- Email: [email protected]
Tau-tubulin kinase-1 gene variants are associated with Alzheimer's disease in Han Chinese
Neuroscience Letters 491 (2011) 83–86
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Tau-tubulin kinase-1 gene variants are associated with Alzheimer’s disease in Han Chinese Nan-Nan Yu a,1 , Jin-Tai Yu a,1 , Jian-Ting Xiao b , Hao-Wen Zhang c , Rui-Chun Lu a , Hong Jiang d , Zhen-Hua Xing a,∗ , Lan Tan a,∗ a
Department of Neurology, Qingdao Municipal Hospital, School of Medicine, Qingdao University, Qingdao 266071, China Department of Neurology, The Affiliated Hospital of the Medical College of Qingdao University, Qingdao 266011, China Department of Neurology, People’s Hospital of Laixi City, Qingdao 266600, China d Department of Physiology, Shandong Provincial Key Laboratory of Pathogenesis and Prevention of Neurological Disorders and State Key Disciplines: Physiology, Medical College of Qingdao University, Qingdao 266071, China b c
a r t i c l e
i n f o
Article history: Received 9 December 2010 Received in revised form 31 December 2010 Accepted 4 January 2011 Keywords: Alzheimer’s disease Tau-tubulin kinase-1 (TTBK1) Polymorphism Genetic association
a b s t r a c t Tau-tubuline kinase 1 (TTBK1) is a recently discovered brain-specific protein kinase involved in tau phosphorylation at AD-related sites. A recent large study has identified significant association of two single nucleotide polymorphisms (SNPs) (rs2651206 and rs7764257) in the TTBK1 gene with late-onset Alzheimer’s disease (LOAD) in Spanish. Here, we performed a case–control study to clarify whether the risk for LOAD might be influenced by these polymorphisms in a large Chinese cohort consisting of 400 patients and 388 healthy controls. The minor alleles of the rs2651206 polymorphism within TTBK1 was significantly associated with a reduced risk of LOAD (odds ratio/OR = 0.69, P = 0.011). Furthermore, rs2651206 polymorphism was still strongly associated with LOAD (OR = 0.72, P = 0.05) after adjusted for age, gender, and the apolipoprotein E (APOE) 4 status. Haplotype analysis identified the TG haplotype, deriving from the two minor alleles, to decrease the risk of LOAD (OR = 0.78, P = 0.037). This study provides the evidence that variations in the TTBK1 gene may play an important role in the pathogenesis of sporadic LOAD in a Han Chinese population. © 2011 Elsevier Ireland Ltd. All rights reserved.
Alzheimer’s disease (AD) is a progressive neurodegenerative disorder and the most common form of age-related dementia in modern society, with a prevalence of over 35 million worldwide [29,39]. It is characterized by global cognitive impairment and the accumulation of amyloid beta-protein deposits and neuro-fibrillary tangles (NFTs) in the brain [38]. NFTs are pathologic hallmarks of AD and other neurodegenerative diseases known as “tauopathies” [14,24]. Recent experiments suggest a synergy, if not a direct causal link, between amyloid pathology and NFTs in AD [27]. The number of NFTs directly correlates with the presence and the degree of dementia in AD [1,14]. Furthermore, NFTs contain abnormal paired helical filaments (PHFs), of which the primary component is hyperphosphorylated tau protein (PHF-tau) [3,12,24]. Microtubule-associated cytoskeletal tau protein has been a focal point in understanding the molecular mechanism of NFTs formation through its multiple phosphorylation [16,17]. In normal neurons, tau is one of the microtubule-associated proteins and
∗ Corresponding authors. Tel.: +86 532 8890 5659; fax: +86 532 8596 8434. E-mail address: [email protected] (L. Tan). 1 These authors contributed equally to this work. 0304-3940/$ – see front matter © 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2011.01.011
maintains the cellular structure and morphology [2]. Tau protein has been implicated in numerous cellular processes, including neurite outgrowth [4,5,21], microtubule transport [8], and oligodendrocyte maturation [10,20]. These functions are diminished by phosphorylation with several protein kinases [23]. Thus, the reduction of tau expression or its phosphorylation by other tau kinases may be a therapeutic potential. Tau-tubuline kinase 1 (TTBK1) is a recently discovered brainspecific protein kinase involved in tau phosphorylation at AD-related sites [30]. Overexpression of TTBK1 leads to accumulation of phospho-tau in neuronal cell bodies of the cortex and hippocampus [35]. Recently, Vázquez-Higuera et al. [33] examined the contribution of TTBK1 to the susceptibility for AD, by analyzing nine htSNPs in this gene in a large group of AD patients and controls. They proved that two markers (rs2651206 and rs7764257) within the TTBK1 gene have association with AD susceptibility in Spanish. However, the association needs to be confirmed by further replication studies, particularly in other ethnic cohorts. In this case–control study, we evaluated whether the two polymorphisms of the TTBK1 gene might influence the risk of LOAD in an ethnically homogeneous Han Chinese population. 400 sporadic LOAD (age at onset ≥ 65 years) patients (168 men and 232 women; mean age = 78.2 ± 6.4 years, age at
84
N.-N. Yu et al. / Neuroscience Letters 491 (2011) 83–86 Table 3 Multivariate logistic regression in AD patients and controls.
Table 1 The characteristics of the study population.
Age (years) (mean ± SD) Sex (male:female) Mean age at onset (years) (mean ± SD) ApoE-4 carrier (n)
AD (400)
Controls (388)
P
78.2 ± 6.4 168:232 71.5 ± 5.9 192
75.5 ± 6.7 178:210
0.37 0.27
86
<0.001*
SD: standard deviation; n: number. * P < 0.05, significant values.
onset = 71.5 ± 5.9) and 388 healthy subjects (178 men and 210 women; mean age = 75.5 ± 6.7) free from any neurodegenerative disorders were recruited for the study. All the above subjects were of Northern Han Chinese in origin. The patients were recruited from the Department of Neurology at Qingdao Municipal Hospital, and several other hospitals in Shandong Province. A clinical diagnosis of probable AD fulfilled the criteria of the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer’s disease and Related Disorders Association (NINCDS–ADRDA) [26]. No AD patient had a family history of dementia. The control groups were confirmed healthy and neurologically normal by medical history, general examinations, laboratory examinations, and Mini Mental State Examination (MMSE) score >28. Subjects with significant illness such as autoimmune disease, T2DM, myocardial infarction, congestive heart failure, asthma, and stroke were excluded from our study. An informed consent to participate in this study was obtained from each subject or from a guardian, and the protocol of this study was approved by the Ethical Committe of Qingdao Municipal Hospital. The polymorphisms at positions rs2651206 and rs7764257 within TTBK1 were genotyped by Beijing Genomics Institute (BGI, Shenzhen, China) using MALDI-TOF Mass assay (MassArrayTM , Sequenom Inc., San Diego, CA, USA). Polymerase chain reaction (PCR) and extension primers (rs2651206, forward: ACGTTGGATGTGACCACACCTTTCTGTGTC, reverse: ACGTTGGATGACCTGTCCTAATTCGAGGAG, extension: GAGAGATGTGTTCTTTCTTGT; rs7764257, forward: ACGTTGGATGTGACCCTGATCAGAGAATGG, reverse: ACGTTGGAT GTCCTACAGTATGCAGCATCG, extension: AGTATGCAGCATCGTGCCTGGCG) were designed using the Sequenom MassARRAY
rs2651206 TT + CT versus CC rs7764257 GG + GA versus AA
Wald
P
OR (95% CI)
4.04 0.81
0.05 0.37
0.723(0.528–0.992) 0.872(0.647–1.175)
Adjusted for sex, age and ApoE4 status. OR; odds ratio; CI; confidence interval.
assay-design software. Details are available from the authors upon request. Twenty randomly selected DNA samples from each genotype were sequenced to validate the genotyping by MALDI-TOF MS. Results of the MALDI-TOF MS method corresponded with the results of sequencing. ApoE genotype was determined as the method described by Donohoe et al. [7]. Laboratory staffs were blinded to case status of study participants. Genotype and allele frequencies were estimated by counting. Hardy–Weinberg equilibrium was assessed using the 2 -test. Differences in study population between two groups were examined using the Student t-test or the 2 -test. Genotype and allele distributions were compared using the 2 -test. Differences in allele and genotype distribution between cases and controls were analyzed using logistic regression adjusted for age, gender, and APOE 4 status. The P value, odds ratios (ORs) and 95% confidence intervals (CIs) were calculated. Linkage disequilibrium (LD) and haplotypic frequencies were estimated using SHEsis software (http://analysis.bio-x.cn/myAnalysis.php). The statistical power of this study was calculated by STPLAN 4.5 software. Data were analyzed using a commercially available statistical package (SPSS version 11.5, SPSS, Inc., Chicago, IL, USA). The criterion for significant difference is P < 0.05. Demographic and clinical characteristics of AD and control subjects are shown in Table 1. As expected, the presence of the ApoE 4 allele was associated with an increased risk of LOAD (P < 0.001, odds ratios/OR = 3.24, 95% confidence intervals/CI = 2.38–4.42). Distributions of genotypes of these two polymorphisms were in the Hardy–Weinberg equilibrium both in AD and in control groups. Allelic and genotype frequencies of rs2651206 and rs7764257 SNPs in AD patients and controls in the total sample and after stratification for ApoE 4 allele are given in Table 2. For rs2651206 polymorphism, there were significant differences in genotype and
Table 2 Distribution of the TTBK1 polymorphisms in AD patients and controls. n
rs2651206 AD Controls ApoEε4(+) AD Controls ApoE ε4(−) AD Controls
Genotype
P
CC (%)
CT (%)
TT (%)
400 388
150(37.5) 114(29.4)
196(49) 204(52.6)
54(13.5) 70(18.0)
192 86
57(29.7) 26(30.2)
110(57.3) 46(53.5)
208 302
93(44.7) 88(29.1)
86(41.3) 158(52.3)
*
T (%)
0.031*
496(62.0) 432(55.7)
304(38.0) 344(44.3)
0.011*
25(13.0) 14(16.3)
0.738
224(58.3) 98(57.0)
160(41.7) 74(43.0)
0.765
29(14.0) 56(18.6)
0.001*
272(65.4) 334(55.3)
144(34.6) 270(44.7)
0.001*
P
AA (%)
GA (%)
GG (%)
400 388
197(49.3) 170(43.8)
170(42.5) 172(44.3)
33(8.2) 46(11.9)
192 86
79(41.1) 30(34.9)
98(51.0) 44(51.2)
208 302
118(56.7) 140(46.4)
72(34.6) 128(42.4)
P < 0.05, significant values.
P
C (%)
Genotype
rs7764257 AD Controls ApoEε4(+) AD Controls ApoEε4(−) AD Controls
Allele
Allele
P
A (%)
G (%)
0.138
564(70.5) 512(66.0)
236(29.5) 264(34.0)
0.054
15(7.9) 12(13.9)
0.235
256(66.7) 104(60.5)
128(33.3) 68(39.5)
0.157
18(8.7) 34(11.2)
0.069
308(74.0) 408(67.5)
108(26.0) 196(32.5)
0.026*
N.-N. Yu et al. / Neuroscience Letters 491 (2011) 83–86
85
Table 4 Estimated haplotype frequencies of TTBK1 in AD patients and controls. Haplotype
Case (%)
Controls (%)
2 -Test single statistics
2 -Test global statistics
P
2
Pb
4.366 1.268 0.081 7.737
0.037* NS NS 0.005*
8.445
0.038*
2
TG TA CG CA
157(19.7) 145(18.1) 77(9.6) 421(52.6)
186(23.9) 158(20.4) 78(10.1) 354(45.6)
a
NS: not significant. a Each haplotype was compared with all the others. b All the haplotypes were compared. * P < 0.05, significant values.
allele frequencies between AD and controls (genotype P = 0.031, allele P = 0.011). The minor allele (T) of rs2651206 showed protective effect against the risk of developing LOAD (OR = 0.69, 95% CI, 0.52–0.93, P = 0.011). When these data were stratified by the APOE 4 status, significant association was only found in subjects without APOE 4 allele. No significant differences were detected for the rs7764257 polymorphism between AD patients and controls (genotype P = 0.138, allele P = 0.054). However, when these data were stratified by the APOE 4 status, significant association was found in subjects without APOE 4 allele (P = 0.026). Furthermore, logistic regression revealed that rs2651206 polymorphism was still strongly associated with LOAD (OR = 0.72, 95% CI, 0.52–0.99, P = 0.05) after adjusted for age, gender, and the APOE 4 status (Table 3). For rs7764257, there was no significant difference between the (GG + GA) genotypes and the AA genotype (P = 0.37) (Table 3). A genetic association with AD was further investigated by examining frequencies of the haplotypes composed of the 2 loci, rs2651206 and rs7764257. The polymorphisms in the TTBK1 gene were in moderate linkage disequilibrium (LD) (D = 0.983, r2 = 0.643). The haplotypes were significantly associated with AD (P = 0.038) (Table 4). The haplotype TG, deriving from the two minor alleles, was associated with a decreased risk (OR = 0.78, 95% CI, 0.61–0.99, P = 0.037). A power analysis was added to calculate the sufficiency of sample size in this study. Based on the observed prevalence of the minor alleles in controls, our sample size had an 80% power to detect the odds ratio of 0.75 and 0.749 for rs2651206 and rs7764257, respectively, at a significance level (alpha) of 0.05. The power calculations in the whole dataset imply that our data would have been more than sufficient to detect moderate (OR of 0.4–0.5) differences in allele and genotype frequencies between all AD cases and controls. Here, we report the significant association of the rs2651206 in TTBK1 with a reduced risk of LOAD in a Han Chinese population. The minor alleles of rs2651206 and rs7764257 defined a 2-site protective haplotype. Our results were partially consistent with the results of Vázquez-Higuera et al. [33]. In Vázquez-Higuera et al.’s study, the minor allele homozygotes for rs2651206 in intron 1 and rs7764257 in intron 9, had a lower risk of developing AD than subjects homozygotes and heterozygotes for the major allele. In their study, the minor allele frequencies of the rs2651206 and rs7764257 SNPs within TTBK1 in controls were 13% and 7%, respectively, while in our study, the minor allele frequencies of the rs2651206 and rs7764257 SNPs within TTBK1 in controls were 18% and 11.9%, respectively. The minor allele frequencies of the rs2651206 and rs7764257 SNPs within TTBK1 in our LOAD patients and healthy controls are similar to those obtained previously. In addition, no significant differences were detected for the rs7764257 polymorphism between AD patients and controls. However, when these data were stratified by the APOE 4 status, significant association was found in subjects without APOE 4 allele. This disparity between our findings and those of Vázquez-Higuera et al. might
be attributable to the different genetic backgrounds of the Chinese Han and Spanish populations. TTBK1 is a neuron-specific dual kinase involved in tau phosphorylation at AD-related sites and is also associated with tau aggregation [30]. More than 10 serine/threonine protein kinases have been studied in investigating the molecular mechanism of tau phosphorylation, such as GSK3, CDK5/p25, stress-activated protein kinases (JNK and p38), cdc-2, PKA, PKC, CaM kinase II, MAP kinase or CKII [9,16,17,34,36,37]. Among these kinases, GSK-3 is the most implicated in the abnormal hyperphosphorylation of tau in AD brains. Some recent reviews describing the progress of other kinases in addition to GSK-3 in tau hyperphosphorylation and in the drug design are listed [6,15,25]. Interestingly, TTBK1 is a kinase that up-regulates the subsequent phosphorylation of tau by GSK-3 in vivo [32,35]. Xu et al. [35] developed bigenic mice overexpressing full-length TTBK1 and the P301L tau mutant. They showed that TTBK1 up-regulation enhances tau phosphorylation and oligomerization, whose toxicity results in enhanced neurodegeneration in the tauopathy animal model. TTBK1 is expressed in NFT-bearing neurons in the cortical region of AD brains [30], and moreover, TTBK1 levels are upregulated in brains of AD patients compared with age-matched non-AD controls [31]. TTBK2, a TTBK1 isoform, which is expressed in the Purkinje cells of the cerebellum and seems to play an important role in the tau cascade [13,22]. The TTBK2 serine/threonine kinase domain has been proven to be able to phosphorylate tau in vitro, which plays a major role in the cause of AD [19]. The two loci are located in the intron region (intron 1 and intron 9) of TTBK1 gene, which do not modify the encoded protein directly. However, intron region variants may potentially regulate the gene expression and therefore influence the disease susceptibility [11,18,28]. It is therefore an attractive hypothesis that the genetic variability in the two SNPs of TTBK1 could contribute to vulnerability for AD. To date, however, no known functional significance has been reported for the two polymorphisms. Hence, further functional study is necessary to investigate the exact role of TTBK1 polymorphisms in pathological processes of LOAD. In summary, our data support a possible implication of the genetic variations in the TTBK1 gene as a modest protective factor for LOAD in Han Chinese, thus providing further contribution toward new opportunities to investigate AD pathogenesis, treatment, and prevention. Disclosure statement The authors have no proprietary or financial interest in any material or device mentioned. Acknowledgements We are grateful to all of the subjects who kindly agreed to participate in this study. This work was supported by Grants
86
N.-N. Yu et al. / Neuroscience Letters 491 (2011) 83–86
from the National Natural Science Foundation of China (81000544, 30870884), the Shandong Provincial Natural Science Foundation, China (ZR2010HQ004), the Project supported by the Fok Ying-Tong Education Foundation for Young Teachers in the Higher Education Institutions of China (121034), the Project supported by the Qingdao Bureau of Science and Technology (08-2-1-2-nsh, 091-1-30-nsh) and the Shandong Provincial Outstanding Medical Academic Professional Program. References [1] P.V. Arriagada, J.H. Growdon, E.T. Hedley-Whyte, B.T. Hyman, Neurofibrillary tangles but not senile plaques parallel duration and severity of Alzheimer’s disease, Neurology 42 (1992) 631–639. [2] J. Avila, Tau phosphorylation and aggregation in Alzheimer’s disease pathology, FEBS Lett. 580 (2006) 2922–2927. [3] L. Buee, T. Bussiere, V. Buee-Scherrer, A. Delacourte, P.R. Hof, Tau protein isoforms, phosphorylation and role in neuro-degenerative disorders, Brain Res. Rev. 33 (2000) 95–130. [4] A. Caceres, K.S. Kosik, Inhibition of neurite polarity by tau antisense oligonucleotides in primary cerebellar neurons, Nature 343 (1990) 461–463. [5] A. Caceres, S. Potrebic, K.S. Kosik, The effect of tau antisense oligonucleotides on neurite formation of cultured cerebellar macroneurons, J. Neurosci. 11 (1991) 1515–1523. [6] I. Churcher, Tau therapeutic strategies for the treatment of Alzheimer’s disease, Curr. Top. Med. Chem. 6 (2006) 579–595. [7] G.G. Donohoe, A. Salomäki, T. Lehtimäki, K. Pulkki, V. Kairisto1, Rapid identification of apolipoprotein E genotypes by multiplex amplification refractory mutation system PCR and capillary gel electrophoresis, Clin. Chem. 45 (1999) 143–146. [8] A. Ebneth, R. Godemann, K. Stamer, S. Illenberger, B. Trinczek, E. Mandelkow, Overexpression of tau protein inhibits kinesin dependent trafficking of vesicles, mitochondria, and endoplasmic reticulum: implications for Alzheimer’s disease, J. Cell Biol. 143 (1998) 777–794. [9] C.X. Gong, F. Liu, I. Grundke-Iqbal, K. Iqbal, Post-translational modifications of tau protein in Alzheimer’s disease, J. Neural. Transm. 112 (2005) 813–838. [10] M. Gorath, T. Stahnke, T. Mronga, O. Goldbaum, C. Richter-Landsberg, Developmental changes of tau protein and mRNA in cultured rat brain oligodendrocytes, Glia 36 (2001) 89–101. [11] J.M. Gregoire, P.H. Romeo, T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer, J. Biol. Chem. 274 (1999) 6567–6578. [12] I. Grundke-Iqbal, K. Iqbal, Y.C. Tung, M. Quinlan, H.M. Wisniewski, L.I. Binder, Abnormal phosphorylation of the micro-tubule-associated protein tau (tau) in Alzheimer cytoskeletal pathology, Proc. Natl. Acad. Sci. U.S.A. 83 (1986) 4913–4917. [13] H. Houlden, J. Johnson, C. Gardner-Thorpe, T. Lashley, D. Hernandez, P. Worth, A.B. Singleton, D.A. Hilton, J. Holton, T. Revesz, M.B. Davis, P. Giunti, N.W. Wood, Mutations in TTBK2, encoding a kinase implicated in tau phosphorylation, segregate with spinocerebellar ataxia type 11, Nat. Genet. 39 (2007) 1434–1436. [14] K. Iqbal, I. Grundke-Iqbal, Inhibition of neurofibrillary degeneration: a promising approach to Alzheimer’s disease and other tauopathies, Curr. Drug Targets 5 (2004) 495–502. [15] K. Iqbal, I. Grundke-Iqbal, Developing pharmacological therapies for Alzheimer disease, Cell. Mol. Life Sci. 64 (2007) 2234–2244. [16] K. Iqbal, I. Grundke-Iqbal, Alzheimer neurofibrillary degeneration: significance, etiopathogenesis, therapeutics and prevention, J. Cell. Mol. Med. 12 (2008) 38–55. [17] K. Iqbal, F. Liu, C.X. Gong, A.C. Alonso, I. Grundke-Iqbal, Mechanisms of tauinduced neurodegeneration, Acta Neuropathol. 118 (2009) 53–69. [18] C.H. Kim, H.S. Kim, J.F. Cubells, K.S. Kim, A previously undescribed intron and extensive 5 upstream sequence, but not Phox2a-mediated transactivation, are necessary for high level cell type-specific expression of the human norepinephrine transporter gene, J. Biol. Chem. 274 (1999) 6507–6518.
[19] M. Kitano-Takahashi, H. Morita, S. Kondo, K. Tomizawa, R. Kato, M. Tanio, Y. Shirota, H. Takahashi, S. Sugio, T. Kohno, Expression, purification and crystallization of a human tau-tubulin kinase 2 that phosphorylates tau protein, Acta Crystallogr. Sect. F: Struct. Biol. Cryst. Commun. 63 (2007) 602–604. [20] C. Klein, E.M. Kramer, A.M. Cardine, B. Schraven, R. Brandt, J. Trotter, Process outgrowth of oligodendrocytes is promoted by interaction of fyn kinase with the cytoskeletal protein tau, J. Neurosci. 22 (2002) 698–707. [21] J. Knops, K.S. Kosik, G. Lee, J.D. Pardee, L. Cohen-Gould, L. McConlogue, Overexpression of tau in a nonneuronal cell induces long cellular processes, J. Cell Biol. 114 (1991) 725–733. [22] B.C. Kraemer, J.K. Burgess, J.H. Chen, J.H. Thomas, G.D. Schellenberg, Molecular pathways that influence human tau-induced pathology in Caenorhabditis elegans, Hum. Mol. Genet. 15 (2006) 483–1496. [23] V.M. Lee, Disruption of the cytoskeleton in Alzheimer’s disease, Curr. Opin. Neurobiol. 5 (1995) 663–668. [24] V.M. Lee, M. Goedert, J.Q. Trojanowski, Neurodegenerative tauopathies, Annu. Rev. Neurosci. 24 (2001) 1121–1159. [25] M.P. Mazanetz, P.M. Fischer, Untangling tau hyperphosphorylation in drug design for neurodegenerative diseases, Nat. Rev. Drug Discov. 6 (2007) 464–479. [26] G. McKhann, D. Drachman, M. Folstein, R. Katzman, D. Price, E.M. Stadlan, Clinical diagnosis of Alzheimer’s disease: report of the NINCDSADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer’s Disease, Neurology 34 (1984) 939–944. [27] S. Oddo, L. Billings, J.P. Kesslak, D.H. Cribbs, F.M. LaFerla, Abeta immunotherapy leads to clearance of early, but not late, hyperphosphorylated tau aggregates via the proteasome, Neuron 43 (2004) 321–332. [28] A.E. Prada, K. Zahedi, A.E. Davis, Regulation of C1 inhibitor synthesis, Immunobiology 199 (1998) 377–388. [29] H.W. Querfurth, F.M. LaFerla, Alzheimer’s disease, New Engl. J. Med. 362 (2010) 329–344. [30] S. Sato, R.L. Cerny, J.L. Buescher, T. Ikezu, Tau-tubulin kinase 1 (TTBK1), a neuron-specific tau kinase candidate, is involved in tau phosphorylation and aggregation, J. Neurochem. 98 (2006) 1573–1584. [31] S. Sato, J. Xu, S. Okuyama, L.B. Martinez, S.M. Walsh, M.T. Jacobsen, R.J. Swan, J.D. Schlautman, P. Ciborowski, T. Ikezu, Spatial learning impairment, enhanced CDK5/p35 activity, and down regulation of NMDA receptor expression in transgenic mice expressing tau-tubulin kinase 1, J. Neurosci. 28 (2008) 14511–14521. [32] K. Tomizawa, A. Omori, A. Ohtake, K. Sato, M. Takahashi, Tau-tubulin kinase phosphorylates tau at Ser-208 and Ser-210, sites found inpaired helical filament-tau, FEBS Lett. 492 (2001) 221–227. [33] J.L. Vázquez-Higuera, A. Martínez-García, P. Sánchez-Juan, E. RodríguezRodríguez, I. Mateo, A. Pozueta, A. Frank, F. Valdivieso, J. Berciano, M.J. Bullido, O. Combarros, Genetic variations in tau-tubulin kinase-1 are linked to Alzheimer’s disease in a Spanish case–control cohort, Neurobiol. Aging (January 20) (2010) [Epub ahead of print]. [34] J.Z. Wang, F. Liu, Microtubule-associated protein tau in development, degeneration and protection of neurons, Prog. Neurobiol. 85 (2008) 148–175. [35] J. Xu, S. Sato, S. Okuyama, R.J. Swan, M.T. Jacobsen, E. Strunk, T. Ikezu, Tau-tubulin kinase 1 enhances prefibrillar tau aggregation and motor neuron degeneration in P301L FTDP-17 tau-mutant mice, FASEB J. 24 (2010) 2904–2915. [36] H. Yamamoto, E. Yamauchi, H. Taniguchi, T. Ono, E. Miyamoto, Phosphorylation of microtubule-associated protein tau by Ca2+ /calmodulin-dependent protein kinase II in its tubulin binding sites, Arch. Biochem. Biophys. 408 (2002) 255–262. [37] J.T. Yu, R.C. Chang, L. Tan, Calcium dysregulation in Alzheimer’s disease: from mechanisms to therapeutic opportunities, Prog. Neurobiol. 89 (2009) 240–255. [38] N.N. Yu, X.X. Wang, J.T. Yu, N.D. Wang, R.C. Lu, D. Miao, Y. Tian, L. Tan, Blocking beta2-adrenergic receptor attenuates acute stress-induced amyloid beta peptides production, Brain Res. 1317 (2010) 305–310. [39] J.T. Yu, L. Li, Q.X. Zhu, Q. Zhang, W. Zhang, Z.C. Wu, J. Guan, L. Tan, Implication of CLU gene polymorphisms in Chinese patients with Alzheimer’s disease, Clin. Chim. Acta 411 (2010) 1516–1519.
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Tau-tubulin kinase-1 gene variants are associated with Alzheimer’s disease in Han Chinese Nan-Nan Yu a,1 , Jin-Tai Yu a,1 , Jian-Ting Xiao b , Hao-Wen Zhang c , Rui-Chun Lu a , Hong Jiang d , Zhen-Hua Xing a,∗ , Lan Tan a,∗ a
Department of Neurology, Qingdao Municipal Hospital, School of Medicine, Qingdao University, Qingdao 266071, China Department of Neurology, The Affiliated Hospital of the Medical College of Qingdao University, Qingdao 266011, China Department of Neurology, People’s Hospital of Laixi City, Qingdao 266600, China d Department of Physiology, Shandong Provincial Key Laboratory of Pathogenesis and Prevention of Neurological Disorders and State Key Disciplines: Physiology, Medical College of Qingdao University, Qingdao 266071, China b c
a r t i c l e
i n f o
Article history: Received 9 December 2010 Received in revised form 31 December 2010 Accepted 4 January 2011 Keywords: Alzheimer’s disease Tau-tubulin kinase-1 (TTBK1) Polymorphism Genetic association
a b s t r a c t Tau-tubuline kinase 1 (TTBK1) is a recently discovered brain-specific protein kinase involved in tau phosphorylation at AD-related sites. A recent large study has identified significant association of two single nucleotide polymorphisms (SNPs) (rs2651206 and rs7764257) in the TTBK1 gene with late-onset Alzheimer’s disease (LOAD) in Spanish. Here, we performed a case–control study to clarify whether the risk for LOAD might be influenced by these polymorphisms in a large Chinese cohort consisting of 400 patients and 388 healthy controls. The minor alleles of the rs2651206 polymorphism within TTBK1 was significantly associated with a reduced risk of LOAD (odds ratio/OR = 0.69, P = 0.011). Furthermore, rs2651206 polymorphism was still strongly associated with LOAD (OR = 0.72, P = 0.05) after adjusted for age, gender, and the apolipoprotein E (APOE) 4 status. Haplotype analysis identified the TG haplotype, deriving from the two minor alleles, to decrease the risk of LOAD (OR = 0.78, P = 0.037). This study provides the evidence that variations in the TTBK1 gene may play an important role in the pathogenesis of sporadic LOAD in a Han Chinese population. © 2011 Elsevier Ireland Ltd. All rights reserved.
Alzheimer’s disease (AD) is a progressive neurodegenerative disorder and the most common form of age-related dementia in modern society, with a prevalence of over 35 million worldwide [29,39]. It is characterized by global cognitive impairment and the accumulation of amyloid beta-protein deposits and neuro-fibrillary tangles (NFTs) in the brain [38]. NFTs are pathologic hallmarks of AD and other neurodegenerative diseases known as “tauopathies” [14,24]. Recent experiments suggest a synergy, if not a direct causal link, between amyloid pathology and NFTs in AD [27]. The number of NFTs directly correlates with the presence and the degree of dementia in AD [1,14]. Furthermore, NFTs contain abnormal paired helical filaments (PHFs), of which the primary component is hyperphosphorylated tau protein (PHF-tau) [3,12,24]. Microtubule-associated cytoskeletal tau protein has been a focal point in understanding the molecular mechanism of NFTs formation through its multiple phosphorylation [16,17]. In normal neurons, tau is one of the microtubule-associated proteins and
∗ Corresponding authors. Tel.: +86 532 8890 5659; fax: +86 532 8596 8434. E-mail address: [email protected] (L. Tan). 1 These authors contributed equally to this work. 0304-3940/$ – see front matter © 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2011.01.011
maintains the cellular structure and morphology [2]. Tau protein has been implicated in numerous cellular processes, including neurite outgrowth [4,5,21], microtubule transport [8], and oligodendrocyte maturation [10,20]. These functions are diminished by phosphorylation with several protein kinases [23]. Thus, the reduction of tau expression or its phosphorylation by other tau kinases may be a therapeutic potential. Tau-tubuline kinase 1 (TTBK1) is a recently discovered brainspecific protein kinase involved in tau phosphorylation at AD-related sites [30]. Overexpression of TTBK1 leads to accumulation of phospho-tau in neuronal cell bodies of the cortex and hippocampus [35]. Recently, Vázquez-Higuera et al. [33] examined the contribution of TTBK1 to the susceptibility for AD, by analyzing nine htSNPs in this gene in a large group of AD patients and controls. They proved that two markers (rs2651206 and rs7764257) within the TTBK1 gene have association with AD susceptibility in Spanish. However, the association needs to be confirmed by further replication studies, particularly in other ethnic cohorts. In this case–control study, we evaluated whether the two polymorphisms of the TTBK1 gene might influence the risk of LOAD in an ethnically homogeneous Han Chinese population. 400 sporadic LOAD (age at onset ≥ 65 years) patients (168 men and 232 women; mean age = 78.2 ± 6.4 years, age at
84
N.-N. Yu et al. / Neuroscience Letters 491 (2011) 83–86 Table 3 Multivariate logistic regression in AD patients and controls.
Table 1 The characteristics of the study population.
Age (years) (mean ± SD) Sex (male:female) Mean age at onset (years) (mean ± SD) ApoE-4 carrier (n)
AD (400)
Controls (388)
P
78.2 ± 6.4 168:232 71.5 ± 5.9 192
75.5 ± 6.7 178:210
0.37 0.27
86
<0.001*
SD: standard deviation; n: number. * P < 0.05, significant values.
onset = 71.5 ± 5.9) and 388 healthy subjects (178 men and 210 women; mean age = 75.5 ± 6.7) free from any neurodegenerative disorders were recruited for the study. All the above subjects were of Northern Han Chinese in origin. The patients were recruited from the Department of Neurology at Qingdao Municipal Hospital, and several other hospitals in Shandong Province. A clinical diagnosis of probable AD fulfilled the criteria of the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer’s disease and Related Disorders Association (NINCDS–ADRDA) [26]. No AD patient had a family history of dementia. The control groups were confirmed healthy and neurologically normal by medical history, general examinations, laboratory examinations, and Mini Mental State Examination (MMSE) score >28. Subjects with significant illness such as autoimmune disease, T2DM, myocardial infarction, congestive heart failure, asthma, and stroke were excluded from our study. An informed consent to participate in this study was obtained from each subject or from a guardian, and the protocol of this study was approved by the Ethical Committe of Qingdao Municipal Hospital. The polymorphisms at positions rs2651206 and rs7764257 within TTBK1 were genotyped by Beijing Genomics Institute (BGI, Shenzhen, China) using MALDI-TOF Mass assay (MassArrayTM , Sequenom Inc., San Diego, CA, USA). Polymerase chain reaction (PCR) and extension primers (rs2651206, forward: ACGTTGGATGTGACCACACCTTTCTGTGTC, reverse: ACGTTGGATGACCTGTCCTAATTCGAGGAG, extension: GAGAGATGTGTTCTTTCTTGT; rs7764257, forward: ACGTTGGATGTGACCCTGATCAGAGAATGG, reverse: ACGTTGGAT GTCCTACAGTATGCAGCATCG, extension: AGTATGCAGCATCGTGCCTGGCG) were designed using the Sequenom MassARRAY
rs2651206 TT + CT versus CC rs7764257 GG + GA versus AA
Wald
P
OR (95% CI)
4.04 0.81
0.05 0.37
0.723(0.528–0.992) 0.872(0.647–1.175)
Adjusted for sex, age and ApoE4 status. OR; odds ratio; CI; confidence interval.
assay-design software. Details are available from the authors upon request. Twenty randomly selected DNA samples from each genotype were sequenced to validate the genotyping by MALDI-TOF MS. Results of the MALDI-TOF MS method corresponded with the results of sequencing. ApoE genotype was determined as the method described by Donohoe et al. [7]. Laboratory staffs were blinded to case status of study participants. Genotype and allele frequencies were estimated by counting. Hardy–Weinberg equilibrium was assessed using the 2 -test. Differences in study population between two groups were examined using the Student t-test or the 2 -test. Genotype and allele distributions were compared using the 2 -test. Differences in allele and genotype distribution between cases and controls were analyzed using logistic regression adjusted for age, gender, and APOE 4 status. The P value, odds ratios (ORs) and 95% confidence intervals (CIs) were calculated. Linkage disequilibrium (LD) and haplotypic frequencies were estimated using SHEsis software (http://analysis.bio-x.cn/myAnalysis.php). The statistical power of this study was calculated by STPLAN 4.5 software. Data were analyzed using a commercially available statistical package (SPSS version 11.5, SPSS, Inc., Chicago, IL, USA). The criterion for significant difference is P < 0.05. Demographic and clinical characteristics of AD and control subjects are shown in Table 1. As expected, the presence of the ApoE 4 allele was associated with an increased risk of LOAD (P < 0.001, odds ratios/OR = 3.24, 95% confidence intervals/CI = 2.38–4.42). Distributions of genotypes of these two polymorphisms were in the Hardy–Weinberg equilibrium both in AD and in control groups. Allelic and genotype frequencies of rs2651206 and rs7764257 SNPs in AD patients and controls in the total sample and after stratification for ApoE 4 allele are given in Table 2. For rs2651206 polymorphism, there were significant differences in genotype and
Table 2 Distribution of the TTBK1 polymorphisms in AD patients and controls. n
rs2651206 AD Controls ApoEε4(+) AD Controls ApoE ε4(−) AD Controls
Genotype
P
CC (%)
CT (%)
TT (%)
400 388
150(37.5) 114(29.4)
196(49) 204(52.6)
54(13.5) 70(18.0)
192 86
57(29.7) 26(30.2)
110(57.3) 46(53.5)
208 302
93(44.7) 88(29.1)
86(41.3) 158(52.3)
*
T (%)
0.031*
496(62.0) 432(55.7)
304(38.0) 344(44.3)
0.011*
25(13.0) 14(16.3)
0.738
224(58.3) 98(57.0)
160(41.7) 74(43.0)
0.765
29(14.0) 56(18.6)
0.001*
272(65.4) 334(55.3)
144(34.6) 270(44.7)
0.001*
P
AA (%)
GA (%)
GG (%)
400 388
197(49.3) 170(43.8)
170(42.5) 172(44.3)
33(8.2) 46(11.9)
192 86
79(41.1) 30(34.9)
98(51.0) 44(51.2)
208 302
118(56.7) 140(46.4)
72(34.6) 128(42.4)
P < 0.05, significant values.
P
C (%)
Genotype
rs7764257 AD Controls ApoEε4(+) AD Controls ApoEε4(−) AD Controls
Allele
Allele
P
A (%)
G (%)
0.138
564(70.5) 512(66.0)
236(29.5) 264(34.0)
0.054
15(7.9) 12(13.9)
0.235
256(66.7) 104(60.5)
128(33.3) 68(39.5)
0.157
18(8.7) 34(11.2)
0.069
308(74.0) 408(67.5)
108(26.0) 196(32.5)
0.026*
N.-N. Yu et al. / Neuroscience Letters 491 (2011) 83–86
85
Table 4 Estimated haplotype frequencies of TTBK1 in AD patients and controls. Haplotype
Case (%)
Controls (%)
2 -Test single statistics
2 -Test global statistics
P
2
Pb
4.366 1.268 0.081 7.737
0.037* NS NS 0.005*
8.445
0.038*
2
TG TA CG CA
157(19.7) 145(18.1) 77(9.6) 421(52.6)
186(23.9) 158(20.4) 78(10.1) 354(45.6)
a
NS: not significant. a Each haplotype was compared with all the others. b All the haplotypes were compared. * P < 0.05, significant values.
allele frequencies between AD and controls (genotype P = 0.031, allele P = 0.011). The minor allele (T) of rs2651206 showed protective effect against the risk of developing LOAD (OR = 0.69, 95% CI, 0.52–0.93, P = 0.011). When these data were stratified by the APOE 4 status, significant association was only found in subjects without APOE 4 allele. No significant differences were detected for the rs7764257 polymorphism between AD patients and controls (genotype P = 0.138, allele P = 0.054). However, when these data were stratified by the APOE 4 status, significant association was found in subjects without APOE 4 allele (P = 0.026). Furthermore, logistic regression revealed that rs2651206 polymorphism was still strongly associated with LOAD (OR = 0.72, 95% CI, 0.52–0.99, P = 0.05) after adjusted for age, gender, and the APOE 4 status (Table 3). For rs7764257, there was no significant difference between the (GG + GA) genotypes and the AA genotype (P = 0.37) (Table 3). A genetic association with AD was further investigated by examining frequencies of the haplotypes composed of the 2 loci, rs2651206 and rs7764257. The polymorphisms in the TTBK1 gene were in moderate linkage disequilibrium (LD) (D = 0.983, r2 = 0.643). The haplotypes were significantly associated with AD (P = 0.038) (Table 4). The haplotype TG, deriving from the two minor alleles, was associated with a decreased risk (OR = 0.78, 95% CI, 0.61–0.99, P = 0.037). A power analysis was added to calculate the sufficiency of sample size in this study. Based on the observed prevalence of the minor alleles in controls, our sample size had an 80% power to detect the odds ratio of 0.75 and 0.749 for rs2651206 and rs7764257, respectively, at a significance level (alpha) of 0.05. The power calculations in the whole dataset imply that our data would have been more than sufficient to detect moderate (OR of 0.4–0.5) differences in allele and genotype frequencies between all AD cases and controls. Here, we report the significant association of the rs2651206 in TTBK1 with a reduced risk of LOAD in a Han Chinese population. The minor alleles of rs2651206 and rs7764257 defined a 2-site protective haplotype. Our results were partially consistent with the results of Vázquez-Higuera et al. [33]. In Vázquez-Higuera et al.’s study, the minor allele homozygotes for rs2651206 in intron 1 and rs7764257 in intron 9, had a lower risk of developing AD than subjects homozygotes and heterozygotes for the major allele. In their study, the minor allele frequencies of the rs2651206 and rs7764257 SNPs within TTBK1 in controls were 13% and 7%, respectively, while in our study, the minor allele frequencies of the rs2651206 and rs7764257 SNPs within TTBK1 in controls were 18% and 11.9%, respectively. The minor allele frequencies of the rs2651206 and rs7764257 SNPs within TTBK1 in our LOAD patients and healthy controls are similar to those obtained previously. In addition, no significant differences were detected for the rs7764257 polymorphism between AD patients and controls. However, when these data were stratified by the APOE 4 status, significant association was found in subjects without APOE 4 allele. This disparity between our findings and those of Vázquez-Higuera et al. might
be attributable to the different genetic backgrounds of the Chinese Han and Spanish populations. TTBK1 is a neuron-specific dual kinase involved in tau phosphorylation at AD-related sites and is also associated with tau aggregation [30]. More than 10 serine/threonine protein kinases have been studied in investigating the molecular mechanism of tau phosphorylation, such as GSK3, CDK5/p25, stress-activated protein kinases (JNK and p38), cdc-2, PKA, PKC, CaM kinase II, MAP kinase or CKII [9,16,17,34,36,37]. Among these kinases, GSK-3 is the most implicated in the abnormal hyperphosphorylation of tau in AD brains. Some recent reviews describing the progress of other kinases in addition to GSK-3 in tau hyperphosphorylation and in the drug design are listed [6,15,25]. Interestingly, TTBK1 is a kinase that up-regulates the subsequent phosphorylation of tau by GSK-3 in vivo [32,35]. Xu et al. [35] developed bigenic mice overexpressing full-length TTBK1 and the P301L tau mutant. They showed that TTBK1 up-regulation enhances tau phosphorylation and oligomerization, whose toxicity results in enhanced neurodegeneration in the tauopathy animal model. TTBK1 is expressed in NFT-bearing neurons in the cortical region of AD brains [30], and moreover, TTBK1 levels are upregulated in brains of AD patients compared with age-matched non-AD controls [31]. TTBK2, a TTBK1 isoform, which is expressed in the Purkinje cells of the cerebellum and seems to play an important role in the tau cascade [13,22]. The TTBK2 serine/threonine kinase domain has been proven to be able to phosphorylate tau in vitro, which plays a major role in the cause of AD [19]. The two loci are located in the intron region (intron 1 and intron 9) of TTBK1 gene, which do not modify the encoded protein directly. However, intron region variants may potentially regulate the gene expression and therefore influence the disease susceptibility [11,18,28]. It is therefore an attractive hypothesis that the genetic variability in the two SNPs of TTBK1 could contribute to vulnerability for AD. To date, however, no known functional significance has been reported for the two polymorphisms. Hence, further functional study is necessary to investigate the exact role of TTBK1 polymorphisms in pathological processes of LOAD. In summary, our data support a possible implication of the genetic variations in the TTBK1 gene as a modest protective factor for LOAD in Han Chinese, thus providing further contribution toward new opportunities to investigate AD pathogenesis, treatment, and prevention. Disclosure statement The authors have no proprietary or financial interest in any material or device mentioned. Acknowledgements We are grateful to all of the subjects who kindly agreed to participate in this study. This work was supported by Grants
86
N.-N. Yu et al. / Neuroscience Letters 491 (2011) 83–86
from the National Natural Science Foundation of China (81000544, 30870884), the Shandong Provincial Natural Science Foundation, China (ZR2010HQ004), the Project supported by the Fok Ying-Tong Education Foundation for Young Teachers in the Higher Education Institutions of China (121034), the Project supported by the Qingdao Bureau of Science and Technology (08-2-1-2-nsh, 091-1-30-nsh) and the Shandong Provincial Outstanding Medical Academic Professional Program. References [1] P.V. Arriagada, J.H. Growdon, E.T. Hedley-Whyte, B.T. Hyman, Neurofibrillary tangles but not senile plaques parallel duration and severity of Alzheimer’s disease, Neurology 42 (1992) 631–639. [2] J. Avila, Tau phosphorylation and aggregation in Alzheimer’s disease pathology, FEBS Lett. 580 (2006) 2922–2927. [3] L. Buee, T. Bussiere, V. Buee-Scherrer, A. Delacourte, P.R. Hof, Tau protein isoforms, phosphorylation and role in neuro-degenerative disorders, Brain Res. Rev. 33 (2000) 95–130. [4] A. Caceres, K.S. Kosik, Inhibition of neurite polarity by tau antisense oligonucleotides in primary cerebellar neurons, Nature 343 (1990) 461–463. [5] A. Caceres, S. Potrebic, K.S. Kosik, The effect of tau antisense oligonucleotides on neurite formation of cultured cerebellar macroneurons, J. Neurosci. 11 (1991) 1515–1523. [6] I. Churcher, Tau therapeutic strategies for the treatment of Alzheimer’s disease, Curr. Top. Med. Chem. 6 (2006) 579–595. [7] G.G. Donohoe, A. Salomäki, T. Lehtimäki, K. Pulkki, V. Kairisto1, Rapid identification of apolipoprotein E genotypes by multiplex amplification refractory mutation system PCR and capillary gel electrophoresis, Clin. Chem. 45 (1999) 143–146. [8] A. Ebneth, R. Godemann, K. Stamer, S. Illenberger, B. Trinczek, E. Mandelkow, Overexpression of tau protein inhibits kinesin dependent trafficking of vesicles, mitochondria, and endoplasmic reticulum: implications for Alzheimer’s disease, J. Cell Biol. 143 (1998) 777–794. [9] C.X. Gong, F. Liu, I. Grundke-Iqbal, K. Iqbal, Post-translational modifications of tau protein in Alzheimer’s disease, J. Neural. Transm. 112 (2005) 813–838. [10] M. Gorath, T. Stahnke, T. Mronga, O. Goldbaum, C. Richter-Landsberg, Developmental changes of tau protein and mRNA in cultured rat brain oligodendrocytes, Glia 36 (2001) 89–101. [11] J.M. Gregoire, P.H. Romeo, T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer, J. Biol. Chem. 274 (1999) 6567–6578. [12] I. Grundke-Iqbal, K. Iqbal, Y.C. Tung, M. Quinlan, H.M. Wisniewski, L.I. Binder, Abnormal phosphorylation of the micro-tubule-associated protein tau (tau) in Alzheimer cytoskeletal pathology, Proc. Natl. Acad. Sci. U.S.A. 83 (1986) 4913–4917. [13] H. Houlden, J. Johnson, C. Gardner-Thorpe, T. Lashley, D. Hernandez, P. Worth, A.B. Singleton, D.A. Hilton, J. Holton, T. Revesz, M.B. Davis, P. Giunti, N.W. Wood, Mutations in TTBK2, encoding a kinase implicated in tau phosphorylation, segregate with spinocerebellar ataxia type 11, Nat. Genet. 39 (2007) 1434–1436. [14] K. Iqbal, I. Grundke-Iqbal, Inhibition of neurofibrillary degeneration: a promising approach to Alzheimer’s disease and other tauopathies, Curr. Drug Targets 5 (2004) 495–502. [15] K. Iqbal, I. Grundke-Iqbal, Developing pharmacological therapies for Alzheimer disease, Cell. Mol. Life Sci. 64 (2007) 2234–2244. [16] K. Iqbal, I. Grundke-Iqbal, Alzheimer neurofibrillary degeneration: significance, etiopathogenesis, therapeutics and prevention, J. Cell. Mol. Med. 12 (2008) 38–55. [17] K. Iqbal, F. Liu, C.X. Gong, A.C. Alonso, I. Grundke-Iqbal, Mechanisms of tauinduced neurodegeneration, Acta Neuropathol. 118 (2009) 53–69. [18] C.H. Kim, H.S. Kim, J.F. Cubells, K.S. Kim, A previously undescribed intron and extensive 5 upstream sequence, but not Phox2a-mediated transactivation, are necessary for high level cell type-specific expression of the human norepinephrine transporter gene, J. Biol. Chem. 274 (1999) 6507–6518.
[19] M. Kitano-Takahashi, H. Morita, S. Kondo, K. Tomizawa, R. Kato, M. Tanio, Y. Shirota, H. Takahashi, S. Sugio, T. Kohno, Expression, purification and crystallization of a human tau-tubulin kinase 2 that phosphorylates tau protein, Acta Crystallogr. Sect. F: Struct. Biol. Cryst. Commun. 63 (2007) 602–604. [20] C. Klein, E.M. Kramer, A.M. Cardine, B. Schraven, R. Brandt, J. Trotter, Process outgrowth of oligodendrocytes is promoted by interaction of fyn kinase with the cytoskeletal protein tau, J. Neurosci. 22 (2002) 698–707. [21] J. Knops, K.S. Kosik, G. Lee, J.D. Pardee, L. Cohen-Gould, L. McConlogue, Overexpression of tau in a nonneuronal cell induces long cellular processes, J. Cell Biol. 114 (1991) 725–733. [22] B.C. Kraemer, J.K. Burgess, J.H. Chen, J.H. Thomas, G.D. Schellenberg, Molecular pathways that influence human tau-induced pathology in Caenorhabditis elegans, Hum. Mol. Genet. 15 (2006) 483–1496. [23] V.M. Lee, Disruption of the cytoskeleton in Alzheimer’s disease, Curr. Opin. Neurobiol. 5 (1995) 663–668. [24] V.M. Lee, M. Goedert, J.Q. Trojanowski, Neurodegenerative tauopathies, Annu. Rev. Neurosci. 24 (2001) 1121–1159. [25] M.P. Mazanetz, P.M. Fischer, Untangling tau hyperphosphorylation in drug design for neurodegenerative diseases, Nat. Rev. Drug Discov. 6 (2007) 464–479. [26] G. McKhann, D. Drachman, M. Folstein, R. Katzman, D. Price, E.M. Stadlan, Clinical diagnosis of Alzheimer’s disease: report of the NINCDSADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer’s Disease, Neurology 34 (1984) 939–944. [27] S. Oddo, L. Billings, J.P. Kesslak, D.H. Cribbs, F.M. LaFerla, Abeta immunotherapy leads to clearance of early, but not late, hyperphosphorylated tau aggregates via the proteasome, Neuron 43 (2004) 321–332. [28] A.E. Prada, K. Zahedi, A.E. Davis, Regulation of C1 inhibitor synthesis, Immunobiology 199 (1998) 377–388. [29] H.W. Querfurth, F.M. LaFerla, Alzheimer’s disease, New Engl. J. Med. 362 (2010) 329–344. [30] S. Sato, R.L. Cerny, J.L. Buescher, T. Ikezu, Tau-tubulin kinase 1 (TTBK1), a neuron-specific tau kinase candidate, is involved in tau phosphorylation and aggregation, J. Neurochem. 98 (2006) 1573–1584. [31] S. Sato, J. Xu, S. Okuyama, L.B. Martinez, S.M. Walsh, M.T. Jacobsen, R.J. Swan, J.D. Schlautman, P. Ciborowski, T. Ikezu, Spatial learning impairment, enhanced CDK5/p35 activity, and down regulation of NMDA receptor expression in transgenic mice expressing tau-tubulin kinase 1, J. Neurosci. 28 (2008) 14511–14521. [32] K. Tomizawa, A. Omori, A. Ohtake, K. Sato, M. Takahashi, Tau-tubulin kinase phosphorylates tau at Ser-208 and Ser-210, sites found inpaired helical filament-tau, FEBS Lett. 492 (2001) 221–227. [33] J.L. Vázquez-Higuera, A. Martínez-García, P. Sánchez-Juan, E. RodríguezRodríguez, I. Mateo, A. Pozueta, A. Frank, F. Valdivieso, J. Berciano, M.J. Bullido, O. Combarros, Genetic variations in tau-tubulin kinase-1 are linked to Alzheimer’s disease in a Spanish case–control cohort, Neurobiol. Aging (January 20) (2010) [Epub ahead of print]. [34] J.Z. Wang, F. Liu, Microtubule-associated protein tau in development, degeneration and protection of neurons, Prog. Neurobiol. 85 (2008) 148–175. [35] J. Xu, S. Sato, S. Okuyama, R.J. Swan, M.T. Jacobsen, E. Strunk, T. Ikezu, Tau-tubulin kinase 1 enhances prefibrillar tau aggregation and motor neuron degeneration in P301L FTDP-17 tau-mutant mice, FASEB J. 24 (2010) 2904–2915. [36] H. Yamamoto, E. Yamauchi, H. Taniguchi, T. Ono, E. Miyamoto, Phosphorylation of microtubule-associated protein tau by Ca2+ /calmodulin-dependent protein kinase II in its tubulin binding sites, Arch. Biochem. Biophys. 408 (2002) 255–262. [37] J.T. Yu, R.C. Chang, L. Tan, Calcium dysregulation in Alzheimer’s disease: from mechanisms to therapeutic opportunities, Prog. Neurobiol. 89 (2009) 240–255. [38] N.N. Yu, X.X. Wang, J.T. Yu, N.D. Wang, R.C. Lu, D. Miao, Y. Tian, L. Tan, Blocking beta2-adrenergic receptor attenuates acute stress-induced amyloid beta peptides production, Brain Res. 1317 (2010) 305–310. [39] J.T. Yu, L. Li, Q.X. Zhu, Q. Zhang, W. Zhang, Z.C. Wu, J. Guan, L. Tan, Implication of CLU gene polymorphisms in Chinese patients with Alzheimer’s disease, Clin. Chim. Acta 411 (2010) 1516–1519.