PTEN pathway in BV2 microglial cells

Journal Pre-proofs Telmisartan ameliorates Aβ oligomer-induced inflammation via PPARγ/PTEN pathway in BV2 microglial cells Ze-Fen Wang, Jie Li, Chao Ma, Chong Huang, Zhi-Qiang Li PII: DOI: Reference:

S0006-2952(19)30373-9 https://doi.org/10.1016/j.bcp.2019.113674 BCP 113674

To appear in:

Biochemical Pharmacology

Received Date: Accepted Date:

22 August 2019 16 October 2019

Please cite this article as: Z-F. Wang, J. Li, C. Ma, C. Huang, Z-Q. Li, Telmisartan ameliorates Aβ oligomer-induced inflammation via PPARγ/PTEN pathway in BV2 microglial cells, Biochemical Pharmacology (2019), doi: https:// doi.org/10.1016/j.bcp.2019.113674

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier Inc.

Telmisartan

ameliorates

Aβ

oligomer-induced

inflammation

via

PPARγ/PTEN pathway in BV2 microglial cells

Ze-Fen Wang a,b, Jie Lib, Chao Maa, Chong Huanga, Zhi-Qiang Lia,* a

Brain Glioma Center, Zhongnan Hospital of Wuhan University, Wuhan, Hubei, China

b

Department of Physiology, Wuhan University School of Basic Medical Sciences, Wuhan,

Hubei, China

*Corresponding author: Zhi-Qiang Li Brain Glioma Center, Zhongnan Hospital of Wuhan University, Wuhan 430071, China. E-mail: [email protected]

Category: Neuropharmacology

1

Abstract Telmisartan ameliorates inflammation in various brain disorders through angiotensin II type 1 receptor (AT1) blockade and peroxisome proliferator-activated receptor gamma (PPARγ) activation. Soluble β-amyloid oligomers (AβOs) play a causative role in neuronal dysfunction and memory loss in Alzheimer’s disease. In addition to directly targeting neurons, AβOs may also activate microglia to trigger toxic proinflammatory responses. Here, we investigated whether and how telmisartan ameliorates inflammatory responses in AβO-stimulated microglia. A mouse-derived BV2 microglial cell line lacking AT1 expression was selected as an in vitro model. Telmisartan not only inhibited AβO-induced proinflammatory interleukin (IL)-1β and tumor necrosis factor-α (TNF-α) expression, but also increased anti-inflammatory IL-10 expression, which was not affected by AβO stimulation. Telmisartan also inhibited AβOinduced nuclear factor (NF)-κB activity and phosphorylation of Akt and ERK, two upstream regulators of NF-κB activation. These anti-inflammatory effects were antagonized by PPARγ inhibitor GW9662. In addition, telmisartan increased the expression of PTEN (phosphate and tensin homolog deleted on chromosome 10), a lipid and protein phosphatase; PPARγ inhibitor GW9662 reversed this effect, indicating that telmisartan-induced PTEN expression is PPARγ dependent. The PTEN inhibitor blocked the effects of telmisartan on Akt and ERK phosphorylation, NF-κB transcriptional activity, and IL-1β and TNF-α production, but failed to reverse IL-10 expression. This data indicates that telmisartan-induced IL-10 expression is PPARγ-dependent but PTEN-independent. Altogether, telmisartan ameliorated AβO-induced microglial inflammation by inhibiting NF-κB-mediated proinflammatory cytokine expression via the PPARγ/PTEN pathways and by increasing PPARγ-mediated anti-inflammatory IL-10 expression. Telmisartan may present a promising therapy for the treatment of AβO pathology. Keywords: telmisartan, amyloid-β oligomers, inflammation, PPARγ, PTEN

2

1. Introduction Amyloid-β (Aβ) accumulation and deposition is one of the pathological characteristics of Alzheimer's disease (AD), and its oligomer form is widely regarded as the principal cytotoxic species responsible for synaptic failure and memory deficit [1]. It has been reported that brain Aβ oligomers, rather than amyloid plaques, are closely correlated with neuronal loss [2]. In normal adult rats, intraventricular application of soluble Aβ oligomers (AβOs) isolated directly from human AD brains impaired hippocampal synaptic plasticity and memory, whereas insoluble amyloid plaque cores from AD brains did not [3]. In addition to the direct toxic effects on neurons, AβOs may also activate microglia and astrocytes, eliciting a toxic proinflammatory response [4-6]. Microglia are resident immune cells in the brain and the main source of brain inflammation. In AD, activated microglia are found in close vicinity to Aβ deposits and produce a wide range of cytokines and chemokines [7]. Proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β), not only act directly on neurons to instigate synaptic impairment, but also activate astrocytes to amplify the inflammatory response [8]. The regulation of Aβ aggregation and inflammation is a promising target for AD therapies. Angiotensin II receptor blockers (ARBs), which are compounds widely used to treat cardiovascular and metabolic disorders, provide neuroprotective effects in the central nervous system. ARBs restored neurological performance and cognition in the rodent model of AD, brain ischemia, and traumatic brain injury at doses that did not significantly affect systemic blood pressure [9-15]. In human clinical trials, ARBs exhibited superior amelioration of cognitive loss compared to other antihypertensive medications that reduce blood pressure to a similar extent [16-18]. These results indicate that ARBs are excellent candidates for the treatment of brain disorders. ARBs exhibit a pleiotropic pharmacological profile, not only selectively blocking angiotensin II type 1 receptor (AT1), but also activating peroxisome 3

proliferation-activated receptor gamma (PPARγ)[19]. In the brain, AT1 activity is associated with inflammatory response in addition to cerebrovascular and metabolic functions [19]. PPARγ is a ligand-activated nuclear receptor with potent anti-inflammatory properties. The anti-inflammatory action has been widely considered an important component of ARB neuroprotection. Among all ARBs currently used in clinical settings, telmisartan exhibits the strongest affinity for AT1, the greatest efficiency for PPARγ activation, the longest half-life, and a sustained efficacy for up to 24 h[19]. Additionally, telmisartan can cross the blood-brain barrier when administered systematically and exhibits slow clearance from the brain [20]. The anti-inflammatory effects of telmisartan have been reported in lipopolysaccharide (LPS)stimulated BV2 cells and primary microglia as well as in animal models of brain ischemia, traumatic brain injury, and Parkinson’s disease [11, 21-24]. However, the molecular and signaling mechanisms underlying the anti-inflammatory effects of telmisartan have yet to be fully elucidated. Telmisartan also ameliorated Aβ-induced microglial inflammatory responses in a five-familial AD mouse model (5XFAD)[25, 26], which rapidly starts to develop amyloid plaques at the age of two months[27]. In both studies, treatment started when the mice reached two months of age and continued for several weeks; thus the observed inflammatory response was most likely a result of accumulated insoluble Aβ fibrils rather than soluble oligomers. In this study, we aimed to investigate the effect of telmisartan on AβO-induced microglial inflammation. As AD brain-derived and synthetic AβOs appear structurally equivalent [28] and share a similar toxicology [29, 30], synthetic AβOs were employed in this study to elicit microglial activation. The angiotensin II receptors AT1 and AT2 are not expressed in human or mouse microglia [31, 32], whereas AT2 (but not AT1) is expressed in unstimulated rat microglial cultures [33]. Thus, mouse-derived microglia are a more valid substitute for human microglia to investigate the anti-inflammatory effects of ARBs. The mouse microglia-like BV2 cell line imitates primary microglia responses with high fidelity and is frequently used as an in 4

vitro model for studying brain inflammation [34]. Therefore, the BV2 cell line, which expresses PPARγ [35, 36], was selected as an in vitro model for human microglia in this study. We found that telmisartan ameliorated AβO-induced microglial inflammation by negatively regulating NF-κB-mediated proinflammatory cytokine expression via the PPARγ/PTEN (phosphate and tensin homolog deleted on chromosome 10) pathways and by positively regulating PPARγmediated anti-inflammatory IL-10 expression. Our results indicate that PPARγ activation plays a pivotal role in the anti-inflammatory effects of telmisartan in microglial cells devoid of AT1.

2. Materials and Methods 2.1 Chemicals and antibodies Synthetic Aβ1-42 peptide was purchased from AnaSpec (Fremont, CA, USA). Telmisartan, GW9662, U0126, LY294002, and Akt inhibitor (1L6-Hydroxymethyl-chiro-inositol-2-(R)-2O-methyl-3-O-octadecyl-sn-glycerocarbonate) were purchased from Sigma-Aldrich (St. Louis, MO, USA). SCH772984 and SF1670 were obtained from Selleckchem (Houston, TX) and MedChemExpress (Shanghai, China), respectively. These chemicals were dissolved in DMSO. Antibodies against p-Akt (Ser473, Cat #4060), Akt (Cat #4685), ERK (Cat #9102), pERK (Thr202/204, Cat #4370), PTEN(Cat #9188), and β-amyloid (1-42 specific) (Cat #14974) were purchased from Cell Signaling Technology (Beverly, MA, USA). Antibodies against βactin (sc-58673) and AT1 (sc-515884), AT1 siRNA (sc-29751), and control siRNA (sc-37007) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). 2.2 Preparation of soluble Aβ oligomers Oligomeric Aβ was prepared as previously described[37]. Briefly, Aβ peptide was dissolved in 1 mM hexafluoroisopropanol, aliquoted, and dried under vacuum. The peptide film was stored at -20 °C and resuspended in DMSO at a concentration of 5 mM prior to use. To form oligomers, the peptide was diluted to a final concentration of 100 μM with phenol5

free F12 medium and incubated for 24 h at 4 °C. Preparations were separated by Tricine-SDSpolyacrylamide gel electrophoresis (PAGE) to characterize the form of Aβ oligomers. 2.3 Cell culture and treatment BV2 cells were purchased from the China Center for Type Culture Collection (Wuhan, China) and maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C in 5% CO2 humidified air. Cells were seeded at a density of 1×105 cells in 6-well plates and grown for 24 h prior to the experiments. BV2 cells were activated with 1 μM AβOs for 6 h (for western blotting, quantitative PCR, and luciferase assay) or 12 h (for ELISA). Telmisartan was administered 2 h prior to AβO treatment. Akt and ERK inhibitors were administrated 30 min prior to telmisartan treatment, while PPARγ and PTEN inhibitors were administrated 2 h prior to telmisartan treatment. The doses of telmisartan (5 μM) and GW9662 (20 μM) were selected based on previous studies that investigated the anti-inflammatory effects of telmisartan in LPS-stimulated BV2 cells [21, 25]. The doses of LY294002 (10 μM), Akt inhibitor (10 μM), U0126 (10 μM), and SCH772984 (10 μM) were selected according to previous studies on inflammatory responses in BV2 cells [3840]. 2.4 Western blotting BV2 cells were lysed in cold radioimmunoprecipitation assay buffer containing a protease and phosphatase inhibitor cocktail (Roche, Indianapolis, IN). Proteins were separated by 10% SDS-PAGE and then transferred onto polyvinylidene fluoride membranes (Millipore, Billerica, MA). After blocking with 5% non-fat milk in Tris-buffered saline, membranes were incubated with primary and secondary antibodies and visualized using enhanced chemiluminescence reagents (Millipore, Billerica, MA, USA) with the Viber Fusion FX7 imaging system (Viber 6

Lourmat, France). AβO preparations were separated by Tricine-SDS-PAGE and detected with the β-amyloid (1-42 specific) antibody. The western blot data were quantified using Image J software. 2.5 ELISA assay After 12 h exposure to AβOs, BV2 cell media was collected and the levels of IL-10, TNFα, and IL-1β were assayed using enzyme-linked immunosorbent assay (ELISA) kits (Multi science, ShenZheng, China) according to the manufacturer’s instructions. 2.6 Quantitative PCR Total RNA was extracted from BV2 cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Isolated RNA was reverse transcribed to cDNA using cDNA synthesis kit (Thermo Fisher, Waltham, MA, USA). The resulting cDNAs were subjected to quantitative real-time PCR with a Bio-Rad CFX Connect real-time PCR detection system (Bio-Rad, Hercules, CA, USA). The primers (Genepharma, Shanghai, China) were listed in Table 1. Reactions were performed in a final volume of 20 μl with reagents provided by the SYBR Green Master Mix kit (Thermo Fisher, Waltham, MA, USA). The reaction conditions consisted of 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, and 60 °C for 60 s. The relative expression of target genes was calculated using 2 -ΔΔCTwith GAPDH as an internal control. 2.7 Transient transfection and dual luciferase assay BV2 cells were seeded onto 24-well plates for 24 h and then transfected with PPARγ (pGM PPARγ-Lu) or NF-κB (pGM NF-κB-Lu) luciferase reporter plasmids (Genomeditech, Shanghai, China) with Lipofectamine 2000 (Invitrogen, Carlsbad, CA). After 24 h of transfection, cells were treated with the corresponding inhibitors and/or AβOs. Renilla luciferase pRL-TK reporter (Promega, Madison, WI, USA) was co-transfected to monitor the transfection efficiency. Dual luciferase assay (Promega, Madison, WI, USA) was performed 7

after 6 h exposure to AβOs, and promoter activity values were normalized by Renilla luciferase. Each experiment was performed three times in triplicate wells. 2.8 Statistical analysis Data are represented as mean ± SEM. Statistical analysis among multiple groups was carried out using the one-way ANOVA followed by Bonferroni’s post hoc test. Statistical analysis between two groups was performed using the student t-test. Statistical significance was performed using GraphPad Prism 5.0 software (GraphPad Software, San Diego, CA, USA). The differences were considered significant if the p value was < 0.05.

3. Results 3.1 Telmisartan inhibited AβO-induced production of IL-1β and TNF-α and caused an additional increase in IL-10 production In order to characterize the form of oligomers used in our studies, AβOs preparations were separated by Tricine-SDS-PAGE. The majority of AβOs migrated with a similar molecular weight as a tetramer (Fig. 1A). We further examined the secretion of proinflammatory (IL-1β and TNF-α) and anti-inflammatory (IL-10) cytokines from BV2 cells exposed to AβOs or AβOs plus telmisartan. In our preliminary study, we found that 1 μM and 2.5 μM of AβOs (the doses were selected according to a previous study on mice primary microglia cultures[41]) induced similar amounts of secretion of IL-1β and TNF-α without decreasing cell viability (data not shown); thus 1 μM of AβOs was used for further experiments. AβOs significantly increased IL-1β and TNF-α secretion, but did not affect IL-10 secretion (Fig. 1B). In AβOstimulated cells, the addition of 5 μM telmisartan not only significantly reduced IL-1β and TNF-α secretion, but also induced a significant amount of IL-10 secretion (Fig. 1B). Telmisartan alone did not affect IL-1β, TNF-α, or IL-10 secretion.

8

We further examined the mRNA levels of these cytokines to determine how telmisartan regulated their production. Compared to control cells, mRNA levels of TNF-α and IL-1β were significantly upregulated, whereas IL-10 mRNA levels remained unchanged in AβOstimulated cells (Fig. 1C). Telmisartan alone did not affect the mRNA levels of TNF-α, IL-1β, or IL-10. However, in AβO-stimulated cells, telmisartan treatment not only reduced TNF-α and IL-1β mRNA levels, but also upregulated IL-10 mRNA levels (Fig. 1C). These data indicate that telmisartan suppresses AβO-induced inflammatory responses via downregulation of IL-1β and TNF-α expression and upregulation of IL-10 expression. 3.2 Telmisartan suppressed IL-1β and TNF-α via NF-κB inhibition Activation of NF-κB is closely related to the regulation of proinflammatory cytokine (e.g. IL-1β and TNF-α) expression. AβO treatment significantly enhanced NF-κB transcriptional activity, and telmisartan inhibited AβO-induced NF-κB activation (Fig. 2A). Extracellular AβOs bind to the surface membrane proteins of target cells and trigger transmembrane signaling events that lead to intracellular changes [42]; thus we investigated potential upstream regulators involved in NF-κB activation, such as Akt and ERK [43]. Akt and ERK phosphorylation were significantly increased after 3 h and 6 h of AβO treatment (Fig. 2B). Telmisartan significantly blocked AβO-induced Akt and ERK phosphorylation (Fig. 2B). To confirm the involvement of Akt and ERK in NF-κB activity regulation, the effects of the phosphatidylinositol 3-kinase (PI3K) /Akt inhibitors (LY294002 and Akt inhibitor) and ERK inhibitors (U0126 and SCH772984) on IL-1β and TNF-α secretion were assayed. Both PI3K/Akt and ERK inhibitors significantly reduced AβO-induced TNF-α and IL-1β secretion and had no effect on IL-10 secretion (Fig. 2C). However, these inhibitors failed to affect TNFα and IL-1β secretion when BV2 cells were exposed to AβO plus telmisartan (Fig. 2C). These data indicate that the inhibitory effects of telmisartan on AβO-induced IL-1β and TNF-α secretion result from suppression of NF-κB signaling. 9

3.3 The anti-inflammatory effects of telmisartan in BV2 cells are unrelated to AT1 blockade Previous studies have shown that AT1 is not expressed in BV2 cells [21, 44]. To exclude the possible phenotypic alterations occurring in cell lines from diverse sources, AT1 expression in our BV2 cell line was detected by quantitative real-time PCR and western blot. In contrast with the clear expression of AT1 mRNA and protein in mouse cortex tissue, AT1 expression was undetectable in our BV2 cell line, even when cells were stimulated with AβOs (Fig. 3A and 3B). However, these results cannot exclude the possibility of lower trace expressions of AT1. Thus, the effects of AT1 siRNA on AβO-induced inflammatory responses were examined. Under the condition of AβO stimulation, BV2 cells transfected with AT1 siRNA showed similar levels of IL-1β, TNF-α, and IL-10 as those transfected with control shRNA (Fig. 3C-3E). These data confirm that the anti-inflammatory effects of telmisartan in BV2 cells were independent of AT1 blockade. 3.4 The PPARγ inhibitor abolished the anti-inflammatory effects of telmisartan We further investigated whether telmisartan performed its anti-inflammatory actions via PPARγ activation. AβOs alone did not affect PPARγ transcriptional activity (Fig. 4A). In AβOstimulated cells, telmisartan induced a significant elevation in PPARγ transcriptional activity, which was suppressed by the PPARγ inhibitor GW9662 (Fig. 4A). GW9662 also effectively blocked the effects of telmisartan on NF-κB activation as well as phosphorylation of AKT and ERK (Fig. 4B and 4C). Consistently, telmisartan-induced changes in IL-1β, TNF-α, and IL-10 were recovered by GW9662 (Fig. 4D). These results confirm the involvement of PPARγ activity in the anti-inflammatory effects of telmisartan. No significant changes were observed in cells treated with AβOs plus GW9662 compared to those treated with AβOs alone (Fig. 4D),

10

indicating that the AβO-induced inflammatory response in BV2 cells is independent of PPARγ activation. 3.5 PTEN signaling partially mediates the anti-inflammatory effects of telmisartan in AβO-stimulated BV2 cells Activation of PPARγ causes an increase in the expression and activity of PTEN, a phosphatase that can dephosphorylate serine, threonine, and tyrosine residues [45]. Both ERK and AKT pathways can be regulated by PTEN [46, 47]. AβOs alone did not affect the basal expression level of PTEN (Fig. 5A). In AβO-stimulated cells, telmisartan administration significantly increased PTEN expression, which was antagonized by the PPARγ inhibitor GW9662 (Fig. 5A). This data suggests that telmisartan upregulated PTEN expression via PPARγ activation. Next, we investigated whether PTEN was involved in the PPARγ-mediated anti-inflammatory effects of telmisartan. The PTEN inhibitor SF1670 effectively antagonized the effects of telmisartan on Akt and ERK phosphorylation, NF-κB activity, and IL-1β and TNF-α secretion, but failed to reverse IL-10 secretion (Fig. 5B, 5C, and 5D). This result indicates that IL-10 secretion is not regulated by PTEN signaling.

4. Discussion Telmisartan is considered as a potent anti-inflammatory compound for brain disorders, due to its highly efficient AT1 blockade and PPARγ activation as well as long duration of action. The aim of this study was to explore the effects of telmisartan on AβO-induced microglial inflammation and the underlying mechanisms. Previous studies have demonstrated that human and mouse microglia are devoid of AT1 and AT2 expression [31, 32], whereas unstimulated rat primary microglia express AT2 but not AT1 [33]. Therefore, the mouse microglia-like BV2 cell line, which expresses PPARγ [35, 36], was used as an in vitro model for human microglia. Consistent with two previous studies [21, 44], AT1 mRNA and protein 11

levels in our mouse microglia-like BV2 cell line were undetectable. Therefore, the effects of telmisartan observed in this study were independent of AT1 blockade. AβOs induced a proinflammatory response in BV2 cells demonstrated by elevated proinflammatory cytokine (IL-1β and TNF-α) production and no change in IL-10 production. This proinflammatory response was associated with increased NF-κB transcriptional activity, which was regulated by Akt and ERK. The PI3K/Akt signaling pathway activates NF-κB via IκB kinase-mediated phosphorylation of inhibitory molecules, whereas ERK activates NF-κB via mitogen- and stress-activated protein kinase 1 (MSK1)-mediated p65 phosphorylation [43]. Interestingly, telmisartan not only inhibited AβO-induced IL-1β and TNF-α expression, but also caused an increase in anti-inflammatory IL-10 expression. These results indicate that telmisartan can exert neuroprotective effects by inhibiting proinflammatory responses and intensifying anti-inflammatory responses. The effects of telmisartan on proinflammatory cytokine production, NF-κB activity, and Akt and ERK phosphorylation were antagonized by the PPARγ inhibitor GW9662. Previous studies of cell-based reporter assays show that GW9662 at concentration used in our study may activate PPARα but does not significantly activate PPARδ or PPARγ, while it was able to inhibit agonist-induced activation of all PPAR members [48, 49]. However, telmisartan at concentration less than 10μM does not significantly affect the activity of PPARα and PPARδ[50]. In our study, 5μM telmisartan was used. Therefore, concurrent GW9662 treatment could not cause inhibition of PPARα and PPARδ. We also observed that GW9662 alone had no significant effect on AβO-induced cytokine production, indicating that GW9662-induced PPARα activation may have no or little effect on AβO-induced inflammatory response in BV2 cells. Taken together, the effect of telmisartan was a result of PPARγ activation rather than PPARα or PPARδ activation, and GW9662 suppressed the anti-inflammatory effects of telmisartan through PPARγ inhibition. Thus, we further investigated how PPARγ activation 12

modulates Akt and ERK signaling. The activity of Akt and ERK was regulated by phosphorylation at specific sites. PTEN, a dual lipid and protein phosphatase, can function as a negative regulator of PI3K/Akt and ERK signaling [46, 47]. The lipid phosphatase activity of PTEN is required for its downregulation of AKT and ERK activation[47, 51, 52]. PTEN inhibits PI3K/Akt signaling by dephosphorylating phosphatidylinositol 3,4,5-trisphosphate. PTEN cannot dephosphorylate isolated, activated ERK in vitro[53], and its inhibition of ERK activation occurs at upstream steps necessary for ERK activation [52]. A previous study demonstrated that PPARγ could bind with the PTEN promoter and upregulate its expression [45]. Consistently, we found that telmisartan induced an increase in PTEN expression, which was attenuated by the PPARγ inhibitor. The PTEN inhibitor SF1670 antagonized telmisartaninduced changes in NF-κB signaling and proinflammatory cytokine (IL-1β and TNF-α) production. These data indicate that telmisartan suppresses AβO-induced proinflammatory responses by negative regulation of NF-κB signaling via the PPARγ/PTEN pathway (Fig. 6). The effect of telmisartan on IL-10 production was suppressed by the PPARγ inhibitor, but not by the selective PTEN inhibitor SF1670. PPARγ is a ligand-activated nuclear receptor with potent anti-inflammatory properties. In addition to down-regulating proinflammatory cytokines by suppressing transcription factors such as NF-κB, AP-1, and STAT-1, PPAR-γ activation may also exert anti-inflammatory effects by inducing proinflammatory IL-10 production [36, 54]. Human and mouse IL-10 promoters have NF-κB binding sites[55], and the binding of the NF-κB subunit p50 or p65 to the IL-10 promoter has been described in the human T cell lymphoma cell line and in mouse primary microphages[56-58]. In the present study, AβO-induced NF-κB activation did not accompany IL-10 overproduction, indicating that IL10 expression was not regulated by the NF-κB signaling pathway in microglia-like BV2 cells. This is consistent with the result that the PTEN inhibitor had no effect on telmisartan-induced IL-10 production. Previous studies have shown that ERK signaling is required for IL-10 13

production in macrophages and myeloid dendritic cells in response to Toll-like receptor stimulation [59-61]. However, IL-10 induction in BV2 cells was independent of ERK signaling, as ERK activation following AβO stimulation was not accompanied with IL-10 overproduction. These data suggest that distinct mechanisms of IL-10 regulation may exist in different immune cells in response to different stimuli. A functional PPAR response element has been identified in the human IL-10 promoter, which is conserved in the murine IL-10 promoter [62]. Thus, IL-10 induction by telmisartan in BV2 cells may be a direct result of enhanced PPARγ transcriptional activity (Fig. 6). Our results may have significant translational significance. Interventions to promote AβO clearance and/or reduce inflammation are potential therapeutic targets for AD patients. This study provides direct evidence demonstrating the anti-inflammatory effects of telmisartan on AβO-stimulated microglia via PPARγ activation. Interestingly, telmisartan might also have direct effects on Aβ generation and clearance since administration of telmisartan reduced Aβ plaque burden in 5XFAD mice [25, 26]. Aβ clearance is achieved by microglial phagocytosis or by enzymatic degradation. Activation of PPARγ increased CD36-mediated microglial Aβ phagocytosis in a transgenic AD mouse model [63]. Insulin-degrading enzyme (IDE) plays a significant role in extracellular and intracellular Aβ degradation. It cleaves not only monomeric Aβ but also toxic oligomers with less efficiency [64]. Notably, such degradation products of Aβ monomers are unable to oligomerize or deposit on amyloid plaques [65, 66]. Thus, IDE functions as an Aβ-scavenging enzyme, restricting Aβ oligomerization and plaque formation. PPARγ induced IDE expression in rat primary neurons [67] and the Aβ degrading activity of an IDE-like metalloproteinase in mouse primary neurons and glial cells [68]. Additionally, PPARγ reduced Aβ generation by inhibiting β-secretase transcription [69]. Based on these findings, PPARγ is a promising therapeutic target for the treatment of Aβ pathology, and its activation may play a critical role in the telmisartan-induced reduction of amyloid plaques in 14

5XFAD mice [25, 26]. As a strong PPARγ agonist, telmisartan may be a valid diseasemodifying drug with multifactorial targets including inflammation and amyloid generation and aggregation. Further in vitro and in vivo studies are required to verify the involvement of increased Aβ phagocytosis and upregulation of Aβ-degrading enzymes in the beneficial effects of telmisartan. It should be pointed out that AT1 blockade also plays an important role in ARBs neuroprotection. In the brain, AT1 is highly expressed in the endothelial and smooth muscle cells of cerebral vessels as well as neurons. Brain AT1 overactivation reduces cerebrovascular blood flow leading to hypoxia and metabolic abnormality, injures the blood-brain barrier, and increases the neuronal vulnerability to cell injury. In fact, excessive brain AT1 activity is a common feature of many brain disorders including Alzheimer’s disease[19]. Therefore, telmisartan may be a potent candidate therapeutics for Alzheimer’s disease since it protects against multifactorial mechanisms of injury. The present study has several limitations. Our results were obtained using a BV2 microglial cell line and oligomers prepared from synthetic Aβ monomers. Whether the results may be replicated in primary microglia with AD brain-derived AβOs remains to be determined. Additionally, the molecular mechanisms involved in Akt and ERK regulation of NF-κB activity still need to be addressed in future studies. In conclusion, our results demonstrate that telmisartan exerts potent anti-inflammatory effects via PPARγ/PTEN pathway in AβO-stimulated microglial cells. The novelty of this study lies in the fact that although previous reports on the anti-inflammatory effects of telmisartan exist, this is the first report of molecular mechanisms underlying its protection against AβO-induced microglial inflammation. To fully understand the potential therapeutic

15

value of telmisartan in the treatment of AβOs pathology, its effects on AβOs generation and clearance need to be addressed in further studies.

Declarations of interest: none Acknowledgements This research was supported by grants from the National Natural Science Foundation of China (No. 81573459, 81671072) and the Natural Science Foundation of Hubei Province (2017CFA028).

References [1]

Haass C, Selkoe DJ. Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer's amyloid beta-peptide. Nat Rev Mol Cell Biol 2007;8(2):101-12.

[2]

DaRocha-Souto B, Scotton TC, Coma M, Serrano-Pozo A, Hashimoto T, Sereno L, et al. Brain oligomeric beta-amyloid but not total amyloid plaque burden correlates with neuronal loss and astrocyte inflammatory response in amyloid precursor protein/tau transgenic mice. J Neuropathol Exp Neurol 2011;70(5):360-76.

[3]

Shankar GM, Li S, Mehta TH, Garcia-Munoz A, Shepardson NE, Smith I, et al.

16

Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat Med 2008;14(8):837-42. [4]

Sondag CM, Dhawan G, Combs CK. Beta amyloid oligomers and fibrils stimulate differential activation of primary microglia. J Neuroinflammation 2009;6:1.

[5]

Ledo JH, Azevedo EP, Clarke JR, Ribeiro FC, Figueiredo CP, Foguel D, et al. Amyloid-beta oligomers link depressive-like behavior and cognitive deficits in mice. Mol Psychiatry 2013;18(10):1053-4.

[6]

Lourenco MV, Clarke JR, Frozza RL, Bomfim TR, Forny-Germano L, Batista AF, et al. TNF-alpha mediates PKR-dependent memory impairment and brain IRS-1 inhibition induced by Alzheimer's beta-amyloid oligomers in mice and monkeys. Cell Metab 2013;18(6):831-43.

[7]

Saijo K, Glass CK. Microglial cell origin and phenotypes in health and disease. Nat Rev Immunol 2011;11(11):775-87.

[8]

Glass CK, Saijo K, Winner B, Marchetto MC, Gage FH. Mechanisms underlying inflammation in neurodegeneration. Cell 2010;140(6):918-34.

[9]

Ongali B, Nicolakakis N, Tong XK, Aboulkassim T, Papadopoulos P, Rosa-Neto 17

P, et al. Angiotensin II type 1 receptor blocker losartan prevents and rescues cerebrovascular, neuropathological and cognitive deficits in an Alzheimer's disease model. Neurobiol Dis 2014;68:126-36. [10]

Shindo T, Takasaki K, Uchida K, Onimura R, Kubota K, Uchida N, et al. Ameliorative effects of telmisartan on the inflammatory response and impaired spatial memory in a rat model of Alzheimer's disease incorporating additional cerebrovascular disease factors. Biol Pharm Bull 2012;35(12):2141-7.

[11]

Villapol S, Balarezo MG, Affram K, Saavedra JM, Symes AJ. Neurorestoration after traumatic brain injury through angiotensin II receptor blockage. Brain 2015;138(Pt 11):3299-315.

[12]

Villapol S, Yaszemski AK, Logan TT, Sanchez-Lemus E, Saavedra JM, Symes AJ. Candesartan, an angiotensin II AT(1)-receptor blocker and PPAR-gamma agonist, reduces lesion volume and improves motor and memory function after traumatic brain injury in mice. Neuropsychopharmacology 2012;37(13):281729.

[13]

Danielyan L, Klein R, Hanson LR, Buadze M, Schwab M, Gleiter CH, et al. Protective effects of intranasal losartan in the APP/PS1 transgenic mouse 18

model of Alzheimer disease. Rejuvenation Res 2010;13(2-3):195-201. [14]

Tsukuda K, Mogi M, Iwanami J, Min LJ, Sakata A, Jing F, et al. Cognitive deficit in amyloid-beta-injected mice was improved by pretreatment with a low dose of telmisartan partly because of peroxisome proliferator-activated receptorgamma activation. Hypertension 2009;54(4):782-7.

[15]

Wang J, Ho L, Chen L, Zhao Z, Zhao W, Qian X, et al. Valsartan lowers brain beta-amyloid protein levels and improves spatial learning in a mouse model of Alzheimer disease. J Clin Invest 2007;117(11):3393-402.

[16]

Hajjar I, Hart M, Chen YL, Mack W, Milberg W, Chui H, et al. Effect of antihypertensive therapy on cognitive function in early executive cognitive impairment: a double-blind randomized clinical trial. Arch Intern Med 2012;172(5):442-4.

[17]

Li NC, Lee A, Whitmer RA, Kivipelto M, Lawler E, Kazis LE, et al. Use of angiotensin receptor blockers and risk of dementia in a predominantly male population: prospective cohort analysis. Bmj 2010;340:b5465.

[18]

Kume K, Hanyu H, Sakurai H, Takada Y, Onuma T, Iwamoto T. Effects of telmisartan on cognition and regional cerebral blood flow in hypertensive 19

patients with Alzheimer's disease. Geriatr Gerontol Int 2012;12(2):207-14. [19]

Saavedra JM. Evidence to consider angiotensin II receptor blockers for the treatment of early Alzheimer's disease. Cell Mol Neurobiol 2016;36(2):259-79.

[20]

Noda A, Fushiki H, Murakami Y, Sasaki H, Miyoshi S, Kakuta H, et al. Brain penetration of telmisartan, a unique centrally acting angiotensin II type 1 receptor blocker, studied by PET in conscious rhesus macaques. Nucl Med Biol 2012;39(8):1232-5.

[21]

Xu Y, Xu Y, Wang Y, Wang Y, He L, Jiang Z, et al. Telmisartan prevention of LPS-induced microglia activation involves M2 microglia polarization via CaMKKbeta-dependent AMPK activation. Brain Behav Immun 2015;50:298313.

[22]

Haraguchi T, Takasaki K, Naito T, Hayakawa K, Katsurabayashi S, Mishima K, et

al.

Cerebroprotective

action

of

telmisartan

by

inhibition

of

macrophages/microglia expressing HMGB1 via a peroxisome proliferatoractivated

receptor

gamma-dependent

mechanism.

Neurosci

Lett

2009;464(3):151-5. [23]

Garrido-Gil P, Joglar B, Rodriguez-Perez AI, Guerra MJ, Labandeira-Garcia JL. 20

Involvement of PPAR-gamma in the neuroprotective and anti-inflammatory effects of angiotensin type 1 receptor inhibition: effects of the receptor antagonist telmisartan and receptor deletion in a mouse MPTP model of Parkinson's disease. J Neuroinflammation 2012;9:38. [24]

Rodriguez-Perez AI, Sucunza D, Pedrosa MA, Garrido-Gil P, Kulisevsky J, Lanciego JL, et al. Angiotensin type 1 receptor antagonists protect against alpha-synuclein-induced neuroinflammation and dopaminergic neuron death. Neurotherapeutics 2018;15(4):1063-81.

[25]

Torika N, Asraf K, Danon A, Apte RN, Fleisher-Berkovich S. Telmisartan modulates glial activation: In vitro and in vivo studies. PLoS One 2016;11(5):e0155823.

[26]

Torika N, Asraf K, Cohen H, Fleisher-Berkovich S. Intranasal telmisartan ameliorates brain pathology in five familial Alzheimer's disease mice. Brain Behav Immun 2017;64:80-90.

[27]

Oakley H, Cole SL, Logan S, Maus E, Shao P, Craft J, et al. Intraneuronal betaamyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer's disease mutations: potential factors in amyloid 21

plaque formation. J Neurosci 2006;26(40):10129-40. [28]

Gong Y, Chang L, Viola KL, Lacor PN, Lambert MP, Finch CE, et al. Alzheimer's disease-affected brain: presence of oligomeric A beta ligands (ADDLs) suggests a molecular basis for reversible memory loss. Proc Natl Acad Sci U S A 2003;100(18):10417-22.

[29]

De Felice FG, Wu D, Lambert MP, Fernandez SJ, Velasco PT, Lacor PN, et al. Alzheimer's disease-type neuronal tau hyperphosphorylation induced by A beta oligomers. Neurobiol Aging 2008;29(9):1334-47.

[30]

Klyubin I, Cullen WK, Hu NW, Rowan MJ. Alzheimer's disease Abeta assemblies mediating rapid disruption of synaptic plasticity and memory. Mol Brain 2012;5:25.

[31]

Gosselin D, Skola D, Coufal NG, Holtman IR, Schlachetzki JCM, Sajti E, et al. An environment-dependent transcriptional network specifies human microglia identity. Science 2017;356(6344).

[32]

Zhang Y, Chen K, Sloan SA, Bennett ML, Scholze AR, O'Keeffe S, et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci 2014;34(36):11929-47. 22

[33]

Miyoshi M, Miyano K, Moriyama N, Taniguchi M, Watanabe T. Angiotensin type 1 receptor antagonist inhibits lipopolysaccharide-induced stimulation of rat microglial cells by suppressing nuclear factor kappaB and activator protein-1 activation. Eur J Neurosci 2008;27(2):343-51.

[34]

Henn A, Lund S, Hedtjarn M, Schrattenholz A, Porzgen P, Leist M. The suitability of BV2 cells as alternative model system for primary microglia cultures or for animal experiments examining brain inflammation. Altex 2009;26(2):83-94.

[35]

Zhang L, Gao J, Tang P, Chong L, Liu Y, Liu P, et al. Nuciferine inhibits LPSinduced inflammatory response in BV2 cells by activating PPAR-gamma. Int Immunopharmacol 2018;63:9-13.

[36]

Choi MJ, Lee EJ, Park JS, Kim SN, Park EM, Kim HS. Anti-inflammatory mechanism of galangin in lipopolysaccharide-stimulated microglia: Critical role of PPAR-gamma signaling pathway. Biochem Pharmacol 2017;144:120-31.

[37]

Dahlgren KN, Manelli AM, Stine WB, Jr., Baker LK, Krafft GA, LaDu MJ. Oligomeric and fibrillar species of amyloid-beta peptides differentially affect neuronal viability. J Biol Chem 2002;277(35):32046-53. 23

[38]

Lim HS, Kim YJ, Kim BY, Park G, Jeong SJ. The anti-neuroinflammatory activity of tectorigenin pretreatment via downregulated NF-kappaB and ERK/JNK pathways in BV-2 microglial and microglia inactivation in mice with lipopolysaccharide. Front Pharmacol 2018;9:462.

[39]

Lin HY, Tang CH, Chen YH, Wei IH, Chen JH, Lai CH, et al. Peptidoglycan enhances proinflammatory cytokine expression through the TLR2 receptor, MyD88, phosphatidylinositol 3-kinase/AKT and NF-kappaB pathways in BV-2 microglia. Int Immunopharmacol 2010;10(8):883-91.

[40]

Qin S, Yang C, Huang W, Du S, Mai H, Xiao J, et al. Sulforaphane attenuates microglia-mediated

neuronal

necroptosis

through

down-regulation

of

MAPK/NF-kappaB signaling pathways in LPS-activated BV-2 microglia. Pharmacol Res 2018;133:218-35. [41]

Parajuli B, Sonobe Y, Horiuchi H, Takeuchi H, Mizuno T, Suzumura A. Oligomeric amyloid beta induces IL-1beta processing via production of ROS: implication in Alzheimer's disease. Cell Death Dis 2013;4:e975.

[42]

Viola KL, Klein WL. Amyloid beta oligomers in Alzheimer's disease pathogenesis, treatment, and diagnosis. Acta Neuropathol 2015;129(2):18324

206. [43]

Viatour P, Merville MP, Bours V, Chariot A. Phosphorylation of NF-kappaB and IkappaB proteins: implications in cancer and inflammation. Trends Biochem Sci 2005;30(1):43-52.

[44]

Elkahloun AG, Rodriguez Y, Alaiyed S, Wenzel E, Saavedra JM. Telmisartan protects a microglia cell line from lps injury beyond at1 receptor blockade or ppargamma activation. Mol Neurobiol 2019;56(5):3193-210.

[45]

Patel L, Pass I, Coxon P, Downes CP, Smith SA, Macphee CH. Tumor suppressor and anti-inflammatory actions of PPARgamma agonists are mediated via upregulation of PTEN. Curr Biol 2001;11(10):764-8.

[46]

Leslie NR, Batty IH, Maccario H, Davidson L, Downes CP. Understanding PTEN

regulation:

PIP2,

polarity

and

protein

stability.

Oncogene

2008;27(41):5464-76. [47]

Liu R, Tang JC, Pan MX, Zhuang Y, Zhang Y, Liao HB, et al. ERK 1/2 Activation Mediates the Neuroprotective Effect of BpV(pic) in Focal Cerebral IschemiaReperfusion Injury. Neurochem Res 2018;43(7):1424-38.

[48]

Seimandi M, Lemaire G, Pillon A, Perrin A, Carlavan I, Voegel JJ, et al. 25

Differential responses of PPARalpha, PPARdelta, and PPARgamma reporter cell lines to selective PPAR synthetic ligands. Anal Biochem 2005;344(1):8-15. [49]

Leesnitzer LM, Parks DJ, Bledsoe RK, Cobb JE, Collins JL, Consler TG, et al. Functional consequences of cysteine modification in the ligand binding sites of peroxisome proliferator activated receptors by GW9662. Biochemistry 2002;41(21):6640-50.

[50]

Benson SC, Pershadsingh HA, Ho CI, Chittiboyina A, Desai P, Pravenec M, et al. Identification of telmisartan as a unique angiotensin II receptor antagonist with selective PPARgamma-modulating activity. Hypertension 2004;43(5):9931002.

[51]

Lee JE, Lim MS, Park JH, Park CH, Koh HC. PTEN Promotes Dopaminergic Neuronal Differentiation Through Regulation of ERK-Dependent Inhibition of S6K Signaling in Human Neural Stem Cells. Stem Cells Transl Med 2016;5(10):1319-29.

[52]

Gu J, Tamura M, Yamada KM. Tumor suppressor PTEN inhibits integrin- and growth factor-mediated mitogen-activated protein (MAP) kinase signaling pathways. J Cell Biol 1998;143(5):1375-83. 26

[53]

Myers MP, Stolarov JP, Eng C, Li J, Wang SI, Wigler MH, et al. P-TEN, the tumor suppressor from human chromosome 10q23, is a dual-specificity phosphatase. Proc Natl Acad Sci U S A 1997;94(17):9052-7.

[54]

Ferreira AE, Sisti F, Sonego F, Wang S, Filgueiras LR, Brandt S, et al. PPARgamma/IL-10 axis inhibits MyD88 expression and ameliorates murine polymicrobial sepsis. J Immunol 2014;192(5):2357-65.

[55]

Wen AY, Sakamoto KM, Miller LS. The role of the transcription factor CREB in immune function. J Immunol 2010;185(11):6413-9.

[56]

Mori N, Prager D. Activation of the interleukin-10 gene in the human T lymphoma line HuT 78: identification and characterization of NF-kappa B binding sites in the regulatory region of the interleukin-10 gene. Eur J Haematol 1997;59(3):162-70.

[57]

Cao S, Zhang X, Edwards JP, Mosser DM. NF-kappaB1 (p50) homodimers differentially regulate pro- and anti-inflammatory cytokines in macrophages. J Biol Chem 2006;281(36):26041-50.

[58]

Saraiva M, Christensen JR, Tsytsykova AV, Goldfeld AE, Ley SC, Kioussis D, et al. Identification of a macrophage-specific chromatin signature in the IL-10 27

locus. J Immunol 2005;175(2):1041-6. [59]

Kaiser F, Cook D, Papoutsopoulou S, Rajsbaum R, Wu X, Yang HT, et al. TPL2 negatively regulates interferon-beta production in macrophages and myeloid dendritic cells. J Exp Med 2009;206(9):1863-71.

[60]

Agrawal A, Dillon S, Denning TL, Pulendran B. ERK1-/- mice exhibit Th1 cell polarization and increased susceptibility to experimental autoimmune encephalomyelitis. J Immunol 2006;176(10):5788-96.

[61]

Dillon S, Agrawal A, Van Dyke T, Landreth G, McCauley L, Koh A, et al. A Tolllike receptor 2 ligand stimulates Th2 responses in vivo, via induction of extracellular signal-regulated kinase mitogen-activated protein kinase and cFos in dendritic cells. J Immunol 2004;172(8):4733-43.

[62]

Thompson PW, Bayliffe AI, Warren AP, Lamb JR. Interleukin-10 is upregulated by nanomolar rosiglitazone treatment of mature dendritic cells and human CD4+ T cells. Cytokine 2007;39(3):184-91.

[63]

Yamanaka M, Ishikawa T, Griep A, Axt D, Kummer MP, Heneka MT. PPARgamma/RXRalpha-induced and CD36-mediated microglial amyloid-beta phagocytosis results in cognitive improvement in amyloid precursor 28

protein/presenilin 1 mice. J Neurosci 2012;32(48):17321-31. [64]

Stargardt A, Gillis J, Kamphuis W, Wiemhoefer A, Kooijman L, Raspe M, et al. Reduced amyloid-beta degradation in early Alzheimer's disease but not in the APPswePS1dE9 and 3xTg-AD mouse models. Aging Cell 2013;12(3):499-507.

[65]

Mukherjee A, Song E, Kihiko-Ehmann M, Goodman JP, Jr., Pyrek JS, Estus S, et al. Insulysin hydrolyzes amyloid beta peptides to products that are neither neurotoxic nor deposit on amyloid plaques. J Neurosci 2000;20(23):8745-9.

[66]

Chesneau V, Vekrellis K, Rosner MR, Selkoe DJ. Purified recombinant insulindegrading enzyme degrades amyloid beta-protein but does not promote its oligomerization. Biochem J 2000;351 Pt 2:509-16.

[67]

Du J, Zhang L, Liu S, Zhang C, Huang X, Li J, et al. PPARgamma transcriptionally regulates the expression of insulin-degrading enzyme in primary neurons. Biochem Biophys Res Commun 2009;383(4):485-90.

[68]

Espuny-Camacho I, Dominguez D, Merchiers P, Van Rompaey L, Selkoe D, De Strooper B. Peroxisome proliferator-activated receptor gamma enhances the activity of an insulin degrading enzyme-like metalloprotease for amyloidbeta clearance. J Alzheimers Dis 2010;20(4):1119-32. 29

[69]

Sastre M, Dewachter I, Rossner S, Bogdanovic N, Rosen E, Borghgraef P, et al. Nonsteroidal anti-inflammatory drugs repress beta-secretase gene promoter activity by the activation of PPARgamma. Proc Natl Acad Sci U S A 2006;103(2):443-8.

30

Figure Legends Fig. 1. Telmisartan inhibited TNF-α and IL-1β expression and secretion in AβO-stimulated BV2 cells. (A) AβO preparations were separated by Tricine-SDS-PAGE and analyzed with an anti-Aβ antibody. (B, C) BV2 cells were treated with telmisart an (Tel; 5 μM) for 2 h, and then with AβOs (1 μM) for 6 h (for real-time PCR analysis, n=4) or 12 h (for ELISA, n=6), after which secretion amount (B) or mRNA level (C) of TNF-α, IL-1β, and IL-10 was assayed. ** p<0.01, # p<0.05, ## p<0.01. Fig. 2. Telmisartan inhibited AβO-induced NF-κB activation and phosphorylation of Akt and ERK. (A) BV2 cells were first transfected with the PPARγ luciferase reporter plasmid for 24 h, then treated with telmisartan (Tel) for 2 h, and subsequently with AβO for 6 h. NF-κB transcriptional activity was determined by luciferase assay (n=3). ** p<0.01, ## p<0.01. (B) Telmisartan reduced the phosphorylation level of Akt and ERK in AβO-stimulated cells (n=5). * p<0.05, ** p<0.01, ## p<0.01, ns: no significance. (C) In AβO-stimulated BV2 cells, inhibition of Akt or ERK activity significantly reduced TNF-α or IL-1β secretion (n=5). Akt inhibitor (10μM), PI3K inhibitor LY294002 (10 μM), ERK inhibitor U0126 (10 μM), and ERK inhibitor SCH772984 (10 μM) were added 30 min prior to telmisartan treatment. * p<0.05 vs. vehicle control (DMSO). Fig. 3. The anti-inflammatory effects of telmisartan were unrelated to AT1 receptor blockade. (A, B) AT1 protein or mRNA in BV2 cells was undetectable (n=3). Rodent cortex tissue was used as positive control. (C) The efficiency of AT1 siRNA was confirmed in cultured mouse primary neurons (n=3). (D, E) BV2 cells were transfected with AT1 and control siRNA for 24

31

h and then treated with AβO. AT1 siRNA transfection did not affect AβO-induced secretion (C, n=6) or expression (D, n=4) of TNF-α, IL-1β, and IL-10. ns: no significance. Fig. 4. The PPARγ inhibitor suppressed the anti-inflammatory effects of telmisartan in AβOstimulated BV2 cells. BV2 microglial cells were treated with the PPARγ inhibitor GW9662 (GW; 20 μM) for 2 h prior to telmisartan (Tel) treatment. After 6 h of AβO treatment, the transcriptional activity of PPARγ (A) and NF-κB (B) was determined by luciferase assay (n=3). The changes in Akt and ERK phosphorylation (C) and cytokine secretion (D) were measured 6 h and 12 h after AβO treatment, respectively (n=6). * p<0.05, ** p<0.01, ns: no significance. Fig. 5. The PTEN inhibitor SF1670 partially antagonized the anti-inflammatory effects of telmisartan. BV2 cells were treated with SF1670 (5 μM) for 2 h prior to telmisartan (Tel) treatment. PTEN expression, phosphorylation of AKT and ERK, and NF-κB transcriptional activity were determined 6 h after AβO treatment; secretion of TNF-α, IL-1β, and IL-10 was assayed 12 h after AβO treatment. (A) Telmisartan induced an increase in PTEN expression, which was suppressed by the PPARγ inhibitor GW9662 (GW) (n=5). (B) SF1670 inhibited telmisartan-induced decreases in Akt and ERK phosphorylation (n=5). (C) The telmisartaninduced reduction in NF-κB transcriptional activity was recovered by SF1670 (n=3). (D) SF1670 altered telmisartan-induced changes in TNF-α and IL-1β production, but had no effect on IL-10 production (n=6). * p<0.05, ** p<0.01, # p<0.05, ns: no significance. Fig. 6. The proposed mechanism underlying the anti-inflammatory action of telmisartan in AβO-activated microglia. AβOs bind to surface receptors and induce Akt and ERK intracellular signaling, subsequently activating NF-κB-induced proinflammatory cytokine expression. Telmisartan activates PPARγ and results in increased expression of antiinflammatory cytokines and PTEN. PTEN inhibits NF-κB-induced proinflammatory cytokine expression by negatively modulating Akt and ERK activity. 32

33

34

35

36

37

38

39

40

Table 1. List of primers used for quantitative PCR.

Gene

Forward (5’-3’)

Reverse (5’-3’)

AT1

TGTTCCTGCTCACGTGTCTC

CATCAG CCAGATGATGATG C

TNF-α

GCTGAGCTCAAACCCTGGTA

CGGACTCCGCAAAGTCTAAG

IL-1β

TGTGAAATGCCACCTT TTGA

GGTCAAAGGTTTGGAAGCAG

IL-10

GCCAGTACAGCCGGGAAGACAATA

GCCTTGTAGACACCTTGGTCTT

GAPDH

GGCCTTCCGTGTTCCTAC

TGTCATCATATCTGGCAGGTT

41