELISA (Biocca et al., 1995 and data not shown). Targeting of this scFv to different cellular compartments was carried out in COS cells transiently transfected with the different vectors. The results are shown in Fig. 3. In each case the scFv is detected by the 9E10 antibody which recognises the myc tag ( Evan et al., 1985) placed at the C terminus of the scFv. The plasmids all show the expected pattern of distribution conferred by the targeting signals used (Biocca et al., 1990, 1995). Contrary to previous reports, where the nuclear localisation signal (NLS ) was at the N terminus (Biocca et al., 1990; Biocca and Cattaneo, 1995), in the present format the NLS is found at the C-terminal of the scFv, so facing away from the antigen binding site and reducing potential problems of steric hindrance. Fig. 3a shows the nuclear distribution obtained with the scFvExpress-nuc plasmid. Fig. 3b shows a characteristic mitochondrial distribution (scFvExpress-mit), and the patterns of expression with secretory and ER retained
L. Persic et al. / Gene 187 (1997) 1–8
plasmids, scFvExpress-sec and scFvExpress-ER, are shown in Fig. 3c and d. The retention within the ER shown by Fig. 3d has been previously shown in ELISA experiments using this plasmid, which demonstrated that 24 and 48 h after transient transfection in COS cells, scFv produced by the secretory plasmid was found predominantly in the supernatant, whereas that produced by the ER plasmid was predominantly retained within the cell (Biocca et al., 1995). The pattern obtained with scFvExpress-cyto (Fig. 4) is more complex, with a number of different distributions obtained. Some cells show a typically cytoplasmic diffuse distribution (Fig. 4a and b), while others show a previously observed (Biocca et al., 1990) puntiform distribution, which may or may not be superimposed upon a diffuse background (Fig. 4c). In some cases ‘donut-like’ aggregates are seen (Fig. 4d). In general, the results suggest that the greater the accumulation of intracellular scFv, the more likely that distribution will change from a diffuse to a puntiform and then a ‘donut-like’ pattern. This is best illustrated in Fig. 4b, c and d which represent typical examples of cells found during a time course of 24, 48 and 72 h post transfection using the EF-1a promoter and in Fig. 4a where the EF-1a promoter has been switched for the weaker CMV promoter in the same
5
vector background. In consequence we suggest that the weaker CMV promoter is used for cytoplasmic expression. Similar donut like aggregates superimposed upon the reticular secretory pattern are seen in occasional cells transfected with the secretory and ER retained plasmids (data not shown). We feel these probably represent cases in which components of the secretory apparatus have been overwhelmed and scFv has precipitated either in the ER after, or in the cytoplasm prior to, removal of the signal sequence. In addition to the data presented here, these plasmids have been used to create stable cell lines secreting functional aD11 scFv in C6 glioma cell lines (data not shown) and the scFvE-cyto and scFvE-ER plasmids have been used to make stable cell clones in a T cell line, CEM, with expression patterns similar to those described above, again indicating that cytoplasmic expression is consistent with long term cellular survival and proliferation (S. Biocca, personal communication).
2.3. Cloning of V regions Given the different possible sources of scFvs which may be expressed with these vectors, it is difficult to
Fig. 4. Immunofluorescence of cytoplasmic targeting. (a) scFvExpress-cytoII (diffuse cytoplasmic); (b) scFvExpress-cyto, 24 h after transfection (diffuse cytoplasmic); (c) scFvExpress-cyto, 48 h after transfection (puntiform cytoplasmic); (d ) scFvExpress-cyto, 72 h after transfection (donut cytoplasmic). Methods: See Fig. 3.
6
L. Persic et al. / Gene 187 (1997) 1–8
Table 2 Restriction sites for V and scFv cloning Vector
5∞ Restriction site
Sequence of oligo used for amplication
3∞ Restriction site
Sequence of oligo used for amplification*
scFvExpress-cyto
NcoI (at the start of the scFv coding region)
CTGTGGCCATGGCC – start of scFv (ATG=start met)
XhoI (within 3∞ end of VL coding region)
^XhoI must start 12 bp before the end of VL with GAG=glu
scFvExpress-nuc
^PstI/Sse83871 (within the 5∞ end of the scFv coding region) BssHII (upstream of 5∞ end of scFv) ^PstI/Sse83871 (within the 5∞ end of the scFv coding region) BssHII (upstream of 5∞ end of scFv) ^PstI/Sse83871 (within the 5∞ end of the scFv coding region)
#PstI/Sse83871 must start on bp 10/9 if VH (of scFv), with CTG=leu TATCCGCGCGCACTCC – start of scFv #PstI/Sse83871 must start on bp 10/9 of VH (of scFv), with CTG=leu TATCCGCGCGCCAAGATCCATTCGTTG – start of scFv #PstI/Sse83871 must start on bp 10/9 of VH (of scFv), with CTG=leu
^EagI/NotI (external to 3∞ end scFv)
End of scFv-CGGGCGGCCGCAGAACAAAAC
scFvExpress-sec scFvExpress-er scFvExpress-mito
The restriction sites to be used for cloning different V region forms into the scFvExpress vectors are indicated, as well as guidelines for the sequence of oligonucleotides to be used for PCR. The oligo sequences which should be used will include a sequence defined by the user (e.g., ‘end of scFv’) and a sequence which is common to all (e.g., CGGGCGGCCGCAGAACAAAAC ). The user-defined sequence should have at least eighteen bases homology to the sequence to be amplified. The start and end of V regions indicate the first or last complete codon of that region, as defined in Kabat et al. (1991). Although PstI is found in many V regions, it is usually found at the 5∞ end corresponding to the exact position of the site used in the vector. The use of Sse8387I which is an octanucleotide cutter (CCTGCA/GG) compatible with PstI (and leaving the PstI site intact) is recommended as it is absent from VH regions and occurs infrequently in VL regions. The BssHII site in the scFvExpress-mito is in a different position (and with a different frame) with respect to the BssHII used in the other scFv vectors. This is because insufficient work has been carried out on the mitochondrial targeting signal to know which modifications can be incorporated without affecting the ability to target to mitochondria. ^The recognition sequence for PstI (CTGCA/G) is found within the recognition sequence, and is compatible with, that of the octanucleotide cutter Sse8387I (CCTGCA/GG). The recognition sequence for EagI (C/GGCCG) is found within the recognition sequence, and is compatible with, that of the octanucleotide cutter NotI (GC/GGCCGC ). # Indicates that the full sequence of the oligos used with the internal restriction sites cannot be given as the restriction site sequence (e.g., PstI CTGCA/G) will be embedded within a user-defined sequence (e.g., the 5∞ end of the VH which is to be cloned). *The sequences given here are sense and must be reversed and complemented after the complete sense oligonucleotide has been determined. – indicates the boundary between the part of the oligo which is user-defined and the part which is common to all.
indicate a universal cloning strategy. However, each plasmid has been designed to include at least two restriction sites at either end ( Fig. 2 and Table 2). For each set of cloning sites given, the outer pair can be added without modifying the V region sequence, while the inner pair involves the incorporation of amino acids which may not be present in the original V region sequence, but which in most cases will not alter the binding characteristics of the scFv. Although PstI is found in many V regions, it is usually found at the 5∞ end corresponding to the exact position of the site used in the vector (see Persic et al., this issue). The use of Sse8387I which is an octanucleotide cutter (CCTGCA/GG) compatible with PstI (and leaving the PstI site intact) is recommended as it is absent from VH regions and occurs relatively infrequently in VL regions. Guidelines are given in Table 2 as to the sequences of oligonucleotides which should be used to amplify scFvs. These sequences are given in two parts: a user defined part which will depend on the sequence of the V regions contained in the scFv (which in turn will depend upon the species from which the scFv is derived and the order of the VH and VL chains in the scFv) and which should contain at least fifteen bases of homology to the sequence to be amplified.
Where scFvs are derived from phage antibody libraries following selection on antigen, it is relatively trivial to either clone these directly from compatible vectors (e.g. pHEN; Hoogenboom et al., 1991) into the appropriate plasmid (using the sites indicated in Table 2), or to amplify the cloned scFv incorporating compatible sites ( Table 2) at either end of the scFv. To express scFvs from isolated V regions (either derived from hybridomas by V region PCR (Orlandi et al., 1989), RACE (Frohman et al., 1988; Ruberti et al., 1994) or by oligoligation PCR ( Edwards et al. (1991) or from FAb phage libraries Griffiths et al. (1994) we recommend that the V regions are assembled into scFv by PCR assembly (Clackson et al., 1991), and cloned either directly into the appropriate scFv vector or into a phage(mid) display vector. In the latter strategy, selection for appropriate binding activity can be assayed prior to cloning into these vectors as described above. We have chosen the VH-linker-VL order for our scFv format, and the restriction sites used are particularly appropriate for this order of VH and VL genes. However, scFvs with the VL-linker-VH format can also be cloned using the outer restriction sites ( Table 2 and Fig. 2).
L. Persic et al. / Gene 187 (1997) 1–8
3. Conclusion In this paper we have described a series of modular vectors capable of directing scFvs to a number of different cellular compartments specified by the targeting signal present on the plasmid. Previous studies (see above) have demonstrated that such ectopically expressed antibodies are functional and able to inhibit cellular functions, suggesting that intracellular immunisation is likely to be a useful tool in cell biology where antibodies to proteins or other molecules in identified compartments are available. Targeting to all compartments produced the immunofluorescence pattern expected. Under certain conditions, however, scFvExpress-cyto can give a pattern of expression which we term a ‘donut-like’ pattern (Fig. 4c and d). This aggregated pattern of expression is almost certainly a consequence of overexpression, since it can be avoided by using a weaker promoter, such as CMV (Fig. 4a), or by not letting cells accumulate too much cytoplasmic scFv (by examining them at 24 h after transfection, Fig. 4b). This problem is likely to be aggravated in COS cells where the combination of a powerful promoter such as EF-1a, and the high plasmid amplification levels (obtained as a result of the action of the T antigen found in COS cells on the SV40 origin of replication) result in extremely high expression levels which may overwhelm the ability of the cell to fold the ectopically expressed scFv. It is not a problem in stable cell lines (Biocca, personal communication), where plasmid amplification does not occur. In addition, we expect that different scFvs will probably have different tendencies to precipitate within the cytoplasm, as has been previously shown for expression of scFv in bacteria (Ge et al., 1995). The quantity of antibody required to inhibit the function of an intracellular protein will depend upon the affinity of the antibody and the intracellular concentration of the antigen. We have used the strong EF-1a promoter in these vectors. In cases where an antigen is present in low concentrations and the affinity of the antibody is high, the use of a weaker promoter may be more appropriate. The use of inducible promoters, such as those described in Gossen and Bujard (1992), would resolve the need to exchange promoters if they can be adapted for use in this vector. The modular design of these vectors would permit the easy exchange of this or any other individual component with relative ease.
References Beerli, R.R., Wels, W. and Hynes, N.E. (1994a) Autocrine inhibition of the epidermal growth factor receptor by intracellular expression of a single-chain antibody. Biochem. Biophys. Res. Commun. 204, 666–672.
7
Beerli, R.R., Wels, W. and Hynes, N.E. (1994b) Intracellular expression of single chain antibodies reverts ErbB-2 transformation. J. Biol. Chem. 269, 23931–23936. Biocca, S. and Cattaneo, A. (1995) Intracellular immunization: antibody targeting to subcellular compartments. Trends Cell Biol. 5, 248–252. Biocca, S., Neuberger, M.S. and Cattaneo, A. (1990) Expression and targeting of intracellular antibodies in mammalian cells. EMBO J. 9, 101–108. Biocca, S., Pierandrei-Amaldi, P. and Cattaneo, A. (1993) Intracellular expression of anti-p21ras single chain Fv fragments inhibits meiotic maturation of Xenopus oocytes. Biochem. Biophys. Res. Commun. 197, 422–427. Biocca, S., Pierandrei-Amaldi, P., Campioni, N. and Cattaneo, A. (1994) Intracellular immunisation with cytosolic recombinant antibodies. Bio/Tech 12, 396–400. Biocca, S., Ruberti, F., Tafani, M., Pierandrei-Amaldi, P. and Cattaneo, A. (1995) Redox state of single chain Fv fragments targeted to the endoplasmic reticulum, cytosol and mitochondria. Bio/Tech 13, 1110–1115. Carlson, J.R. (1988) A new means of inducibly inactivating a cellular protein. Mol. Cell. Biol. 8, 2638–2646. Cattaneo, A. and Neuberger, M.S. (1987) Polymeric immunoglobulin M is secreted by transfectants of non-lymphoid cells in the absence of immunoglobulin J chain. EMBO J. 6, 2753–2758. Clackson, T., Hoogenboom, H.R., Griffiths, A.D. and Winter, G. (1991) Making antibody fragments using phage display libraries. Nature 352, 624–628. Deshane, J., Loechel, F., Conry, R.M., Siegal, G.P., King, C.R. and Curiel, D.T. (1994) Intracellular single-chain antibody directed against erbB2 down-regulates cell surface erbB2 and exhibits a selective anti-proliferative effect in erbB2 overexpressing cancer cell lines. Gene Ther. 1, 332–337. Duan, L., Bagasra, O., Laughlin, M.A., Oakes, J.W. and Pomerantz, R.J. (1994a) Potent inhibition of human immunodeficiency virus type 1 replication by an intracellular anti-Rev single-chain antibody. Proc. Natl. Acad. Sci. USA 91, 5075–5079. Duan, L., Zhang, H., Oakes, J.W., Bagasra, O. and Pomerantz, R.J. (1994b) Molecular and virological effects of intracellular anti-Rev single-chain variable fragments on the expression of various human immunodeficiency virus-1 strains. Human Gene Ther. 5, 1315–1324. Edwards, J.B., Delort, J. and Mallet, J. (1991) Oligodeoxyribonucleotide ligation to single stranded cDNAs: a new tool for cloning 5∞ ends of mRNAs and for constructing cDNA libraries by in vitro amplification. Nucleic Acids Res. 19, 5227–5232. Evan, G.I., Lewis, G.K., Ramsay, G. and Bishop, J.M. (1985) Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol. Cell Biol. 5, 3610–3616. Fisher-Fantuzzi, L. and Vesco, C. (1988) Cell-dependent efficiency of reiterated nuclear signals in a mutant simian virus 40 oneoprotein targeted to the nucleus. Mol. Cell. Biol. 8, 5495–5503. Frohman, M.A., Dush, M.K. and Martin, G. (1988) Rapid production of full length cDNAs from rare transcripts: Amplification using a single gene-specific oligonucletide primer. Proc. Natl. Acad. Sci. USA 85, 8998–9002. Ge, L., Knappik, A., Pack, P., Freund, C. and Plu¨ckthun, A. (1995) Expressing antibodies in Escherichia coli. In: Borrebaeck, C.A.K. ( Ed.), Antibody Engineering. Oxford University Press, New York, Oxford, pp. 229–266. Gossen, M. and Bujard, H. (1992) Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89, 5547–5551. Griffiths, A.D., Williams, S.C., Hartley, O., Tomlinson, I.M., Waterhouse, P., Crosby, W.L., Kontermann, R.E., Jones, P.T., Low, N.M., Alison, T.J., Prospero, T.D., Hoogenboom, H.R., Nissim, A., Cox, J.P.L., Harrison, J.L., Zaccolo, M., Gherardi, E. and
8
L. Persic et al. / Gene 187 (1997) 1–8
Winter, G. (1994) Isolation of high affinity human antibodies directly from large synthetic repertoires. EMBO J. 13, 3245–3260. Hoogenboom, H.R., Griffiths, A.D., Johnson, K.S., Chiswell, D.J., Hudson, P. and Winter, G. (1991) Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody ( Fab) heavy and light chains. Nucleic Acids Res. 19, 4133–4137. Jost, C.R., Kurucz, I., Jacobus, C.M., Titus, J.A., George, A.J. and Segal, D.M. (1994) Mammalian expression and secretion of functional single-chain Fv molecules. J. Biol. Chem. 269, 26267–26273. Kabat, E.A., Wu, T.T., Perry, H.M., Gottesman, K.S. and Foeller, C. (1991) Sequences of Proteins of Immunological Interest, 5 edition U.S. Department of Health and Human Services, U.S. Government Printing Office, Washington, DC. Maciejewski, J., Weichold, F., Young, N., Cara, A., Zella, D., Reitz Jr., M. and Gallo, R. (1995) Intracellular expression of antibody fragments directed against HIV reverse transcriptase prevents HIV infection in vitro. Nature Med. 1, 667–673. Marasco, W.A., Haseltine, W.A. and Chen, S.Y. (1993) Design, intracellular expression, and activity of a human anti-human immunodeficiency virus type 1 gp120 single-chain antibody Marks, J.D., Hoogenboom, H.R., Bonnert, T.P., McCafferty, J., Griffiths, A.D. and Winter, G. (1991) By-passing immunization-human antibodies from V-gene libraries displayed on phage. J. Mol. Biol. 222, 581–597. McCafferty, J., Griffiths, A.D., Winter, G. and Chiswell, D.J. (1990) Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348, 552–554. Mhashilkar, A.M., Bagley, J., Chen, S.Y., Szilvay, A.M., Helland, D.G. and Marasco, W.A. (1995) Inhibition of HIV-1 Tat-mediated LTR transactivation and HIV-1 infection by anti-Tat single chain intrabodies. EMBO J. 14, 1542–1551. Munro, S. and Pelham, H.R.B. (1987) A C-terminal signal prevents secretion of luminal ER proteins. Cell 48, 899–907. Nissim, A., Hoogenboom, H.R., Tomlinson, I.M., Flynn, G., Midgley, C., Lane, D. and Winter, G. (1994) Antibody fragments from a
‘single pot’ phage display library as immunochemical reagents. EMBO J. 13, 692–698. Orlandi, R., Gussow, D.H., Jones, P.T. and Winter, G. (1989) Cloning immunoglobulin variable domains for expression by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86, 3833–3837. Pelham, H.R.B. (1984) Hsp70 accelerates the recovery of nucleolar morphology after heat shock. EMBO J. 3, 3095–3100. Persic, L., Roberts, A., Wilton, J., Cattaneo, A., Bradbury, A. and Hoogenboom, H.R. (1997) An integrated vector system for the eukaryotic expression of antibodies or their fragments after selection from phage display libraries. Gene 187, 000–000. Richardson, J.H. and Marasco, W.A. (1995) Intracellular antibodies: development and therapeutic potential. TIBTECH 13, 306–310. Richardson, J.H., Sodroski, J.G., Waldmann, T.A. and Marasco, W.A. (1995) Phenotypic knockout of the high-affinity human interleukin 2 receptor by intracellular single-chain antibodies against the alpha subunit of the receptor. Proc. Natl. Acad. Sci. USA 92, 3137–3141. Rizzuto, R., Simpson, A.W.M., Brini, M. and Pozzan, T. (1992) Rapid changes of mitochondrial Ca++ revealed by specifically targeted recombinant aequorin. Nature 358, 325–327. Ruberti, F., Cattaneo, A. and Bradbury, A. (1994) The use of the RACE method to clone hybridoma cDNA when V region primers fail. J. Immunol. Methods 173, 33–39. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A. and Galeffi, P. (1993) Transgenic plants expressing a functional single chain Fv antibody are specifically protected from virus attack. Nature 366, 469–472. Werge, T.M., Baldari, C.T. and Telford, J.L. (1994) Intracellular single chain Fv antibody inhibits Ras activity in T-cell antigen receptor stimulated Jurkat cells. FEBS Lett. 3517. 393–396.
Targeting vectors for intracellular immunisation Lidija Persic a, Massimo Righi b, Andy Roberts c, Hennie R. Hoogenboom d, Antonino Cattaneo b, Andrew Bradbury a,b,* a Societa Italiana per la Ricerca Scientifica, Via G. Paisiello 47C, Roma 00198, Italy b Scuola Internazionale Superiore di Studi Avanzati (SISSA), Via Beirut 2/4, Trieste 34013, Italy c Cambridge Antibody Technology (CAT), The Science Park, Melbourn, SG6 8EH, UK d CAT and CESAME, present address CESAME at the Department of Pathology, University Hospital Maastricht, P.O. Box 5800, 6202 AZ Maastricht, The Netherlands Received 15 February 1996; revised 23 July 1996; accepted 25 July 1996; Received by J. Knowles
Abstract We define intracellular immunization as the inhibition or inactivation of the function of a molecule by the ectopic intracellular expression of antibody binding domains which recognise the molecule. Such recombinant antibodies can be directed to different compartments of eukaryotic cells by means of previously defined targeting signals, thus permiting the study of any molecule in any cellular compartment for which an antibody is available. For this purpose, we have created a set of vectors based on the VHExpress vector described [Persic, L., Roberts, A., Wilton, J., Cattaneo, A., Bradbury, A. and Hoogenboom, H.R. (1997) An integrated vector system for the eukaryotic expression of antibodies or their fragments after selection from phage display libraries. Gene 187, 000–000], which has been modified to express scFvs (single chain fragments) linked to specific targeting signals. These permit the localisation of scFvs to different intracellular compartments: the endoplasmic reticulum (scFvE-er), the nucleus (scFvEnuclear), the mitochondria (scFvE-mit), the cytoplasm (scFvE-cyto), and as secreted proteins (scFvE-sec). The function of these vectors has been assessed by the immunofluorescence of COS cells transiently transfected with constructs containing the aD11 scFv. Keywords: Intracellular immunization; Targeting signals; Antibodies
1. Introduction The concept of intracellular immunisation using the ectopic expression of antibody domains within different intracellular compartments has progressed from a model system (Biocca et al., 1990) to an experimental tool (reviewed in Biocca and Cattaneo (1995) and Richardson and Marasco (1995) which has been used to inhibit the function of proteins expressed in the cytoplasm (Biocca et al., 1993; Duan et al., 1994a,b; Werge et al., 1994; Maciejewski et al., 1995; Mhashilkar et al., 1995), the nucleus (Mhashilkar et al., 1995) and in the secretory pathway (Marasco et al., 1993; Beerli * Corresponding author. Tel +39 40 398995; Fax +39 40 398991; e-mail: [email protected] Abbreviations: ELISA, enzyme-linked immunosorbent assay; NGF, nerve growth factor; PBS, phosphate buffered saline; scFv, single-chain Fv; VH, immunoglobulin heavy chain variable region; VL, immunoglobulin light chain variable region; NLS, nuclear localization signal; ER, endoplasmic reticulum.
et al., 1994a; Deshane et al., 1994) of mammalian cells. Inhibition in the secretory pathway can be improved (Beerli et al., 1994b; Richardson et al., 1995) by the incorporation of the SEKDEL endoplasmic reticulum retention signal (Munro and Pelham, 1987). The use of intracellular immunisation has not been limited to mammalian cells: the activity of alcohol dehydrogenase has been inhibited in yeast (Carlson, 1988), that of p21ras has been inhibited in Xenopus oocytes (Biocca et al., 1993, 1994), and inhibition of viral infection has been shown for single chain Fvs (scFvs) expressed in plant cytoplasm ( Tavladoraki et al., 1993). Targeting in a model system has also been demonstrated for mitochondria (Biocca and Cattaneo, 1995; Biocca et al., 1995), and is potentially possible for a large number of other organelles (e.g. peroxisomes, lysosomes, nucleoli, trans golgi network) for which single or combination targeting signals have been identified. In general, the single chain Fv has been the form preferred for these experiments due to its smaller size. The problems with the use of this technique concern
0378-1119/97/$17.00 Copyright © 1997 Elsevier Science B.V. All rights reserved PII S 03 7 8 -1 1 1 9 ( 9 6 ) 0 0 6 27 - 0
2
L. Persic et al. / Gene 187 (1997) 1–8
Fig. 1. Map of scFvExpress-cyto. A map of the scFvExpress-cyto plasmid is given. This is the backbone plasmid from which the other scFv targeting plasmids are derived.
the relative difficulty in isolating antibody V region genes from hybridomas (Ruberti et al., 1994) and their subsequent cloning under control of an appropriate promoter with the signal necessary to direct the antibody to the desired cellular compartment. The first of these problems is likely to be overcome in the future by the isolation of antibody binding regions as scFvs or FAbs from large phage antibody libraries (McCafferty et al., 1990; Marks et al., 1991; Griffiths et al., 1994; Nissim et al., 1994), where the cloning of the antibody gene is simultaneous with the selection of the antibody with the desired binding activity. The second problem has been addressed here, by the modification of the already existing VHExpress vector from the integrated vector system (see Persic et al. (1997) in this issue) for the expression and targeting of scFvs to different compartments of the mammalian cells.
2. Experimental and discussion 2.1. Vector construction In the accompanying paper (Persic et al., this issue) we describe the construction of VHExpress, a vector
used to produce secretory immunoglobulin heavy chains from cloned IgH regions. We used this as the starting point for the creation of the scFvExpress vectors. The prototype of all these, scFvExpress-cyto (Fig. 1), has no targeting signal and expresses scFv with an N-terminal methionine. As a result it should be expresssed in the cytoplasm. This plasmid was constructed by the cloning of the pHEN1 expression cassette ( Hoogenboom et al., 1991) into the Nco1 and Xba1 sites of the heavy chain expression vector, VHExpress. In scFvExpress-cytoII, the EF BOS promoter is replaced by the weaker CMV (cytomegalovirus) promotor, using the EcoRI and PmlI sites of scFvExpress-cyto. All other targeting vectors are derivatives of the scFvExpress-cyto and were obtained by the insertion of a series of previously well characterised targeting signals ( Table 1) (Biocca et al., 1990, 1993, 1994, 1995; Biocca and Cattaneo, 1995) either N or C-terminal to the scFv by PCR or by cloning annealed oligonucleotides. These are all characterized by the same backbone plasmid and a series of expression cassettes (shown in Fig. 2) which should direct the synthesis of the scFv to different cellular compartments. In addition, all the expression cassettes encode a myc tag in frame with the scFv at the C terminus (in addition to any targeting signals),
Table 1 Origins of targeting signals Target
Origin
Reference
Secretory leader Nuclear localization sequence Mitochondrial signal Endoplasmatic reticulum retention signal
IgG1 pRLT3 coxVIII cDNA Chemically synthesized
Cattaneo and Neuberger, 1987 Fisher-Fantuzzi and Vesco, 1988 Rizzuto et al., 1992 Munro and Pelham, 1987
The origins and references of the targeting signals used in this work are given.
L. Persic et al. / Gene 187 (1997) 1–8
3
Fig. 2. scFvExpress polylinker sequences. The sequences of all the scFvExpress polylinkers are given. These have been inserted into the VHbackbone between the NcoI and XbaI sites. The scFvExpress-cyto and scFvExpress-nuclear polylinkers share the first 66 bp, indicated as scFvExpress intracellular framework. The scFvExpress-sec and scFvExpress-er polylinkers share the first 195 bp, indicated as scFvExpress secretory framework. Restrictions sites, targeting signals (including secretory leaders), and introns are indicated. Numbers refer to base pairs from the beginning of the scFvExpress expression cassette, which includes the EF-a-BOSS promoter. Methods: All cloning steps were performed by standard genetic engineering methods (Sambrook et al., 1989). DH5aF ∞ (Life Technologies) was the bacterial strain used for transformations. Restriction and modification enzymes were from Promega or New England Biolabs. PCR was carried out using AmpliTaq (Perkin-Elmer) or Vent (New England Biolabs).
4
L. Persic et al. / Gene 187 (1997) 1–8
Fig. 3. Confocal images of targeting of scFv to different cellular compartments. Immunofluorescence of COS cells transiently transfected with different scFvExpress vectors. The patterns of expression shown are typical for the compartment targeted. (a) scFvExpress-nuclear (nuclear); (b) scFvExpress-mit (mitochondrial ); (c) scFvExpress-sec (secretory); (d ) scFvExpress-er (endoplasmatic reticulum); Methods: Transient transfections were performed in simian COS cells by the DEAE-dextran method (Pelham, 1984). Cells were grown on glass coverslips coated with poly--lysine. Immunofluorescence analysis was usually performed 48 h after transfection. The cells were fixed with 3.7% paraformaldehyde in PBS and permeabilized with 0.1 M Tris-HCl (pH 7.4) and 0.2% TritonX-100. After blocking in 3% BSA or 2.5% skimmed milk, the cells were incubated for 2 h at room temperature with the appropriate dilution of fluorescein-conjugated antibody. For scFv detection, the monoclonal antibody 9E10 ( Evan et al., 1985) was used.
allowing their detection in immunofluorescence and in Western blots using the mAb 9E10 ( Evan et al., 1985). Confirmation of the expected pattern of expression for all plasmids was tested by cloning the scFv form of the murine aD11 hybridoma which recognises nerve growth factor (NGF ) into each of the vectors. 2.2. scFv targeting to different cellular compartments It has been previously shown that scFv’s can be efficiently folded and secreted in COS cells (Jost et al., 1994), although other studies (Marasco et al., 1993; Richardson et al., 1995) have failed to demonstrate secretion. The level of scFv secretion is variable, this variability appearing to depend upon the amino acid sequence of the V regions and the level of glycosylation of the scFv (Jost et al., 1994). The aD11 scFv expressed and secreted in COS cell transient transfections as well as in C6 stable transfections using these vectors is detectable as protein of
the expected length and is active in recognizing NGF in ELISA (Biocca et al., 1995 and data not shown). Targeting of this scFv to different cellular compartments was carried out in COS cells transiently transfected with the different vectors. The results are shown in Fig. 3. In each case the scFv is detected by the 9E10 antibody which recognises the myc tag ( Evan et al., 1985) placed at the C terminus of the scFv. The plasmids all show the expected pattern of distribution conferred by the targeting signals used (Biocca et al., 1990, 1995). Contrary to previous reports, where the nuclear localisation signal (NLS ) was at the N terminus (Biocca et al., 1990; Biocca and Cattaneo, 1995), in the present format the NLS is found at the C-terminal of the scFv, so facing away from the antigen binding site and reducing potential problems of steric hindrance. Fig. 3a shows the nuclear distribution obtained with the scFvExpress-nuc plasmid. Fig. 3b shows a characteristic mitochondrial distribution (scFvExpress-mit), and the patterns of expression with secretory and ER retained
L. Persic et al. / Gene 187 (1997) 1–8
plasmids, scFvExpress-sec and scFvExpress-ER, are shown in Fig. 3c and d. The retention within the ER shown by Fig. 3d has been previously shown in ELISA experiments using this plasmid, which demonstrated that 24 and 48 h after transient transfection in COS cells, scFv produced by the secretory plasmid was found predominantly in the supernatant, whereas that produced by the ER plasmid was predominantly retained within the cell (Biocca et al., 1995). The pattern obtained with scFvExpress-cyto (Fig. 4) is more complex, with a number of different distributions obtained. Some cells show a typically cytoplasmic diffuse distribution (Fig. 4a and b), while others show a previously observed (Biocca et al., 1990) puntiform distribution, which may or may not be superimposed upon a diffuse background (Fig. 4c). In some cases ‘donut-like’ aggregates are seen (Fig. 4d). In general, the results suggest that the greater the accumulation of intracellular scFv, the more likely that distribution will change from a diffuse to a puntiform and then a ‘donut-like’ pattern. This is best illustrated in Fig. 4b, c and d which represent typical examples of cells found during a time course of 24, 48 and 72 h post transfection using the EF-1a promoter and in Fig. 4a where the EF-1a promoter has been switched for the weaker CMV promoter in the same
5
vector background. In consequence we suggest that the weaker CMV promoter is used for cytoplasmic expression. Similar donut like aggregates superimposed upon the reticular secretory pattern are seen in occasional cells transfected with the secretory and ER retained plasmids (data not shown). We feel these probably represent cases in which components of the secretory apparatus have been overwhelmed and scFv has precipitated either in the ER after, or in the cytoplasm prior to, removal of the signal sequence. In addition to the data presented here, these plasmids have been used to create stable cell lines secreting functional aD11 scFv in C6 glioma cell lines (data not shown) and the scFvE-cyto and scFvE-ER plasmids have been used to make stable cell clones in a T cell line, CEM, with expression patterns similar to those described above, again indicating that cytoplasmic expression is consistent with long term cellular survival and proliferation (S. Biocca, personal communication).
2.3. Cloning of V regions Given the different possible sources of scFvs which may be expressed with these vectors, it is difficult to
Fig. 4. Immunofluorescence of cytoplasmic targeting. (a) scFvExpress-cytoII (diffuse cytoplasmic); (b) scFvExpress-cyto, 24 h after transfection (diffuse cytoplasmic); (c) scFvExpress-cyto, 48 h after transfection (puntiform cytoplasmic); (d ) scFvExpress-cyto, 72 h after transfection (donut cytoplasmic). Methods: See Fig. 3.
6
L. Persic et al. / Gene 187 (1997) 1–8
Table 2 Restriction sites for V and scFv cloning Vector
5∞ Restriction site
Sequence of oligo used for amplication
3∞ Restriction site
Sequence of oligo used for amplification*
scFvExpress-cyto
NcoI (at the start of the scFv coding region)
CTGTGGCCATGGCC – start of scFv (ATG=start met)
XhoI (within 3∞ end of VL coding region)
^XhoI must start 12 bp before the end of VL with GAG=glu
scFvExpress-nuc
^PstI/Sse83871 (within the 5∞ end of the scFv coding region) BssHII (upstream of 5∞ end of scFv) ^PstI/Sse83871 (within the 5∞ end of the scFv coding region) BssHII (upstream of 5∞ end of scFv) ^PstI/Sse83871 (within the 5∞ end of the scFv coding region)
#PstI/Sse83871 must start on bp 10/9 if VH (of scFv), with CTG=leu TATCCGCGCGCACTCC – start of scFv #PstI/Sse83871 must start on bp 10/9 of VH (of scFv), with CTG=leu TATCCGCGCGCCAAGATCCATTCGTTG – start of scFv #PstI/Sse83871 must start on bp 10/9 of VH (of scFv), with CTG=leu
^EagI/NotI (external to 3∞ end scFv)
End of scFv-CGGGCGGCCGCAGAACAAAAC
scFvExpress-sec scFvExpress-er scFvExpress-mito
The restriction sites to be used for cloning different V region forms into the scFvExpress vectors are indicated, as well as guidelines for the sequence of oligonucleotides to be used for PCR. The oligo sequences which should be used will include a sequence defined by the user (e.g., ‘end of scFv’) and a sequence which is common to all (e.g., CGGGCGGCCGCAGAACAAAAC ). The user-defined sequence should have at least eighteen bases homology to the sequence to be amplified. The start and end of V regions indicate the first or last complete codon of that region, as defined in Kabat et al. (1991). Although PstI is found in many V regions, it is usually found at the 5∞ end corresponding to the exact position of the site used in the vector. The use of Sse8387I which is an octanucleotide cutter (CCTGCA/GG) compatible with PstI (and leaving the PstI site intact) is recommended as it is absent from VH regions and occurs infrequently in VL regions. The BssHII site in the scFvExpress-mito is in a different position (and with a different frame) with respect to the BssHII used in the other scFv vectors. This is because insufficient work has been carried out on the mitochondrial targeting signal to know which modifications can be incorporated without affecting the ability to target to mitochondria. ^The recognition sequence for PstI (CTGCA/G) is found within the recognition sequence, and is compatible with, that of the octanucleotide cutter Sse8387I (CCTGCA/GG). The recognition sequence for EagI (C/GGCCG) is found within the recognition sequence, and is compatible with, that of the octanucleotide cutter NotI (GC/GGCCGC ). # Indicates that the full sequence of the oligos used with the internal restriction sites cannot be given as the restriction site sequence (e.g., PstI CTGCA/G) will be embedded within a user-defined sequence (e.g., the 5∞ end of the VH which is to be cloned). *The sequences given here are sense and must be reversed and complemented after the complete sense oligonucleotide has been determined. – indicates the boundary between the part of the oligo which is user-defined and the part which is common to all.
indicate a universal cloning strategy. However, each plasmid has been designed to include at least two restriction sites at either end ( Fig. 2 and Table 2). For each set of cloning sites given, the outer pair can be added without modifying the V region sequence, while the inner pair involves the incorporation of amino acids which may not be present in the original V region sequence, but which in most cases will not alter the binding characteristics of the scFv. Although PstI is found in many V regions, it is usually found at the 5∞ end corresponding to the exact position of the site used in the vector (see Persic et al., this issue). The use of Sse8387I which is an octanucleotide cutter (CCTGCA/GG) compatible with PstI (and leaving the PstI site intact) is recommended as it is absent from VH regions and occurs relatively infrequently in VL regions. Guidelines are given in Table 2 as to the sequences of oligonucleotides which should be used to amplify scFvs. These sequences are given in two parts: a user defined part which will depend on the sequence of the V regions contained in the scFv (which in turn will depend upon the species from which the scFv is derived and the order of the VH and VL chains in the scFv) and which should contain at least fifteen bases of homology to the sequence to be amplified.
Where scFvs are derived from phage antibody libraries following selection on antigen, it is relatively trivial to either clone these directly from compatible vectors (e.g. pHEN; Hoogenboom et al., 1991) into the appropriate plasmid (using the sites indicated in Table 2), or to amplify the cloned scFv incorporating compatible sites ( Table 2) at either end of the scFv. To express scFvs from isolated V regions (either derived from hybridomas by V region PCR (Orlandi et al., 1989), RACE (Frohman et al., 1988; Ruberti et al., 1994) or by oligoligation PCR ( Edwards et al. (1991) or from FAb phage libraries Griffiths et al. (1994) we recommend that the V regions are assembled into scFv by PCR assembly (Clackson et al., 1991), and cloned either directly into the appropriate scFv vector or into a phage(mid) display vector. In the latter strategy, selection for appropriate binding activity can be assayed prior to cloning into these vectors as described above. We have chosen the VH-linker-VL order for our scFv format, and the restriction sites used are particularly appropriate for this order of VH and VL genes. However, scFvs with the VL-linker-VH format can also be cloned using the outer restriction sites ( Table 2 and Fig. 2).
L. Persic et al. / Gene 187 (1997) 1–8
3. Conclusion In this paper we have described a series of modular vectors capable of directing scFvs to a number of different cellular compartments specified by the targeting signal present on the plasmid. Previous studies (see above) have demonstrated that such ectopically expressed antibodies are functional and able to inhibit cellular functions, suggesting that intracellular immunisation is likely to be a useful tool in cell biology where antibodies to proteins or other molecules in identified compartments are available. Targeting to all compartments produced the immunofluorescence pattern expected. Under certain conditions, however, scFvExpress-cyto can give a pattern of expression which we term a ‘donut-like’ pattern (Fig. 4c and d). This aggregated pattern of expression is almost certainly a consequence of overexpression, since it can be avoided by using a weaker promoter, such as CMV (Fig. 4a), or by not letting cells accumulate too much cytoplasmic scFv (by examining them at 24 h after transfection, Fig. 4b). This problem is likely to be aggravated in COS cells where the combination of a powerful promoter such as EF-1a, and the high plasmid amplification levels (obtained as a result of the action of the T antigen found in COS cells on the SV40 origin of replication) result in extremely high expression levels which may overwhelm the ability of the cell to fold the ectopically expressed scFv. It is not a problem in stable cell lines (Biocca, personal communication), where plasmid amplification does not occur. In addition, we expect that different scFvs will probably have different tendencies to precipitate within the cytoplasm, as has been previously shown for expression of scFv in bacteria (Ge et al., 1995). The quantity of antibody required to inhibit the function of an intracellular protein will depend upon the affinity of the antibody and the intracellular concentration of the antigen. We have used the strong EF-1a promoter in these vectors. In cases where an antigen is present in low concentrations and the affinity of the antibody is high, the use of a weaker promoter may be more appropriate. The use of inducible promoters, such as those described in Gossen and Bujard (1992), would resolve the need to exchange promoters if they can be adapted for use in this vector. The modular design of these vectors would permit the easy exchange of this or any other individual component with relative ease.
References Beerli, R.R., Wels, W. and Hynes, N.E. (1994a) Autocrine inhibition of the epidermal growth factor receptor by intracellular expression of a single-chain antibody. Biochem. Biophys. Res. Commun. 204, 666–672.
7
Beerli, R.R., Wels, W. and Hynes, N.E. (1994b) Intracellular expression of single chain antibodies reverts ErbB-2 transformation. J. Biol. Chem. 269, 23931–23936. Biocca, S. and Cattaneo, A. (1995) Intracellular immunization: antibody targeting to subcellular compartments. Trends Cell Biol. 5, 248–252. Biocca, S., Neuberger, M.S. and Cattaneo, A. (1990) Expression and targeting of intracellular antibodies in mammalian cells. EMBO J. 9, 101–108. Biocca, S., Pierandrei-Amaldi, P. and Cattaneo, A. (1993) Intracellular expression of anti-p21ras single chain Fv fragments inhibits meiotic maturation of Xenopus oocytes. Biochem. Biophys. Res. Commun. 197, 422–427. Biocca, S., Pierandrei-Amaldi, P., Campioni, N. and Cattaneo, A. (1994) Intracellular immunisation with cytosolic recombinant antibodies. Bio/Tech 12, 396–400. Biocca, S., Ruberti, F., Tafani, M., Pierandrei-Amaldi, P. and Cattaneo, A. (1995) Redox state of single chain Fv fragments targeted to the endoplasmic reticulum, cytosol and mitochondria. Bio/Tech 13, 1110–1115. Carlson, J.R. (1988) A new means of inducibly inactivating a cellular protein. Mol. Cell. Biol. 8, 2638–2646. Cattaneo, A. and Neuberger, M.S. (1987) Polymeric immunoglobulin M is secreted by transfectants of non-lymphoid cells in the absence of immunoglobulin J chain. EMBO J. 6, 2753–2758. Clackson, T., Hoogenboom, H.R., Griffiths, A.D. and Winter, G. (1991) Making antibody fragments using phage display libraries. Nature 352, 624–628. Deshane, J., Loechel, F., Conry, R.M., Siegal, G.P., King, C.R. and Curiel, D.T. (1994) Intracellular single-chain antibody directed against erbB2 down-regulates cell surface erbB2 and exhibits a selective anti-proliferative effect in erbB2 overexpressing cancer cell lines. Gene Ther. 1, 332–337. Duan, L., Bagasra, O., Laughlin, M.A., Oakes, J.W. and Pomerantz, R.J. (1994a) Potent inhibition of human immunodeficiency virus type 1 replication by an intracellular anti-Rev single-chain antibody. Proc. Natl. Acad. Sci. USA 91, 5075–5079. Duan, L., Zhang, H., Oakes, J.W., Bagasra, O. and Pomerantz, R.J. (1994b) Molecular and virological effects of intracellular anti-Rev single-chain variable fragments on the expression of various human immunodeficiency virus-1 strains. Human Gene Ther. 5, 1315–1324. Edwards, J.B., Delort, J. and Mallet, J. (1991) Oligodeoxyribonucleotide ligation to single stranded cDNAs: a new tool for cloning 5∞ ends of mRNAs and for constructing cDNA libraries by in vitro amplification. Nucleic Acids Res. 19, 5227–5232. Evan, G.I., Lewis, G.K., Ramsay, G. and Bishop, J.M. (1985) Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol. Cell Biol. 5, 3610–3616. Fisher-Fantuzzi, L. and Vesco, C. (1988) Cell-dependent efficiency of reiterated nuclear signals in a mutant simian virus 40 oneoprotein targeted to the nucleus. Mol. Cell. Biol. 8, 5495–5503. Frohman, M.A., Dush, M.K. and Martin, G. (1988) Rapid production of full length cDNAs from rare transcripts: Amplification using a single gene-specific oligonucletide primer. Proc. Natl. Acad. Sci. USA 85, 8998–9002. Ge, L., Knappik, A., Pack, P., Freund, C. and Plu¨ckthun, A. (1995) Expressing antibodies in Escherichia coli. In: Borrebaeck, C.A.K. ( Ed.), Antibody Engineering. Oxford University Press, New York, Oxford, pp. 229–266. Gossen, M. and Bujard, H. (1992) Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89, 5547–5551. Griffiths, A.D., Williams, S.C., Hartley, O., Tomlinson, I.M., Waterhouse, P., Crosby, W.L., Kontermann, R.E., Jones, P.T., Low, N.M., Alison, T.J., Prospero, T.D., Hoogenboom, H.R., Nissim, A., Cox, J.P.L., Harrison, J.L., Zaccolo, M., Gherardi, E. and
8
L. Persic et al. / Gene 187 (1997) 1–8
Winter, G. (1994) Isolation of high affinity human antibodies directly from large synthetic repertoires. EMBO J. 13, 3245–3260. Hoogenboom, H.R., Griffiths, A.D., Johnson, K.S., Chiswell, D.J., Hudson, P. and Winter, G. (1991) Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody ( Fab) heavy and light chains. Nucleic Acids Res. 19, 4133–4137. Jost, C.R., Kurucz, I., Jacobus, C.M., Titus, J.A., George, A.J. and Segal, D.M. (1994) Mammalian expression and secretion of functional single-chain Fv molecules. J. Biol. Chem. 269, 26267–26273. Kabat, E.A., Wu, T.T., Perry, H.M., Gottesman, K.S. and Foeller, C. (1991) Sequences of Proteins of Immunological Interest, 5 edition U.S. Department of Health and Human Services, U.S. Government Printing Office, Washington, DC. Maciejewski, J., Weichold, F., Young, N., Cara, A., Zella, D., Reitz Jr., M. and Gallo, R. (1995) Intracellular expression of antibody fragments directed against HIV reverse transcriptase prevents HIV infection in vitro. Nature Med. 1, 667–673. Marasco, W.A., Haseltine, W.A. and Chen, S.Y. (1993) Design, intracellular expression, and activity of a human anti-human immunodeficiency virus type 1 gp120 single-chain antibody Marks, J.D., Hoogenboom, H.R., Bonnert, T.P., McCafferty, J., Griffiths, A.D. and Winter, G. (1991) By-passing immunization-human antibodies from V-gene libraries displayed on phage. J. Mol. Biol. 222, 581–597. McCafferty, J., Griffiths, A.D., Winter, G. and Chiswell, D.J. (1990) Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348, 552–554. Mhashilkar, A.M., Bagley, J., Chen, S.Y., Szilvay, A.M., Helland, D.G. and Marasco, W.A. (1995) Inhibition of HIV-1 Tat-mediated LTR transactivation and HIV-1 infection by anti-Tat single chain intrabodies. EMBO J. 14, 1542–1551. Munro, S. and Pelham, H.R.B. (1987) A C-terminal signal prevents secretion of luminal ER proteins. Cell 48, 899–907. Nissim, A., Hoogenboom, H.R., Tomlinson, I.M., Flynn, G., Midgley, C., Lane, D. and Winter, G. (1994) Antibody fragments from a
‘single pot’ phage display library as immunochemical reagents. EMBO J. 13, 692–698. Orlandi, R., Gussow, D.H., Jones, P.T. and Winter, G. (1989) Cloning immunoglobulin variable domains for expression by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86, 3833–3837. Pelham, H.R.B. (1984) Hsp70 accelerates the recovery of nucleolar morphology after heat shock. EMBO J. 3, 3095–3100. Persic, L., Roberts, A., Wilton, J., Cattaneo, A., Bradbury, A. and Hoogenboom, H.R. (1997) An integrated vector system for the eukaryotic expression of antibodies or their fragments after selection from phage display libraries. Gene 187, 000–000. Richardson, J.H. and Marasco, W.A. (1995) Intracellular antibodies: development and therapeutic potential. TIBTECH 13, 306–310. Richardson, J.H., Sodroski, J.G., Waldmann, T.A. and Marasco, W.A. (1995) Phenotypic knockout of the high-affinity human interleukin 2 receptor by intracellular single-chain antibodies against the alpha subunit of the receptor. Proc. Natl. Acad. Sci. USA 92, 3137–3141. Rizzuto, R., Simpson, A.W.M., Brini, M. and Pozzan, T. (1992) Rapid changes of mitochondrial Ca++ revealed by specifically targeted recombinant aequorin. Nature 358, 325–327. Ruberti, F., Cattaneo, A. and Bradbury, A. (1994) The use of the RACE method to clone hybridoma cDNA when V region primers fail. J. Immunol. Methods 173, 33–39. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A. and Galeffi, P. (1993) Transgenic plants expressing a functional single chain Fv antibody are specifically protected from virus attack. Nature 366, 469–472. Werge, T.M., Baldari, C.T. and Telford, J.L. (1994) Intracellular single chain Fv antibody inhibits Ras activity in T-cell antigen receptor stimulated Jurkat cells. FEBS Lett. 3517. 393–396.